Association of Tobacco Ringspot Virus, Tomato Ringspot Virus and Xiphinema Americanum with a Decline of Highbush Blueberry in New York Fuchs, M

Total Page:16

File Type:pdf, Size:1020Kb

Load more

21st International Conference on Virus and other Graft Transmissible Diseases of Fruit Crops Association of Tobacco ringspot virus, Tomato ringspot virus and Xiphinema americanum with a decline of highbush blueberry in New York Fuchs, M. Department of Plant Pathology and Plant-Microbe Biology, Cornell University, New York State Agricultural Experiment Station, Geneva, NY 14456 Abstract Plantings of highbush blueberry cultivars ‘Patriot’ and ‘Bluecrop’ showing virus-like symptoms and decline in vigor in New York were surveyed for the occurrence of viruses. Tobacco ringspot virus (TRSV) and Tomato ringspot virus (ToRSV) from the genus Nepovirus in the family Comoviridae were identified in leaf samples by DAS-ELISA. Their presence was confirmed by RT-PCR with amplification of 320-bp and 585-bp fragments of the RNA-dependent RNA polymerase genes, respectively. Comparative sequence analysis of viral amplicons of New York isolates indicated moderate (80.7-99.7 %) to high (90.8-99.7 %) nucleotide sequence identities with other ToRSV and TRSV strains, respectively. Soil samples from the root zone of blueberry bushes contained dagger nematodes and cucumber bait plants potted in soil samples with identified X. americanum became infected with ToRSV or TRSV. Altogether, ToRSV, TRSV, and their vector X. americanum sensu lato are associated with the decline of highbush blueberry in New York. Keywords: Vaccinium corymbosum L., dieback, DAS-ELISA, RT-PCR, RNA-dependent RNA polymerase gene Introduction In the spring of 2007, decline and virus-like symptoms were observed in plantings of mature highbush blueberry (Vaccinium corymbosum L.) cvs. ‘Patriot’ and ‘Bluecrop’ in New York. Symptoms consisted of stunted growth, top dieback or mosaic and dark reddish lesions on apical leaves. Necrosis of leaf and flower buds and reduced fruit yield were also noticed. These observations prompted a survey of highbush blueberry cvs. ‘Patriot’ and ‘Bluecrop’ for the occurrence of viruses and their vectors. Materials and methods Plantings of highbush blueberry cv. ‘Bluecrop’ and ‘Patriot’ were surveyed for the occurrence of viruses by double antibody sandwich (DAS) enzyme-linked immunosorbent assay (ELISA) with specific antibodies (Bioreba, Reinach, Switzerland). The presence of viruses identified by DAS-ELISA was confirmed by reverse transcription (RT) polymerase chain reaction (PCR) using total RNA extracted from leaf tissue and appropriate primers. RT-PCR was carried out using the OneStep kit (Qiagen, Valencia, CA) with a 30 min heating step at 50 °C and a 15 min heating step at 95 °C followed by 35 cycles of 30 sec melting at 94 °C, 1 min annealing at 50°C, and 1 min elongation at 72 °C with a final extension of 10 min at 72 °C. The reaction products were resolved by electrophoresis in 1.5 % agarose gels. Viral DNA amplicons obtained by RT-PCR were extracted from agarose gels and sequenced bidirectionally. Sequences were analyzed and compared using the DNASTAR Lasergene® v7.2 software package and TRSV strain bud blight (GenBank accession no. U50869) and ToRSV strain raspberry (GenBank accession no. L19655) as reference strains. Soil samples were collected from the root zone of blueberry bushes and analyzed for the occurrence of dagger nematodes, which were identified based on morphological parameters (Lamberti et al., 2002) and counted under a dissecting microscope at 40X magnification. Blueberry soil samples collected from the root zone of blueberry bushes were used in cucumber baiting assays in a greenhouse. Results Decline and virus-like symptoms were observed in plantings of mature highbush blueberry cvs. ‘Patriot’ and ‘Bluecrop’ in New York in the spring of 2007. Symptoms in cultivar ‘Patriot’ consisted of a severely reduced vigor, shoot defoliation, distorted leaves and chlorosis of apical leaves, vein clearing or mosaic. Some bushes also showed a top dieback with poor blossom development or necrotic flower buds, and a few of them were dead. The decline symptoms were observed throughout the planting of blueberry cv. ‘Patriot’. Symptoms in cultivar ‘Bluecrop’ consisted of mosaic or dark reddish lesions on apical leaves and a general decline. Preliminary DAS-ELISA results indicated the presence of Tomato ringspot virus (TRSV) and Tomato ringspot virus (ToRSV) in a few leaf samples surveyed in the fall of 2007. Since these tests were run late in the season, an extensive Julius-Kühn-Archiv, 427, 2010 15 21st International Conference on Virus and other Graft Transmissible Diseases of Fruit Crops survey was conducted in the spring of 2008 to confirm preliminary findings and determine the incidence of these two virus species from the genus Nepovirus, family Comoviridae in every bush of the two blueberry plantings. Thirty-seven of the 528 blueberry leaf samples (7 %), including 439 from cv. ‘Patriot’ and 89 from cv. ‘Bluecrop’, reacted positively to ToRSV (3 %, 17 of 528) or TRSV (4 %, 20 of 528) in DAS-ELISA. Nine ToRSV-infected samples were from Patriot (2 %) and eight from Bluecrop (9 %); twelve Patriot (3 %) and eight Bluecrop (2 %) samples were infected with TRSV. The two target viruses were found in symptomatic and asymptomatic blueberry bushes, suggesting no strict association between virus detection by DAS-ELISA and symptom development. Seven soil samples from the Patriot planting and three from the Bluecrop planting were tested for the presence of nematodes. Species identified were primarily Pratylenchus spp., Helicotylenchus spp. and Hoplolaimus spp. but members of the Xiphinema americanum group were also found. X. americanum populations varied from 40 to 280 per kg of soil collected and were all from the root zone of Patriot bushes. Cucumber baiting assays with each of the four soil samples containing X. americanum demonstrated transmission of TRSV or ToRSV. The presence of TRSV was confirmed by RT-PCR in blueberry leaf samples with amplification of a 320-bp DNA fragment of the RNA1-encoded RNA-dependent RNA polymerase (RdRp) using primers MF05-21-R (5’ CAATACGGTAAGTGCACACCCCG 3’) and MF05-22-F (5’ CAGGGGCGTGAGTGGGGGCTC 3’). Similarly, the presence of ToRSV was confirmed in blueberry leaf tissue by immunocapture RT-PCR and primers ToRSV-R (5’ CCACCACACTCCACCTACC 3’) and ToRSV-F (5’ ACTTCTGAAGGCTACCCGTT 3’) to characterize a 585-bp fragment of the RNA1-encoded RdRp gene. The viral gene amplicons obtained by PCR-based assays from four ToRSV and eleven TRSV isolates were sequenced. A multiple sequence alignment of ToRSV isolates from blueberry characterized in this study and those available in GenBank indicated 80.7-99.7 % and 90.2-99.5% sequence identity at the nucleotide (585 nts) and amino acid (194 residues) levels, respectively. Phylogenetic analyses showed a clustering of ToRSV isolates into three groups. Notwithstanding, ToRSV haplotypes from blueberry did not group with corresponding haplotypes from other crops, suggesting a genetic differentiation according to host. A multiple sequence alignment of TRSV isolates from blueberry characterized in this study and those available in GenBank indicated 90.8-99.7 % and 91.4-100 % sequence identity at the nucleotide (316 nts) and amino acid (105 residues) levels, respectively. Phylogenetic analyses inferred a clustering of TRSV isolates into a single group. Discussion ToRSV and TRSV are known to occur in fruit crops in New York, including grapevines (Gilmer et al., 1970; Uyemoto et al., 1977a) and Prunus spp. (Cummins and Gonsalves, 1986; Uyemoto et al., 1977b). ToRSV is also described in Malus spp. (Rosenberger et al., 1989) but, to our knowledge, this is the first report on the occurrence of TRSV and ToRSV in highbush blueberry in New York. In the USA, TRSV was reported in blueberry in Connecticut, Illinois, Michigan, Arkansas, Oregon and New Jersey (Ramsdell, 1985a). Also, ToRSV was described in blueberry in Oregon, Washington and Pennsylvania (Ramsdell, 1985b). The distribution of the two nepovirus species in the major blueberry producing areas in the United States is likely explained by the use of noncertified planting material. The infection rate of TRSV and ToRSV was low in apical leaves in spite of a severe degeneration in cv. ‘Patriot’ and a slow decline in cv. ‘Bluecrop’. Highbush Bluecrop is known to recover from TRSV infection (Lister et al., 1963). This recovery phenomenon likely results from the manifestation of RNA silencing. Interestingly, a complete or partial recovery of N. tabaccum and N. benthamiana from TRSV infection was described recently (Siddiqui et al., 2008) as well as a recovery of N. benthamiana from ToRSV infection (Jovel et al., 2007). It is conceivable that RNA silencing could be active in highbush blueberry cvs. ‘Patriot’ and ‘Bluecrop’ infected with TRSV or ToRSV, affecting systemic spread, reducing virus titers in apical leaves, in spite of a marked decline. X. americanum, the nematode vector of TRSV and ToRSV, was detected in the root zone of highbush blueberry cv. ‘Patriot’. Populations of X. americanum were described in vineyards (Uyemoto et al., 1977a) and in apple, peach and cherry orchards (Molinari et al., 2004) in New York. To our knowledge, this is the first report of the dagger nematode X. americanum senso lato in blueberry in New York. The population density of X. americanum in the blueberry plantings surveyed in this study was low, but similar to findings in other crops (Evans et al., 2004; Pinkerton et al., 2008). In spite of the low population density detected, it is conceivable that X. americanum could contribute to the decline of highbush blueberry cvs. Patriot and Bluecrop by feeding on actively growing rootlets, thus weakening the root system and affecting plant vigor. 16 Julius-Kühn-Archiv, 427, 2010 21st International Conference on Virus and other Graft Transmissible Diseases of Fruit Crops Literature Cummins, J.N.; Gonsalves, D.; 1986: Constriction and decline of ‘Stanley’ prune associated with tomato ringspot virus. J. Am. Soc. Hort. Sci. 111, 315-318. Evans, T.A.; Miller, C.; Vasilas, B.L.; Mulrooney, R.P.; 2007: Management of Xiphinema americanum and soybean severe stunt in soybean using crop rotation.
Recommended publications
  • Vector Capability of Xiphinema Americanum Sensu Lato in California 1

    Vector Capability of Xiphinema Americanum Sensu Lato in California 1

    Journal of Nematology 21(4):517-523. 1989. © The Society of Nematologists 1989. Vector Capability of Xiphinema americanum sensu lato in California 1 JOHN A. GRIESBACH 2 AND ARMAND R. MAGGENTI s Abstract: Seven field populations of Xiphineraa americanum sensu lato from California's major agronomic areas were tested for their ability to transmit two nepoviruses, including the prune brownline, peach yellow bud, and grapevine yellow vein strains of" tomato ringspot virus and the bud blight strain of tobacco ringspot virus. Two field populations transmitted all isolates, one population transmitted all tomato ringspot virus isolates but failed to transmit bud blight strain of tobacco ringspot virus, and the remaining four populations failed to transmit any virus. Only one population, which transmitted all isolates, bad been associated with field spread of a nepovirus. As two California populations of Xiphinema americanum sensu lato were shown to have the ability to vector two different nepoviruses, a nematode taxonomy based on a parsimony of virus-vector re- lationship is not practical for these populations. Because two California populations ofX. americanum were able to vector tobacco ringspot virus, commonly vectored by X. americanum in the eastern United States, these western populations cannot be differentiated from eastern populations by vector capability tests using tobacco ringspot virus. Key words: dagger nematode, tobacco ringspot virus, tomato ringspot virus, nepovirus, Xiphinema americanum, Xiphinema californicum. Populations of Xiphinema americanum brownline (PBL), prunus stem pitting (PSP) Cobb, 1913 shown through rigorous test- and cherry leaf mottle (CLM) (8). Both PBL ing (23) to be nepovirus vectors include X. and PSP were transmitted with a high de- americanum sensu lato (s.1.) for tobacco gree of efficiency, whereas CLM was trans- ringspot virus (TobRSV) (5), tomato ring- mitted rarely.
  • Response of Blackberry Cultivars to Nematode Transmission of Tobacco Ringspot Virus Alisha Sanny University of Arkansas, Fayetteville

    Response of Blackberry Cultivars to Nematode Transmission of Tobacco Ringspot Virus Alisha Sanny University of Arkansas, Fayetteville

    Inquiry: The University of Arkansas Undergraduate Research Journal Volume 4 Article 18 Fall 2003 Response of Blackberry Cultivars to Nematode Transmission of Tobacco Ringspot Virus Alisha Sanny University of Arkansas, Fayetteville Follow this and additional works at: http://scholarworks.uark.edu/inquiry Part of the Agronomy and Crop Sciences Commons, Horticulture Commons, and the Plant Pathology Commons Recommended Citation Sanny, Alisha (2003) "Response of Blackberry Cultivars to Nematode Transmission of Tobacco Ringspot Virus," Inquiry: The University of Arkansas Undergraduate Research Journal: Vol. 4 , Article 18. Available at: http://scholarworks.uark.edu/inquiry/vol4/iss1/18 This Article is brought to you for free and open access by ScholarWorks@UARK. It has been accepted for inclusion in Inquiry: The nivU ersity of Arkansas Undergraduate Research Journal by an authorized editor of ScholarWorks@UARK. For more information, please contact [email protected], [email protected]. '' I.'' Sanny: Response of Blackberry Cultivars to Nematode Transmission of Toba 106 INQUIRY Volume 4 2003 RESPONSE OF BLACKBERRY CULTIVARS TO NEMATODE TRANSMISSION OF TOBACCO RINGSPOT VIRUS \ ! By Alisha Sanny i Department of Horticulture :' Faculty Mentors: Professors John R.Clark and Rose Gergerich Departments of Horticulture and Plant Pathology, respectively Abstract: length in a two-year period, but that there was a significant yield reduction (50%) in RBDV infected plants, along with reduced A study was conducted on eight cultivars of blackberry berry weight (40%) and drupelet number per berry (39%) (Strik ('Apache', 'Arapaho', 'Chester', 'Chickasaw', 'Kiowa', and Martin, 2002). Infected plants also showed visual symptoms, 'Navaho', 'Shawnee', and 'Triple Crown'), ofwhichfourplants including chlorosis, vein clearing, silver discoloration, and of each were previously detennined in the fall of200I to have malformed, small fruit.
  • Journal of Virological Methods 153 (2008) 16–21

    Journal of Virological Methods 153 (2008) 16–21

    Journal of Virological Methods 153 (2008) 16–21 Contents lists available at ScienceDirect Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet Use of primers with 5 non-complementary sequences in RT-PCR for the detection of nepovirus subgroups A and B Ting Wei, Gerard Clover ∗ Plant Health and Environment Laboratory, Investigation and Diagnostic Centre, MAF Biosecurity New Zealand, P.O. Box 2095, Auckland 1140, New Zealand abstract Article history: Two generic PCR protocols were developed to detect nepoviruses in subgroups A and B using degenerate Received 21 April 2008 primers designed to amplify part of the RNA-dependent RNA polymerase (RdRp) gene. It was observed that Received in revised form 17 June 2008 detection sensitivity and specificity could be improved by adding a 12-bp non-complementary sequence Accepted 19 June 2008 to the 5 termini of the forward, but not the reverse, primers. The optimized PCR protocols amplified a specific product (∼340 bp and ∼250 bp with subgroups A and B, respectively) from all 17 isolates of the 5 Keywords: virus species in subgroup A and 3 species in subgroup B tested. The primers detect conserved protein motifs Nepoviruses in the RdRp gene and it is anticipated that they have the potential to detect unreported or uncharacterised Primer flap Universal primers nepoviruses in subgroups A and B. RT-PCR © 2008 Elsevier B.V. All rights reserved. 1. Introduction together with nematode transmission make these viruses partic- ularly hard to eradicate or control (Harrison and Murant, 1977; The genus Nepovirus is classified in the family Comoviridae, Fauquet et al., 2005).
  • Morphology and Taxonomy of Xiphinema ( Nematoda: Longidoridae) Occurring in Arkansas,USA

    Morphology and Taxonomy of Xiphinema ( Nematoda: Longidoridae) Occurring in Arkansas,USA

    江西农业大学学报 2010,32( 5): 0928 - 0945 http: / /xuebao. jxau. edu. cn Acta AGriculturae Universitatis JianGxiensis E - mail: ndxb7775@ sina. com Morphology and Taxonomy of Xiphinema ( Nematoda: Longidoridae) Occurring in Arkansas,USA YE Weimin 1,2 ,ROBBINS R. T. 1 ( 1. Department of Plant PatholoGy,NematoloGy Laboratory,2601 N. YounG Ave. ,University of Arkan- sas,Fayetteville,AR 72704,USA. 2. Present address: Nematode Assay Laboratory,North Carolina Depart- ment of AGriculture and Consumer Services,RaleiGh,NC 27607,USA) Abstract: In a survey,primarily from the rhizosphere of hardwood trees GrowinG on sandy stream banks, for lonGidorids,828 soil samples were collected from 37 Arkansas counties in 1999—2001. One hundred twenty-seven populations of Xiphinema were recovered from 452 of the 828 soil samples ( 54. 6% ),includinG 71 populations of X. americanum sensu lato,33 populations of X. bakeri,23 populations of X. chambersi and one population of X. krugi. The morpholoGical and morphometric characteristics of these Arkansas species are presented. MorpholoGical and morphometric characteristics are also Given for two populations of X. krugi from Hawaii and North Carolina. Key words: Arkansas; morpholoGy; SEM; survey; taxonomy; Xiphinema americanum; X. bakeri; X. chambersi; X. krugi. 中图分类号: Q959. 17; S432. 4 + 5 文献标志码: A 文章编号: 1000 - 2286( 2010) 05 - 0928 - 18 Xiphinema species are miGratory ectoparasites of both herbaceous and woody plants. Direct feedinG dam- aGe may result in root-tip GallinG and stuntinG of top Growth. In addition,some species
  • Bacillus Firmus for the Biological Control of Meloidogyne Hapla and Xiphinema Americanum

    Bacillus Firmus for the Biological Control of Meloidogyne Hapla and Xiphinema Americanum

    Graduate Theses, Dissertations, and Problem Reports 2016 Bacillus firmus for the biological control of Meloidogyne hapla and Xiphinema americanum Lisa M. Valencia Follow this and additional works at: https://researchrepository.wvu.edu/etd Recommended Citation Valencia, Lisa M., "Bacillus firmus for the biological control of Meloidogyne hapla and Xiphinema americanum" (2016). Graduate Theses, Dissertations, and Problem Reports. 6860. https://researchrepository.wvu.edu/etd/6860 This Thesis is protected by copyright and/or related rights. It has been brought to you by the The Research Repository @ WVU with permission from the rights-holder(s). You are free to use this Thesis in any way that is permitted by the copyright and related rights legislation that applies to your use. For other uses you must obtain permission from the rights-holder(s) directly, unless additional rights are indicated by a Creative Commons license in the record and/ or on the work itself. This Thesis has been accepted for inclusion in WVU Graduate Theses, Dissertations, and Problem Reports collection by an authorized administrator of The Research Repository @ WVU. For more information, please contact [email protected]. Bacillus firmus for the biological control of Meloidogyne hapla and Xiphinema americanum Lisa M. Valencia Thesis submitted to the Davis College of Agriculture, Natural Resources and Design at West Virginia University in partial fulfillment of the requirements for the degree of Master of Science in Applied and Environmental Microbiology James B. Kotcon, Ph.D., Chair Alan J. Sexstone, Ph.D. Gary K. Bissonnette, Ph.D. Division of Plant and Soil Sciences Morgantown, WV 2016 Keywords: Bacillus firmus, Meloidogyne hapla, Xiphinema americanum, plant-parasitic nematode, biological control, bionematicide, mode of action, chemotaxis Copyright 2016 Lisa M.
  • Tomato Ringspot Virus

    Tomato Ringspot Virus

    -- CALIFORNIA D EP ARTM ENT OF cdfaFOOD & AGRICULTURE ~ California Pest Rating Proposal for Tomato ringspot virus Current Pest Rating: C Proposed Pest Rating: C Realm: Riboviria; Phylum: incertae sedis Family: Secoviridae; Subfamily: Comovirinae Genus: Nepovirus Comment Period: 6/2/2020 through 7/17/2020 Initiating Event: On August 9, 2019, USDA-APHIS published a list of “Native and Naturalized Plant Pests Permitted by Regulation”. Interstate movement of these plant pests is no longer federally regulated within the 48 contiguous United States. There are 49 plant pathogens (bacteria, fungi, viruses, and nematodes) on this list. California may choose to continue to regulate movement of some or all these pathogens into and within the state. In order to assess the needs and potential requirements to issue a state permit, a formal risk analysis for Tomato ringspot virus (ToRSV) is given herein and a permanent pest rating is proposed. History & Status: Background: Tomato ringspot virus is widespread in North America. Despite the name, it is of minor importance to tomatoes. However, it infects many other hosts and causes particularly severe losses on perennial woody plants including fruit trees and brambles. ToRSV is a nepovirus; “nepo” stands for nematode- transmitted polyhedral. It is part of a large group of more than 30 viruses, each of which may attack many annual and perennial plants and trees. They cause severe diseases of trees and vines. ToRSV is vectored by dagger nematodes in the genus Xiphinema and sometimes spreads through seeds or can be transmitted by pollen to the pollinated plant and seeds. ToRSV is often among the most important diseases for each of its fruit tree, vine, or bramble hosts, which can suffer severe losses in yield or be -- CALIFORNIA D EP ARTM ENT OF cdfaFOOD & AGRICULTURE ~ killed by the virus.
  • Pest Categorisation of Non‐EU Viruses of Rubus L

    Pest Categorisation of Non‐EU Viruses of Rubus L

    SCIENTIFIC OPINION ADOPTED: 21 November 2019 doi: 10.2903/j.efsa.2020.5928 Pest categorisation of non-EU viruses of Rubus L. EFSA Panel on Plant Health (PLH), Claude Bragard, Katharina Dehnen-Schmutz, Paolo Gonthier, Marie-Agnes Jacques, Josep Anton Jaques Miret, Annemarie Fejer Justesen, Alan MacLeod, Christer Sven Magnusson, Panagiotis Milonas, Juan A Navas-Cortes, Stephen Parnell, Roel Potting, Philippe Lucien Reignault, Hans-Hermann Thulke, Wopke Van der Werf, Antonio Vicent Civera, Jonathan Yuen, Lucia Zappala, Thierry Candresse, Elisavet Chatzivassiliou, Franco Finelli, Stephan Winter, Domenico Bosco, Michela Chiumenti, Francesco Di Serio, Franco Ferilli, Tomasz Kaluski, Angelantonio Minafra and Luisa Rubino Abstract The Panel on Plant Health of EFSA conducted a pest categorisation of 17 viruses of Rubus L. that were previously classified as either non-EU or of undetermined standing in a previous opinion. These infectious agents belong to different genera and are heterogeneous in their biology. Blackberry virus X, blackberry virus Z and wineberry latent virus were not categorised because of lack of information while grapevine red blotch virus was excluded because it does not infect Rubus. All 17 viruses are efficiently transmitted by vegetative propagation, with plants for planting representing the major pathway for entry and spread. For some viruses, additional pathway(s) are Rubus seeds, pollen and/or vector(s). Most of the viruses categorised here infect only one or few plant genera, but some of them have a wide host range, thus extending the possible entry pathways. Cherry rasp leaf virus, raspberry latent virus, raspberry leaf curl virus, strawberry necrotic shock virus, tobacco ringspot virus and tomato ringspot virus meet all the criteria to qualify as potential Union quarantine pests (QPs).
  • STUDIES on XIPHINEMA AMERICANUM SENSU LATD with DESCRIPTIONS of FIFTEEN NEW SPECIES (NEMATODA, LONGIDORIDAE) by Lima

    STUDIES on XIPHINEMA AMERICANUM SENSU LATD with DESCRIPTIONS of FIFTEEN NEW SPECIES (NEMATODA, LONGIDORIDAE) by Lima

    ~emat~mfli't (1979), 7 51-106. Laboratorio di Nematologia Agraria del C.N.R. - 70126 Bari, Italy STUDIES ON XIPHINEMA AMERICANUM SENSU LATD WITH DESCRIPTIONS OF FIFTEEN NEW SPECIES (NEMATODA, LONGIDORIDAE) By FRANCO LAMBERTI AND TERESA BLEVE-ZACHEO Lima (1965) was the first to hypothesize that Xiphinema ameri­ canum Cobb, 1913 was a complex of different species in which he listed X. americanum, X. brevicolle Lordello et Da Costa, 1961, X. opisthohysterum Siddiqi, 1961 and four undescribed species (Lima, 1968). One of them was later described as X. mediterraneum Martelli et Lamberti, 1967 (Lamberti and Martelli, 1971) and recently synon­ ymized with X. pachtaicum (Tulaganov, 1938) Kirijanova, 1951 (Sid­ diqi and Lamberti, 1977). The morphometrical variability in X. ame­ ricanum was also studied by Tarjan (1968) who, after having examined 75 world-wide collected populations, concluded that the species status of X. brevicolle, X. opisthohysterum and Lima's Mediterranean species, presently X. pachtaicum, was justified but that all the other variations he had observed should be considered as geographical variants, cor­ related with climatic influences, within the X. americanum complex (Tarjan, 1969). In 1974 Heyns stated that «demarcation of species within the group is problematical and unsatisfactory although several of the species proposed by Lima seem to be justified ». Because of the importance of X. americanum as a vector of some plant viruses (Taylor and Robertson, 1975) we thought it useful to carry out studies which would clarify the identity of several popu­ lations from different geographical locations and establish the re­ lationships with this and the other related species.
  • Morphologic and Molecular Identification of Xiphinema Americanum Associated with Pine Trees

    Morphologic and Molecular Identification of Xiphinema Americanum Associated with Pine Trees

    International Journal of Molecular Biology: Open Access Review Article Open Access Morphologic and molecular identification of Xiphinema americanum associated with pine trees Abstract Volume 3 Issue 3 - 2018 Xiphinema spp. member Xiphinema americanum, isolated from soils around roots of pine Lerzan Özturk,1 Tohid Behmand,2 Bahadir tree (Pinus spp.) were identified by morphological and molecular methods. Morphologic Sin,3 Gürkan Güvenç Avci,1 İbrahim Halil identification of species was carried out under microscope by observing featuring 2 characteristics of heat killed and TAF fixed females. On the other handa polymerase chain Elekcioğlu reaction protocol has been developed for the specific molecular identification ofXiphinema 1Viticulture Research Institute, Turkey americanum. A primer sets amlifying ITS1 region were designed (X.americanum F- X. 2Plant Protection Department, Faculty of Agriculture, Çukurova americanumR) and used in diagnostic tests. After running %1 agarose gel, DNA from a University, Turkey 3 single Xiphinema americanum female yielded amplification products with expected lenght Plant Protection Department, Faculty of Agriculture, of 183 bp. Xiphinema americanum was succesfully identified with species-specific primers Gaziosmanpaşa University, Turkey developed from ITS-1 region of rDNA. Correspondence: Lerzan Özturk, Viticulture Research Keywords: Xiphinema americanum, morphology, molecular identification, PCR Institute, Turkey, Email [email protected] Received: March 30, 2018 | Published: May 02, 2018 Introduction divergence of DNA region in many populations of the same species and in closely related species. Clear identification of cyst nematodes, The Xiphinema americanum-group is a large group containing lesion nematodes, stunt nematodes, dagger nematodes and root knot 55 nematode species occurring around roots of several plants and nematodes was achieved with this method.8‒11 This method allows 1 trees.
  • Grapevine Fanleaf Virus: Biology, Biotechnology and Resistance

    Grapevine Fanleaf Virus: Biology, Biotechnology and Resistance

    GRAPEVINE FANLEAF VIRUS: BIOLOGY, BIOTECHNOLOGY AND RESISTANCE A Dissertation Presented to the Faculty of the Graduate School of Cornell University In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy by John Wesley Gottula May 2014 © 2014 John Wesley Gottula GRAPEVINE FANLEAF VIRUS: BIOLOGY, BIOTECHNOLOGY AND RESISTANCE John Wesley Gottula, Ph. D. Cornell University 2014 Grapevine fanleaf virus (GFLV) causes fanleaf degeneration of grapevines. GFLV is present in most grape growing regions and has a bipartite RNA genome. The three goals of this research were to (1) advance our understanding of GFLV biology through studies on its satellite RNA, (2) engineer GFLV into a viral vector for grapevine functional genomics, and (3) discover a source of resistance to GFLV. This author addressed GFLV biology by studying the least understood aspect of GFLV: its satellite RNA. This author sequenced a new GFLV satellite RNA variant and compared it with other satellite RNA sequences. Forensic tracking of the satellite RNA revealed that it originated from an ancestral nepovirus and was likely introduced from Europe into North America. Greenhouse experiments showed that the GFLV satellite RNA has commensal relationship with its helper virus on a herbaceous host. This author engineered GFLV into a biotechnology tool by cloning infectious GFLV genomic cDNAs into binary vectors, with or without further modifications, and using Agrobacterium tumefaciens delivery to infect Nicotiana benthamiana. Tagging GFLV with fluorescent proteins allowed tracking of the virus within N. benthamiana and Chenopodium quinoa tissues, and imbuing GFLV with partial plant gene sequences proved the concept that endogenous plant genes can be knocked down.
  • Transmission of Tomato Ringspot Virus by Xiphinema Americanum and X

    Transmission of Tomato Ringspot Virus by Xiphinema Americanum and X

    Journal of Nematology 20(2):304-308. 1988. © The Society of Nematologists 1988. Transmission of Tomato Ringspot Virus by Xiphinema americanum and X. rivesi from New York Apple Orchards 1 LAURA L. GEORGI 2 Abstract: Populations of Xiphinema americanum and X. rivesi were collected from apple orchards in eastern and western New York and tested in the laboratory for ability to transmit tomato ringspot virus (TmRSV) to cucumber and dandelion. Populations varied in the frequency with which they transmitted TmRSV, but this variation did not correspond to variation in disease prevalence in the orchard. The lower prevalence of TmRSV-incited disease in apple trees in western New York cannot be attributed to inability of the local Xiphinema sl0p. to transmit TmRSV. Key words: Cucumis sativus, Taraxacum ojficinale, tomato ringspot virus, Xiphinema americanum, X. rivesi. Tomato ringspot virus (TmRSV) causes MATERIALS AND METHODS a potentially lethal disease of some apple Nematode populations: One X. americanum cuhivars grafted onto certain rootstocks population from western New York (C) and (13,15). There are extensive plantings of one from the Hudson Valley (F), one X. susceptible trees throughout the apple- rivesi population from western New York growing regions of New York, but disease (E), and a mixed population (34% X. ameri- prevalence is higher in the Hudson Valley canum, 66% X. rivesi) from the Hudson Val- than in western New York (14). Because ley (G) were selected for study. Populations TmRSV is transmitted by Xiphinema ameri- F, E, and G were associated with diseased, canum and X. rivesi (2), one possible expla- TmRSV-infected apple trees, and popu- nation for the observed distribution of dis- lation C with healthy trees (Gonsalves, pers.
  • Xiphinema Americanum Cobb, 1913

    Xiphinema Americanum Cobb, 1913

    -- CALIFORNIA D EPAUMENT OF cdfa FOOD & AGRICULTURE ~ California Pest Rating Proposal for Xiphinema americanum Cobb, 1913 American dagger nematode Current Pest Rating: C Proposed Pest Rating: C Kingdom: Animalia; Phylum: Nematoda; Class: Enoplea Order: Dorylaimida; Superfamily: Dorylaimoidea; Family: Longidoridae; Subfamily: Xiphineminae Comment Period: 02/27/2020 through 04/12/2020 Initiating Event: On August 9, 2019, USDA-APHIS published a list of “Native and Naturalized Plant Pests Permitted by Regulation”. Interstate movement of these plant pests is no longer federally regulated within the 48 contiguous United States. There are 49 plant pathogens (bacteria, fungi, viruses, and nematodes) on this list. California may choose to continue to regulate movement of some or all these pathogens into and within the state. In order to assess the needs and potential requirements to issue a state permit, a formal risk analysis for Xiphinema americanum is given herein and a permanent pest rating is proposed. History & Status: Background: Xiphinema americanum sensu lato (in the broad sense) is a migratory root ectoparasitic nematode that is widespread in North America (Robbins, 1993). This species inhabits the rhizosphere soils of host plants while feeding on roots. Eggs are laid singly in the soil and hatch in approximately one week. A population may be founded by a single larva. Once hatched, each larval stage must feed in order to molt and develop to the next stage. Larvae and adults feed by means of a long stylet that is used to penetrate the vascular tissue of roots. Males are very rare, and reproduction is apparently by parthenogenesis. The life cycle can take four years to complete (Halbrendt and Brown, 1992 and 1993).