The Roles of MIST1 and RAB26 in Zymogenic (Chief) Cell Differentiation and Subcellular Organization" (2015)

Washington University in St. Louis Washington University Open Scholarship

Arts & Sciences Electronic Theses and Dissertations Arts & Sciences

Spring 5-15-2015 The Roles of MIST1 and RAB26 in yZ mogenic (Chief) Cell Differentiation and Subcellular Organization Ramon Jin Washington University in St. Louis

Follow this and additional works at: https://openscholarship.wustl.edu/art_sci_etds Part of the Biology Commons

Recommended Citation Jin, Ramon, "The Roles of MIST1 and RAB26 in Zymogenic (Chief) Cell Differentiation and Subcellular Organization" (2015). Arts & Sciences Electronic Theses and Dissertations. 481. https://openscholarship.wustl.edu/art_sci_etds/481

This Dissertation is brought to you for free and open access by the Arts & Sciences at Washington University Open Scholarship. It has been accepted for inclusion in Arts & Sciences Electronic Theses and Dissertations by an authorized administrator of Washington University Open Scholarship. For more information, please contact [email protected].

WASHINGTON UNIVERSITY IN ST. LOUIS

Division of Biology and Biomedical Sciences Molecular Cell Biology

Dissertation Examination Committee: Jason C. Mills, Chair Paul H. Taghert, Co-Chair Stuart A. Kornfeld Indira U. Mysorekar Babak Razani Joel D. Schilling

The Roles of MIST1 and RAB26 in Zymogenic (Chief) Cell Differentiation and Subcellular Organization by Ramon Jin

A dissertation presented to the Graduate School of Arts & Sciences of Washington University in partial fulfillment of the requirements for the degree of Doctor of Philosophy

May 2015 St. Louis, Missouri

TABLE OF CONTENTS

LIST OF FIGURES ...... v ACKNOWLEDGEMENTS ...... viii ABSTRACT OF THE DISSERTATION ...... xii

CHAPTER 1: Preface ...... 1 Introduction ...... 2 Secretory Vesicle and Lysosome Trafficking ...... 3 Rab Proteins as Membrane Organizers ...... 5 Developmental Regulation of Vesicle Compartments ...... 7 Summary ...... 10 References ...... 12 Figure Legends ...... 17 Figures ...... 18

CHAPTER 2: Congenital and Acquired Diseases of the Stomach ...... 20 Introduction ...... 23 Developmental/Congenital Clinical Disorders ...... 23 Anatomic Development of the Stomach ...... 23 Disorders ...... 24 Motility ...... 25 Cardiac Achalasia ...... 25 Infantile Hypertrophic Pyloric Stenosis ...... 26 Gastric Atresia ...... 27 Gastric Volvulus ...... 28 Congenital Microgastria...... 29 Gastric Diverticulum ...... 30 Gastric Duplication Cysts ...... 30 Teratomas ...... 31 Adult/Acquired Clinical Disorders ...... 32 Histologic Development of the Stomach ...... 32 Disorders ...... 34 Surface Pit Cells ...... 34 Foveolar Hyperplasia ...... 34 Ménétrier Disease ...... 35 Enteroendocrine Cells ...... 36 Hypergastrinemia ...... 37 Zollinger-Ellison Syndrome...... 38 Carcinoid Tumors ...... 39 Parietal Cells ...... 41 Peptic Ulcer Disease ...... 42 Autoimmune Gastritis/Pernicious Anemia ...... 45 ii

Atrophic Gastritis ...... 47 Zymogenic (Chief) Cells...... 48 Atrophic Gastritis/SPEM ...... 49 Intestinal Metaplasia ...... 51 Gastric Cancer ...... 53 Conclusions ...... 58 Acknowledgements ...... 60 References ...... 61 Figure Legends ...... 84 Figures ...... 85

CHAPTER 3: RAB26 and Rab3D are Direct Transcriptional Targets of MIST1 That Regulate Exocrine Granule Maturation ...... 91 Abstract ...... 93 Introduction ...... 94 Materials and Methods ...... 98 Results ...... 109 Discussion ...... 116 Acknowledgements ...... 121 References ...... 122 Figure Legends ...... 127 Figures ...... 133

CHAPTER 4: RAB26 Coordinates Lysosome Traffic and Mitochondrial Localization ...... 143 Summary ...... 144 Introduction ...... 144 Results ...... 146 Discussion ...... 155 Materials and Methods ...... 160 Acknowledgements ...... 168 References ...... 170 Figure Legends ...... 176 Supplemental Material Legends ...... 182 Figures ...... 185 Supplemental Material ...... 193

CHAPTER 5: MIST1 Facilitates Secretory Vesicle Maturation by Regulation of Lysosomal Trafficking in Exocrine Secretory Cells ...... 197 Abstract ...... 199 Introduction ...... 200

iii

Results ...... 202 Discussion ...... 209 Materials and Methods ...... 214 Acknowledgements ...... 218 References ...... 219 Figure Legends ...... 224 Supplemental Figure Legends ...... 228 Figures ...... 230 Supplemental Figures ...... 237

CHAPTER 6: Conclusions and Future Directions ...... 240 MIST1 Induces a Gene Network for Integrated Control of Secretion ...... 241 Future Directions ...... 242 RAB26 Functions to Reorganize Lysosomes and Prune Mitochondria ...... 245 Future Directions ...... 245 MIST1 Suppresses Lysosome Mediated Degradation in Mature Exocrine Cells ...... 251 Future Directions ...... 252 Loss of MIST1 Induces Lysosome Mediated Downscaling During Gastric Metaplasia ...... 254 Future Directions ...... 254 Final Remarks ...... 257 References ...... 259 Figure Legends ...... 264 Figures ...... 267

CURRICULUM VITAE ...... 271

LIST OF FIGURES

CHAPTER 1: Preface Figure 1. Rab proteins coordinate trafficking of secretory vesicles and lysosomes ..... 18

Figure 2. Transcriptionally controlled network of subcellular effectors ...... 19

CHAPTER 2: Congenital and Acquired Diseases of the Stomach Figure 1. Anatomic development of the human stomach ...... 85

Figure 2. Histologic development of the human stomach ...... 86

Figure 3. Re-emergent developmental pathways during gastric cancer progression ... 87

Table 1. Developmental/congenital clinical disorders with underlying disease mechanism, diagnostic approach, and current therapies ...... 88

Table 2. Differences between human and murine stomach anatomy and histology ... 89

Table 3. Adult/acquired clinical disorders with underlying disease mechanism, diagnostic approach, and current therapies ...... 90

CHAPTER 3: RAB26 and Rab3D are Direct Transcriptional Targets of MIST1 That Regulate Exocrine Granule Maturation Figure 1. MIST1 is required for development and maintenance of large zymogenic secretory granules and apical-basal orientation ...... 133

Figure 2. Transient transfection with MIST1 in AGS and HGC-27 gastric cell lines increases expression of a common cohort of genes ...... 134

Figure 3. Several genes activated by MIST1 overexpression have evolutionarily conserved, first intronic canonical MIST1 E-box sequences ...... 135

Figure 4. Conserved MIST1 E-box sequences are directly bound by MIST1 ...... 136

Figure 5. Rab3d and Rab26 expression are zymogenic cell-specific and MIST1-dependent in vivo...... 137

Figure 6. HGC-MIST1 cells form large exocrine granules upon PGC-RFP transfection ...... 138

Figure 7. Large PGC-RFP vesicles in HGC-MIST1 cells are Rab function dependent ...... 139

Figure 8. Schematic illustrating how MIST1 expression is induced as mucous neck cells differentiate into zymogenic cells ...... 140

Table 1. Function of genes upregulated by MIST1 transfection ...... 141

CHAPTER 4: RAB26 Coordinates Lysosome Traffic and Mitochondrial Localization Figure 1. Expression of RAB26 is cell and tissue-dependent, and inducible by the transcription factor MIST1 ...... 185

Figure 2. RAB26 localizes to LAMP1 positive lysosomal vesicles ...... 186

Figure 3. Endogenous RAB26 is also lysosome-associated ...... 187

Figure 4. RAB26 localizes with other lysosomal markers ...... 188

Figure 5. Design and characterization of RAB26 point mutants ...... 189

Figure 6. Scaling of RAB26 expression leads to perinuclear localization of lysosomes ...... 190

Figure 7. RAB26 overexpressing cells show ultrastructural rearrangements ...... 191

Figure 8. RAB26 induced lysosomal clustering leads to mitochondrial reorganization ...... 192

Figure S1. RAB26 does not localize to the immature secretory vesicle, endosomal, Golgi, or post-Golgi sorting compartments ...... 193

Figure S2. RAB26 not RAB3D localizes to lysosomes ...... 194

Figure S3. RAB26 does not affect Golgi or late endosomal distribution ...... 195

Figure S4. RAB26 does not affect lysosomal or mitochondrial function ...... 196

CHAPTER 5: MIST1 Facilitates Secretory Vesicle Maturation by Regulation of Lysosomal Trafficking in Exocrine Secretory Cells Figure 1. MIST1 is required for large secretory granule homeostasis ...... 230

Figure 2. Gastric zymogenic cells show accumulation of lysosomes in the absence of MIST1 ...... 231

Figure 3. Mist1−/− ZCs display degraded secretory vesicles inside accumulating lysosomes ...... 232

Figure 4. Lysosomes accumulate rapidly in the absence of MIST1 ...... 233

Figure 5. Mist1−/− pancreatic acinar cells have lysosomal accumulations ...... 234

Figure 6. Inhibition of lysosome degradation partially rescues Mist1−/− secretory vesicles ...... 235

Figure 7. MIST1 induces direct targets to reorganize subcellular architecture ...... 236

Figure S1. Conditional deletion of Mist1 results in lysosomal accumulation ...... 237

Figure S2. Inhibition of lysosome degradation partially rescues secretory vesicles in Mist1−/− gastric ZCs and pancreatic acinar cells ...... 238

Figure S3. Other markers show partial rescue of secretory vesicles in Mist1−/− gastric ZCs and pancreatic acinar cells ...... 239

CHAPTER 6: Conclusions and Future Directions Figure 1. The expression of CCPG1 and SERPINI1 is MIST1 dependent ...... 267

Figure 2. RAB26 traffics along microtubules and co-localizes with autophagy and mitophagy markers ...... 268

Figure 3. Autophagocytic vesicles mark secretory vesicles and accumulate upon deletion of Atg7 ...... 269

Figure 4. Lysosome mediated secretory vesicle destruction is an early event during gastric metaplasia ...... 270

vii

ACKNOWLEDGEMENTS

This thesis is the culmination of five years of life. To call it “work” would be unfair, as

this single pursuit has permeated into every possible corner of my life. As scientific research, this dissertation must strive to remain emotionless, objective, uncontaminated. But how can one simply ignore the hours of soul crushing frustration, those pit-of-your stomach feelings of disappointment, the muffled when-you-are-alone-in-the-darkroom screams of anger, and most importantly, the fleeting elation that comes when you see those far too brief glimpses of Nature’s masterplan? I guess the real answer is with learned scientific maturity. It is the important lesson that has taken me five years to properly absorb. It means possessing the stoicism that comes with finally knowing what the goal of scientific research is. I realize that the aim of this thesis work is not to answer but to foster more questions; these results do not signify an ultimate truth or a final say, but beg for further study, counter examples, and alternative explanations. Science is selfless. This is what I have learned and it is with this mindset that I present this work.

All that I have done and the wonderful life in which I now live would not be possible without many instrumental people. First, I would like to thank Dr. Palmert and Dr. Drumm for opening my eyes to the world of science. The foundation from which I have built this work was laid by the mentorship of these two great men.

My parents, Qing and Min, I praise for instilling in me the importance of a good work ethic and more importantly, the greater value of good ethical work. Their sacrifice and dedication continue to inspire me every day. I hope this work will make them proud.

I must recognize my advisor, Dr. Mills. His mentorship cannot be properly defined by his words or actions, but by my development as a scientist, as a scholar, and as a man. He has

viii

challenged me from our first meeting to think with a new perspective. It is this that keeps me up

at night. He makes me feel. He makes me angry. He makes me care.

My lab mates, Dr. Tian, Dr. Oates, Dr. Huh, Dr. Capoccia, Dr. Geahlen Dr. Khurana,

soon-to-be Dr. Sibbel, and soon-to-be Dr. Moore, have been instrumental in troubleshooting my

experiments, critiquing my presentations, celebrating the good times, and teaching me in more

ways than they will ever know. I hope they will miss me as much as I will miss them. They are

family.

I would like to acknowledge my dynamic and insightful thesis committee members, Drs.

Taghert, Kornfeld, Mysorekar, Schilling, and Ranzani for their time, consideration, and truly

thoughtful suggestions. I sincerely appreciate all the professors who have opened their doors to

me: Dr. Alpers for meaningful discussion of a book chapter in-preparation, Dr. Davidson for

actively encouraging me to pursue a career as a physician scientist, Dr. Hueckeroth for taking

time on a Friday night to critique my qualification exam presentation, and Dr. Kornfeld for

meeting to guide my project and interpreting my results when they seemed indecipherable.

All of my images and micrographs were possible only through the expertise of Dr. Beatty

(Molecular Microbiology Imaging Facility), Dennis Oakley (Bakewell NeuroImaging

Laboratory), and Karen Green (Research Electron Microscopy Core). The Developmental

Biology Histology Core (Bill Coleman and Marlene Scott) and the Advanced Imaging and

Tissue Analysis Core of the Washington University Digestive Disease Core Center (Kymberli

Carter and Angela Hamer) have been instrumental in processing my mouse tissue precisely and quickly.

The MSTP administrative staff, Liz Bayer, Christy Durbin, Linda Perniciaro, and Brian

Sullivan, have simplified and eased a difficult and often confusing time. They are the glue that

ix makes combining two degrees seamless and natural. In addition, this dissertation would not have been possible without funding from the MSTP Training Grant.

Finally, I would like to express my love to the joy of my life. Without you these five years would have been empty. Science may fill the brain, but the heart is fueled by a different octane. It is by your strength and grace alone that I have been able to continue along and see an end to this difficult journey. Thank you with all of my heart. We did it…

To Tianyi, may you not be limited by the heavens.

ABSTRACT OF THE DISSERTATION

The Roles of MIST1 and RAB26 in Zymogenic (Chief) Cell Differentiation and Subcellular Organization by Ramon Jin Doctor of Philosophy in Biology and Biomedical Sciences (Molecular Cell Biology) Washington University in St. Louis, 2015 Professor Jason C. Mills, Chair Professor Paul H. Taghert, Co-Chair

Little is known about how differentiating cells reorganize their cellular structure to perform specialized physiological functions. Specifically, exocrine cells like pancreatic acinar and zymogenic chief cells have a highly developed secretory architecture that is rapidly established upon differentiation. What is known in these cells is that the evolutionarily conserved transcription factor MIST1 is required for final maturation. We hypothesized that

MIST1 directly regulates specific subcellular components that facilitate functional maturation of secretory cells.

We show that MIST1 binds to conserved CATATG E-boxes to activate transcription of 6 genes, including the small GTPases RAB26 and RAB3D. We next demonstrate that RAB26 and

RAB3D expression is significantly downregulated in Mist1-/- ZCs and upregulated in gastric cancer cell lines stably expressing MIST1 and induced to form secretory granules. Moreover, granule formation in these MIST1-expressing cells requires Rab activity because treatment with a Rab prenylation inhibitor or transfection of dominant negative RAB26 abrogates granule formation.

xii

We next sought to elucidate how a scaling factor like MIST1 rearranges cellular

architecture through transcriptional targets, specifically RAB26. We confirm that RAB26

expression was tissue specific and confined to acinar secretory cells. Functional studies in gastric cell lines showed RAB26 association with lysosomes but not with secretory granules. In addition, increasing RAB26 expression caused lysosomes to coalesce in a central, perinuclear region, causing redistribution of other organelles including mitochondria into distinct subcellular neighborhoods.

In mouse exocrine cells that are null for Mist1 and lack RAB26, we found lysosomes to be similarly abnormally distributed. Normally, lysosomes cluster centrally and basally away from secretory granules, whereas in Mist1−/− cells, they rapidly accumulate apically and degrade secretory vesicles. We confirmed active granule degradation when much of the vesicle phenotype in Mist1−/− mice was rescued upon crossing with mice deficient in the lysosome acid hydrolase processing enzyme, GlcNAc-1-phosphotransferase, alpha and beta subunits

(Gntpab−/−).

Taken together, we propose that MIST1 promotes normal maturation of secretory

granules through blocking their targeting by the cellular degradation/recycling machinery. These

results illustrate how a transcription factor can regulate cell architecture and have implications

for disease processes like acute pancreatitis where MIST1 is lost, and secretory vesicles are

targeted to lysosomes.

xiii

CHAPTER 1: Preface

Introduction

As a whole, this work will examine the cell biology of two functionally interconnected molecules. In this Preface, I will give the context and background for the studies I will describe.

Specifically, I will introduce the concepts of vesicular trafficking, Rab proteins, and transcriptional control of cellular architecture. Then, in Chapter 1, I will focus on applying this molecular knowledge towards an understudied organ, the stomach. I will strive to convince the reader of the continued need for translational cell biological discoveries with a clinical perspective. By exploring the congenital and acquired diseases of the stomach, I will show that our known understanding, be it molecular mechanistic or pathophysiologic, is still far exceeded by what is unknown. Bench to bedside translation has slowed, and far too often the treatment is found on the surgical table. Each major cell type of the gastric epithelium will be introduced and examined pathophysiologically with a focus on the specific importance of gastric zymogenic chief cells. Chapter 2 will describe the importance of the transcription factor MIST1, an exocrine secretory tissue specific functional maturation factor. Experiments will elucidate novel direct transcriptional targets and assay their function in secretory cell maturation. In Chapter 3, I will elucidate the novel lysosomal localization and function of RAB26, one of the novel direct

MIST1 targets. From these experiments, I will return to an in vivo gastric system in Chapter 4 to apply these novel findings of lysosome vesicle organization to MIST1 function and zymogenic cell development. Finally, in Chapter 5, I will interpret these results and give my suggestions to future experimental considerations. This will be highlighted by novel findings that suggest

MIST1, RAB26, and lysosomal dysfunction may play important complementary roles during the pathologic transition and dedifferentiation steps that occur during gastric carcinogenesis.

Secretory Vesicle and Lysosome Trafficking

The subject of vesicle trafficking involves answering the simple question of how cells develop compartmentalization as a response to ever increasing complex physiological functions.

Specifically, I will focus on two common pathways that all cells share; which, at first glance, appear to be antitheses of each other. Lysosomes are responsible for the undertaking of cellular degradation, and secretory vesicles are charged with delivering and releasing the major synthetic products. But both vesicular compartments begin life at the endoplasmic reticulum (ER)

(Cooper, 2000). From this organelle, the unsorted proteins that have been properly folded and glycosylated progress via COPII coated vesicles to the Golgi apparatus where they begin the process of vesicular differentiation (Benham, 2012).

Secretion can occurs through a baseline constitutive pathway and an enhanced regulated version. In fact, giving a regulated secretory load to a cell with only constitutive pathway capabilities will induce neither accumulation of vesicles filled with that cargo nor secretion of those proteins; indicating that regulated secretory components are uniquely expressed and regulated (Molinete et al., 2000). In cells using both routes, the two pathways must be sorted and maintained separately because they simultaneously shuttle different secretory contents

(Burgess and Kelly, 1987). It is thought that this division of secretory contents occurs at the trans-Golgi, where regulated secretory proteins are processed through protein aggregation, lipid raft formation, and organized budding (Tooze et al., 2001). From the Golgi, these immature secretory granules are processed by prohormone convertases as they mature (Taylor et al., 2003).

In addition to sorting-for-entry into maturing secretory vesicles, a sorting-for-retention process

(Arvan and Castle, 1998) also must occur for secretory granule maturation. Active events ensure proper vesicular identity by removal of constitutive secretory and lysosomal proteins and vesicle

membrane constituents through clathrin-coated vesicles (Brodsky et al., 2001). SNARE

mediated vesicle fusion events form and enlarge the maturing secretory vesicles (Waters and

Hughson, 2000). Once mature, secretory vesicles are maintained as reserve and ready-to-release

pools that tether, dock, fuse, and release their contents upon secretagogue signaling in a complex

process that is ATP-dependent and involves actin remodeling and calcium signaling (Burgoyne

and Morgan, 2003).

The constitutive secretory pathway of trafficking from the trans-Golgi to the plasma

membrane may actually involve a combination of several pathways (Ponnambalam and Baldwin,

2003) that are all distinct from one another and from the regulated secretory vesicle route (Tooze and Huttner, 1990). Thus, there may be direct sorting events at the Golgi or subsequent separation of constitutive secretory components from forming regulated secretory vesicles

(Arvan and Castle, 1998). These continuously secreted vesicles may enter an endosomal intermediate compartment or directly progress to the cell surface (Arvan and Castle, 1998).

The itinerary for lysosomes also begins at the ER with subsequent Golgi processing and sorting. In formation, lysosomes require membrane proteins and acid hydrolases. The best understood pathway involves sorting of acid hydrolases by the Mannose-6-Phosphate Receptor

(M6PR) (Kornfeld and Mellman, 1989). These hydrolases are bound by M6PR at the trans-

Golgi and mediate adapter protein and subsequent clathrin coat protein binding and budding

(Ghosh et al., 2003). As these mature and acidify, M6PR releases its cargo and is recycled back to the Golgi by interaction with the TIP47 protein (Diaz and Pfeffer, 1998). These late endosomes continue to mature and fuse with other similar endosomal vesicles to eventually become functional lysosomes. Lysosomal membrane protein trafficking is less well understood.

They are surmised to reach mature lysosomes either by an indirect plasma membrane recycling

endocytic route or the more direct route taken by acid hydrolases through recognition of their

sorting motifs (Saftig and Klumperman, 2009). Once formed, lysosomes are able to fuse with

other trafficked membrane compartments including endosomes, vacuoles, and autophagosomes

to regulate subcellular degradation (Luzio et al., 2000).

The diverse destination of lysosomes and the secretory pathway in light of the intimacy of their formation highlights the important task of ordered and organized vesicle trafficking.

However, to confuse matters somewhat, a combined secretory lysosome organelle also exists in some cells. These hybrid vesicles share features of both lysosomes and regulated secretory vesicles, and have unique properties that enable cell specific physiologic function (Marks et al.,

2013). They are expressed only in a particular subset of cells (Blott and Griffiths, 2002), highlighting the ability of cells to adapt their subcellular structure and components for specialized function. This concept of differential organization of subcellular compartments to suit differing cell physiological needs is a key theme of this dissertation and will be revisited

many times.

Rab Proteins as Membrane Organizers

The Rab small protein GTPases are important intracellular regulators of vesicle

positioning and trafficking. Of the more than 70 members identified (Schwartz et al., 2007),

they all define and organize specific subcellular membrane domains. By guanine nucleotide

cycling and binding membrane specific effector proteins, these small GTPases function as

mechanical switches that mediate vesicle trafficking events (Grosshans et al., 2006). They

become associated with cell membranes by enzymatic attachment of hydrophobic geranylgeranyl

groups to carboxy-terminal cysteine residues (Seabra et al., 1992). The sequence of bound GTP

and GDP is facilitated and determined by membrane specific guanine nucleotide exchange

factors (GEFs) and GTPase-activating proteins (GAPs) (Stenmark, 2009). In its GTP bound form, Rab proteins are considered “active”; they can bind many unique effectors to coordinate membrane trafficking and transport (Zerial and McBride, 2001). Upon performing its cell biological task, Rabs hydrolyze to GTP to GDP and bind to GDP-dissociation inhibitor (GDI), which initiates retrieval back to the membrane of origin (Stenmark, 2009). Specifically, we will focus on the ones important in the secretory and lysosomal membrane trafficking pathways (Fig.

1).

Both routes begin in all cells with vesicle progression from the ER through the Golgi; many ubiquitously expressed Rab proteins mediate this traffic. Among the most extensively studied is RAB6, which has been found to regulate intra-Golgi and retrograde ER trafficking

(Martinez et al., 1994; White et al., 1999). RAB33B complements the function of RAB6 in all cells by co-coordinating Golgi homeostasis and ER trafficking (Starr et al., 2010). Anterograde trafficking from ER to Golgi and through the Golgi cisternae is facilitated by RAB1 and RAB2

(Plutner et al., 1991; Tisdale and Balch, 1996). Additional ER and Golgi characterized Rabs include RAB43 and RAB18 (Liu and Storrie, 2012). The number of Rab proteins that all cells must dedicate to this initial pathway clearly indicates the complexity and importance of early protein sorting and processing.

The best characterized secretory Rabs are the RAB3 and RAB27 families, both playing important roles in regulated secretion (Fukuda, 2008). As discussed, this pathway is found only in certain cells; thus, RAB3 and RAB27 expression is limited. RAB27 functions in the transport and docking of mature vesicles (Fukuda, 2013) in highly secretory cells including cytotoxic T lymphocytes (Menasche et al., 2000), melanocytes (Hume et al., 2001), and exocrine secretory

cells (Gomi et al., 2007). RAB3 has four isoforms: RAB3A, B, C, and D; the first three isoforms

are predominantly neuronal involved in neurotransmitter and neuroendocrine hormone release

(Johannes et al., 1994; Schluter et al., 2004; Weber et al., 1994), while RAB3D is expressed in a

variety of extraneuronal cells including exocrine secretory cells (Millar et al., 2002; Ohnishi et

al., 1996). Functionally, RAB3 isoforms all share a similar role in mature secretory vesicle

docking (Fukuda 2008). Constitutive secretion has been found to be coordinated by the widely

expressed RAB8 (Chen et al., 1993). In particular, RAB8 facilitates basolateral transport from

the trans-Golgi to the plasma membrane (Huber et al., 1993)

The endolysosomal trafficking pathway is found in all cells, and contains likewise more ubiquitously expressed Rab proteins (Gurkan et al., 2005). RAB4, 5, and 11 localize to the endocytic pathway where RAB5 controls early endosome fusion, and RAB4 and RAB11 mediate endosomal recycling events back to the cell surface (Mohrmann and van der Sluijs, 1999).

Maturation of early to late endosome has been found to be mediated by a RAB5-RAB7

conversion (Rink et al., 2005). RAB7 further coordinates delivery to lysosomes, while RAB9

traffics M6PR in a retrograde fashion back to the Golgi (Stenmark, 2009)

Rab protein constitution reflects the diverse physiological functions of that cell (Zerial

and McBride, 2001). Differential expression and control of Rab proteins may represent a yet

unappreciated method for cells to adapt and change subcellular vesicle compartments to suite

developing physiological needs.

Developmental Regulation of Vesicle Compartments

It has long been recognized that upon maturation, secretory cells change

morphologically, characterized by increase stores of secretory vesicles (Boquist, 1970; Caro and

Palade, 1964). However, the direct relationship between developmental signals and cellular architecture has only recently been appreciated, and with the advent of modern molecular techniques we have begun to unmask the developmental regulators that govern these changes in subcellular organelles (Mills and Taghert, 2012). For example, as lymphocytic B cells differentiate into antibody secreting plasma cells, expression of XBP1, a b-ZIP transcription factor is increased and maintained at high levels. Induced XBP1 expression directly “scales-up”

ER components to accommodate secretory capacity (Shaffer et al., 2004). In fact, this developmentally regulated transcription factor is a feature of many diverse mature secretory cells

(Acosta-Alvear et al., 2007) including exocrine secretory cells (Huh et al., 2010; Lee et al.,

2005). Remarkably, its function in these different tissues remains conserved in expanding ER to adjust to increasing secretory demands. XBP1 mediated ER expansion is accompanied by Golgi expansion during secretory cell differentiation (Clermont et al., 1993; Kirk et al., 2010). In fact, the same transcriptional signals may be involved in amplifying both compartments (Travers et al., 2000).

Concomitant with enlarging the ER and Golgi, XBP1 also functions to enhance secretory vesicles by direct induction of the transcription factor, MIST1 (Acosta-Alvear et al., 2007; Huh et al., 2010). This bHLH transcription factor is again highly expressed in mature secretory cells

(Johnson et al., 2004; Lemercier et al., 1997; Pin et al., 2001), but it functions to control direct components of secretory vesicle maturation (Capoccia et al., 2013; Garside et al., 2010;

Rukstalis et al., 2003; Tian et al., 2010). Analogously, in Drosophila, the expression of the bHLH transcription factor and MIST1 ortholog, DIMM are developmentally restricted to mature neurosecretory neurons and endocrine cells (Hewes et al., 2003; Park and Taghert, 2009). DIMM also controls a subset of direct effectors important for secretion (Park et al., 2011; Park et al.,

2008). Other secretory vesicle developmental transcription factor effectors include: REST control of neurosecretion (D'Alessandro et al., 2008), FOXQ1 mediated mucus granule formation in the stomach (Verzi et al., 2008), and FOXA2 regulation of β cell insulin secretion

(Gao et al., 2007). In sum, these transcriptional control networks function in developing cells to enhance secretion logically and stepwise through the major organelles of the secretory pathway.

Lysosomes and degradative function have similarly been shown to be induced during development/differentiation. In epidermis development, keratinocytes terminally differentiate into keratinized corneocytes (Sotiropoulou and Blanpain, 2012); a process which involves a dramatic cell architectural change. Critical for this process is the upregulation of lysosomes, in particular the need for cathepsin D mediated terminal differentiation (Egberts et al., 2004). The autophagy pathway, a lysosome degradative and recycling process for organelles and intracellular proteins, is activated upon and required for differentiation in many cells including erythrocytes, adipocytes, and certain hematopoietic cell lineages to mediate subcellular reorganization (Mizushima and Levine, 2010). Maintained lysosome function is crucial for the sustained health of long lived terminally differentiated cells (Nixon, 2013).

Analogous to secretory vesicles, many transcriptional controllers of lysosomes have also been recently revealed. The best characterized of these is the bHLH transcription factor, TFEB

(Sardiello et al., 2009). Through direct activation of a gene network, TFEB has also been found to be a master enhancer of lysosome function and autophagy (Settembre et al., 2011), and linked to important developmental growth signals (Settembre et al., 2012). Conversely, the zinc finger family transcription factor, ZKSCAN3, has been show to repress lysosomes and associated degradative and autophagocytic function (Chauhan et al., 2013). In addition, at least one factor critical for early tissue development/specification have also been found to have dual roles as

factors that scale lysosomal activity in terminal differentiation of cells. CDX2, a homeobox

transcription factor required for intestinal specification, has been found to activate an endosome-

lysosome trafficking gene network in enterocytes (Gao and Kaestner, 2010). Interestingly, the

importance of developmental regulation of cell function is even seen in hybrid secretory

lysosomes. Melanocyte differentiation is dependent on the bHLH transcription factor, MITF

(Bertolotto et al., 1998), and upon expression in these cells, it activates secretory lysosome

components and granule trafficking effectors (Chiaverini et al., 2008; Levy et al., 2006).

Clearly, the dramatic morphologic changes that occur rapidly and are maintained for the

lifetime of differentiated cells depend on transcriptional regulation. In essence, these

transcription factors and the network of genes they control, allow the cell to quickly and

efficiently adjust physiological function. In disease states in which physiological function is

decreased, manipulation of these factors may represent novel therapeutic targets (Decressac et

al., 2013; Settembre et al., 2013).

Summary

The belief of all cells having the same unregulated baseline functions is changing into the

realization that cells have precisely controlled, highly adaptable, and fully integrated networks

that can be scaled up and down along different cell lineages and over time in the adult in

response to changing environmental conditions. Elucidating the control points and the

components of these networks will further advance our knowledge of how cells change upon

physiological and pathological cues. In summary, this dissertation is founded on the following cell biological tenets (Fig. 2):

1. Vesicular compartments of cells are complex, dynamic, and reflect the specific function

of the cell.

2. As function changes during cellular differentiation or changing environmental conditions,

so must these vesicular compartments.

3. Developmental transcription factors have direct control over a network of subcellular

components and are responsible, in part, for regulating vesicular compartments.

References

Acosta-Alvear, D., Zhou, Y., Blais, A., Tsikitis, M., Lents, N. H., Arias, C., Lennon, C. J., Kluger, Y. and Dynlacht, B. D. (2007). XBP1 controls diverse cell type- and condition-specific transcriptional regulatory networks. Mol Cell 27, 53-66. Arvan, P. and Castle, D. (1998). Sorting and storage during secretory granule biogenesis: looking backward and looking forward. Biochem J 332 ( Pt 3), 593-610. Benham, A. M. (2012). Protein secretion and the endoplasmic reticulum. Cold Spring Harb Perspect Biol 4, a012872. Bertolotto, C., Abbe, P., Hemesath, T. J., Bille, K., Fisher, D. E., Ortonne, J. P. and Ballotti, R. (1998). Microphthalmia gene product as a signal transducer in cAMP-induced differentiation of melanocytes. J Cell Biol 142, 827-35. Blott, E. J. and Griffiths, G. M. (2002). Secretory lysosomes. Nat Rev Mol Cell Biol 3, 122-31. Boquist, L. (1970). Cilia and vesicular particles in the endocrine pancreas of the Mongolian gerbil. J Cell Biol 45, 532-41. Brodsky, F. M., Chen, C. Y., Knuehl, C., Towler, M. C. and Wakeham, D. E. (2001). Biological basket weaving: formation and function of clathrin-coated vesicles. Annu Rev Cell Dev Biol 17, 517-68. Burgess, T. L. and Kelly, R. B. (1987). Constitutive and regulated secretion of proteins. Annu Rev Cell Biol 3, 243-93. Burgoyne, R. D. and Morgan, A. (2003). Secretory granule exocytosis. Physiol Rev 83, 581- 632. Capoccia, B. J., Jin, R. U., Kong, Y. Y., Peek, R. M., Jr., Fassan, M., Rugge, M. and Mills, J. C. (2013). The ubiquitin ligase Mindbomb 1 coordinates gastrointestinal secretory cell maturation. J Clin Invest 123, 1475-91. Caro, L. G. and Palade, G. E. (1964). Protein Synthesis, Storage, and Discharge in the Pancreatic Exocrine Cell. An Autoradiographic Study. J Cell Biol 20, 473-95. Chauhan, S., Goodwin, J. G., Chauhan, S., Manyam, G., Wang, J., Kamat, A. M. and Boyd, D. D. (2013). ZKSCAN3 is a master transcriptional repressor of autophagy. Mol Cell 50, 16-28. Chen, Y. T., Holcomb, C. and Moore, H. P. (1993). Expression and localization of two low molecular weight GTP-binding proteins, Rab8 and Rab10, by epitope tag. Proc Natl Acad Sci U S A 90, 6508-12. Chiaverini, C., Beuret, L., Flori, E., Busca, R., Abbe, P., Bille, K., Bahadoran, P., Ortonne, J. P., Bertolotto, C. and Ballotti, R. (2008). Microphthalmia-associated transcription factor regulates RAB27A gene expression and controls melanosome transport. J Biol Chem 283, 12635-42. Clermont, Y., Xia, L., Rambourg, A., Turner, J. D. and Hermo, L. (1993). Structure of the Golgi apparatus in stimulated and nonstimulated acinar cells of mammary glands of the rat. Anat Rec 237, 308-17. Cooper, G. M. (2000). The Endoplasmic Reticulum. In The Cell: A Molecular Approach. 2nd edition. , (ed. S. (MA)): Sinauer Associates. D'Alessandro, R., Klajn, A., Stucchi, L., Podini, P., Malosio, M. L. and Meldolesi, J. (2008). Expression of the neurosecretory process in PC12 cells is governed by REST. J Neurochem 105, 1369-83.

Decressac, M., Mattsson, B., Weikop, P., Lundblad, M., Jakobsson, J. and Bjorklund, A. (2013). TFEB-mediated autophagy rescues midbrain dopamine neurons from alpha-synuclein toxicity. Proc Natl Acad Sci U S A 110, E1817-26. Diaz, E. and Pfeffer, S. R. (1998). TIP47: a cargo selection device for mannose 6-phosphate receptor trafficking. Cell 93, 433-43. Egberts, F., Heinrich, M., Jensen, J. M., Winoto-Morbach, S., Pfeiffer, S., Wickel, M., Schunck, M., Steude, J., Saftig, P., Proksch, E. et al. (2004). Cathepsin D is involved in the regulation of transglutaminase 1 and epidermal differentiation. J Cell Sci 117, 2295-307. Fukuda, M. (2008). Regulation of secretory vesicle traffic by Rab small GTPases. Cell Mol Life Sci 65, 2801-13. Fukuda, M. (2013). Rab27 Effectors, Pleiotropic Regulators in Secretory Pathways. Traffic. Gao, N. and Kaestner, K. H. (2010). Cdx2 regulates endo-lysosomal function and epithelial cell polarity. Genes Dev 24, 1295-305. Gao, N., White, P., Doliba, N., Golson, M. L., Matschinsky, F. M. and Kaestner, K. H. (2007). Foxa2 controls vesicle docking and insulin secretion in mature Beta cells. Cell Metab 6, 267-79. Garside, V. C., Kowalik, A. S., Johnson, C. L., DiRenzo, D., Konieczny, S. F. and Pin, C. L. (2010). MIST1 regulates the pancreatic acinar cell expression of Atp2c2, the gene encoding secretory pathway calcium ATPase 2. Exp Cell Res 316, 2859-70. Ghosh, P., Dahms, N. M. and Kornfeld, S. (2003). Mannose 6-phosphate receptors: new twists in the tale. Nat Rev Mol Cell Biol 4, 202-12. Gomi, H., Mori, K., Itohara, S. and Izumi, T. (2007). Rab27b is expressed in a wide range of exocytic cells and involved in the delivery of secretory granules near the plasma membrane. Mol Biol Cell 18, 4377-86. Grosshans, B. L., Ortiz, D. and Novick, P. (2006). Rabs and their effectors: achieving specificity in membrane traffic. Proc Natl Acad Sci U S A 103, 11821-7. Gurkan, C., Lapp, H., Alory, C., Su, A. I., Hogenesch, J. B. and Balch, W. E. (2005). Large- scale profiling of Rab GTPase trafficking networks: the membrome. Mol Biol Cell 16, 3847-64. Hewes, R. S., Park, D., Gauthier, S. A., Schaefer, A. M. and Taghert, P. H. (2003). The bHLH protein Dimmed controls neuroendocrine cell differentiation in Drosophila. Development 130, 1771-81. Huber, L. A., Pimplikar, S., Parton, R. G., Virta, H., Zerial, M. and Simons, K. (1993). Rab8, a small GTPase involved in vesicular traffic between the TGN and the basolateral plasma membrane. J Cell Biol 123, 35-45. Huh, W. J., Esen, E., Geahlen, J. H., Bredemeyer, A. J., Lee, A. H., Shi, G., Konieczny, S. F., Glimcher, L. H. and Mills, J. C. (2010). XBP1 controls maturation of gastric zymogenic cells by induction of MIST1 and expansion of the rough endoplasmic reticulum. Gastroenterology 139, 2038-49. Hume, A. N., Collinson, L. M., Rapak, A., Gomes, A. Q., Hopkins, C. R. and Seabra, M. C. (2001). Rab27a regulates the peripheral distribution of melanosomes in melanocytes. J Cell Biol 152, 795-808. Johannes, L., Lledo, P. M., Roa, M., Vincent, J. D., Henry, J. P. and Darchen, F. (1994). The GTPase Rab3a negatively controls calcium-dependent exocytosis in neuroendocrine cells. EMBO J 13, 2029-37.

Johnson, C. L., Kowalik, A. S., Rajakumar, N. and Pin, C. L. (2004). Mist1 is necessary for the establishment of granule organization in serous exocrine cells of the gastrointestinal tract. Mech Dev 121, 261-72. Kirk, S. J., Cliff, J. M., Thomas, J. A. and Ward, T. H. (2010). Biogenesis of secretory organelles during B cell differentiation. J Leukoc Biol 87, 245-55. Kornfeld, S. and Mellman, I. (1989). The biogenesis of lysosomes. Annu Rev Cell Biol 5, 483- 525. Lee, A. H., Chu, G. C., Iwakoshi, N. N. and Glimcher, L. H. (2005). XBP-1 is required for biogenesis of cellular secretory machinery of exocrine glands. EMBO J 24, 4368-80. Lemercier, C., To, R. Q., Swanson, B. J., Lyons, G. E. and Konieczny, S. F. (1997). Mist1: a novel basic helix-loop-helix transcription factor exhibits a developmentally regulated expression pattern. Dev Biol 182, 101-13. Levy, C., Khaled, M. and Fisher, D. E. (2006). MITF: master regulator of melanocyte development and melanoma oncogene. Trends Mol Med 12, 406-14. Liu, S. and Storrie, B. (2012). Are Rab proteins the link between Golgi organization and membrane trafficking? Cell Mol Life Sci 69, 4093-106. Luzio, J. P., Rous, B. A., Bright, N. A., Pryor, P. R., Mullock, B. M. and Piper, R. C. (2000). Lysosome-endosome fusion and lysosome biogenesis. J Cell Sci 113 ( Pt 9), 1515-24. Marks, M. S., Heijnen, H. F. and Raposo, G. (2013). Lysosome-related organelles: unusual compartments become mainstream. Curr Opin Cell Biol 25, 495-505. Martinez, O., Schmidt, A., Salamero, J., Hoflack, B., Roa, M. and Goud, B. (1994). The small GTP-binding protein rab6 functions in intra-Golgi transport. J Cell Biol 127, 1575-88. Menasche, G., Pastural, E., Feldmann, J., Certain, S., Ersoy, F., Dupuis, S., Wulffraat, N., Bianchi, D., Fischer, A., Le Deist, F. et al. (2000). Mutations in RAB27A cause Griscelli syndrome associated with haemophagocytic syndrome. Nat Genet 25, 173-6. Millar, A. L., Pavios, N. J., Xu, J. and Zheng, M. H. (2002). Rab3D: a regulator of exocytosis in non-neuronal cells. Histol Histopathol 17, 929-36. Mills, J. C. and Taghert, P. H. (2012). Scaling factors: transcription factors regulating subcellular domains. Bioessays 34, 10-6. Mizushima, N. and Levine, B. (2010). Autophagy in mammalian development and differentiation. Nat Cell Biol 12, 823-30. Mohrmann, K. and van der Sluijs, P. (1999). Regulation of membrane transport through the endocytic pathway by rabGTPases. Mol Membr Biol 16, 81-7. Molinete, M., Irminger, J. C., Tooze, S. A. and Halban, P. A. (2000). Trafficking/sorting and granule biogenesis in the beta-cell. Semin Cell Dev Biol 11, 243-51. Nixon, R. A. (2013). The role of autophagy in neurodegenerative disease. Nat Med 19, 983-97. Ohnishi, H., Ernst, S. A., Wys, N., McNiven, M. and Williams, J. A. (1996). Rab3D localizes to zymogen granules in rat pancreatic acini and other exocrine glands. Am J Physiol 271, G531- 8. Park, D., Hadzic, T., Yin, P., Rusch, J., Abruzzi, K., Rosbash, M., Skeath, J. B., Panda, S., Sweedler, J. V. and Taghert, P. H. (2011). Molecular organization of Drosophila neuroendocrine cells by Dimmed. Curr Biol 21, 1515-24. Park, D., Shafer, O. T., Shepherd, S. P., Suh, H., Trigg, J. S. and Taghert, P. H. (2008). The Drosophila basic helix-loop-helix protein DIMMED directly activates PHM, a gene encoding a neuropeptide-amidating enzyme. Mol Cell Biol 28, 410-21.

Park, D. and Taghert, P. H. (2009). Peptidergic neurosecretory cells in insects: organization and control by the bHLH protein DIMMED. Gen Comp Endocrinol 162, 2-7. Pin, C. L., Rukstalis, J. M., Johnson, C. and Konieczny, S. F. (2001). The bHLH transcription factor Mist1 is required to maintain exocrine pancreas cell organization and acinar cell identity. J Cell Biol 155, 519-30. Plutner, H., Cox, A. D., Pind, S., Khosravi-Far, R., Bourne, J. R., Schwaninger, R., Der, C. J. and Balch, W. E. (1991). Rab1b regulates vesicular transport between the endoplasmic reticulum and successive Golgi compartments. J Cell Biol 115, 31-43. Ponnambalam, S. and Baldwin, S. A. (2003). Constitutive protein secretion from the trans- Golgi network to the plasma membrane. Mol Membr Biol 20, 129-39. Rink, J., Ghigo, E., Kalaidzidis, Y. and Zerial, M. (2005). Rab conversion as a mechanism of progression from early to late endosomes. Cell 122, 735-49. Rukstalis, J. M., Kowalik, A., Zhu, L., Lidington, D., Pin, C. L. and Konieczny, S. F. (2003). Exocrine specific expression of Connexin32 is dependent on the basic helix-loop-helix transcription factor Mist1. J Cell Sci 116, 3315-25. Saftig, P. and Klumperman, J. (2009). Lysosome biogenesis and lysosomal membrane proteins: trafficking meets function. Nat Rev Mol Cell Biol 10, 623-35. Sardiello, M., Palmieri, M., di Ronza, A., Medina, D. L., Valenza, M., Gennarino, V. A., Di Malta, C., Donaudy, F., Embrione, V., Polishchuk, R. S. et al. (2009). A gene network regulating lysosomal biogenesis and function. Science 325, 473-7. Schluter, O. M., Schmitz, F., Jahn, R., Rosenmund, C. and Sudhof, T. C. (2004). A complete genetic analysis of neuronal Rab3 function. J Neurosci 24, 6629-37. Schwartz, S. L., Cao, C., Pylypenko, O., Rak, A. and Wandinger-Ness, A. (2007). Rab GTPases at a glance. J Cell Sci 120, 3905-10. Seabra, M. C., Goldstein, J. L., Sudhof, T. C. and Brown, M. S. (1992). Rab geranylgeranyl transferase. A multisubunit enzyme that prenylates GTP-binding proteins terminating in Cys-X- Cys or Cys-Cys. J Biol Chem 267, 14497-503. Settembre, C., Di Malta, C., Polito, V. A., Garcia Arencibia, M., Vetrini, F., Erdin, S., Erdin, S. U., Huynh, T., Medina, D., Colella, P. et al. (2011). TFEB links autophagy to lysosomal biogenesis. Science 332, 1429-33. Settembre, C., Fraldi, A., Medina, D. L. and Ballabio, A. (2013). Signals from the lysosome: a control centre for cellular clearance and energy metabolism. Nat Rev Mol Cell Biol 14, 283-96. Settembre, C., Zoncu, R., Medina, D. L., Vetrini, F., Erdin, S., Erdin, S., Huynh, T., Ferron, M., Karsenty, G., Vellard, M. C. et al. (2012). A lysosome-to-nucleus signalling mechanism senses and regulates the lysosome via mTOR and TFEB. EMBO J 31, 1095-108. Shaffer, A. L., Shapiro-Shelef, M., Iwakoshi, N. N., Lee, A. H., Qian, S. B., Zhao, H., Yu, X., Yang, L., Tan, B. K., Rosenwald, A. et al. (2004). XBP1, downstream of Blimp-1, expands the secretory apparatus and other organelles, and increases protein synthesis in plasma cell differentiation. Immunity 21, 81-93. Sotiropoulou, P. A. and Blanpain, C. (2012). Development and homeostasis of the skin epidermis. Cold Spring Harb Perspect Biol 4, a008383. Starr, T., Sun, Y., Wilkins, N. and Storrie, B. (2010). Rab33b and Rab6 are functionally overlapping regulators of Golgi homeostasis and trafficking. Traffic 11, 626-36. Stenmark, H. (2009). Rab GTPases as coordinators of vesicle traffic. Nat Rev Mol Cell Biol 10, 513-25.

Taylor, N. A., Van De Ven, W. J. and Creemers, J. W. (2003). Curbing activation: proprotein convertases in homeostasis and pathology. FASEB J 17, 1215-27. Tian, X., Jin, R. U., Bredemeyer, A. J., Oates, E. J., Blazewska, K. M., McKenna, C. E. and Mills, J. C. (2010). RAB26 and RAB3D are direct transcriptional targets of MIST1 that regulate exocrine granule maturation. Mol Cell Biol 30, 1269-84. Tisdale, E. J. and Balch, W. E. (1996). Rab2 is essential for the maturation of pre-Golgi intermediates. J Biol Chem 271, 29372-9. Tooze, S. A. and Huttner, W. B. (1990). Cell-free protein sorting to the regulated and constitutive secretory pathways. Cell 60, 837-47. Tooze, S. A., Martens, G. J. and Huttner, W. B. (2001). Secretory granule biogenesis: rafting to the SNARE. Trends Cell Biol 11, 116-22. Travers, K. J., Patil, C. K., Wodicka, L., Lockhart, D. J., Weissman, J. S. and Walter, P. (2000). Functional and genomic analyses reveal an essential coordination between the unfolded protein response and ER-associated degradation. Cell 101, 249-58. Verzi, M. P., Khan, A. H., Ito, S. and Shivdasani, R. A. (2008). Transcription factor foxq1 controls mucin gene expression and granule content in mouse stomach surface mucous cells. Gastroenterology 135, 591-600. Waters, M. G. and Hughson, F. M. (2000). Membrane tethering and fusion in the secretory and endocytic pathways. Traffic 1, 588-97. Weber, E., Berta, G., Tousson, A., St John, P., Green, M. W., Gopalokrishnan, U., Jilling, T., Sorscher, E. J., Elton, T. S., Abrahamson, D. R. et al. (1994). Expression and polarized targeting of a rab3 isoform in epithelial cells. J Cell Biol 125, 583-94. White, J., Johannes, L., Mallard, F., Girod, A., Grill, S., Reinsch, S., Keller, P., Tzschaschel, B., Echard, A., Goud, B. et al. (1999). Rab6 coordinates a novel Golgi to ER retrograde transport pathway in live cells. J Cell Biol 147, 743-60. Zerial, M. and McBride, H. (2001). Rab proteins as membrane organizers. Nat Rev Mol Cell Biol 2, 107-17.

Figure Legends

Figure 1. Rab proteins coordinate trafficking of secretory vesicles and lysosomes.

Important Rab proteins are highlighted with arrows indicating their canonical routes of effector

mediated trafficking. Pertinent organelle and vesicular compartments are shown: the

endoplasmic reticulum in blue, the Golgi in orange, secretory vesicles in red, and the endolysosomal pathway in green.

Figure 2. Transcriptionally controlled network of subcellular effectors. Schematic depicting the differentiation of a cell through augmentation of particular organellar and vesicular structures to meet new physiological functional needs. Known developmentally regulated transcription factors are shown with the particular subcellular compartment that they control.

Black arrows signify gene network activation, and red arrows denote gene network repression.

CHAPTER 2: Congenital and Acquired Diseases of the Stomach

This chapter is adapted from the published work:

Jin R. U. and Mills J. C. (2014). Chapter 5: Congenital and Acquired Diseases of the Stomach. In Translational Gastroenterology, from Development to Disease, edited by Deborah L. Gumucio, Linda C. Samuelson, Jason R. Spence, 57-72.

Congenital and Acquired Diseases of the Stomach

Ramon U. Jin and Jason C. Mills

Division of Gastroenterology, Departments of Medicine , Developmental Biology, Pathology & Immunology, Washington University School of Medicine, St. Louis, MO 63110

Address correspondence to:

Jason C. Mills Department of Medicine Washington University School of Medicine, Box 8124 660 So. Euclid Ave. St. Louis, MO 63110 Phone: 314 362-4258 FAX: 314 362-7487 e-mail [email protected]

Introduction

The basic function of the stomach is to facilitate initial digestion of food contents arriving

from the esophagus and modulate their transport to the intestines. Interestingly, the basic tenets of stomach function have been known for more than 5,000 years, as traditional Chinese medicine

has always taught that the qi (energy) of the stomach needs to be in balance for proper downward

flow. In short, it has been believed that insufficient secretory function or “dryness” disturbs the

function of the stomach, in effect causing upward movement (“reflux”) and dyspepsia. In this

chapter, I will focus on the clinical disorders of the stomach, using lessons learned from modern

science to help elucidate the mechanisms and gaps in traditional wisdom.

Conceptually, I will approach this task by examining first the congenital or

developmental stomach disorders and then subsequently discuss the acquired or adult

pathologies. Throughout, I will examine the mechanisms behind the pathology and discuss

associated diagnostics and therapeutics. The focus of this chapter is to situate and justify our cell

biological study of the stomach. Accordingly, I will adopt a human-centric perspective

throughout.

I. Developmental/Congenital Clinical Disorders

A. Anatomic Development of the Stomach

The gross anatomic development of the stomach can be said to begin with the embryonic

folding of the endodermal germ layer into the gut tube. Functional and developmental

specification of this tube occurs next with formation of the foregut, midgut, and hindgut. During

the fourth week of embryonic growth, endodermal foregut gives rise to a bulge that will form the

primitive stomach. As the bulge grows, its dorsal region outpaces its ventral such that by the

sixth week of development, this asymmetric growth establishes the greater and lesser stomach

curvatures and, subsequently, a complex, two-step reorientation. The stomach initially rotates 90 degrees clockwise about its longitudinal axis. Then it turns about its anterior-posterior axis such that the pylorus and cardiac regions tip upwards and downwards, respectively. These spatial movements end around the 8th week of development with the greater curvature of the stomach facing the left side of the body, and the lesser curvature facing right (Fig. 1) (Carlson, 1999;

Sadler, 2012).

The histologic cell types that constitute the epithelium of the stomach arise around the time the stomach settles into its final position. Mucus secreting cells are the first to emerge, as the single cell epithelial lining invaginates from the surface of the gastric lumen towards the submucosal layers. These early invaginations are the gastric pits, lined by mucinous pit (aka foveolar cells). During the next couple of weeks, the other major cells of the gastric mucosa begin to develop with narrower gastric glands elongating downward from the pit region until birth (Angioi et al., 2001; Kataoka et al., 1984; Menard et al., 1993; Nomura et al., 1998). Once established, the glands and the differentiated cells that constitute them are continually renewed throughout adult life. Hence, I will discuss each specific lineage and associated diseases in the

Adult/Acquired disorders section. As for the early developmental disorders, I will show that many of them are due to gut tube formation defects or problems occurring during stomach rotation. In addition, because of the shared foregut embryonic origins of the stomach with the esophagus and the duodenum, many of the disorders are shared with those organs. Congenital clinical disorders are summarized in Table 1.

B. Disorders

1. Motility

Gastric ENS primer

Motility of the stomach is dictated by the enteric nervous system. This autonomic gut

“brain” is divided into the submucosal (Meissner’s) plexus and the myenteric

(Auerbach’s) plexus. Developmentally, the ENS forms via migration of vagal, truncal

and sacral enteric neural crest-derived cells (ENCCs) that colonize and innervate the

developing gut (Heanue and Pachnis, 2007). This ENS development is complete by 13

weeks of embryonic development (Gariepy, 2004). The proximal stomach and

esophagus is colonized by truncal ENCCs while the vagal ENCCs populate the rest of the

stomach and distal GI tract (Heanue and Pachnis, 2007).

a. Cardiac Achalasia

Primary achalasia is characterized by diminished esophageal peristalsis with impaired

LES relaxation and presents clinically as difficulty swallowing (Francis and Katzka, 2010). As

mentioned above, the ENS that populates the esophagus also innervates the proximal or cardiac

portion of the stomach. Accordingly, the cardiac region of the stomach has been shown to have

similar impaired relaxation in patients with esophageal achalasia (Mearin et al., 1995). Thus, the

disease causing mechanism will likely be shared between the esophagus and proximal stomach.

In fact, loss of nitric oxide producing ganglion cells (De Giorgio et al., 1999) and diminished

Interstitial Cells of Cajal (Vanderwinden and Rumessen, 1999) have both been found in the gastric cardia of patients with primary achalasia. Genetically, some insight has been gained from patients with mutations in the Triple A Syndrome (AAAS) gene. These patients present clinically

with a congenital autosomal recessive disorder characterized by the three A’s of achalasia along

with ACTH resistance and alacrima (Handschug et al., 2001; Tullio-Pelet et al., 2000).

b. Infantile Hypertrophic Pyloric Stenosis (IHPS)

IHPS is a common condition (2 per 1000 live births) that presents during the first weeks

of life as gastric outlet obstruction that causes projectile vomiting (Gariepy, 2004; Peeters et al.,

2012). Hypertrophy of the muscularis encircling the distal or pylorus region of the stomach prevents the stomach from emptying. The hypertrophy can be anatomical (i.e. actually increased muscle density) and/or functional (decreased ability of that muscle to relax normally). The underlying cause of this disease may be similar to that described for achalasia as ENS defects, nitric oxide deficiency, and loss of Interstitial Cells of Cajal have also been observed in IHPS patients (Guarino et al., 2000; Vanderwinden et al., 1992; Vanderwinden and Rumessen, 1999).

In rodent models in which the enzyme responsible for nitric oxide generation, one of the nitric oxide synthases (NOS), is disturbed either genetically (Huang et al., 1993) or pharmacologically

(Voelker et al., 1995) a similar anatomic defect is detected. Over-exuberant muscularis growth has also been suggested as a possible cause (Shima et al., 2000; Shima and Puri, 1999).

Extensive genetic linkage, association, and candidate gene approach studies have elucidated a complex network of genes and loci with associated syndromes and environmental factors

(Peeters et al., 2012). Briefly, the diagnosis of this condition is still made clinically through imaging modalities including barium studies and ultrasonography (Poon et al., 1996; Taylor et al., 2013) and the standard treatment for IHPS is still surgical pyloromyotomy (St Peter et al.,

2006) while other interventions have been tried including endoscopic balloon dilatation (Ogawa et al., 1996).

2. Gastric Atresia

Gastric atresia is a rare condition seen only in 1 out of 100,000 live births. Clinically, the symptoms are similar to those seen in other gastric outlet obstructions comprising postprandial vomiting and abdominal distension presenting in early infancy. Anatomically, this obstruction occurs in the distal stomach and is likely due to aberrant outpouchings of the stomach wall termed membranes or fibrous cords. It has been theorized that gastric atresias arise from aberrant endodermal fusion or fetal ischemic events (Berrocal et al., 1999; Semrin, 2010).

Understanding the molecular basis of this disease has benefited from the clinical association of pyloric atresias with epidermolysis bullosa (EB) (Hayashi et al., 1991; Pfendner et al., 2007).

Several genes have been linked to this autosomal recessive disorder including α6 integrin

(ITGA6) (Ruzzi et al., 1997), β6 integrin (ITGB6) (Niessen et al., 1996; Vidal et al., 1995), and plectin (PLEC1) (Nakamura et al., 2011; Pfendner and Uitto, 2005). These genes all encode components of the hemidesmosome, a cellular anchor that allows tight attachment of cells to the basement membrane. Generation of rodent models of this syndrome (Jiang and Uitto, 2005) should lead to continued understanding of the basic mechanisms of these adhesional complexes

(Sterk et al., 2000). Diagnosis of gastric atresias is typically made using imaging modalities including contrast radiography and ultrasonography, and treatment is still largely by excision

(Al-Salem, 2007; Ilce et al., 2003). Excitingly, chorionic villus biopsies or amniotic fluid samples are being used in novel genetic diagnostic techniques for the subset of gastric atresias that are associated with epidermolysis bullosa and genetically based on hemidesmosome defects

(Pfendner et al., 2003). In addition, these same patients might benefit from new gene, protein,

27 and cell based therapies aimed at restoring the structural defects being developed for EB (Tamai et al., 2009).

3. Gastric Volvulus

Gastric Mesentery Primer

During embryonic development, the tubular foregut is attached to the front and back of

the body wall by the ventral and dorsal mesogastria. As the stomach rotates and enlarges,

the ventral mesogastrium moves to the right connecting the lesser curvature and the

superior duodenum with the developing liver. The dorsal mesogastrium moves to the

left, enlarges to become the greater omentum, and encompasses the developing pancreas

and spleen (Carlson). These mesenteries mature to form the four major ligaments that

anchor the stomach intraperitoneally. The gastrophrenic, gastrosplenic, and gastrocolic

form from the dorsal mesogastrium or greater omentum, while the gastrichepatic

ligament develops from the ventral mesogastrium or lesser omentum (Gray, 2008).

Gastric volvulus is a rare medical emergency defined as an abnormal 180-degree twisting of the stomach that can ultimately result in vascular compromise and necrosis. When occurring in adults, this disorder is usually secondary to hernias of the stomach through the diaphragm

(Wasselle and Norman, 1993). In children, twisting occurs primarily due to laxity of the gastric mesentery ligaments (Cribbs et al., 2008). Specifically, the stomach may twist about its longitudinal axis (organoaxial), its short axis (mesenteroaxial), or a combination of the two

(Sevcik and Steiner, 1999). The clinical presentation of acute gastric volvulus in adults is often chest pain, unproductive vomiting, vomiting of blood, and inability to pass a nasogastric tube

(Miller et al., 1991), while in children symptoms may include vomiting, distension, and pain

(Cribbs et al., 2008). Diagnosis is made clinically based on symptoms and confirmed by barium

studies and CT scans (McElreath et al., 2008). Treatments remains surgical with the strategy to

decompress and reduce the volvulus, correct concomitant factors such as hernias and necrotic

tissue, and anchor the stomach to the anterior abdominal wall or perform an anastomotic bypass

of the twist (antral-fundal gastrogastrostomy) to prevent future movement (Rashid et al., 2010).

Gastronomy tubes are usually placed in children with volvulus to prevent future movement and

allow feeding (Cribbs et al., 2008).

4. Congenital Microgastria

Congenital microgastria is another extremely rare (only about 60 known cases) (Vasas et

al., 2011) developmental gastric condition characterized by failure of foregut growth during the

5th week of embryonic development (Ramos et al., 1996). These patients present with

obstruction-like symptoms including vomiting, reflux, and esophageal dilation (Kroes and

Festen, 1998). Retarded stomach growth also manifests as iron and vitamin B12 deficiencies due to decreased acid and intrinsic factor production. This condition is usually associated with

VACTERL (vertebral defects, anal atresia, cardiac defects, tracheo-esophageal abnormalities, renal anomalies, and limb malformations) and other developmental abnormalities including asplenia due to improper rotation and development of the dorsal mesogastrium (Aintablian,

1987; Filippi et al., 2008; Hernaiz Driever et al., 1997). The role of Sonic hedgehog (Shh) and in particular the Gli transcription factors with VACTERL syndrome (Kim et al., 2001) may shed light on the underlying molecular mechanisms associated with congenital microgastria.

Diagnosis is made using imaging modalities including contrast radiography and ultrasonography,

and treatment is individualized. Milder cases are treated with feeding strategies, while more

severe cases are treated with a double lumen distal Roux-en-Y jejunal reservoir (Hunt-Lawrence pouch) operation allowing for increased stomach volume (Neifeld et al., 1980; Velasco et al.,

1990).

5. Gastric Diverticulum

Gastric diverticulum disease consists of outpouchings of the stomach wall that typically present asymptomatically in adults with an incidence of about 0.04% (Rashid et al., 2012).

These diverticula are classified as either: a) true congenital, containing all gastric tissue layers

and usually located on the posterior wall of the cardia; or b) partial acquired, lacking the

muscularis and usually located in the antrum (Rodeberg et al., 2002). A congenital muscle

weakness, lack of a peritoneal membrane, and invading arterioles all may be contributing factors

in this condition (Mohan et al., 2010). Diagnosis is usually incidental upon radiological studies,

and surgical excision is only needed if the diverticulum is at risk to bleed, perforate (Rodeberg et

al., 2002), or become malignant (Fork et al., 1998).

6. Gastric Duplication Cysts

Duplication cysts are defined as heterotopic epithelium lined by muscle located in or near

the wall of the GI tract. Less than 10% of all GI duplication cysts consists of aberrant gastric

epithelium (Macpherson, 1993). When found in the stomach proper, they are located on the

greater curvature(Macpherson, 1993). Symptoms vary depending on the type of heterotopic

epithelium and location in the GI tract, with gastric cysts often presenting with symptoms of

peptic ulcer disease. Because of their rarity (an incidence of 17 per 1 million births (Bonacci and

Schlatter, 2008)), the research into this disorder is limited, and currently a handful of hypotheses

exist involving formation of invaginations during embryonic development that aberrantly persist

into duplication cysts (O'Donnell et al., 2005). Imaging modalities including CT scan and

transabdominal ultrasound are used for diagnosis, and surgical excision is usually the

recommended treatment (Semrin, 2010).

7. Teratomas

Teratomas are germ cell tumors defined as having all three germ cell layers: endoderm,

mesoderm, and ectoderm. These rare tumors are further classified into immature and mature

depending on differentiation status with immature teratomas more likely to become malignant

(Peterson et al., 2012). Gastric localization of teratomas is extremely rare with only about 100 documented cases, and when they do occur in the stomach, teratomas tend to be exophytic and

on the posterior greater curvature side (Corapcioglu et al., 2004). The causative mechanism of teratomas remains unknown (Oosterhuis and Looijenga, 2005); however, interesting work

implicates the origins of this germ cell tumor to primordial germ cells using genetic imprinting

(Bussey et al., 2001) and animal model techniques (Kimura et al., 2003). Occurring mostly in

males (Yoon et al., 2000), gastric teratomas may cause distension, vomiting, hematemesis, and

perforation depending on the growth pattern (Sharif et al., 2010). CT scan is the gold standard

for diagnosis (Singh M, 2012), and use of serum tumor markers (a-fetoprotein (AFP) and human

beta-choriogonadotropin (HCG)) is important in the diagnosis and follow-up (Gobel et al.,

2000). Treatment is usually surgical excision for the mature variety, while chemotherapy is used

in conjunction with surgery for immature teratomas (Romagnani et al., 2006). Understanding of

this rare tumor type will become increasingly important in the future as basic science findings

involving human embryonic stem cells and induced pluripotent stem cells are being translated

into the clinical realm (Blum and Benvenisty, 2009).

II. Adult/Acquired Clinical Disorders

A. Histological Development of the Stomach

The acquired clinical disorders of the stomach occur in the “adult” stomach. Because the

gastric epithelium is continuously renewed throughout life from multipotent stem cells, adults

can acquire developmental disease based on abnormal differentiation of progeny cell lineages

(Fenoglio-Preiser C.M., 1999). I have divided the adult clinical disorders discussion into lineage

specific categories and, in doing so, I am tasked with explaining in detail the cells of each

lineage. Karam, Lee, and Leblond did much of the seminal work describing the dynamics of

stomach epithelium differentiation in the mouse using electron microscopy and 3H-thymidine

pulse labeling. Despite small differences as will be described including lineage turnover times

(about twice that seen in mice (Fenoglio-Preiser C.M., 1999; Karam and Leblond, 1995; Karam

et al., 2003; Macdonald et al., 1964)), the mouse and human stomachs seem to share remarkable

similarities in development, physiology and cell biology.

Grossly, the human stomach is divided into four anatomic regions: the cardia, the fundus,

the body/corpus, and the antrum (Fig. 2A). The cardia is the short transition region of

predominantly mucous glands on the border with the esophagus closest to the gastroesophageal

junction, the fundus (the outpouching, hunchback portion of the stomach along the greater curvature) and body make up the major portion of the stomach, and the antrum (or pylorus) is the distal area leading to the pyloric sphincter. A key anatomic difference in mice is that they have

an enlarged proximal gastric region called the forestomach, which can be considered, in part, an

extension of the esophagus and is, similarly, lined by mature stratified squamous epithelium.

Each subanatomic region of the human stomach contains unique gastric invaginations or

glands comprised of distinct histological cell types. The cardiac glands comprise simple

columnar, mucus-secreting epithelial cells. Architecture in the antrum is similar, though, in

addition to mucus glands, there are abundant endocrine cells (specifically, gastrin secreting G

cells and somatostatin-secreting D cells). In the mouse, careful nucleotide pulse-chase labeling

studies have shown that antral glands are continuously renewed bi-directionally from the isthmal

region with pit or surface mucus gland cells turning over every 3 days, and basal gland cells

turning over with a more variable rate of 1-60 days (Fig. 2B) (Lee, 1985; Lee and Leblond,

1985a; Lee and Leblond, 1985b).

The glands of the fundus/body or oxyntic glands contain four distinct regions, from surface to base: the pit, isthmus, neck and base (Fig. 2C). Eleven separate cell types (Karam and

Leblond, 1995) have been found in the oxyntic glands but for our purposes I will characterize and examine these cell types in terms of their developmental lineages. In the isthmus resides the self-renewing stem cell, which, as in the antrum, bidirectionally differentiates and migrates

(Karam and Leblond, 1993a). Interestingly, in mice a clear “granule free” stem cell was identified by electron microscopy, but all isthmal cells in humans seem to have at least some granules (Karam et al., 2003). Those cells that migrate up from the stem cell towards the lumen of the stomach become the surface pit (foveolar) mucus secreting cells; turnover of this lineage is rapid occurring every 3 days in mice just as in the antrum (Karam and Leblond, 1993b). The

acid secreting parietal cells terminally differentiate and move in both directions, luminally and

basally; these cells survive for 54 days in mice (Karam, 1993). In humans, parietal cells seem

only to migrate towards the base, as they are not observed in the pit region (Karam et al., 2003).

Cells destined to become pepsinogen- secreting zymogenic cells (chief cells), mature from isthmal stem cells through a mucus neck cell intermediate as they migrate towards the base.

These neck cells take 1-2 weeks to migrate and terminally differentiate into chief cells (Ramsey et al., 2007); cells in this lineage turn over once every 190 days in mice (Karam and Leblond,

1993c). It is important to note that in mice, intrinsic factor is not typically produced in parietal cells as in humans but rather in chief cells (Shao et al., 2000). Finally, enteroendocrine cells

(predominantly histamine-producing enterochromaffin like, ECL cells) differentiate and mostly migrate towards the base with a lineage turnover rate of 60 days (Karam and Leblond, 1993d;

Thompson et al., 1990). It is in this complex setting of multiple simultaneous cell movement and maturation that acquired adult disorders occur. Adult/Acquired clinical disorders are summarized in Table 1

B. Disorders

1. Surface Pit Cells

These mucus secreting cells populate the most apical region of the gastric gland and undergo rapid turnover and renewal (estimated at 4-6 day half-life in human (Macdonald et al.,

1964)). Functionally, their mucus and bicarbonate secretory product protects the stomach epithelium from the damaging effects of luminal acid and digestive enzymes (Bhaskar et al.,

1992).

a. Foveolar Hyperplasia

Foveolar hyperplasia is defined histopathologically as an overgrowth of surface pit cells associated with underlying mucosal injury such as chronic gastritis. There are multiple disease states/underlying causes, so I will not discuss foveolar hyperplasia diagnostic and therapeutic interventions in isolation. However, newly gained mechanistic insights have shed light on how pit cell growth is hyperstimulated. Helicobacter colonization can induce IL-1β release from activated macrophages in areas of foveolar hyperplasia, which in turn stimulates neutrophils and mesenchymal cells to release the growth factor, HGF (Yasunaga et al., 1996). Mouse models in which HGF activator is genetically ablated do not display the reactive foveolar hyperplasia post gastric injury (Yamagata et al., 2012). TGFα has been implicated in foveolar hyperplasia in a mouse model (Goldenring et al., 1996) and TGFα/EGF signaling in humans with Ménétrier disease, which will be discussed later.

Foveolar hyperplasia occurs usually in the setting of atrophic gastritis (i.e., where there is chronic inflammation and atrophy of parietal cells, discussed in more detail below). Mouse models have shown that parietal cells express and need the morphogen Sonic hedgehog (Shh) for acid secretion (Stepan et al., 2005). Genetic ablation of Shh in mice caused decreased acid secretion, hypergastrinemia, foveolar hyperplasia, and a reduced ability for the stomach mucosa to heal (Xiao et al., 2013; Xiao et al., 2010). Loss of Shh has been associated with neoplastic progression in humans as well, thus making Shh signaling a valid clinical target post gastric injury (Shiotani et al., 2005). Importantly, gastrin secreted from antral G cells (to be discussed in detail in the enteroendocrine section) has been shown to have a similar causative role in foveolar hyperplasia (Nomura et al., 2005b; Wang et al., 1996)

b. Ménétrier Disease

Ménétrier disease is a chronic adult disease characterized by enlarged rugal folds due to surface mucus pit cell overgrowth. Symptoms include pain, vomiting, bloating, weight loss, and edema in large part due to hyper mucus secretion leading to hypoproteinemia (Fenoglio-Preiser

C.M., 1999; Rich et al., 2010). The definitive diagnostic procedure is gastroscopy and confirmatory biopsy (Lambrecht, 2011). Unlike foveolar hyperplasia, in which the foveolar overgrowth is secondary to epithelial damage response and a potentially complex set of associated signaling pathways, the causative process in Ménétrier disease has long been thought to be specifically increased TGF-α signaling in foveolar pit cells (Dempsey et al., 1992;

Goldenring et al., 1996). Activation of EGF receptors that bind EGF and TGFα as ligands in the setting of normal gastrin levels, redirects lineage specification towards the surface mucus cells at the expense of parietal and zymogenic cell lineages (Coffey and Tanksley, 2012; Nomura et al.,

2005a),. These observations have spurred exciting novel treatments of this disorder targeting this particular signaling cascade. The chemotherapeutic drug cetuximab (Erbitux), that blocks

TGF-α activation of its receptor, is now being developed as a promising first line treatment, shown to be effective clinically to increase parietal cell numbers and stomach acidity(Burdick et al., 2000; Fiske et al., 2009; Settle et al., 2005).

2. Enteroendocrine Cells

Enteroendocrine cells are located at the base of the gastric gland. Their function is primarily to control parietal cell acid secretion through release of gastrin, histamine and somatostatin. In response to distention, digested proteins, and postprandial cholinergic innervation, antral G cells release the peptide hormone gastrin (Schubert and Makhlouf, 1992).

Gastrin primarily mediates fundic ECL cell histamine release, although it may also directly

stimulate parietal cell acid release. Histamine from the ECL cells stimulates parietal cell H-2

receptors to activate cAMP signaling, the ultimate effect of which is to recruit H,K ATPase

transporters to membranes that ultimately communicate with the glandular lumen, thereby

initiating and augmenting H+ release (Schubert, 2009). The principal inhibitory hormone is somatostatin from the D cells, which directly inhibits G cell gastrin, ECL histamine, and parietal cell acid secretion (Schubert, 2009).

a. Hypergastrinemia

Hypergastrinemia is a condition caused either directly by gastrin-secreting tumors

(Zollinger-Ellison syndrome, discussed below) or, indirectly, by increased gastric pH secondary to atrophic gastritis (and other abnormal epithelial differentiation states like intestinal metaplasia and cancer), vagotomy, or pharmacological inhibition of gastric acid secretion.

Hypergastrinemia is characterized by serum gastrin levels above the normal range of 150 pg/mL.

(Orlando et al., 2007). When hypergastrinemia is secondary to increased gastric pH, clinical symptoms will vary depending on the primary cause. Importantly, symptoms may be masked when acid production is inhibited pharmacologically (usually through proton pump inhibitor therapy). In these patients, discontinuation of therapy can cause rebound dyspepsia and sudden

impairment of gastric emptying (McCarthy, 2010). Histologically, hypergastrinemic states present with increased epithelial hyperplasia of gastrin’s cellular targets: parietal cells and ECL cells. The underlying effects of increased gastrin levels have been extensively studied using genetic tools available in rodent models (Jain and Samuelson, 2006). In H,K ATPase deficient mice, increased cell proliferation caused by impaired parietal cell acid secretion was rescued

upon genetic ablation of gastrin (Franic et al., 2001). In mouse models overexpressing gastrin,

increased levels of heparin-binding epidermal-like growth factor (HB-EGF) and TGF-α (Sinclair et al., 2004; Wang et al., 2000) have been found in parietal and surface mucus cells. It is still unclear how gastrin acts to initiate proliferation; whether it is through induction of growth factors like EGF/TGFα or via more direct signaling to stem/progenitor cells (Kazumori et al., 2001).

Serum gastrin measurements, secretin test of gastrin release, and basal acid output are used diagnostically to differentiate gastrinomas (i.e. gastrin-producing tumors causing direct hypergastrinemia) from other, secondary hypergastrinemic states (Del Valle J, 2003a).

Therapies should be aimed at treating the underlying cause, usually the agent causing the gastritis (e.g., Helicobacter) or causing the acid inhibition in non-neoplasia-related hypergastrinemia.

b. Zollinger-Ellison Syndrome

Zollinger-Ellison syndrome is a rare disorder characterized by excessive gastrin secretion from a neuroendocrine tumor resulting in aberrant mucosal growth and hypersecretion of acid

(aka a gastrinoma). These neoplasias are usually located in a triangular area marked by the cystic and common bile ducts, the second and third parts of the duodenum, and the pancreas (Del

Valle J, 2003a). Patients with gastrinomas usually present with peptic ulcer disease and diarrhea.

The growth promoting effects of gastrin coupled with the difficulty in recognizing this disease

(Corleto et al., 2001), make early diagnosis an important factor in preventing malignant progression and improving outcomes (Weber et al., 1995). Current clinical diagnostic logarithms involve measuring serum gastrin with concomitant pharmacologic control of peptic ulcer disease (e.g. via proton pump inhibitors). After endoscopic confirmation of peptic ulcer disease healing, PPI treatment is discontinued and gastric acid levels are measured. Once

hypergastrinemia is confirmed with gastric pH <2, other conditions can be excluded and curative

surgical resection of the gastrinoma can be performed (Ito et al., 2012; Metz, 2012). The

causative mechanism for the formation of these neoplasias is currently unknown, but they have been associated with several genetic defects (Yu et al., 2000) including mutations in the tumor suppressor gene p16 (Muscarella et al., 1998; Serrano et al., 2000) and the oncogene HER-2/neu

(Evers et al., 1994). Interesting work has associated Zollinger-Ellison syndrome with the autosomal dominant disorder, multiple endocrine neoplasia type 1 (MEN1). Mutations in the

MEN1 gene cause inactivation of the tumor suppressor Menin that has many roles in inhibiting cell proliferation (Wu and Hua, 2011). Classically, MEN patients present with hyperparathyroidism, pancreatic endocrine tumors, and pituitary and adrenal adenomas.

Gastrinomas with Zollinger-Ellison syndrome are the most common endocrine tumor type seen in MEN1 patients occurring in 21-70% of those patients (Gibril et al., 2004). Genetic linkage testing can be used diagnostically in MEN1 patients (Larsson et al., 1992), and new gene therapies aimed at replacing MEN1 gene function are promising in reducing cancer cell proliferation rates (Walls et al., 2012).

c. Carcinoid Tumors

Carcinoid tumors are rare endocrine tumors that arise from fundic ECL cells and usually occur in the setting of hypergastrinemia associated with chronic gastritis and pernicious anemia

(type 1), or MEN1 syndrome (type 2); an aggressive sporadic form (type 3) that is gastrin- independent also exists (Borch et al., 1985; Lehy et al., 1992; Rindi et al., 1993). Carcinoid tumors spawned by excessive gastrin secretion are usually asymptomatic aside from the underlying condition. Sporadic carcinoids are often also asymptomatic and are usually

discovered incidentally. They can, however, cause symptoms such as bleeding, diarrhea, weight

loss, and atypical carcinoid syndrome (characterized by flushing, headaches, shortness of breath, and lacrimation) (Borch et al., 2005; Burkitt and Pritchard, 2006). Diagnosis is based on gastroscopy, biopsy and histological analysis for ECL cell markers (chromagranin A), and

somatostatin receptor scintigraphy and ultrasound or abdominal CT to look for metastasis

(Scherubl et al., 2010). Therapy for type 1 and type 2 gastric carcinoid tumors is surgical resection, which can be augmented by antrectomy (to decrease gastrin levels by removing G

cells) and octreotide (a somatostatin analog and inhibitor of gastrin) (Lawrence et al., 2011).

Type 3 carcinoids demand more aggressive treatment with gastrectomy and chemotherapy

(Lawrence et al., 2011). The strong association with MEN1 syndrome independent of sporadic

Zollinger Ellison Syndrome (Lehy et al., 1992) has led to the theory that loss of heterozygosity at

the MEN1 gene loci plays a role in gastric carcinoid formation (Cadiot et al., 1993; Debelenko et

al., 1997). Further insights into the pathogenesis of this disease have been made using unique

rodent models including the cotton rat (Sigmodon hispidus), which spontaneously develop gastric

carcinoids (Cui et al., 2000), and the Natal multimammate mouse (Mastomys natalensis)(Nilsson

et al., 1993). Experiments using the Mastomys model have confirmed the ECL cell growth-

promoting roles of gastrin (Kidd et al., 2000) and histamine (Modlin et al., 1996). Specifically,

recent reports have shown that gastrin and histamine may mediate AP-1 transcriptional activation

(Kidd et al., 2004), increase growth factor expression (TGF-α and EGFR (Tang et al., 1996),

CCN2/CTGF (Kidd et al., 2007), and polyamines (Kidd et al., 1998)), and induce the expression

of anti-apoptotic proteins (mcl-1(Pritchard et al., 2008), clusterin (Fjeldbo et al., 2012)).

Ultimately, these animal models have proven to be useful to test and validate potential new

clinical therapies including the novel gastrin (cholecystokinin-2) receptor antagonist Netazepide

(YF476) (Kidd et al., 2010; Martinsen et al., 2003).

3. Parietal Cells

Parietal cells are the primary gastric acid and intrinsic factor secreting cells located in the

body and fundic regions of the stomach. In the unstimulated state, the H,K ATPase proton

pumps are stored in an elaborate tubulovesicle membrane system within the cell. Upon

stimulation, these membranes are trafficked to fuse with the plasma membrane to form the

intercanalicular system which increases surface area for increased acid release. Stimulation of

acid secretion is mediated by histamine, gastrin, and acetylcholine. Briefly, as previously

discussed, histamine released from fundic ECL cells and gastrin released from antral G cells

stimulates parietal cell H2 and CCK2 receptors, respectively. Postganglionic vagal or ENS

stimulation releases acetylcholine to stimulate M3 muscarinic receptors. Both gastrin and

acetylcholine lead to phospholipase C mediated mobilization of intracellular calcium (Del Valle

J, 2003b). Alternatively, histamine acts to increase intracellular cAMP levels through adenylate

cyclase activation (Del Valle J, 2003b). Both pathways lead to well established cell biological

events that result in proton pump mobilization and acid secretion (Yao and Forte, 2003). The

principal inhibitor of acid secretion is somatostatin, produced by endocrine D cells, which, in

addition to inhibiting gastrin release from G-cells and histamine release from ECL cells, directly inhibits parietal cell cAMP levels (Del Valle J, 2003b). Occasional studies have also found that

intrinsic factor secretion is stimulated by the same factors that increase acid secretion (Del Valle

J, 2003b)

a. Peptic Ulcer Disease

Peptic ulcer disease is characterized by mucosal erosions that are caused by imbalances

between acid secretion and the mechanisms that protect against acid-induced damage to the

mucosa. Acid hypersecretion, NSAID toxicity, and H pylori infection are the most common

etiologies. In cases of pure acid hypersecretion, the cause is usually hypergastrinemia in the

setting of Zollinger-Ellison syndrome, which has already been discussed. Here, I will focus on the latter two etiologies. Although I discuss it in the “parietal cell” section, peptic ulcer disease

is a multifaceted mucosal disorder that affects multiple cell lineages. Peptic ulcer disease can be

viewed simply as a breakdown in mucosal protection. The barrier in the most general sense

comprises the interplay among stomach acid, surface mucus production, the ability of the

epithelium to self-renewal, blood flow, inflammation, and molecular regulators, such as

prostaglandins (PGE2 and PGI2) (Wallace, 2008). Clinically, peptic ulcer disease manifests as

pain, bloating satiety, nausea and/or vomiting (Yuan et al., 2006). NSAIDs are thought to cause

peptic ulcer disease via inhibition of the enzyme COX1 (PTGS1), which produces protective

prostaglandins. Thus, selective inhibitors of the other prostaglandin-producing enzyme COX2

(PTGS2) have been adopted (Laine et al., 1999) to spare the gastric mucosa from barrier effects.

However, recent evidence has revealed that COX2 inhibition might also have deleterious effects

on mucosal health (Chan et al., 2004; Hippisley-Cox et al., 2005; Mizuno et al., 1997). This has

led to the current hypothesis that both COX-1 and COX-2 have mutually protective effects in the

stomach through synthesis of prostaglandins that reduce gastric hypermotility, vascular damage,

and neutrophil activation (Laine et al., 2008; Taha et al., 1999; Wallace et al., 1990).

Colonization by the gram negative bacterium, H pylori, causes chronic gastritis. H pylori

generally favors the antrum or transitional regions between the fundus/body and antrum, though

it also can chronically infect the fundus/body, too (see below). H pylori is estimated to infect half the world, and infected individuals are usually asymptomatic; however, when symptoms arise, patients with predominantly antral colonization tend to experience overproduction of acid in the fundus/body (Genta, 2003). Thus, H pylori is one etiology for hypersecretion of acid and

the ultimate cause of the vast majority of duodenal peptic ulcers. On the other hand,

fundus/body predominant colonization increases risk of gastric peptic ulcers and carcinogenesis

(to be discussed in the neck cell/zymogenic cell lineage section) (Suerbaum and Michetti, 2002).

H pylori causes pathology through interplay between toxins it produces and the inflammation

induced in the host. The ability of H pylori to survive, navigate, and adhere in the acidic gastric

lumen is facilitated by the bacterial enzyme urease, bacterial flagella, and the bacterial surface

protein BabA binding to Lewis B blood group antigen on host cells (Suerbaum and Michetti,

2002). Once bound to the gastric epithelium, pathogenic strains of H pylori usually harbor the

toxin CagA on a pathogenicity island that also encodes a type IV secretion system to inject CagA

into the host cell. CagA in turn elicits a variety of responses including disruption of cell

junctional complexes (Amieva et al., 2003), transduction of MAPK pathway growth signals

(Mimuro et al., 2002), activation of SHP-2 phosphatase (Higashi et al., 2002), and initiation of

host transcriptional activity (Hirata et al., 2002). In addition, H pylori strains can also secrete

another toxin, VacA, a vacuolating toxin that inserts in the host cell membrane, forms anion-

selective channels (Szabo et al., 1999), and induces a cytochrome c release mediated cell death

response (Galmiche et al., 2000). The host inflammatory response to these microbial factors is

mediated by cytokines (interleukin-1β, interleukin-2, interleukin-6, interleukin-8, and tumor

necrosis factor alpha (TNF-α)) and involves recruitment of neutrophils, lymphocytes, plasma

cells, and macrophages (Suerbaum and Michetti, 2002). Specifically, NF-κB mediated IL-8

production leads to the neutrophil recruitment classically noted by pathologists during H pylori

induced gastritis (Brandt et al., 2005; Sharma et al., 1998). This Th1 predominant inflammatory

response (Mohammadi et al., 1996) allows persistent colonization of the microbe (Tummala et al., 2004). An antecedent Th17 response has been shown to be induced by H pylori to trigger the Th1 and subsequent inflammatory response (Luzza et al., 2000; Shi et al., 2010); studies have also suggested that H pylori may suppress this Th17 activation in order to promote immune tolerance and persistent colonization (Kao et al., 2010; Oertli et al., 2013). This ability of H pylori to persist may also be due to its ability to survive intracellularly (Amieva et al., 2002; Oh et al., 2005) and to evade host autophagy defenses through VacA toxin action (Raju et al., 2012;

Terebiznik et al., 2009). Importantly, due to their overlapping effects on the inflammatory response, H pylori infections and NSAID use can synergistically increase the development and progression of peptic ulcer disease (Huang et al., 2002).

Endoscopy is currently the gold standard in diagnosing peptic ulcer disease with simultaneous testing for H pylori (assayed by culture, histological examination, the rapid urease test (RUT), and polymerase chain reaction (PCR)). Treatment involves the first line, so-called, triple therapies (proton pump inhibitor, amoxicillin, and clarithromycin) and secondary quadruple (proton pump inhibitor, bismuth, tetracycline, and metronidazole) therapies to eradicate the bacterium (Luther et al., 2010; Malfertheiner et al., 2011; Malfertheiner et al.,

2002) Additionally, administration of misoprostol (a PGE1 analog), use of H2-receptor antagonists, proton pump inhibitor therapy, and switching to a selective COX2 inhibitor (Laine et al., 2008; Yuan et al., 2006) can all aid treatment, depending on exact etiology (e.g., NSAID use with H pylori infection). Several new classes of NSAIDs are in development that capitalize on insights gained from basic science. As previously discussed, it is neutrophil activation that is

thought to be the common mechanism for mucosal damage. Nitric oxide has been shown to

regulate epithelial barrier permeability, increase gastric blood flow, inhibit neutrophil invasion,

and facilitate gastric mucosal healing (Lanas et al., 2000; Wallace and Miller, 2000). To address

both prostaglandin and nitric oxide mechanisms, several new cyclooxygenase-inhibiting nitric

oxide donators are being developed (Fiorucci et al., 2003; Lohmander et al., 2005) including

Naproxcinod (Baerwald et al., 2010). In addition, inhibitors of 5-lipoxygenase, an enzyme that

produces pro-inflammatory leukotrienes from arachidonic acid as a result of COX inhibition, are

being packaged with COX inhibitors (Bias et al., 2004). Additional lines of therapy being

develop involve using phosphatidylcholine to enhance mucosal barrier function (Lichtenberger et

al., 2009) and hydrogen sulfide to reduce inflammation (Wallace, 2007). With regard to H

pylori, new treatment algorithms are being tested (Malfertheiner et al., 2011) with alternative therapies including probiotics and phytomedicine (Vitor and Vale, 2011). The ultimate goal for much of the research into eradication has now shifted towards effective vaccine production, given the rising incidence of antibiotic resistant variants (Megraud, 2004). Several candidate vaccines are in development based on animal studies aimed at circumventing host immunoregulation, which seems to suppress the natural immune response that would be sufficient to eradicate H Pylori (Czinn and Blanchard, 2011).

b. Autoimmune Gastritis/Pernicious Anemia

Autoimmune gastritis is an autoimmune disease characterized by autoimmune destruction of parietal cells due to autoantibodies to the parietal cell H/K ATPase (Karlsson et al., 1988) and intrinsic factor (Bardhan et al., 1968). Clinically, these patients may present with achlorhydria or hypochlorhydria from parietal cell damage, decreased pepsinogen levels, hypergastrinemia with

ECL and G cell hyperplasia, iron deficiency and cobalamin (B12)-deficient (i.e. pernicious

anemia) (Genta, 2003). Autoimmune gastritis patients often show a genetic HLA association

(Oksanen et al., 2010) and possibly an inciting role of H pylori infection (Veijola et al., 2010).

Immunologists have long studied this disease, because it is an autoimmune disease with well- established auto antigen target, the H,K ATPase proton pump (D'Elios et al., 2001). In a mouse model with a transgenic T cell receptor specific for H,K ATPase, scientists were able to induce autoimmune gastritis after transferring T cells to immunodeficient mice; Th1, Th2, and Th17

CD4 subtypes were all shown to play a role in development of gastritis (Stummvoll et al., 2008).

Peripheral extra-thymic deletion and Treg suppression have been found to mechanistically prevent these H/K ATPase–specific T cells from becoming pathogenic (DiPaolo et al., 2007;

DiPaolo et al., 2005; Read et al., 2007). Despite these insights, diagnosis of this condition is made usually after presentation and diagnosis of megaloblastic anemia due to vitamin B12 deficiency. Noninvasive serum screens for low pepsinogen, high gastrin, low serum ghrelin

(Checchi et al., 2007), and auto antibodies are first line diagnostic tests followed by subsequent endoscopic confirmation of mucosal atrophy and surveillance for advanced stage disease complications like polyps, carcinoids, and cancer (Annibale et al., 2011; Toh et al., 2012).

Conventional treatment involves vitamin B12 replacement (Annibale et al., 2011; Toh et al.,

2012). Several potential areas of treatment are being pursued including extrathymically induced

T regulatory cells (iTregs) that can be induced, expanded, and administered to attenuate stomach pathology in a mouse model of autoimmune gastritis (Nguyen et al., 2011). An alternatively novel approach being investigated in all autoimmune diseases is the use of gene therapy to introduce autoantigens into bone marrow stem cells to promote immune tolerance (Alderuccio et al., 2009).

b. Atrophic Gastritis

Chronic atrophic gastritis is a pathologic condition secondary to chronic infection with H

Pylori characterized by loss of parietal cells and consequent changes in the chief cell lineage (to be discussed in detail in the chief cell lineage section), usually also associated with secondary foveolar hyperplasia and hypergastrinemia produced by endocrine cell response to loss of parietal cell acid production. As mentioned, H pylori infection can be asymptomatic, induce peptic ulcer disease, and also cause atrophic gastritis with increased risk for progression to gastric adenocarcinoma or lymphoma. In general terms, disease typically starts in the antrum with hypersecretion of acid often causing duodenal ulcers, as discussed. Several theories have served to explain the hyperchlorhydria associated with this initial phase. It is believed that H pylori infection causes alkalization of the antrum, loss of G cell inhibitory mechanisms, and ultimately hypergastrinemia-induced acid secretion (Gillen et al., 1998; Hamlet and Olbe, 1996;

Moss et al., 1992; Olbe et al., 1996). If the disease progresses, it can spread to cause loss

(atrophy) of parietal cells in the fundus/body, which allows the bacteria to colonize the fundic and corpus portion of the stomach, because pH increases to levels tolerated by the bugs (El-

Zimaity, 2008). H pylori initiates death and dysfunction of parietal cells through many proposed mechanisms, including: direct cagE pathogenicity island mediated NF-κB activation of the inducible nitric oxide synthetase iNOS (Neu et al., 2002), upregulation of proapoptotic factors

(Hagen et al., 2008; Houghton et al., 2000), and disruption of cell junctions and architecture

(Murakami et al., 2013; Wang et al., 2008). Indirect effects of H pylori on parietal cells include

T cell cytotoxicity where T cells are induced to react against parietal cell antigens as in autoimmune gastritis (Amedei et al., 2003; Claeys et al., 1998) and neutrophil activation as

previously discussed. In addition, H pylori has been found to directly (Saha et al., 2010) and

indirectly (Beales and Calam, 1998; Wolfe and Nompleggi, 1992) decrease parietal cell acid

secretion. In fact, even the hypergastrinemia caused by infection has been found to induce

parietal cell death (Cui et al., 2006). Interestingly, recent work has shown that the H pylori

induced cytokine IL-1β blocks Sonic hedgehog expression (Waghray et al., 2010; Xiao et al.,

2010), thus providing a mechanistic link between parietal cell loss and subsequent foveolar

hyperplasia and chief cell metaplasia. Diagnosis and treatment are the same as those discussed

in peptic ulcer disease, mostly involving reducing acid secretion and eradication of H pylori.

4. Zymogenic (Chief) Cells

The zymogenic (aka Chief) cells are the major digestive enzyme secreting cells of the

stomach. These cells terminally differentiate from TFF2 (Trefoil factor family 2 or spasmolytic

polypeptide) and mucus-secreting cells in the neck of the gastric gland that migrate towards the

bases of the glands in the fundus/body. Large secretory vesicles containing precursor forms of digestive enzymes like pepsinogen C are stored apically in zymogenic cells until regulated secretion is signaled mainly through vagal cholinergic stimulation and additional histaminergic, adrenergic, and peptide hormonal inputs (Gritti et al., 2000). These stimulatory signals are transduced through phospholipase C activation of PKC and mobilization of intracellular calcium stores, and cAMP activation of protein kinases. Once secreted, the inactive proenzyme form of pepsinogen is catalyzed by luminal acidity into the active proteolytic pepsin enzyme form.

Physiologically, pepsin functions as an endopeptidase to initiate the first steps in luminal food digestion; peptides liberated by this digestion in turn facilitate subsequent digestive motility, secretions, and absorption (Del Valle J, 2003b).

a. Atrophic Gastritis/SPEM

In the setting of chronic gastritis and atrophy of parietal cells, mature chief cells become

metaplastic, lose mature chief cell functions, and start re-expressing mucous neck cell markers,

like TFF2. This phenomenon has been extensively studied using mouse models, with the initial observation made with model where infection with the Helicobacter pylori relative Helicobacter

felis recapitulates many aspects of human H pylori infection, including parietal cell atrophy,

foveolar hyperplasia, and mucus metaplasia (Wang et al., 1998). TFF2 has proven to be a good marker for this chief cell mucous metaplasia in humans and rodent models (Schmidt et al., 1999;

Yamaguchi et al., 2002). Hence, the sequence of parietal cell loss with chief cell metaplasia has been called Spasmolytic Polypeptide Expressing Metaplasia (SPEM), though it is also known as pseudopyloric metaplasia or antralization, because the resulting glandular morphology (with

TFF2 expressing cells at the base and decreased or absent parietal cell) resembles that of the normal antrum/pylorus. Additional mouse models based on parietal cell ablation genetically

(Ohnishi et al., 1996) or pharmacologically (Goldenring et al., 2000; Huh et al., 2012) have demonstrated the requirement of parietal cells for proper chief cell maturation and maintenance.

Recent evidence has shown that upon oxyntic atrophy, not only do chief cells begin re-

expressing immature markers, but they also become proliferative (Huh et al., 2012; Nam et al.,

2010; Nozaki et al., 2008). These proliferative events are likely independent of the foveolar hyperplasia that also occurs during parietal cell loss (Nomura et al., 2005b). Mechanistically,

mouse models have shown that it is loss of parietal cells and reduction in homeostatic differentiation signals: Sonic hedgehog (Xiao et al., 2010), TGF-β (Li et al., 2002; Yano et al.,

2006), Bone Morphogenic Protein (BMP) (Maloum et al., 2011; Shinohara et al., 2010) that

initiate zymogenic cell dedifferentiation. Aberrant enteroendocrine signals may also play a role in chief cell metaplasia (Nozaki et al., 2009; Wang et al., 2000).

MIST1 primer

A developmentally regulated transcription factor, MIST1 was initially characterized in

highly secretory tissues including the pancreas, salivary glands, digestive tract, and the

testes (Lemercier et al., 1997; Pin et al., 2000). Subsequent studies have elucidated that

MIST1 functions as a homodimer (Zhu et al., 2004) and binds to CATATG-type E-boxes

to transcriptionally activate its targets (Tran et al., 2007). Genetically engineered mice

deficient in MIST1 expression exhibited disruption of cellular polarity and secretory

defects in specifically the exocrine tissues (Pin et al., 2001). Additional studies in the

pancreas have further characterized these secretion defects and have revealed deficiencies

in calcium mediated exocytosis (Luo et al., 2005) and decreases in granule size and

organization (Johnson et al., 2004). Recent work has revealed that loss of MIST1, in

these tissues, is a necessary and consequential event during injury response and

subsequent tumorigenesis events (Alahari et al., 2011; Capoccia et al., 2013; Huh et al.,

2012; Kowalik et al., 2007; Lennerz et al., 2010; Shi et al., 2009). While some purport

that MIST1 may act through direct transcriptional targets in a traditional tumor

suppressor role (Jia et al., 2008), there remain many unanswered questions about the

importance of MIST1 in these secretory tissues (Goldenring et al., 2011; Mills and

Taghert, 2012; Pin, 2012).

Many reports indicate the same molecular and cellular changes in zymogenic cell differentiation that occur in response to parietal cell atrophy in mouse models occur in humans

(Capoccia et al., 2013; Goldenring et al., 2010; Lee et al., 2010). If the insult to parietal cells is temporary (e.g., by a toxin), and parietal census is restored, than normal chief cell differentiation is also restored (Capoccia et al., 2013; Huh et al., 2012; Khurana et al., 2013); thus, it is generally thought that SPEM is a normal repair response to decrease elaboration of potentially harmful substances (acid, digestive enzymes) and increase protective agents (mucus, trefoil factor), while increasing proliferation to replace lost cells. Diagnosis of atrophy and metaplasia is made on biopsy histopathologically. Clinical diagnosis and treatments have been previously discussed. Specifically, H pylori eradication has been found to reverse SPEM (Ley et al., 2004;

Sung et al., 2000b; Zivny et al., 2003). Improved diagnosis of early stages of chief cell differentiation changes may result from histopathological biomarkers of chief cell damage, like loss of the transcription factor MIST1 (see primer) and its direct targets (Lennerz Am J Path

2010; Capoccia JCI 2013); diagnostic tests of serum pepsinogen levels (in particular the ratio between pepsinogen A, normally produced only in corpus zymogenic cells, and C, normally

produced in antral glands, corpus zymogenic cells, and the duodenal bulb Brunner’s glands, can

inform about loss of normal chief cell function) have been found to be predictive of atrophy,

metaplasia, and cancer initiation (Miki, 2006).

b. Intestinal Metaplasia

The ectopic expression of intestinal type epithelium in the stomach defines this

pathologic condition. A clear association between a sequence of predisposing events H pylori

infection, chronic gastritis, formation of SPEM, development of intestinal metaplasia, and

ultimate carcinogenesis has been made (Correa, 1988; Uemura et al., 2001). In a Mongolian

gerbil animal model, infection with H pylori induced SPEM formation that later progressed into

51 intestinal metaplasia (IM) (Yoshizawa et al., 2007). Corroborating these findings, a mouse model deficient in amphiregulin also develops SPEM, and those same metaplastic glands further progress into intestinal metaplasia (Nam et al., 2009). The idea of IM arising from a SPEM precursor is supported by the finding that intestinal genes start to become expressed in subpopulations of SPEM cells (Weis et al., 2012) and that IM is formed by monoclonal conversion of a multipotent proliferative precursor (McDonald et al., 2008). Mechanistically, formation of intestinal metaplasia must arise from a re-expression of primitive intestinal factors.

Among these factors are the master intestinal transcription factors, CDX-1 (Fujii et al., 2012) and

CDX-2 (Barros et al., 2012) whose increased expression has been found in human IM (Almeida et al., 2003). Genetic mouse models have proven that ectopic stomach expression of both factors is sufficient to cause intestinal metaplasia (Mutoh et al., 2004; Silberg et al., 2002) with CDX-2 acting as the initiating factor (Mutoh et al., 2009). H pylori induced expression of BMP signaling has been shown to induce CDX-2 expression and represses the stomach specifying transcription factor SRY-related HMG-box 2 (SOX-2) (Asonuma et al., 2009; Barros et al.,

2008; Camilo et al., 2012). H pylori CagA has also been shown to effect E-cadherin association and activate β-catenin mediated CDX1 expression (Franco et al., 2005; Murata-Kamiya et al.,

2007). In addition, loss of parietal cells and hypochlorhydria has also been shown to induce inflammation and expression of intestinal genes (Zavros et al., 2005). Diagnosis of IM remains a key prognostic in the future development of stomach cancer; current surveillance options include endoscopic biopsy and use of serum biomarkers to monitor atrophy (Correa et al., 2010).

Treatment remains focused on HP eradication. However, as opposed to atrophy and SPEM, whether elimination of H pylori reverses IM has been controversial (Zivny et al., 2003) with reductions in IM (Ley et al., 2004; Sung et al., 2000b; Zhou et al., 2003) and reductions only in

atrophic gastritis (Rokkas et al., 2007; Wang et al., 2011) seen upon treatment. In fact, CDX2

expression levels have been found to remain elevated despite eradication (Satoh et al., 2002).

Other pharmacologic agents such as antioxidants and COX-2 inhibitors may play beneficial roles in preventing IM addition to H pylori eradication (Dinis-Ribeiro et al., 2012).

d. Gastric Cancer

The study of gastric cancer defines a vast and ever expanding field of knowledge, as is fitting for the world’s second most common cause of cancer death. For this review, I will specifically focus on adenocarcinomas, which represent the bulk of the cancers in the stomach.

In particular, I choose to focus on the non-cardia type of gastric cancer, as adenocarcinomas of the cardia overlap in etiology, epidemiology, and prognosis with mechanisms of carcinogenesis in the distal esophagus and gastro-esophageal junction. Gastric adenocarcinomas of the

body/antrum (so-called distal gastric adenocarcinomas) are generally classified roughly by their histological features: either intestinal (which resemble to varying degrees, colorectal tumors and are largely glandular) or diffuse (which are poorly differentiated, and defined by invasion of isolated, single cells) types (Leung, 2003). The former is the most common type, tends to occur in older individuals, displays geographic variations, and is generally decreasing in incidence throughout the world (Peleteiro et al., 2012; Wu et al., 2009b). Gastric cancer of any type tends

to have terrible prognosis in the absence of active, endoscopic screening protocols of populations

at risk, because it usually remains asymptomatic, and symptoms are non-specific until the tumor

becomes large or metastatic (Leung, 2003). H pylori infection is thought to be at the root of the

vast majority of intestinal-type adenocarcinomas, but only about 1% of patients with chronic

infection will go on to develop cancer (Huang et al., 2003; Uemura et al., 2001). Thus, given the

regional variation in prevalence, additional environmental factors (Larsson et al., 2006; Torres et

al., 2013; Tsugane and Sasazuki, 2007) and genetic susceptibilities (Gonzalez et al., 2002; Loh et

al., 2009) have been proposed to play roles in carcinogenesis.

The majority of work exploring the mechanistic causes of gastric cancer has focused on the intestinal-type cancers, with study of the multiple underlying host and pathogen signaling pathways (Wu et al., 2010). In general, as opposed to pancreatic cancer (where mutant K-RAS plays a predominant role in carcinogenesis) or colorectal cancer (where APC mutations and aberrant Wnt signaling predominate), gastric cancer does not seem to have any predominant pattern of aberrant/mutant signaling at its root (Capoccia et al., 2009). I will briefly touch on some of the many aberrant signaling pathways that have been shown to be involved in at least some gastric cancers (Fig. 3). As previously discussed, H pylori mediates activation of the NF-

κB transcriptional signaling pathway (Brandt et al., 2005; Sharma et al., 1998). In addition to its role in inducing inflammation, NF-κB has been shown to upregulate COX2 (Sung et al., 2000a)

mediated prostaglandin E2 (Oshima et al., 2004) expression. Sustained COX2 mediated PGE2 activation leads to increased growth factor release and gastric carcinogenesis in a mouse model of cancer formation (Oshima et al., 2004). H pylori through its CagA-containing pathogenicity island can initiate activation of β-catenin (Franco et al., 2005; Murata-Kamiya et al., 2007). Wnt pathway signaling has been shown to be important in a population of antral gastric stem cells

(Barker et al., 2010), and its activation has been correlated with gastric cancer (Kurayoshi et al.,

2006; Oshima and Oshima, 2010). In fact, the effects of COX2 and Wnt pathway activation are synergistic and act to further promote carcinogenesis (Oshima et al., 2006). The role of TGF-β signaling has also been explored. Smad phosphorylation transduces TGF-beta signals to transcriptional activation of RunX3 induced apoptosis pathways (Yano et al., 2006). Mouse

models deficient for RunX3 (Li et al., 2002) or Smad4 (Xu et al., 2000) show cancer formation,

as does increased STAT3 signaling induced by mutation of the common cytokine receptor

GP130 (Jenkins et al., 2005; Judd et al., 2004; Judd et al., 2006). However, paradoxically, TGF-

β is re-expressed in cancers with complex roles in repressing immune surveillance, initiating

EMT, and inducing angiogenesis (Achyut and Yang, 2011). Similarly, BMP signaling also seems to have a bi-functional role in carcinogenesis and in cancer. In mouse models, disruption of BMP pathway function resulted in aberrant epithelium homeostasis with increased proliferation (Maloum et al., 2011; Shinohara et al., 2010). But BMP also can induce CDX-2 expression as previously described (Asonuma et al., 2009; Barros et al., 2008; Camilo et al.,

2012) and promote carcinogenesis (Thawani et al., 2010). As discussed previously, the parietal cell morphogen Sonic hedgehog is often lost during atrophic gastritis (Shiotani et al., 2005) and may be downregulated directly by H pylori induced IL-1β (Waghray et al., 2010; Xiao et al.,

2013). Hedgehog signaling also follows a similar trend of reemergence during cancer progression (El-Zaatari et al., 2007; Saze et al., 2012). Mechanistically, HP mediates NF-κB

activation resulting in upregulation of the hedgehog targets Gli-1 and Bcl-2 to promote growth

and inhibit apoptosis (El-Zaatari et al., 2013; Martin et al., 2010). The interdependence and

crosstalk of these cancer promoting pathways is again evidenced by the finding that the

hedgehog pathway may signal through the TGF-β pathway during cancer progression (Yoo et al.,

2008). Notch pathway activation is also associated with gastric cancer (Sun et al., 2011) and has been shown to induce COX-2 expression (Yeh et al., 2009). In fact, a mouse model aberrantly

overexpressing Notch in the stomach resulted in dedifferentiation, proliferation, and tumor

formation (Kim JEM 2011). Upregulation of fibroblast growth factor signaling through receptor

overexpression and activation has been found in gastric cancer (Shin et al., 2000; Ye et al., 2011)

along with direct activation of this pathway by H pylori CagA mediated SHP2 signal

transduction (Katoh and Katoh, 2006). Clearly, reactivation of these important developmental pathways is important in carcinogenesis. The finding of developmental pathways reactivation in cancer has presented new therapeutic pathways to target with new TGF-β inhibitors (Kano et al.,

2007) and FGF receptor inhibitors (Zhao et al., 2010) being developed.

Outside the realm of developmental growth factors, gastrin and chronic inflammation have been shown to be major components in gastric cancer formation. A mouse model overexpressing gastrin showed increased susceptibility to developing gastric cancer with a

synergistic effect upon subsequent Helicobacter infection(Takaishi et al., 2009b; Wang et al.,

2000). However, another model lacking the SHP2-binding site on the gp130 receptor family, as

mentioned above, has shown that tumorigenesis occurs even in the absence of hypergastrinemia

(Jenkins et al., 2005; Judd et al., 2004; Judd et al., 2006). These mice display a chronic

inflammatory state due to hyperactivation of the STAT3 signaling pathway. Thus, the

independent role of inflammation to mediate gastric cancer was established. The gastrin-

deficient mouse model recapitulated many of the findings regarding the gastrin-independent

transformative potential of chronic (Huang et al., 2012) inflammation through IFNγ activated

STAT3 pathway activation (Zavros et al., 2005). Studies have even postulated a protective role

of gastrin to cancer formation through its ability to upregulate the tumor suppressing and healing

trefoil factors, TFF1 and TFF2 (Khan et al., 2003; Tu et al., 2007). Thus gastrin and STAT3

pathway activation both are being targeted for cancer therapy (Ajani et al., 2006; Giraud et al.,

2012).

The molecular events that lead to diffuse-type gastric carcinomas, many of which are

characterized by mucus-stuffed so-called signet ring cells, have been more clearly elucidated

56 under a common signaling theme. Seminal work established a hereditary form of diffuse-type gastric cancer that resulted from a germline mutation in the E-cadherin gene (Guilford et al.,

1998). Mouse models mimicking the human genetics by expressing only one copy of the E- cadherin gene showed increased susceptibility to cancer initiation independent of β-catenin/Wnt pathway activation (Humar et al., 2009). In a murine system, it was shown that complete genetic ablation of E-cadherin in adult mice was sufficient to produce signet ring lesions (Mimata et al.,

2011), and those progressed to cancer if p53 was also ablated (Shimada et al., 2012). In humans,

E-cadherin promoter methylation leads to a second hit inactivation (Humar et al., 2009) in patients heterozygous for functional E-cadherin that results from H pylori induced IL-1β stimulation of NF-κB transcriptional activation of DNA methyl transferase activity through iNOS and NO production (Huang et al., 2012).

While discussing the cellular signals involved in tumorigenesis it is often easy to ignore which cells become responsive and receptive to those signals or, in other words, the cell of origin for cancer. I have included the cancer discussion in the chief cell section because there is evidence that chief cells dedifferentiate to become the proliferating cells in SPEM (Huh et al.,

2012; Nam et al., 2010; Nozaki et al., 2008). Tracking of IM has shown that it develops from

SPEM and clonally progresses to dysplasia (Gutierrez-Gonzalez et al., 2011; McDonald et al.,

2008). Thus, it is possible that the dedifferentiation of mature chief cells gives rise to the cancer.

However, other gastric cell lineages with the right growth impetus have been shown to have the ability to dedifferentiate and become multipotent in mouse models (Kim and Shivdasani, 2011;

Quante et al., 2010). In fact, studies in mice have found that bone marrow-derived cells can be recruited to sites of stomach injury and give rise to adenocarcinoma (Houghton et al., 2004).

This “dedifferentiation” of mature cells into cancer is at odds with alternative theories that

stomach cancer may progress from an undifferentiated stem cell precursor. Antral tumors in

mice have been shown to develop clonally from multipotent cells marked by expression from the

Lgr5 gene locus (Barker et al., 2010) marked by expression from a transgenic villin promoter (Li

et al., 2012). The difficulty in studying these cells is the lack of markers. Several markers have

been proposed including CD44 (Khurana et al., 2013; Takaishi et al., 2009a), CD90 (Jiang et al.,

2012), and CD133 (Fukamachi et al., 2011). Identification of these markers will lead to therapies that specifically target these cancer stem cells (Jiang et al., 2012; Khurana et al., 2013;

Smith et al., 2008).

Early detection and H pylori eradication therapy has been demonstrated to be effective at cancer prevention (Ito et al., 2009; Wu et al., 2009a), but as discussed previously, the benefits start to decrease with advancement of carcinogenesis towards SPEM and IM, indicating diffuse repatterning of the gastric epithelium that is often referred to as a “point of no return” (Peleteiro et al., 2012; Wong et al., 2004). Unfortunately, the early detection protocols involve endoscopic surveillance and biopsy, which are too expensive to initiate in regions where gastric cancer incidence is relatively much lower (e.g., the US, northern Europe) than in the far east where it is

by far the most common cancer killer (e.g., Japan, South Korea) (Dan et al., 2006). New chemotherapy combination regimes are being implemented (Wagner et al., 2010) along with radiotherapy and biological agents targeting classic cancer pathway targets including HER2,

EGFR, and VEGF (Price et al., 2012). Novel immunotherapies are also being developed utilizing dendritic cell-based vaccines, priming of natural killer cells, T cell based therapies to recognize and attack cancer cells (Amedei et al., 2011).

Conclusions

It is clear that our knowledge of the pathology and pathophysiology of the stomach has

and continues to increase since ancient times. With the advent of modern genetics, cell biology,

and biochemistry we are building new avenues exploring the molecular mechanisms behind

congenital and acquired diseases. However there is still much we do not know. Much light has

been shed on the developmental pathways that are important in formation and differentiation of

the stomach, but an overarching interconnected model that might be clinically useful has yet to

be proposed. And therein lies the complexity of the problem. Multiple signals to multiple

receptors on multiple cell types all respond simultaneously during stomach development and

disease. The beauty of modern science has been the ability to study complex systems in isolation

and there again is its greatest weakness. For example, it is clear that during chronic

inflammation every stomach lineage is affected and responds. How can we tease out which cell

is the cell of origin that proceeds towards carcinogenesis? Efforts have started to concentrate on

identifying gastric stem cell markers. But many new studies have demonstrated the plasticity of

terminally differentiated cells in the stomach to transdifferentiate and possibly even

dedifferentiate. In fact, much of our knowledge comes from work using genetic murine models.

With fundamental differences between mice and men, do we have the best physiological model

to study gastric diseases? Despite these unknowns, exciting new gene stem cell markers and

gene expression studies are being performed currently that seek to unify and create a systems- based network for understanding normal development and disease.

Clinically, the challenges are now greater than ever. Our knowledge about the causes of rare developmental disorders has remained largely unchanged since their discoveries. Increased survival rates have largely benefited from advances in radiological and surgical interventions.

Clearly, there is a need to further understand these congenital diseases. In fact, the same can be

said about the adult diseases. Stomach cancer remains a leading cause of mortality throughout

the world, and despite near eradication of H pylori here in the United States, stomach cancer

rates are actually increasing among certain demographics (Anderson et al., 2010). A growing

demand exists for new noninvasive screening modalities including new biomarkers for diagnosis

and therapeutic efficacy monitoring. Current therapy is bimodal; from mitigation of symptoms

on one end of the spectrum to aggressive surgery and cancer pharmacotherapy on the other end.

New safe treatment options that utilize our basic science insights must focus on the stomach as

an interconnected network. We must continue to translate our findings from the bench back to the clinics. In this review, we have taken a developmental biology centric view, however future studies must apply our knowledge of stomach development and integrate those insights with new epidemiological evidence and modern genetic approaches. The traditional Chinese medicine holistic belief of interdependence and interconnectivity hold true and are concepts that we would be wise to continue to apply in our modern pursuits of stomach clinical cures.

Acknowledgements

We would like to thank David Alpers who provided insightful discussion and thoughtful feedback. JCM is supported by grants from the National Institutes of Health (R01 DK-079798-

01, DK094989, 2P30 DK052574-12).

References

Achyut, B. R. and Yang, L. (2011). Transforming growth factor-beta in the gastrointestinal and hepatic tumor microenvironment. Gastroenterology 141, 1167-78. Aintablian, N. H. S., M. S.; Antoun, B. W. (1987). Congenital Microgastria. Pediatr Surg Int 2, 307-310. Ajani, J. A., Hecht, J. R., Ho, L., Baker, J., Oortgiesen, M., Eduljee, A. and Michaeli, D. (2006). An open-label, multinational, multicenter study of G17DT vaccination combined with cisplatin and 5-fluorouracil in patients with untreated, advanced gastric or gastroesophageal cancer: the GC4 study. Cancer 106, 1908-16. Al-Salem, A. H. (2007). Congenital pyloric atresia and associated anomalies. Pediatr Surg Int 23, 559-63. Alahari, S., Mehmood, R., Johnson, C. L. and Pin, C. L. (2011). The absence of MIST1 leads to increased ethanol sensitivity and decreased activity of the unfolded protein response in mouse pancreatic acinar cells. PLoS One 6, e28863. Alderuccio, F., Chan, J., Scott, D. W. and Toh, B. H. (2009). Gene therapy and bone marrow stem-cell transfer to treat autoimmune disease. Trends Mol Med 15, 344-51. Almeida, R., Silva, E., Santos-Silva, F., Silberg, D. G., Wang, J., De Bolos, C. and David, L. (2003). Expression of intestine-specific transcription factors, CDX1 and CDX2, in intestinal metaplasia and gastric carcinomas. J Pathol 199, 36-40. Amedei, A., Benagiano, M., della Bella, C., Niccolai, E. and D'Elios, M. M. (2011). Novel immunotherapeutic strategies of gastric cancer treatment. J Biomed Biotechnol 2011, 437348. Amedei, A., Bergman, M. P., Appelmelk, B. J., Azzurri, A., Benagiano, M., Tamburini, C., van der Zee, R., Telford, J. L., Vandenbroucke-Grauls, C. M., D'Elios, M. M. et al. (2003). Molecular mimicry between Helicobacter pylori antigens and H+, K+ --adenosine triphosphatase in human gastric autoimmunity. J Exp Med 198, 1147-56. Amieva, M. R., Salama, N. R., Tompkins, L. S. and Falkow, S. (2002). Helicobacter pylori enter and survive within multivesicular vacuoles of epithelial cells. Cell Microbiol 4, 677-90. Amieva, M. R., Vogelmann, R., Covacci, A., Tompkins, L. S., Nelson, W. J. and Falkow, S. (2003). Disruption of the epithelial apical-junctional complex by Helicobacter pylori CagA. Science 300, 1430-4. Anderson, W. F., Camargo, M. C., Fraumeni, J. F., Jr., Correa, P., Rosenberg, P. S. and Rabkin, C. S. (2010). Age-specific trends in incidence of noncardia gastric cancer in US adults. JAMA 303, 1723-8. Angioi, K., Hatier, R., Muhale, F., Plenat, F. and Duprez, A. (2001). Morphologic and functional development of whole human fetal stomachs grafted into nude mice. Dev Growth Differ 43, 425-35. Annibale, B., Lahner, E. and Fave, G. D. (2011). Diagnosis and management of pernicious anemia. Curr Gastroenterol Rep 13, 518-24. Asonuma, S., Imatani, A., Asano, N., Oikawa, T., Konishi, H., Iijima, K., Koike, T., Ohara, S. and Shimosegawa, T. (2009). Helicobacter pylori induces gastric mucosal intestinal metaplasia through the inhibition of interleukin-4-mediated HMG box protein Sox2 expression. Am J Physiol Gastrointest Liver Physiol 297, G312-22. Baerwald, C., Verdecchia, P., Duquesroix, B., Frayssinet, H. and Ferreira, T. (2010). Efficacy, safety, and effects on blood pressure of naproxcinod 750 mg twice daily compared with

placebo and naproxen 500 mg twice daily in patients with osteoarthritis of the hip: a randomized, double-blind, parallel-group, multicenter study. Arthritis Rheum 62, 3635-44. Bardhan, K. D., Hall, J. R., Spray, G. H. and Callender, S. T. (1968). Blocking and binding autoantibody to intrinsic factor. Lancet 1, 62-4. Barker, N., Huch, M., Kujala, P., van de Wetering, M., Snippert, H. J., van Es, J. H., Sato, T., Stange, D. E., Begthel, H., van den Born, M. et al. (2010). Lgr5(+ve) stem cells drive self- renewal in the stomach and build long-lived gastric units in vitro. Cell Stem Cell 6, 25-36. Barros, R., Freund, J. N., David, L. and Almeida, R. (2012). Gastric intestinal metaplasia revisited: function and regulation of CDX2. Trends Mol Med 18, 555-63. Barros, R., Pereira, B., Duluc, I., Azevedo, M., Mendes, N., Camilo, V., Jacobs, R. J., Paulo, P., Santos-Silva, F., van Seuningen, I. et al. (2008). Key elements of the BMP/SMAD pathway co-localize with CDX2 in intestinal metaplasia and regulate CDX2 expression in human gastric cell lines. J Pathol 215, 411-20. Beales, I. L. and Calam, J. (1998). Interleukin 1 beta and tumour necrosis factor alpha inhibit acid secretion in cultured rabbit parietal cells by multiple pathways. Gut 42, 227-34. Berrocal, T., Torres, I., Gutierrez, J., Prieto, C., del Hoyo, M. L. and Lamas, M. (1999). Congenital anomalies of the upper gastrointestinal tract. Radiographics 19, 855-72. Bhaskar, K. R., Garik, P., Turner, B. S., Bradley, J. D., Bansil, R., Stanley, H. E. and LaMont, J. T. (1992). Viscous fingering of HCl through gastric mucin. Nature 360, 458-61. Bias, P., Buchner, A., Klesser, B. and Laufer, S. (2004). The gastrointestinal tolerability of the LOX/COX inhibitor, licofelone, is similar to placebo and superior to naproxen therapy in healthy volunteers: results from a randomized, controlled trial. Am J Gastroenterol 99, 611-8. Blum, B. and Benvenisty, N. (2009). The tumorigenicity of diploid and aneuploid human pluripotent stem cells. Cell Cycle 8, 3822-30. Bonacci, J. L. and Schlatter, M. G. (2008). Gastric duplication cyst: a unique presentation. J Pediatr Surg 43, 1203-5. Borch, K., Ahren, B., Ahlman, H., Falkmer, S., Granerus, G. and Grimelius, L. (2005). Gastric carcinoids: biologic behavior and prognosis after differentiated treatment in relation to type. Ann Surg 242, 64-73. Borch, K., Renvall, H. and Liedberg, G. (1985). Gastric endocrine cell hyperplasia and carcinoid tumors in pernicious anemia. Gastroenterology 88, 638-48. Brandt, S., Kwok, T., Hartig, R., Konig, W. and Backert, S. (2005). NF-kappaB activation and potentiation of proinflammatory responses by the Helicobacter pylori CagA protein. Proc Natl Acad Sci U S A 102, 9300-5. Burdick, J. S., Chung, E., Tanner, G., Sun, M., Paciga, J. E., Cheng, J. Q., Washington, K., Goldenring, J. R. and Coffey, R. J. (2000). Treatment of Menetrier's disease with a monoclonal antibody against the epidermal growth factor receptor. N Engl J Med 343, 1697-701. Burkitt, M. D. and Pritchard, D. M. (2006). Review article: Pathogenesis and management of gastric carcinoid tumours. Aliment Pharmacol Ther 24, 1305-20. Bussey, K. J., Lawce, H. J., Himoe, E., Shu, X. O., Heerema, N. A., Perlman, E. J., Olson, S. B. and Magenis, R. E. (2001). SNRPN methylation patterns in germ cell tumors as a reflection of primordial germ cell development. Genes Chromosomes Cancer 32, 342-52. Cadiot, G., Laurent-Puig, P., Thuille, B., Lehy, T., Mignon, M. and Olschwang, S. (1993). Is the multiple endocrine neoplasia type 1 gene a suppressor for fundic argyrophil tumors in the Zollinger-Ellison syndrome? Gastroenterology 105, 579-82.

Camilo, V., Barros, R., Sousa, S., Magalhaes, A. M., Lopes, T., Mario Santos, A., Pereira, T., Figueiredo, C., David, L. and Almeida, R. (2012). Helicobacter pylori and the BMP pathway regulate CDX2 and SOX2 expression in gastric cells. Carcinogenesis 33, 1985-92. Capoccia, B. J., Huh, W. J. and Mills, J. C. (2009). How form follows functional genomics: gene expression profiling gastric epithelial cells with a particular discourse on the parietal cell. Physiol Genomics 37, 67-78. Capoccia, B. J., Jin, R. U., Kong, Y. Y., Peek, R. M., Jr., Fassan, M., Rugge, M. and Mills, J. C. (2013). The ubiquitin ligase Mindbomb 1 coordinates gastrointestinal secretory cell maturation. J Clin Invest 123, 1475-91. Carlson, B. M. (1999). Digestive and Respiratory Systems and Body Cavities. In Human Embryology and Developmental Biology, (ed. B. Copland), pp. 320-326. St Louis: Mosby, Inc. Chan, F. K., Hung, L. C., Suen, B. Y., Wong, V. W., Hui, A. J., Wu, J. C., Leung, W. K., Lee, Y. T., To, K. F., Chung, S. C. et al. (2004). Celecoxib versus diclofenac plus omeprazole in high-risk arthritis patients: results of a randomized double-blind trial. Gastroenterology 127, 1038-43. Checchi, S., Montanaro, A., Pasqui, L., Ciuoli, C., Cevenini, G., Sestini, F., Fioravanti, C. and Pacini, F. (2007). Serum ghrelin as a marker of atrophic body gastritis in patients with parietal cell antibodies. J Clin Endocrinol Metab 92, 4346-51. Claeys, D., Faller, G., Appelmelk, B. J., Negrini, R. and Kirchner, T. (1998). The gastric H+,K+-ATPase is a major autoantigen in chronic Helicobacter pylori gastritis with body mucosa atrophy. Gastroenterology 115, 340-7. Coffey, R. J., Jr. and Tanksley, J. (2012). Pierre Menetrier and his disease. Trans Am Clin Climatol Assoc 123, 126-33; discussion 133-4. Corapcioglu, F., Ekingen, G., Sarper, N. and Guvenc, B. H. (2004). Immature gastric teratoma of childhood: a case report and review of the literature. J Pediatr Gastroenterol Nutr 39, 292-4. Corleto, V. D., Annibale, B., Gibril, F., Angeletti, S., Serrano, J., Venzon, D. J., Delle Fave, G. and Jensen, R. T. (2001). Does the widespread use of proton pump inhibitors mask, complicate and/or delay the diagnosis of Zollinger-Ellison syndrome? Aliment Pharmacol Ther 15, 1555-61. Correa, P. (1988). A human model of gastric carcinogenesis. Cancer Res 48, 3554-60. Correa, P., Piazuelo, M. B. and Wilson, K. T. (2010). Pathology of gastric intestinal metaplasia: clinical implications. Am J Gastroenterol 105, 493-8. Cribbs, R. K., Gow, K. W. and Wulkan, M. L. (2008). Gastric volvulus in infants and children. Pediatrics 122, e752-62. Cui, G., Qvigstad, G., Falkmer, S., Sandvik, A. K., Kawase, S. and Waldum, H. L. (2000). Spontaneous ECLomas in cotton rats (Sigmodon hispidus): tumours occurring in hypoacidic/hypergastrinaemic animals with normal parietal cells. Carcinogenesis 21, 23-7. Cui, G., Takaishi, S., Ai, W., Betz, K. S., Florholmen, J., Koh, T. J., Houghton, J., Pritchard, D. M. and Wang, T. C. (2006). Gastrin-induced apoptosis contributes to carcinogenesis in the stomach. Lab Invest 86, 1037-51. Czinn, S. J. and Blanchard, T. (2011). Vaccinating against Helicobacter pylori infection. Nat Rev Gastroenterol Hepatol 8, 133-40. D'Elios, M. M., Bergman, M. P., Azzurri, A., Amedei, A., Benagiano, M., De Pont, J. J., Cianchi, F., Vandenbroucke-Grauls, C. M., Romagnani, S., Appelmelk, B. J. et al. (2001).

H(+),K(+)-atpase (proton pump) is the target autoantigen of Th1-type cytotoxic T cells in autoimmune gastritis. Gastroenterology 120, 377-86. Dan, Y. Y., So, J. B. and Yeoh, K. G. (2006). Endoscopic screening for gastric cancer. Clin Gastroenterol Hepatol 4, 709-16. De Giorgio, R., Di Simone, M. P., Stanghellini, V., Barbara, G., Tonini, M., Salvioli, B., Mattioli, S. and Corinaldesi, R. (1999). Esophageal and gastric nitric oxide synthesizing innervation in primary achalasia. Am J Gastroenterol 94, 2357-62. Debelenko, L. V., Zhuang, Z., Emmert-Buck, M. R., Chandrasekharappa, S. C., Manickam, P., Guru, S. C., Marx, S. J., Skarulis, M. C., Spiegel, A. M., Collins, F. S. et al. (1997). Allelic deletions on chromosome 11q13 in multiple endocrine neoplasia type 1- associated and sporadic gastrinomas and pancreatic endocrine tumors. Cancer Res 57, 2238-43. Del Valle J, S. J. (2003a). Zollinger-Ellison Syndrome. In Textbook of Gastroenterology, vol. 1 (ed. T. Yamada), pp. 1377-1394. Del Valle J, T. A. (2003b). Secretion and Absorption: Gastric Secretion. In Textbook of Gastroenterology, vol. 1 (ed. T. Yamada), pp. 266-307. Dempsey, P. J., Goldenring, J. R., Soroka, C. J., Modlin, I. M., McClure, R. W., Lind, C. D., Ahlquist, D. A., Pittelkow, M. R., Lee, D. C., Sandgren, E. P. et al. (1992). Possible role of transforming growth factor alpha in the pathogenesis of Menetrier's disease: supportive evidence form humans and transgenic mice. Gastroenterology 103, 1950-63. Dinis-Ribeiro, M., Areia, M., de Vries, A. C., Marcos-Pinto, R., Monteiro-Soares, M., O'Connor, A., Pereira, C., Pimentel-Nunes, P., Correia, R., Ensari, A. et al. (2012). Management of precancerous conditions and lesions in the stomach (MAPS): guideline from the European Society of Gastrointestinal Endoscopy (ESGE), European Helicobacter Study Group (EHSG), European Society of Pathology (ESP), and the Sociedade Portuguesa de Endoscopia Digestiva (SPED). Virchows Arch 460, 19-46. DiPaolo, R. J., Brinster, C., Davidson, T. S., Andersson, J., Glass, D. and Shevach, E. M. (2007). Autoantigen-specific TGFbeta-induced Foxp3+ regulatory T cells prevent autoimmunity by inhibiting dendritic cells from activating autoreactive T cells. J Immunol 179, 4685-93. DiPaolo, R. J., Glass, D. D., Bijwaard, K. E. and Shevach, E. M. (2005). CD4+CD25+ T cells prevent the development of organ-specific autoimmune disease by inhibiting the differentiation of autoreactive effector T cells. J Immunol 175, 7135-42. El-Zaatari, M., Kao, J. Y., Tessier, A., Bai, L., Hayes, M. M., Fontaine, C., Eaton, K. A. and Merchant, J. L. (2013). Gli1 deletion prevents Helicobacter-induced gastric metaplasia and expansion of myeloid cell subsets. PLoS One 8, e58935. El-Zaatari, M., Tobias, A., Grabowska, A. M., Kumari, R., Scotting, P. J., Kaye, P., Atherton, J., Clarke, P. A., Powe, D. G. and Watson, S. A. (2007). De-regulation of the sonic hedgehog pathway in the InsGas mouse model of gastric carcinogenesis. Br J Cancer 96, 1855- 61. El-Zimaity, H. (2008). Gastritis and gastric atrophy. Curr Opin Gastroenterol 24, 682-6. Evers, B. M., Rady, P. L., Sandoval, K., Arany, I., Tyring, S. K., Sanchez, R. L., Nealon, W. H., Townsend, C. M., Jr. and Thompson, J. C. (1994). Gastrinomas demonstrate amplification of the HER-2/neu proto-oncogene. Ann Surg 219, 596-601; discussion 602-4. Fenoglio-Preiser C.M., N. A. E., Stemmermann G.N., Lantz P.E., Listrom M.B. (1999). The Normal Anatomy of the Stomach. In Gastrointestinal Pathology: An Atlas and Text, (ed. A. S. Patterson), pp. 133-151. Philadelphia: Lippincott Williams and Wilkins.

Filippi, L., Serafini, L., Fiorini, P., Agostini, E. and Giovannucci Uzielli, M. L. (2008). Congenital microgastria and primary ciliary dyskinesia in a newborn with DiGeorge syndrome and 22q11.2 deletion. Eur J Pediatr Surg 18, 195-7. Fiorucci, S., Santucci, L., Gresele, P., Faccino, R. M., Del Soldato, P. and Morelli, A. (2003). Gastrointestinal safety of NO-aspirin (NCX-4016) in healthy human volunteers: a proof of concept endoscopic study. Gastroenterology 124, 600-7. Fiske, W. H., Tanksley, J., Nam, K. T., Goldenring, J. R., Slebos, R. J., Liebler, D. C., Abtahi, A. M., La Fleur, B., Ayers, G. D., Lind, C. D. et al. (2009). Efficacy of cetuximab in the treatment of Menetrier's disease. Sci Transl Med 1, 8ra18. Fjeldbo, C. S., Bakke, I., Erlandsen, S. E., Holmseth, J., Laegreid, A., Sandvik, A. K., Thommesen, L. and Bruland, T. (2012). Gastrin upregulates the prosurvival factor secretory clusterin in adenocarcinoma cells and in oxyntic mucosa of hypergastrinemic rats. Am J Physiol Gastrointest Liver Physiol 302, G21-33. Fork, F. T., Toth, E. and Lindstrom, C. (1998). Early gastric cancer in a fundic diverticulum. Endoscopy 30, S2. Francis, D. L. and Katzka, D. A. (2010). Achalasia: update on the disease and its treatment. Gastroenterology 139, 369-74. Franco, A. T., Israel, D. A., Washington, M. K., Krishna, U., Fox, J. G., Rogers, A. B., Neish, A. S., Collier-Hyams, L., Perez-Perez, G. I., Hatakeyama, M. et al. (2005). Activation of beta-catenin by carcinogenic Helicobacter pylori. Proc Natl Acad Sci U S A 102, 10646-51. Franic, T. V., Judd, L. M., Robinson, D., Barrett, S. P., Scarff, K. L., Gleeson, P. A., Samuelson, L. C. and Van Driel, I. R. (2001). Regulation of gastric epithelial cell development revealed in H(+)/K(+)-ATPase beta-subunit- and gastrin-deficient mice. Am J Physiol Gastrointest Liver Physiol 281, G1502-11. Fujii, Y., Yoshihashi, K., Suzuki, H., Tsutsumi, S., Mutoh, H., Maeda, S., Yamagata, Y., Seto, Y., Aburatani, H. and Hatakeyama, M. (2012). CDX1 confers intestinal phenotype on gastric epithelial cells via induction of stemness-associated reprogramming factors SALL4 and KLF5. Proc Natl Acad Sci U S A 109, 20584-9. Fukamachi, H., Shimada, S., Ito, K., Ito, Y. and Yuasa, Y. (2011). CD133 is a marker of gland-forming cells in gastric tumors and Sox17 is involved in its regulation. Cancer Sci 102, 1313-21. Galmiche, A., Rassow, J., Doye, A., Cagnol, S., Chambard, J. C., Contamin, S., de Thillot, V., Just, I., Ricci, V., Solcia, E. et al. (2000). The N-terminal 34 kDa fragment of Helicobacter pylori vacuolating cytotoxin targets mitochondria and induces cytochrome c release. EMBO J 19, 6361-70. Gariepy, C. E. (2004). Developmental disorders of the enteric nervous system: genetic and molecular bases. J Pediatr Gastroenterol Nutr 39, 5-11. Genta, R. M. (2003). Gastritis and Gastropathy. In Textbook of Gastroenterology, vol. 1 (ed. T. Yamada), pp. 1394-1415. Philadelphia: Lippincott Williams & Wilkins. Gibril, F., Schumann, M., Pace, A. and Jensen, R. T. (2004). Multiple endocrine neoplasia type 1 and Zollinger-Ellison syndrome: a prospective study of 107 cases and comparison with 1009 cases from the literature. Medicine (Baltimore) 83, 43-83. Gillen, D., el-Omar, E. M., Wirz, A. A., Ardill, J. E. and McColl, K. E. (1998). The acid response to gastrin distinguishes duodenal ulcer patients from Helicobacter pylori-infected healthy subjects. Gastroenterology 114, 50-7.

Giraud, A. S., Menheniott, T. R. and Judd, L. M. (2012). Targeting STAT3 in gastric cancer. Expert Opin Ther Targets 16, 889-901. Gobel, U., Schneider, D. T., Calaminus, G., Haas, R. J., Schmidt, P. and Harms, D. (2000). Germ-cell tumors in childhood and adolescence. GPOH MAKEI and the MAHO study groups. Ann Oncol 11, 263-71. Goldenring, J. R., Nam, K. T. and Mills, J. C. (2011). The origin of pre-neoplastic metaplasia in the stomach: chief cells emerge from the Mist. Exp Cell Res 317, 2759-64. Goldenring, J. R., Nam, K. T., Wang, T. C., Mills, J. C. and Wright, N. A. (2010). Spasmolytic polypeptide-expressing metaplasia and intestinal metaplasia: time for reevaluation of metaplasias and the origins of gastric cancer. Gastroenterology 138, 2207-10, 2210 e1. Goldenring, J. R., Ray, G. S., Coffey, R. J., Meunier, P. C., Haley, P. J., Barnes, T. B. and Car, B. D. (2000). Reversible drug-induced oxyntic atrophy in rats. Gastroenterology 118, 1080- 93. Goldenring, J. R., Ray, G. S., Soroka, C. J., Smith, J., Modlin, I. M., Meise, K. S. and Coffey, R. J., Jr. (1996). Overexpression of transforming growth factor-alpha alters differentiation of gastric cell lineages. Dig Dis Sci 41, 773-84. Gonzalez, C. A., Sala, N. and Capella, G. (2002). Genetic susceptibility and gastric cancer risk. Int J Cancer 100, 249-60. Gray, H. (2008). Gastrointestinal Tract: Abdominal oesophagus and stomach. In Gray's Anatomy: The Anatomical Basis of Clinical Practice, (ed. S. Standring), pp. 1111-1123. Philadelphia: Churchill Livingstone Elsevier. Gritti, I., Banfi, G. and Roi, G. S. (2000). Pepsinogens: physiology, pharmacology pathophysiology and exercise. Pharmacol Res 41, 265-81. Guarino, N., Shima, H., Oue, T. and Puri, P. (2000). Glial-derived growth factor signaling pathway in infantile hypertrophic pyloric stenosis. J Pediatr Surg 35, 835-9. Guilford, P., Hopkins, J., Harraway, J., McLeod, M., McLeod, N., Harawira, P., Taite, H., Scoular, R., Miller, A. and Reeve, A. E. (1998). E-cadherin germline mutations in familial gastric cancer. Nature 392, 402-5. Gutierrez-Gonzalez, L., Graham, T. A., Rodriguez-Justo, M., Leedham, S. J., Novelli, M. R., Gay, L. J., Ventayol-Garcia, T., Green, A., Mitchell, I., Stoker, D. L. et al. (2011). The clonal origins of dysplasia from intestinal metaplasia in the human stomach. Gastroenterology 140, 1251-1260 e1-6. Hagen, S. J., Yang, D. X., Tashima, K., Taylor, N. S. and Fox, J. G. (2008). Epithelial cell expression of BCL-2 family proteins predicts mechanisms that regulate Helicobacter pylori- induced pathology in the mouse stomach. Lab Invest 88, 1227-44. Hamlet, A. and Olbe, L. (1996). The influence of Helicobacter pylori infection on postprandial duodenal acid load and duodenal bulb pH in humans. Gastroenterology 111, 391-400. Handschug, K., Sperling, S., Yoon, S. J., Hennig, S., Clark, A. J. and Huebner, A. (2001). Triple A syndrome is caused by mutations in AAAS, a new WD-repeat protein gene. Hum Mol Genet 10, 283-90. Hayashi, A. H., Galliani, C. A. and Gillis, D. A. (1991). Congenital pyloric atresia and junctional epidermolysis bullosa: a report of long-term survival and a review of the literature. J Pediatr Surg 26, 1341-5. Heanue, T. A. and Pachnis, V. (2007). Enteric nervous system development and Hirschsprung's disease: advances in genetic and stem cell studies. Nat Rev Neurosci 8, 466-79.

Hernaiz Driever, P., Gohlich-Ratmann, G., Konig, R., Heller, K., Schmidt, H., Baum, R. P. and Bohles, H. J. (1997). Congenital microgastria, growth hormone deficiency and diabetes insipidus. Eur J Pediatr 156, 37-40. Higashi, H., Tsutsumi, R., Muto, S., Sugiyama, T., Azuma, T., Asaka, M. and Hatakeyama, M. (2002). SHP-2 tyrosine phosphatase as an intracellular target of Helicobacter pylori CagA protein. Science 295, 683-6. Hippisley-Cox, J., Coupland, C. and Logan, R. (2005). Risk of adverse gastrointestinal outcomes in patients taking cyclo-oxygenase-2 inhibitors or conventional non-steroidal anti- inflammatory drugs: population based nested case-control analysis. BMJ 331, 1310-6. Hirata, Y., Maeda, S., Mitsuno, Y., Tateishi, K., Yanai, A., Akanuma, M., Yoshida, H., Kawabe, T., Shiratori, Y. and Omata, M. (2002). Helicobacter pylori CagA protein activates serum response element-driven transcription independently of tyrosine phosphorylation. Gastroenterology 123, 1962-71. Houghton, J., Stoicov, C., Nomura, S., Rogers, A. B., Carlson, J., Li, H., Cai, X., Fox, J. G., Goldenring, J. R. and Wang, T. C. (2004). Gastric cancer originating from bone marrow- derived cells. Science 306, 1568-71. Houghton, J. M., Bloch, L. M., Goldstein, M., Von Hagen, S. and Korah, R. M. (2000). In vivo disruption of the fas pathway abrogates gastric growth alterations secondary to Helicobacter infection. J Infect Dis 182, 856-64. Huang, F. Y., Chan, A. O., Rashid, A., Wong, D. K., Cho, C. H. and Yuen, M. F. (2012). Helicobacter pylori induces promoter methylation of E-cadherin via interleukin-1beta activation of nitric oxide production in gastric cancer cells. Cancer 118, 4969-80. Huang, J. Q., Sridhar, S. and Hunt, R. H. (2002). Role of Helicobacter pylori infection and non-steroidal anti-inflammatory drugs in peptic-ulcer disease: a meta-analysis. Lancet 359, 14- 22. Huang, J. Q., Zheng, G. F., Sumanac, K., Irvine, E. J. and Hunt, R. H. (2003). Meta-analysis of the relationship between cagA seropositivity and gastric cancer. Gastroenterology 125, 1636- 44. Huang, P. L., Dawson, T. M., Bredt, D. S., Snyder, S. H. and Fishman, M. C. (1993). Targeted disruption of the neuronal nitric oxide synthase gene. Cell 75, 1273-86. Huh, W. J., Khurana, S. S., Geahlen, J. H., Kohli, K., Waller, R. A. and Mills, J. C. (2012). Tamoxifen induces rapid, reversible atrophy, and metaplasia in mouse stomach. Gastroenterology 142, 21-24 e7. Humar, B., Blair, V., Charlton, A., More, H., Martin, I. and Guilford, P. (2009). E-cadherin deficiency initiates gastric signet-ring cell carcinoma in mice and man. Cancer Res 69, 2050-6. Ilce, Z., Erdogan, E., Kara, C., Celayir, S., Sarimurat, N., Senyuz, O. F. and Yeker, D. (2003). Pyloric atresia: 15-year review from a single institution. J Pediatr Surg 38, 1581-4. Ito, M., Takata, S., Tatsugami, M., Wada, Y., Imagawa, S., Matsumoto, Y., Takamura, A., Kitamura, S., Matsuo, T., Tanaka, S. et al. (2009). Clinical prevention of gastric cancer by Helicobacter pylori eradication therapy: a systematic review. J Gastroenterol 44, 365-71. Ito, T., Cadiot, G. and Jensen, R. T. (2012). Diagnosis of Zollinger-Ellison syndrome: increasingly difficult. World J Gastroenterol 18, 5495-503. Jain, R. N. and Samuelson, L. C. (2006). Differentiation of the gastric mucosa. II. Role of gastrin in gastric epithelial cell proliferation and maturation. Am J Physiol Gastrointest Liver Physiol 291, G762-5.

Jenkins, B. J., Grail, D., Nheu, T., Najdovska, M., Wang, B., Waring, P., Inglese, M., McLoughlin, R. M., Jones, S. A., Topley, N. et al. (2005). Hyperactivation of Stat3 in gp130 mutant mice promotes gastric hyperproliferation and desensitizes TGF-beta signaling. Nat Med 11, 845-52. Jia, D., Sun, Y. and Konieczny, S. F. (2008). Mist1 regulates pancreatic acinar cell proliferation through p21 CIP1/WAF1. Gastroenterology 135, 1687-97. Jiang, J., Zhang, Y., Chuai, S., Wang, Z., Zheng, D., Xu, F., Zhang, Y., Li, C., Liang, Y. and Chen, Z. (2012). Trastuzumab (herceptin) targets gastric cancer stem cells characterized by CD90 phenotype. Oncogene 31, 671-82. Jiang, Q. J. and Uitto, J. (2005). Animal models of epidermolysis bullosa--targets for gene therapy. J Invest Dermatol 124, xi-xiii. Johnson, C. L., Kowalik, A. S., Rajakumar, N. and Pin, C. L. (2004). Mist1 is necessary for the establishment of granule organization in serous exocrine cells of the gastrointestinal tract. Mech Dev 121, 261-72. Judd, L. M., Alderman, B. M., Howlett, M., Shulkes, A., Dow, C., Moverley, J., Grail, D., Jenkins, B. J., Ernst, M. and Giraud, A. S. (2004). Gastric cancer development in mice lacking the SHP2 binding site on the IL-6 family co-receptor gp130. Gastroenterology 126, 196- 207. Judd, L. M., Bredin, K., Kalantzis, A., Jenkins, B. J., Ernst, M. and Giraud, A. S. (2006). STAT3 activation regulates growth, inflammation, and vascularization in a mouse model of gastric tumorigenesis. Gastroenterology 131, 1073-85. Kano, M. R., Bae, Y., Iwata, C., Morishita, Y., Yashiro, M., Oka, M., Fujii, T., Komuro, A., Kiyono, K., Kaminishi, M. et al. (2007). Improvement of cancer-targeting therapy, using nanocarriers for intractable solid tumors by inhibition of TGF-beta signaling. Proc Natl Acad Sci U S A 104, 3460-5. Kao, J. Y., Zhang, M., Miller, M. J., Mills, J. C., Wang, B., Liu, M., Eaton, K. A., Zou, W., Berndt, B. E., Cole, T. S. et al. (2010). Helicobacter pylori immune escape is mediated by dendritic cell-induced Treg skewing and Th17 suppression in mice. Gastroenterology 138, 1046- 54. Karam, S. and Leblond, C. P. (1995). Origin and migratory pathways of the eleven epithelial cell types present in the body of the mouse stomach. Microsc Res Tech 31, 193-214. Karam, S. M. (1993). Dynamics of epithelial cells in the corpus of the mouse stomach. IV. Bidirectional migration of parietal cells ending in their gradual degeneration and loss. Anat Rec 236, 314-32. Karam, S. M. and Leblond, C. P. (1993a). Dynamics of epithelial cells in the corpus of the mouse stomach. I. Identification of proliferative cell types and pinpointing of the stem cell. Anat Rec 236, 259-79. Karam, S. M. and Leblond, C. P. (1993b). Dynamics of epithelial cells in the corpus of the mouse stomach. II. Outward migration of pit cells. Anat Rec 236, 280-96. Karam, S. M. and Leblond, C. P. (1993c). Dynamics of epithelial cells in the corpus of the mouse stomach. III. Inward migration of neck cells followed by progressive transformation into zymogenic cells. Anat Rec 236, 297-313. Karam, S. M. and Leblond, C. P. (1993d). Dynamics of epithelial cells in the corpus of the mouse stomach. V. Behavior of entero-endocrine and caveolated cells: general conclusions on cell kinetics in the oxyntic epithelium. Anat Rec 236, 333-40.

Karam, S. M., Straiton, T., Hassan, W. M. and Leblond, C. P. (2003). Defining epithelial cell progenitors in the human oxyntic mucosa. Stem Cells 21, 322-36. Karlsson, F. A., Burman, P., Loof, L. and Mardh, S. (1988). Major parietal cell antigen in autoimmune gastritis with pernicious anemia is the acid-producing H+,K+-adenosine triphosphatase of the stomach. J Clin Invest 81, 475-9. Kataoka, K., Sakano, Y. and Miura, J. (1984). Histogenesis of the mouse gastric mucosa, with special reference to type and distribution of proliferative cells. Arch Histol Jpn 47, 459-74. Katoh, M. and Katoh, M. (2006). FGF signaling network in the gastrointestinal tract (review). Int J Oncol 29, 163-8. Kazumori, H., Ishihara, S., Kawashima, K., Fukuda, R., Chiba, T. and Kinoshita, Y. (2001). Analysis of gastrin receptor gene expression in proliferating cells in the neck zone of gastric fundic glands using laser capture microdissection. FEBS Lett 489, 208-14. Khan, Z. E., Wang, T. C., Cui, G., Chi, A. L. and Dimaline, R. (2003). Transcriptional regulation of the human trefoil factor, TFF1, by gastrin. Gastroenterology 125, 510-21. Khurana, S. S., Riehl, T. E., Moore, B. D., Fassan, M., Rugge, M., Romero-Gallo, J., Noto, J., Peek, R. M., Stenson, W. F. and Mills, J. C. (2013). The hyaluronic acid receptor CD44 coordinates normal and metaplastic gastric epithelial progenitor cell proliferation. J Biol Chem. Kidd, M., Hinoue, T., Eick, G., Lye, K. D., Mane, S. M., Wen, Y. and Modlin, I. M. (2004). Global expression analysis of ECL cells in Mastomys natalensis gastric mucosa identifies alterations in the AP-1 pathway induced by gastrin-mediated transformation. Physiol Genomics 20, 131-42. Kidd, M., Modlin, I. M., Eick, G. N., Camp, R. L. and Mane, S. M. (2007). Role of CCN2/CTGF in the proliferation of Mastomys enterochromaffin-like cells and gastric carcinoid development. Am J Physiol Gastrointest Liver Physiol 292, G191-200. Kidd, M., Siddique, Z. L., Drozdov, I., Gustafsson, B. I., Camp, R. L., Black, J. W., Boyce, M. and Modlin, I. M. (2010). The CCK(2) receptor antagonist, YF476, inhibits Mastomys ECL cell hyperplasia and gastric carcinoid tumor development. Regul Pept 162, 52-60. Kidd, M., Tang, L. H., Modlin, I. M., Zhang, T., Chin, K., Holt, P. R. and Moss, S. F. (2000). Gastrin-mediated alterations in gastric epithelial apoptosis and proliferation in a mastomys rodent model of gastric neoplasia. Digestion 62, 143-51. Kidd, M., Tang, L. H., Schmid, S. W., Miu, K. and Modlin, I. M. (1998). A polyamine pathway-mediated mitogenic mechanism in enterochromaffin-like cells of Mastomys. Am J Physiol 275, G370-6. Kim, P. C., Mo, R. and Hui Cc, C. (2001). Murine models of VACTERL syndrome: Role of sonic hedgehog signaling pathway. J Pediatr Surg 36, 381-4. Kim, T. H. and Shivdasani, R. A. (2011). Notch signaling in stomach epithelial stem cell homeostasis. J Exp Med 208, 677-88. Kimura, T., Suzuki, A., Fujita, Y., Yomogida, K., Lomeli, H., Asada, N., Ikeuchi, M., Nagy, A., Mak, T. W. and Nakano, T. (2003). Conditional loss of PTEN leads to testicular teratoma and enhances embryonic germ cell production. Development 130, 1691-700. Kowalik, A. S., Johnson, C. L., Chadi, S. A., Weston, J. Y., Fazio, E. N. and Pin, C. L. (2007). Mice lacking the transcription factor Mist1 exhibit an altered stress response and increased sensitivity to caerulein-induced pancreatitis. Am J Physiol Gastrointest Liver Physiol 292, G1123-32. Kroes, E. J. and Festen, C. (1998). Congenital microgastria: a case report and review of literature. Pediatr Surg Int 13, 416-8.

Kurayoshi, M., Oue, N., Yamamoto, H., Kishida, M., Inoue, A., Asahara, T., Yasui, W. and Kikuchi, A. (2006). Expression of Wnt-5a is correlated with aggressiveness of gastric cancer by stimulating cell migration and invasion. Cancer Res 66, 10439-48. Laine, L., Harper, S., Simon, T., Bath, R., Johanson, J., Schwartz, H., Stern, S., Quan, H. and Bolognese, J. (1999). A randomized trial comparing the effect of rofecoxib, a cyclooxygenase 2-specific inhibitor, with that of ibuprofen on the gastroduodenal mucosa of patients with osteoarthritis. Rofecoxib Osteoarthritis Endoscopy Study Group. Gastroenterology 117, 776-83. Laine, L., Takeuchi, K. and Tarnawski, A. (2008). Gastric mucosal defense and cytoprotection: bench to bedside. Gastroenterology 135, 41-60. Lambrecht, N. W. (2011). Menetrier's disease of the stomach: a clinical challenge. Curr Gastroenterol Rep 13, 513-7. Lanas, A., Bajador, E., Serrano, P., Fuentes, J., Carreno, S., Guardia, J., Sanz, M., Montoro, M. and Sainz, R. (2000). Nitrovasodilators, low-dose aspirin, other nonsteroidal antiinflammatory drugs, and the risk of upper gastrointestinal bleeding. N Engl J Med 343, 834- 9. Larsson, C., Shepherd, J., Nakamura, Y., Blomberg, C., Weber, G., Werelius, B., Hayward, N., Teh, B., Tokino, T. and Seizinger, B. (1992). Predictive testing for multiple endocrine neoplasia type 1 using DNA polymorphisms. J Clin Invest 89, 1344-9. Larsson, S. C., Bergkvist, L. and Wolk, A. (2006). Fruit and vegetable consumption and incidence of gastric cancer: a prospective study. Cancer Epidemiol Biomarkers Prev 15, 1998- 2001. Lawrence, B., Kidd, M., Svejda, B. and Modlin, I. (2011). A clinical perspective on gastric neuroendocrine neoplasia. Curr Gastroenterol Rep 13, 101-9. Lee, E. R. (1985). Dynamic histology of the antral epithelium in the mouse stomach: III. Ultrastructure and renewal of pit cells. Am J Anat 172, 225-40. Lee, E. R. and Leblond, C. P. (1985a). Dynamic histology of the antral epithelium in the mouse stomach: II. Ultrastructure and renewal of isthmal cells. Am J Anat 172, 205-24. Lee, E. R. and Leblond, C. P. (1985b). Dynamic histology of the antral epithelium in the mouse stomach: IV. Ultrastructure and renewal of gland cells. Am J Anat 172, 241-59. Lee, H. J., Nam, K. T., Park, H. S., Kim, M. A., Lafleur, B. J., Aburatani, H., Yang, H. K., Kim, W. H. and Goldenring, J. R. (2010). Gene expression profiling of metaplastic lineages identifies CDH17 as a prognostic marker in early stage gastric cancer. Gastroenterology 139, 213-25 e3. Lehy, T., Cadiot, G., Mignon, M., Ruszniewski, P. and Bonfils, S. (1992). Influence of multiple endocrine neoplasia type 1 on gastric endocrine cells in patients with the Zollinger- Ellison syndrome. Gut 33, 1275-9. Lemercier, C., To, R. Q., Swanson, B. J., Lyons, G. E. and Konieczny, S. F. (1997). Mist1: a novel basic helix-loop-helix transcription factor exhibits a developmentally regulated expression pattern. Dev Biol 182, 101-13. Lennerz, J. K., Kim, S. H., Oates, E. L., Huh, W. J., Doherty, J. M., Tian, X., Bredemeyer, A. J., Goldenring, J. R., Lauwers, G. Y., Shin, Y. K. et al. (2010). The transcription factor MIST1 is a novel human gastric chief cell marker whose expression is lost in metaplasia, dysplasia, and carcinoma. Am J Pathol 177, 1514-33. Leung, W. K. N., E.K.W.; Sung, J.J.Y. (2003). Tumors of the Stomach. In Textbook of Gastroenterology, vol. 1 (ed. T. Yamada), pp. 1416-1440.

Ley, C., Mohar, A., Guarner, J., Herrera-Goepfert, R., Figueroa, L. S., Halperin, D., Johnstone, I. and Parsonnet, J. (2004). Helicobacter pylori eradication and gastric preneoplastic conditions: a randomized, double-blind, placebo-controlled trial. Cancer Epidemiol Biomarkers Prev 13, 4-10. Li, Q., Jia, Z., Wang, L., Kong, X., Li, Q., Guo, K., Tan, D., Le, X., Wei, D., Huang, S. et al. (2012). Disruption of Klf4 in villin-positive gastric progenitor cells promotes formation and progression of tumors of the antrum in mice. Gastroenterology 142, 531-42. Li, Q. L., Ito, K., Sakakura, C., Fukamachi, H., Inoue, K., Chi, X. Z., Lee, K. Y., Nomura, S., Lee, C. W., Han, S. B. et al. (2002). Causal relationship between the loss of RUNX3 expression and gastric cancer. Cell 109, 113-24. Lichtenberger, L. M., Barron, M. and Marathi, U. (2009). Association of phosphatidylcholine and NSAIDs as a novel strategy to reduce gastrointestinal toxicity. Drugs Today (Barc) 45, 877- 90. Loh, M., Koh, K. X., Yeo, B. H., Song, C. M., Chia, K. S., Zhu, F., Yeoh, K. G., Hill, J., Iacopetta, B. and Soong, R. (2009). Meta-analysis of genetic polymorphisms and gastric cancer risk: variability in associations according to race. Eur J Cancer 45, 2562-8. Lohmander, L. S., McKeith, D., Svensson, O., Malmenas, M., Bolin, L., Kalla, A., Genti, G., Szechinski, J., Ramos-Remus, C. and Group, S. M. S. (2005). A randomised, placebo controlled, comparative trial of the gastrointestinal safety and efficacy of AZD3582 versus naproxen in osteoarthritis. Ann Rheum Dis 64, 449-56. Luo, X., Shin, D. M., Wang, X., Konieczny, S. F. and Muallem, S. (2005). Aberrant localization of intracellular organelles, Ca2+ signaling, and exocytosis in Mist1 null mice. J Biol Chem 280, 12668-75. Luther, J., Higgins, P. D., Schoenfeld, P. S., Moayyedi, P., Vakil, N. and Chey, W. D. (2010). Empiric quadruple vs. triple therapy for primary treatment of Helicobacter pylori infection: Systematic review and meta-analysis of efficacy and tolerability. Am J Gastroenterol 105, 65-73. Luzza, F., Parrello, T., Monteleone, G., Sebkova, L., Romano, M., Zarrilli, R., Imeneo, M. and Pallone, F. (2000). Up-regulation of IL-17 is associated with bioactive IL-8 expression in Helicobacter pylori-infected human gastric mucosa. J Immunol 165, 5332-7. Macdonald, W. C., Trier, J. S. and Everett, N. B. (1964). Cell Proliferation and Migration in the Stomach, Duodenum, and Rectum of Man: Radioautographic Studies. Gastroenterology 46, 405-17. Macpherson, R. I. (1993). Gastrointestinal tract duplications: clinical, pathologic, etiologic, and radiologic considerations. Radiographics 13, 1063-80. Malfertheiner, P., Bazzoli, F., Delchier, J. C., Celinski, K., Giguere, M., Riviere, M., Megraud, F. and Pylera Study, G. (2011). Helicobacter pylori eradication with a capsule containing bismuth subcitrate potassium, metronidazole, and tetracycline given with omeprazole versus clarithromycin-based triple therapy: a randomised, open-label, non-inferiority, phase 3 trial. Lancet 377, 905-13. Malfertheiner, P., Megraud, F., O'Morain, C., Hungin, A. P., Jones, R., Axon, A., Graham, D. Y., Tytgat, G. and European Helicobacter Pylori Study, G. (2002). Current concepts in the management of Helicobacter pylori infection--the Maastricht 2-2000 Consensus Report. Aliment Pharmacol Ther 16, 167-80. Maloum, F., Allaire, J. M., Gagne-Sansfacon, J., Roy, E., Belleville, K., Sarret, P., Morisset, J., Carrier, J. C., Mishina, Y., Kaestner, K. H. et al. (2011). Epithelial BMP signaling is

required for proper specification of epithelial cell lineages and gastric endocrine cells. Am J Physiol Gastrointest Liver Physiol 300, G1065-79. Martin, J., Donnelly, J. M., Houghton, J. and Zavros, Y. (2010). The role of sonic hedgehog reemergence during gastric cancer. Dig Dis Sci 55, 1516-24. Martinsen, T. C., Kawase, S., Hakanson, R., Torp, S. H., Fossmark, R., Qvigstad, G., Sandvik, A. K. and Waldum, H. L. (2003). Spontaneous ECL cell carcinomas in cotton rats: natural course and prevention by a gastrin receptor antagonist. Carcinogenesis 24, 1887-96. McCarthy, D. M. (2010). Adverse effects of proton pump inhibitor drugs: clues and conclusions. Curr Opin Gastroenterol 26, 624-31. McDonald, S. A., Greaves, L. C., Gutierrez-Gonzalez, L., Rodriguez-Justo, M., Deheragoda, M., Leedham, S. J., Taylor, R. W., Lee, C. Y., Preston, S. L., Lovell, M. et al. (2008). Mechanisms of field cancerization in the human stomach: the expansion and spread of mutated gastric stem cells. Gastroenterology 134, 500-10. McElreath, D. P., Olden, K. W. and Aduli, F. (2008). Hiccups: a subtle sign in the clinical diagnosis of gastric volvulus and a review of the literature. Dig Dis Sci 53, 3033-6. Mearin, F., Papo, M. and Malagelada, J. R. (1995). Impaired gastric relaxation in patients with achalasia. Gut 36, 363-8. Megraud, F. (2004). H pylori antibiotic resistance: prevalence, importance, and advances in testing. Gut 53, 1374-84. Menard, D., Arsenault, P. and Monfils, S. (1993). Maturation of human fetal stomach in organ culture. Gastroenterology 104, 492-501. Metz, D. C. (2012). Diagnosis of the Zollinger-Ellison syndrome. Clin Gastroenterol Hepatol 10, 126-30. Miki, K. (2006). Gastric cancer screening using the serum pepsinogen test method. Gastric Cancer 9, 245-53. Miller, D. L., Pasquale, M. D., Seneca, R. P. and Hodin, E. (1991). Gastric volvulus in the pediatric population. Arch Surg 126, 1146-9. Mills, J. C. and Taghert, P. H. (2012). Scaling factors: transcription factors regulating subcellular domains. Bioessays 34, 10-6. Mimata, A., Fukamachi, H., Eishi, Y. and Yuasa, Y. (2011). Loss of E-cadherin in mouse gastric epithelial cells induces signet ring-like cells, a possible precursor lesion of diffuse gastric cancer. Cancer Sci 102, 942-50. Mimuro, H., Suzuki, T., Tanaka, J., Asahi, M., Haas, R. and Sasakawa, C. (2002). Grb2 is a key mediator of helicobacter pylori CagA protein activities. Mol Cell 10, 745-55. Mizuno, H., Sakamoto, C., Matsuda, K., Wada, K., Uchida, T., Noguchi, H., Akamatsu, T. and Kasuga, M. (1997). Induction of cyclooxygenase 2 in gastric mucosal lesions and its inhibition by the specific antagonist delays healing in mice. Gastroenterology 112, 387-97. Modlin, I. M., Zhu, Z., Tang, L. H., Kidd, M., Lawton, G. P., Miu, K., Powers, R. E., Goldenring, J. R., Pasikhov, D. and Soroka, C. J. (1996). Evidence for a regulatory role for histamine in gastric enterochromaffin-like cell proliferation induced by hypergastrinemia. Digestion 57, 310-21. Mohammadi, M., Czinn, S., Redline, R. and Nedrud, J. (1996). Helicobacter-specific cell- mediated immune responses display a predominant Th1 phenotype and promote a delayed-type hypersensitivity response in the stomachs of mice. J Immunol 156, 4729-38. Mohan, P., Ananthavadivelu, M. and Venkataraman, J. (2010). Gastric diverticulum. CMAJ 182, E226.

Moss, S. F., Legon, S., Bishop, A. E., Polak, J. M. and Calam, J. (1992). Effect of Helicobacter pylori on gastric somatostatin in duodenal ulcer disease. Lancet 340, 930-2. Murakami, M., Fukuzawa, M., Yamamoto, M., Hamaya, K., Tamura, Y., Sugiyama, A., Takahashi, R., Murakami, T., Amagase, K. and Takeuchi, K. (2013). Effects of Helicobacter pylori Infection on Gastric Parietal Cells and E-cadherin in Mongolian Gerbils. J Pharmacol Sci 121, 305-11. Murata-Kamiya, N., Kurashima, Y., Teishikata, Y., Yamahashi, Y., Saito, Y., Higashi, H., Aburatani, H., Akiyama, T., Peek, R. M., Jr., Azuma, T. et al. (2007). Helicobacter pylori CagA interacts with E-cadherin and deregulates the beta-catenin signal that promotes intestinal transdifferentiation in gastric epithelial cells. Oncogene 26, 4617-26. Muscarella, P., Melvin, W. S., Fisher, W. E., Foor, J., Ellison, E. C., Herman, J. G., Schirmer, W. J., Hitchcock, C. L., DeYoung, B. R. and Weghorst, C. M. (1998). Genetic alterations in gastrinomas and nonfunctioning pancreatic neuroendocrine tumors: an analysis of p16/MTS1 tumor suppressor gene inactivation. Cancer Res 58, 237-40. Mutoh, H., Hayakawa, H., Sakamoto, H., Sashikawa, M. and Sugano, K. (2009). Transgenic Cdx2 induces endogenous Cdx1 in intestinal metaplasia of Cdx2-transgenic mouse stomach. FEBS J 276, 5821-31. Mutoh, H., Sakurai, S., Satoh, K., Osawa, H., Hakamata, Y., Takeuchi, T. and Sugano, K. (2004). Cdx1 induced intestinal metaplasia in the transgenic mouse stomach: comparative study with Cdx2 transgenic mice. Gut 53, 1416-23. Nakamura, H., Natsuga, K., Nishie, W., McMillan, J. R., Nakamura, H., Sawamura, D., Akiyama, M. and Shimizu, H. (2011). DNA-based prenatal diagnosis of plectin-deficient epidermolysis bullosa simplex associated with pyloric atresia. Int J Dermatol 50, 439-42. Nam, K. T., Lee, H. J., Mok, H., Romero-Gallo, J., Crowe, J. E., Jr., Peek, R. M., Jr. and Goldenring, J. R. (2009). Amphiregulin-deficient mice develop spasmolytic polypeptide expressing metaplasia and intestinal metaplasia. Gastroenterology 136, 1288-96. Nam, K. T., Lee, H. J., Sousa, J. F., Weis, V. G., O'Neal, R. L., Finke, P. E., Romero-Gallo, J., Shi, G., Mills, J. C., Peek, R. M., Jr. et al. (2010). Mature chief cells are cryptic progenitors for metaplasia in the stomach. Gastroenterology 139, 2028-2037 e9. Neifeld, J. P., Berman, W. F., Lawrence, W., Jr., Kodroff, M. B. and Salzberg, A. M. (1980). Management of congenital microgastria with a jejunal reservoir pouch. J Pediatr Surg 15, 882-5. Neu, B., Randlkofer, P., Neuhofer, M., Voland, P., Mayerhofer, A., Gerhard, M., Schepp, W. and Prinz, C. (2002). Helicobacter pylori induces apoptosis of rat gastric parietal cells. Am J Physiol Gastrointest Liver Physiol 283, G309-18. Nguyen, T. L., Sullivan, N. L., Ebel, M., Teague, R. M. and DiPaolo, R. J. (2011). Antigen- specific TGF-beta-induced regulatory T cells secrete chemokines, regulate T cell trafficking, and suppress ongoing autoimmunity. J Immunol 187, 1745-53. Niessen, C. M., van der Raaij-Helmer, M. H., Hulsman, E. H., van der Neut, R., Jonkman, M. F. and Sonnenberg, A. (1996). Deficiency of the integrin beta 4 subunit in junctional epidermolysis bullosa with pyloric atresia: consequences for hemidesmosome formation and adhesion properties. J Cell Sci 109 ( Pt 7), 1695-706. Nilsson, O., Wangberg, B., Johansson, L., Theodorsson, E., Dahlstrom, A., Modlin, I. M. and Ahlman, H. (1993). Rapid induction of enterochromaffinlike cell tumors by histamine2- receptor blockade. Am J Pathol 142, 1173-85.

Nomura, S., Esumi, H., Job, C. and Tan, S. S. (1998). Lineage and clonal development of gastric glands. Dev Biol 204, 124-35. Nomura, S., Settle, S. H., Leys, C. M., Means, A. L., Peek, R. M., Jr., Leach, S. D., Wright, C. V., Coffey, R. J. and Goldenring, J. R. (2005a). Evidence for repatterning of the gastric fundic epithelium associated with Menetrier's disease and TGFalpha overexpression. Gastroenterology 128, 1292-305. Nomura, S., Yamaguchi, H., Ogawa, M., Wang, T. C., Lee, J. R. and Goldenring, J. R. (2005b). Alterations in gastric mucosal lineages induced by acute oxyntic atrophy in wild-type and gastrin-deficient mice. Am J Physiol Gastrointest Liver Physiol 288, G362-75. Nozaki, K., Ogawa, M., Williams, J. A., Lafleur, B. J., Ng, V., Drapkin, R. I., Mills, J. C., Konieczny, S. F., Nomura, S. and Goldenring, J. R. (2008). A molecular signature of gastric metaplasia arising in response to acute parietal cell loss. Gastroenterology 134, 511-22. Nozaki, K., Weis, V., Wang, T. C., Falus, A. and Goldenring, J. R. (2009). Altered gastric chief cell lineage differentiation in histamine-deficient mice. Am J Physiol Gastrointest Liver Physiol 296, G1211-20. O'Donnell, P. L., Morrow, J. B. and Fitzgerald, T. L. (2005). Adult gastric duplication cysts: a case report and review of literature. Am Surg 71, 522-5. Oertli, M., Noben, M., Engler, D. B., Semper, R. P., Reuter, S., Maxeiner, J., Gerhard, M., Taube, C. and Muller, A. (2013). Helicobacter pylori gamma-glutamyl transpeptidase and vacuolating cytotoxin promote gastric persistence and immune tolerance. Proc Natl Acad Sci U S A 110, 3047-52. Ogawa, Y., Higashimoto, Y., Nishijima, E., Muraji, T., Yamazato, M., Tsugawa, C. and Matsumoto, Y. (1996). Successful endoscopic balloon dilatation for hypertrophic pyloric stenosis. J Pediatr Surg 31, 1712-4. Oh, J. D., Karam, S. M. and Gordon, J. I. (2005). Intracellular Helicobacter pylori in gastric epithelial progenitors. Proc Natl Acad Sci U S A 102, 5186-91. Ohnishi, H., Ernst, S. A., Wys, N., McNiven, M. and Williams, J. A. (1996). Rab3D localizes to zymogen granules in rat pancreatic acini and other exocrine glands. Am J Physiol 271, G531- 8. Oksanen, A. M., Haimila, K. E., Rautelin, H. I. and Partanen, J. A. (2010). Immunogenetic characteristics of patients with autoimmune gastritis. World J Gastroenterol 16, 354-8. Olbe, L., Hamlet, A., Dalenback, J. and Fandriks, L. (1996). A mechanism by which Helicobacter pylori infection of the antrum contributes to the development of duodenal ulcer. Gastroenterology 110, 1386-94. Oosterhuis, J. W. and Looijenga, L. H. (2005). Testicular germ-cell tumours in a broader perspective. Nat Rev Cancer 5, 210-22. Orlando, L. A., Lenard, L. and Orlando, R. C. (2007). Chronic hypergastrinemia: causes and consequences. Dig Dis Sci 52, 2482-9. Oshima, H., Matsunaga, A., Fujimura, T., Tsukamoto, T., Taketo, M. M. and Oshima, M. (2006). Carcinogenesis in mouse stomach by simultaneous activation of the Wnt signaling and prostaglandin E2 pathway. Gastroenterology 131, 1086-95. Oshima, H. and Oshima, M. (2010). Mouse models of gastric tumors: Wnt activation and PGE2 induction. Pathol Int 60, 599-607. Oshima, H., Oshima, M., Inaba, K. and Taketo, M. M. (2004). Hyperplastic gastric tumors induced by activated macrophages in COX-2/mPGES-1 transgenic mice. EMBO J 23, 1669-78.

Peeters, B., Benninga, M. A. and Hennekam, R. C. (2012). Infantile hypertrophic pyloric stenosis--genetics and syndromes. Nat Rev Gastroenterol Hepatol 9, 646-60. Peleteiro, B., La Vecchia, C. and Lunet, N. (2012). The role of Helicobacter pylori infection in the web of gastric cancer causation. Eur J Cancer Prev 21, 118-25. Peterson, C. M., Buckley, C., Holley, S. and Menias, C. O. (2012). Teratomas: a multimodality review. Curr Probl Diagn Radiol 41, 210-9. Pfendner, E. and Uitto, J. (2005). Plectin gene mutations can cause epidermolysis bullosa with pyloric atresia. J Invest Dermatol 124, 111-5. Pfendner, E. G., Bruckner, A., Conget, P., Mellerio, J., Palisson, F. and Lucky, A. W. (2007). Basic science of epidermolysis bullosa and diagnostic and molecular characterization: Proceedings of the IInd International Symposium on Epidermolysis Bullosa, Santiago, Chile, 2005. Int J Dermatol 46, 781-94. Pfendner, E. G., Nakano, A., Pulkkinen, L., Christiano, A. M. and Uitto, J. (2003). Prenatal diagnosis for epidermolysis bullosa: a study of 144 consecutive pregnancies at risk. Prenat Diagn 23, 447-56. Pin, C. (2012). A new class of transcription factors? Bioessays 34, 6. Pin, C. L., Bonvissuto, A. C. and Konieczny, S. F. (2000). Mist1 expression is a common link among serous exocrine cells exhibiting regulated exocytosis. Anat Rec 259, 157-67. Pin, C. L., Rukstalis, J. M., Johnson, C. and Konieczny, S. F. (2001). The bHLH transcription factor Mist1 is required to maintain exocrine pancreas cell organization and acinar cell identity. J Cell Biol 155, 519-30. Poon, T. S., Zhang, A. L., Cartmill, T. and Cass, D. T. (1996). Changing patterns of diagnosis and treatment of infantile hypertrophic pyloric stenosis: a clinical audit of 303 patients. J Pediatr Surg 31, 1611-5. Price, T. J., Shapiro, J. D., Segelov, E., Karapetis, C. S., Pavlakis, N., Van Cutsem, E., Shah, M. A., Kang, Y. K. and Tebbutt, N. C. (2012). Management of advanced gastric cancer. Expert Rev Gastroenterol Hepatol 6, 199-208; quiz 209. Pritchard, D. M., Berry, D., Przemeck, S. M., Campbell, F., Edwards, S. W. and Varro, A. (2008). Gastrin increases mcl-1 expression in type I gastric carcinoid tumors and a gastric epithelial cell line that expresses the CCK-2 receptor. Am J Physiol Gastrointest Liver Physiol 295, G798-805. Quante, M., Marrache, F., Goldenring, J. R. and Wang, T. C. (2010). TFF2 mRNA transcript expression marks a gland progenitor cell of the gastric oxyntic mucosa. Gastroenterology 139, 2018-2027 e2. Raju, D., Hussey, S., Ang, M., Terebiznik, M. R., Sibony, M., Galindo-Mata, E., Gupta, V., Blanke, S. R., Delgado, A., Romero-Gallo, J. et al. (2012). Vacuolating cytotoxin and variants in Atg16L1 that disrupt autophagy promote Helicobacter pylori infection in humans. Gastroenterology 142, 1160-71. Ramos, C. T., Moss, R. L. and Musemeche, C. A. (1996). Microgastria as an isolated anomaly. J Pediatr Surg 31, 1445-7. Ramsey, V. G., Doherty, J. M., Chen, C. C., Stappenbeck, T. S., Konieczny, S. F. and Mills, J. C. (2007). The maturation of mucus-secreting gastric epithelial progenitors into digestive- enzyme secreting zymogenic cells requires Mist1. Development 134, 211-22. Rashid, F., Aber, A. and Iftikhar, S. Y. (2012). A review on gastric diverticulum. World J Emerg Surg 7, 1.

Rashid, F., Thangarajah, T., Mulvey, D., Larvin, M. and Iftikhar, S. Y. (2010). A review article on gastric volvulus: a challenge to diagnosis and management. Int J Surg 8, 18-24. Read, S., Hogan, T. V., Zwar, T. D., Gleeson, P. A. and Van Driel, I. R. (2007). Prevention of autoimmune gastritis in mice requires extra-thymic T-cell deletion and suppression by regulatory T cells. Gastroenterology 133, 547-58. Rich, A., Toro, T. Z., Tanksley, J., Fiske, W. H., Lind, C. D., Ayers, G. D., Piessevaux, H., Washington, M. K. and Coffey, R. J. (2010). Distinguishing Menetrier's disease from its mimics. Gut 59, 1617-24. Rindi, G., Luinetti, O., Cornaggia, M., Capella, C. and Solcia, E. (1993). Three subtypes of gastric argyrophil carcinoid and the gastric neuroendocrine carcinoma: a clinicopathologic study. Gastroenterology 104, 994-1006. Rodeberg, D. A., Zaheer, S., Moir, C. R. and Ishitani, M. B. (2002). Gastric diverticulum: a series of four pediatric patients. J Pediatr Gastroenterol Nutr 34, 564-7. Rokkas, T., Pistiolas, D., Sechopoulos, P., Robotis, I. and Margantinis, G. (2007). The long- term impact of Helicobacter pylori eradication on gastric histology: a systematic review and meta-analysis. Helicobacter 12 Suppl 2, 32-8. Romagnani, E., Gallerani, E. and Cavalli, F. (2006). Mediastinal mature teratoma with an immature component--what about the treatment? Ann Oncol 17, 1602-4. Ruzzi, L., Gagnoux-Palacios, L., Pinola, M., Belli, S., Meneguzzi, G., D'Alessio, M. and Zambruno, G. (1997). A homozygous mutation in the integrin alpha6 gene in junctional epidermolysis bullosa with pyloric atresia. J Clin Invest 99, 2826-31. Sadler, T. W. (2012). Digestive System. In Langman's Medical Embryology, (ed. C. Taylor), pp. 208-219. Philadelphia: Lippincott Williams & Wilkins. Saha, A., Hammond, C. E., Beeson, C., Peek, R. M., Jr. and Smolka, A. J. (2010). Helicobacter pylori represses proton pump expression and inhibits acid secretion in human gastric mucosa. Gut 59, 874-81. Satoh, K., Mutoh, H., Eda, A., Yanaka, I., Osawa, H., Honda, S., Kawata, H., Kihira, K. and Sugano, K. (2002). Aberrant expression of CDX2 in the gastric mucosa with and without intestinal metaplasia: effect of eradication of Helicobacter pylori. Helicobacter 7, 192-8. Saze, Z., Terashima, M., Kogure, M., Ohsuka, F., Suzuki, H. and Gotoh, M. (2012). Activation of the sonic hedgehog pathway and its prognostic impact in patients with gastric cancer. Dig Surg 29, 115-23. Scherubl, H., Cadiot, G., Jensen, R. T., Rosch, T., Stolzel, U. and Kloppel, G. (2010). Neuroendocrine tumors of the stomach (gastric carcinoids) are on the rise: small tumors, small problems? Endoscopy 42, 664-71. Schmidt, P. H., Lee, J. R., Joshi, V., Playford, R. J., Poulsom, R., Wright, N. A. and Goldenring, J. R. (1999). Identification of a metaplastic cell lineage associated with human gastric adenocarcinoma. Lab Invest 79, 639-46. Schubert, M. L. (2009). Gastric exocrine and endocrine secretion. Curr Opin Gastroenterol 25, 529-36. Schubert, M. L. and Makhlouf, G. M. (1992). Neural, hormonal, and paracrine regulation of gastrin and acid secretion. Yale J Biol Med 65, 553-60; discussion 621-3. Semrin, M. G. R. M. A. (2010). Chapter 47 – Anatomy, Histology, Embryology, and Developmental Anomalies of the Stomach and Duodenum. In Sleisenger and Fordtran's Gastrointestinal and Liver Disease Pathophysiology/Diagnosis/Management, (ed. L. S. F. Mark Feldman, Lawrence J. Brandt), pp. 773-788. Philadelphia: Saunders Elsevier.

Serrano, J., Goebel, S. U., Peghini, P. L., Lubensky, I. A., Gibril, F. and Jensen, R. T. (2000). Alterations in the p16INK4a/CDKN2A tumor suppressor gene in gastrinomas. J Clin Endocrinol Metab 85, 4146-56. Settle, S. H., Washington, K., Lind, C., Itzkowitz, S., Fiske, W. H., Burdick, J. S., Jerome, W. G., Ray, M., Weinstein, W. and Coffey, R. J. (2005). Chronic treatment of Menetrier's disease with Erbitux: clinical efficacy and insight into pathophysiology. Clin Gastroenterol Hepatol 3, 654-9. Sevcik, W. E. and Steiner, I. P. (1999). Acute gastric volvulus: case report and review of the literature. CJEM 1, 200-3. Shao, J., Sartor, R. B., Dial, E., Lichtenberger, L. M., Schepp, W. and Alpers, D. H. (2000). Expression of intrinsic factor in rat and murine gastric mucosal cell lineages is modified by inflammation. Am J Pathol 157, 1197-205. Sharif, M., Mirza, B., Ijaz, L., Iqbal, S. and Sheikh, A. (2010). Immature gastric teratoma: a rare tumour. APSP J Case Rep 1, 17. Sharma, S. A., Tummuru, M. K., Blaser, M. J. and Kerr, L. D. (1998). Activation of IL-8 gene expression by Helicobacter pylori is regulated by transcription factor nuclear factor-kappa B in gastric epithelial cells. J Immunol 160, 2401-7. Shi, G., Zhu, L., Sun, Y., Bettencourt, R., Damsz, B., Hruban, R. H. and Konieczny, S. F. (2009). Loss of the acinar-restricted transcription factor Mist1 accelerates Kras-induced pancreatic intraepithelial neoplasia. Gastroenterology 136, 1368-78. Shi, Y., Liu, X. F., Zhuang, Y., Zhang, J. Y., Liu, T., Yin, Z., Wu, C., Mao, X. H., Jia, K. R., Wang, F. J. et al. (2010). Helicobacter pylori-induced Th17 responses modulate Th1 cell responses, benefit bacterial growth, and contribute to pathology in mice. J Immunol 184, 5121-9. Shima, H., Ohshiro, K. and Puri, P. (2000). Increased local synthesis of epidermal growth factors in infantile hypertrophic pyloric stenosis. Pediatr Res 47, 201-7. Shima, H. and Puri, P. (1999). Increased expression of transforming growth factor-alpha in infantile hypertrophic pyloric stenosis. Pediatr Surg Int 15, 198-200. Shimada, S., Mimata, A., Sekine, M., Mogushi, K., Akiyama, Y., Fukamachi, H., Jonkers, J., Tanaka, H., Eishi, Y. and Yuasa, Y. (2012). Synergistic tumour suppressor activity of E- cadherin and p53 in a conditional mouse model for metastatic diffuse-type gastric cancer. Gut 61, 344-53. Shin, E. Y., Lee, B. H., Yang, J. H., Shin, K. S., Lee, G. K., Yun, H. Y., Song, Y. J., Park, S. C. and Kim, E. G. (2000). Up-regulation and co-expression of fibroblast growth factor receptors in human gastric cancer. J Cancer Res Clin Oncol 126, 519-28. Shinohara, M., Mao, M., Keeley, T. M., El-Zaatari, M., Lee, H. J., Eaton, K. A., Samuelson, L. C., Merchant, J. L., Goldenring, J. R. and Todisco, A. (2010). Bone morphogenetic protein signaling regulates gastric epithelial cell development and proliferation in mice. Gastroenterology 139, 2050-2060 e2. Shiotani, A., Iishi, H., Uedo, N., Ishiguro, S., Tatsuta, M., Nakae, Y., Kumamoto, M. and Merchant, J. L. (2005). Evidence that loss of sonic hedgehog is an indicator of Helicobater pylori-induced atrophic gastritis progressing to gastric cancer. Am J Gastroenterol 100, 581-7. Silberg, D. G., Sullivan, J., Kang, E., Swain, G. P., Moffett, J., Sund, N. J., Sackett, S. D. and Kaestner, K. H. (2002). Cdx2 ectopic expression induces gastric intestinal metaplasia in transgenic mice. Gastroenterology 122, 689-96.

Sinclair, N. F., Ai, W., Raychowdhury, R., Bi, M., Wang, T. C., Koh, T. J. and McLaughlin, J. T. (2004). Gastrin regulates the heparin-binding epidermal-like growth factor promoter via a PKC/EGFR-dependent mechanism. Am J Physiol Gastrointest Liver Physiol 286, G992-9. Singh M, K. R., YS Kadian, Hasija N. (2012). Gastric Teratoma: A Rare Neoplasm. Journal of Neonatal Surgery 1, 28. Smith, L. M., Nesterova, A., Ryan, M. C., Duniho, S., Jonas, M., Anderson, M., Zabinski, R. F., Sutherland, M. K., Gerber, H. P., Van Orden, K. L. et al. (2008). CD133/prominin-1 is a potential therapeutic target for antibody-drug conjugates in hepatocellular and gastric cancers. Br J Cancer 99, 100-9. St Peter, S. D., Holcomb, G. W., 3rd, Calkins, C. M., Murphy, J. P., Andrews, W. S., Sharp, R. J., Snyder, C. L. and Ostlie, D. J. (2006). Open versus laparoscopic pyloromyotomy for pyloric stenosis: a prospective, randomized trial. Ann Surg 244, 363-70. Stepan, V., Ramamoorthy, S., Nitsche, H., Zavros, Y., Merchant, J. L. and Todisco, A. (2005). Regulation and function of the sonic hedgehog signal transduction pathway in isolated gastric parietal cells. J Biol Chem 280, 15700-8. Sterk, L. M., Geuijen, C. A., Oomen, L. C., Calafat, J., Janssen, H. and Sonnenberg, A. (2000). The tetraspan molecule CD151, a novel constituent of hemidesmosomes, associates with the integrin alpha6beta4 and may regulate the spatial organization of hemidesmosomes. J Cell Biol 149, 969-82. Stummvoll, G. H., DiPaolo, R. J., Huter, E. N., Davidson, T. S., Glass, D., Ward, J. M. and Shevach, E. M. (2008). Th1, Th2, and Th17 effector T cell-induced autoimmune gastritis differs in pathological pattern and in susceptibility to suppression by regulatory T cells. J Immunol 181, 1908-16. Suerbaum, S. and Michetti, P. (2002). Helicobacter pylori infection. N Engl J Med 347, 1175- 86. Sun, Y., Gao, X., Liu, J., Kong, Q. Y., Wang, X. W., Chen, X. Y., Wang, Q., Cheng, Y. F., Qu, X. X. and Li, H. (2011). Differential Notch1 and Notch2 expression and frequent activation of Notch signaling in gastric cancers. Arch Pathol Lab Med 135, 451-8. Sung, J. J., Leung, W. K., Go, M. Y., To, K. F., Cheng, A. S., Ng, E. K. and Chan, F. K. (2000a). Cyclooxygenase-2 expression in Helicobacter pylori-associated premalignant and malignant gastric lesions. Am J Pathol 157, 729-35. Sung, J. J., Lin, S. R., Ching, J. Y., Zhou, L. Y., To, K. F., Wang, R. T., Leung, W. K., Ng, E. K., Lau, J. Y., Lee, Y. T. et al. (2000b). Atrophy and intestinal metaplasia one year after cure of H. pylori infection: a prospective, randomized study. Gastroenterology 119, 7-14. Szabo, I., Brutsche, S., Tombola, F., Moschioni, M., Satin, B., Telford, J. L., Rappuoli, R., Montecucco, C., Papini, E. and Zoratti, M. (1999). Formation of anion-selective channels in the cell plasma membrane by the toxin VacA of Helicobacter pylori is required for its biological activity. EMBO J 18, 5517-27. Taha, A. S., Dahill, S., Morran, C., Hudson, N., Hawkey, C. J., Lee, F. D., Sturrock, R. D. and Russell, R. I. (1999). Neutrophils, Helicobacter pylori, and nonsteroidal anti-inflammatory drug ulcers. Gastroenterology 116, 254-8. Takaishi, S., Okumura, T., Tu, S., Wang, S. S., Shibata, W., Vigneshwaran, R., Gordon, S. A., Shimada, Y. and Wang, T. C. (2009a). Identification of gastric cancer stem cells using the cell surface marker CD44. Stem Cells 27, 1006-20. Takaishi, S., Tu, S., Dubeykovskaya, Z. A., Whary, M. T., Muthupalani, S., Rickman, B. H., Rogers, A. B., Lertkowit, N., Varro, A., Fox, J. G. et al. (2009b). Gastrin is an essential

cofactor for helicobacter-associated gastric corpus carcinogenesis in C57BL/6 mice. Am J Pathol 175, 365-75. Tamai, K., Kaneda, Y. and Uitto, J. (2009). Molecular therapies for heritable blistering diseases. Trends Mol Med 15, 285-92. Tang, L. H., Modlin, I. M., Lawton, G. P., Kidd, M. and Chinery, R. (1996). The role of transforming growth factor alpha in the enterochromaffin-like cell tumor autonomy in an African rodent mastomys. Gastroenterology 111, 1212-23. Taylor, N. D., Cass, D. T. and Holland, A. J. (2013). Infantile hypertrophic pyloric stenosis: has anything changed? J Paediatr Child Health 49, 33-7. Terebiznik, M. R., Raju, D., Vazquez, C. L., Torbricki, K., Kulkarni, R., Blanke, S. R., Yoshimori, T., Colombo, M. I. and Jones, N. L. (2009). Effect of Helicobacter pylori's vacuolating cytotoxin on the autophagy pathway in gastric epithelial cells. Autophagy 5, 370-9. Thawani, J. P., Wang, A. C., Than, K. D., Lin, C. Y., La Marca, F. and Park, P. (2010). Bone morphogenetic proteins and cancer: review of the literature. Neurosurgery 66, 233-46; discussion 246. Thompson, E. M., Price, Y. E. and Wright, N. A. (1990). Kinetics of enteroendocrine cells with implications for their origin: a study of the cholecystokinin and gastrin subpopulations combining tritiated thymidine labelling with immunocytochemistry in the mouse. Gut 31, 406- 11. Toh, B. H., Chan, J., Kyaw, T. and Alderuccio, F. (2012). Cutting edge issues in autoimmune gastritis. Clin Rev Allergy Immunol 42, 269-78. Torres, J., Correa, P., Ferreccio, C., Hernandez-Suarez, G., Herrero, R., Cavazza-Porro, M., Dominguez, R. and Morgan, D. (2013). Gastric cancer incidence and mortality is associated with altitude in the mountainous regions of Pacific Latin America. Cancer Causes Control 24, 249-56. Tran, T., Jia, D., Sun, Y. and Konieczny, S. F. (2007). The bHLH domain of Mistl is sufficient to activate gene transcription. Gene Expr 13, 241-53. Tsugane, S. and Sasazuki, S. (2007). Diet and the risk of gastric cancer: review of epidemiological evidence. Gastric Cancer 10, 75-83. Tu, S., Chi, A. L., Lim, S., Cui, G., Dubeykovskaya, Z., Ai, W., Fleming, J. V., Takaishi, S. and Wang, T. C. (2007). Gastrin regulates the TFF2 promoter through gastrin-responsive cis- acting elements and multiple signaling pathways. Am J Physiol Gastrointest Liver Physiol 292, G1726-37. Tullio-Pelet, A., Salomon, R., Hadj-Rabia, S., Mugnier, C., de Laet, M. H., Chaouachi, B., Bakiri, F., Brottier, P., Cattolico, L., Penet, C. et al. (2000). Mutant WD-repeat protein in triple-A syndrome. Nat Genet 26, 332-5. Tummala, S., Keates, S. and Kelly, C. P. (2004). Update on the immunologic basis of Helicobacter pylori gastritis. Curr Opin Gastroenterol 20, 592-7. Uemura, N., Okamoto, S., Yamamoto, S., Matsumura, N., Yamaguchi, S., Yamakido, M., Taniyama, K., Sasaki, N. and Schlemper, R. J. (2001). Helicobacter pylori infection and the development of gastric cancer. N Engl J Med 345, 784-9. Vanderwinden, J. M., Mailleux, P., Schiffmann, S. N., Vanderhaeghen, J. J. and De Laet, M. H. (1992). Nitric oxide synthase activity in infantile hypertrophic pyloric stenosis. N Engl J Med 327, 511-5. Vanderwinden, J. M. and Rumessen, J. J. (1999). Interstitial cells of Cajal in human gut and gastrointestinal disease. Microsc Res Tech 47, 344-60.

Vasas, P., Mudan, S. S. and Akle, C. A. (2011). Congenital microgastria with limb defect combined with megaduodenum: case report and review of literature. Indian J Surg 73, 122-4. Veijola, L. I., Oksanen, A. M., Sipponen, P. I. and Rautelin, H. I. (2010). Association of autoimmune type atrophic corpus gastritis with Helicobacter pylori infection. World J Gastroenterol 16, 83-8. Velasco, A. L., Holcomb, G. W., 3rd, Templeton, J. M., Jr. and Ziegler, M. M. (1990). Management of congenital microgastria. J Pediatr Surg 25, 192-7. Vidal, F., Aberdam, D., Miquel, C., Christiano, A. M., Pulkkinen, L., Uitto, J., Ortonne, J. P. and Meneguzzi, G. (1995). Integrin beta 4 mutations associated with junctional epidermolysis bullosa with pyloric atresia. Nat Genet 10, 229-34. Vitor, J. M. and Vale, F. F. (2011). Alternative therapies for Helicobacter pylori: probiotics and phytomedicine. FEMS Immunol Med Microbiol 63, 153-64. Voelker, C. A., Miller, M. J., Zhang, X. J., Eloby-Childress, S., Clark, D. A. and Pierce, M. R. (1995). Perinatal nitric oxide synthase inhibition retards neonatal growth by inducing hypertrophic pyloric stenosis in rats. Pediatr Res 38, 768-74. Waghray, M., Zavros, Y., Saqui-Salces, M., El-Zaatari, M., Alamelumangapuram, C. B., Todisco, A., Eaton, K. A. and Merchant, J. L. (2010). Interleukin-1beta promotes gastric atrophy through suppression of Sonic Hedgehog. Gastroenterology 138, 562-72, 572 e1-2. Wagner, A. D., Unverzagt, S., Grothe, W., Kleber, G., Grothey, A., Haerting, J. and Fleig, W. E. (2010). Chemotherapy for advanced gastric cancer. Cochrane Database Syst Rev, CD004064. Wallace, J. L. (2007). Hydrogen sulfide-releasing anti-inflammatory drugs. Trends Pharmacol Sci 28, 501-5. Wallace, J. L. (2008). Prostaglandins, NSAIDs, and gastric mucosal protection: why doesn't the stomach digest itself? Physiol Rev 88, 1547-65. Wallace, J. L., Keenan, C. M. and Granger, D. N. (1990). Gastric ulceration induced by nonsteroidal anti-inflammatory drugs is a neutrophil-dependent process. Am J Physiol 259, G462-7. Wallace, J. L. and Miller, M. J. (2000). Nitric oxide in mucosal defense: a little goes a long way. Gastroenterology 119, 512-20. Walls, G. V., Lemos, M. C., Javid, M., Bazan-Peregrino, M., Jeyabalan, J., Reed, A. A., Harding, B., Tyler, D. J., Stuckey, D. J., Piret, S. et al. (2012). MEN1 gene replacement therapy reduces proliferation rates in a mouse model of pituitary adenomas. Cancer Res 72, 5060-8. Wang, F., Xia, P., Wu, F., Wang, D., Wang, W., Ward, T., Liu, Y., Aikhionbare, F., Guo, Z., Powell, M. et al. (2008). Helicobacter pylori VacA disrupts apical membrane-cytoskeletal interactions in gastric parietal cells. J Biol Chem 283, 26714-25. Wang, J., Xu, L., Shi, R., Huang, X., Li, S. W., Huang, Z. and Zhang, G. (2011). Gastric atrophy and intestinal metaplasia before and after Helicobacter pylori eradication: a meta- analysis. Digestion 83, 253-60. Wang, T. C., Dangler, C. A., Chen, D., Goldenring, J. R., Koh, T., Raychowdhury, R., Coffey, R. J., Ito, S., Varro, A., Dockray, G. J. et al. (2000). Synergistic interaction between hypergastrinemia and Helicobacter infection in a mouse model of gastric cancer. Gastroenterology 118, 36-47.

Wang, T. C., Goldenring, J. R., Dangler, C., Ito, S., Mueller, A., Jeon, W. K., Koh, T. J. and Fox, J. G. (1998). Mice lacking secretory phospholipase A2 show altered apoptosis and differentiation with Helicobacter felis infection. Gastroenterology 114, 675-89. Wang, T. C., Koh, T. J., Varro, A., Cahill, R. J., Dangler, C. A., Fox, J. G. and Dockray, G. J. (1996). Processing and proliferative effects of human progastrin in transgenic mice. J Clin Invest 98, 1918-29. Wasselle, J. A. and Norman, J. (1993). Acute gastric volvulus: pathogenesis, diagnosis, and treatment. Am J Gastroenterol 88, 1780-4. Weber, H. C., Venzon, D. J., Lin, J. T., Fishbein, V. A., Orbuch, M., Strader, D. B., Gibril, F., Metz, D. C., Fraker, D. L., Norton, J. A. et al. (1995). Determinants of metastatic rate and survival in patients with Zollinger-Ellison syndrome: a prospective long-term study. Gastroenterology 108, 1637-49. Weis, V. G., Sousa, J. F., Lafleur, B. J., Nam, K. T., Weis, J. A., Finke, P. E., Ameen, N. A., Fox, J. G. and Goldenring, J. R. (2012). Heterogeneity in mouse spasmolytic polypeptide- expressing metaplasia lineages identifies markers of metaplastic progression. Gut. Wolfe, M. M. and Nompleggi, D. J. (1992). Cytokine inhibition of gastric acid secretion--a little goes a long way. Gastroenterology 102, 2177-8. Wong, B. C., Lam, S. K., Wong, W. M., Chen, J. S., Zheng, T. T., Feng, R. E., Lai, K. C., Hu, W. H., Yuen, S. T., Leung, S. Y. et al. (2004). Helicobacter pylori eradication to prevent gastric cancer in a high-risk region of China: a randomized controlled trial. JAMA 291, 187-94. Wu, C. Y., Kuo, K. N., Wu, M. S., Chen, Y. J., Wang, C. B. and Lin, J. T. (2009a). Early Helicobacter pylori eradication decreases risk of gastric cancer in patients with peptic ulcer disease. Gastroenterology 137, 1641-8 e1-2. Wu, H., Rusiecki, J. A., Zhu, K., Potter, J. and Devesa, S. S. (2009b). Stomach carcinoma incidence patterns in the United States by histologic type and anatomic site. Cancer Epidemiol Biomarkers Prev 18, 1945-52. Wu, T. and Hua, X. (2011). Menin represses tumorigenesis via repressing cell proliferation. Am J Cancer Res 1, 726-39. Wu, W. K., Cho, C. H., Lee, C. W., Fan, D., Wu, K., Yu, J. and Sung, J. J. (2010). Dysregulation of cellular signaling in gastric cancer. Cancer Lett 295, 144-53. Xiao, C., Feng, R., Engevik, A. C., Martin, J. R., Tritschler, J. A., Schumacher, M., Koncar, R., Roland, J., Nam, K. T., Goldenring, J. R. et al. (2013). Sonic Hedgehog contributes to gastric mucosal restitution after injury. Lab Invest 93, 96-111. Xiao, C., Ogle, S. A., Schumacher, M. A., Orr-Asman, M. A., Miller, M. L., Lertkowit, N., Varro, A., Hollande, F. and Zavros, Y. (2010). Loss of parietal cell expression of Sonic hedgehog induces hypergastrinemia and hyperproliferation of surface mucous cells. Gastroenterology 138, 550-61, 561 e1-8. Xu, X., Brodie, S. G., Yang, X., Im, Y. H., Parks, W. T., Chen, L., Zhou, Y. X., Weinstein, M., Kim, S. J. and Deng, C. X. (2000). Haploid loss of the tumor suppressor Smad4/Dpc4 initiates gastric polyposis and cancer in mice. Oncogene 19, 1868-74. Yamagata, Y., Aikou, S., Fukushima, T., Kataoka, H., Seto, Y., Esumi, H., Kaminishi, M., Goldenring, J. R. and Nomura, S. (2012). Loss of HGF activator inhibits foveolar hyperplasia induced by oxyntic atrophy without altering gastrin levels. Am J Physiol Gastrointest Liver Physiol 303, G1254-61.

Yamaguchi, H., Goldenring, J. R., Kaminishi, M. and Lee, J. R. (2002). Identification of spasmolytic polypeptide expressing metaplasia (SPEM) in remnant gastric cancer and surveillance postgastrectomy biopsies. Dig Dis Sci 47, 573-8. Yano, T., Ito, K., Fukamachi, H., Chi, X. Z., Wee, H. J., Inoue, K., Ida, H., Bouillet, P., Strasser, A., Bae, S. C. et al. (2006). The RUNX3 tumor suppressor upregulates Bim in gastric epithelial cells undergoing transforming growth factor beta-induced apoptosis. Mol Cell Biol 26, 4474-88. Yao, X. and Forte, J. G. (2003). Cell biology of acid secretion by the parietal cell. Annu Rev Physiol 65, 103-31. Yasunaga, Y., Shinomura, Y., Kanayama, S., Higashimoto, Y., Yabu, M., Miyazaki, Y., Kondo, S., Murayama, Y., Nishibayashi, H., Kitamura, S. et al. (1996). Increased production of interleukin 1 beta and hepatocyte growth factor may contribute to foveolar hyperplasia in enlarged fold gastritis. Gut 39, 787-94. Ye, Y. W., Zhou, Y., Yuan, L., Wang, C. M., Du, C. Y., Zhou, X. Y., Zheng, B. Q., Cao, X., Sun, M. H., Fu, H. et al. (2011). Fibroblast growth factor receptor 4 regulates proliferation and antiapoptosis during gastric cancer progression. Cancer 117, 5304-13. Yeh, T. S., Wu, C. W., Hsu, K. W., Liao, W. J., Yang, M. C., Li, A. F., Wang, A. M., Kuo, M. L. and Chi, C. W. (2009). The activated Notch1 signal pathway is associated with gastric cancer progression through cyclooxygenase-2. Cancer Res 69, 5039-48. Yoo, Y. A., Kang, M. H., Kim, J. S. and Oh, S. C. (2008). Sonic hedgehog signaling promotes motility and invasiveness of gastric cancer cells through TGF-beta-mediated activation of the ALK5-Smad 3 pathway. Carcinogenesis 29, 480-90. Yoon, S. E., Goo, H. W., Jun, S., Lee, I. C. and Yoon, C. H. (2000). Immature gastric teratoma in an infant: a case report. Korean J Radiol 1, 226-8. Yoshizawa, N., Takenaka, Y., Yamaguchi, H., Tetsuya, T., Tanaka, H., Tatematsu, M., Nomura, S., Goldenring, J. R. and Kaminishi, M. (2007). Emergence of spasmolytic polypeptide-expressing metaplasia in Mongolian gerbils infected with Helicobacter pylori. Lab Invest 87, 1265-76. Yu, F., Jensen, R. T., Lubensky, I. A., Mahlamaki, E. H., Zheng, Y. L., Herr, A. M. and Ferrin, L. J. (2000). Survey of genetic alterations in gastrinomas. Cancer Res 60, 5536-42. Yuan, Y., Padol, I. T. and Hunt, R. H. (2006). Peptic ulcer disease today. Nat Clin Pract Gastroenterol Hepatol 3, 80-9. Zavros, Y., Eaton, K. A., Kang, W., Rathinavelu, S., Katukuri, V., Kao, J. Y., Samuelson, L. C. and Merchant, J. L. (2005). Chronic gastritis in the hypochlorhydric gastrin-deficient mouse progresses to adenocarcinoma. Oncogene 24, 2354-66. Zhao, W. M., Wang, L., Park, H., Chhim, S., Tanphanich, M., Yashiro, M. and Kim, K. J. (2010). Monoclonal antibodies to fibroblast growth factor receptor 2 effectively inhibit growth of gastric tumor xenografts. Clin Cancer Res 16, 5750-8. Zhou, L., Sung, J. J., Lin, S., Jin, Z., Ding, S., Huang, X., Xia, Z., Guo, H., Liu, J. and Chao, W. (2003). A five-year follow-up study on the pathological changes of gastric mucosa after H. pylori eradication. Chin Med J (Engl) 116, 11-4. Zhu, L., Tran, T., Rukstalis, J. M., Sun, P., Damsz, B. and Konieczny, S. F. (2004). Inhibition of Mist1 homodimer formation induces pancreatic acinar-to-ductal metaplasia. Mol Cell Biol 24, 2673-81.

Zivny, J., Wang, T. C., Yantiss, R., Kim, K. H. and Houghton, J. (2003). Role of therapy or monitoring in preventing progression to gastric cancer. J Clin Gastroenterol 36, S50-60; discussion S61-2.

Figure Legends

Figure 1. Anatomic development of the human stomach. Embryonic gastric developmental milestones of enlargement, rotation, and asymmetric curvature establishment.

Figure 2. Histologic development of the human stomach. A. Gross anatomic regionization of the human stomach. B. Antrum and C. Corpus gastric unit architecture with regions, direction of migration and differentiation, major cell types, turnover times (* based on murine data), and main secretory products.

Figure 3. Re-emergent developmental pathways during gastric cancer progression. Well understood developmental pathways important in gastric carcinogenesis.

Table 1. Developmental/congenital clinical disorders with underlying disease mechanisms, diagnostic approach, and current therapies.

Table 2. Differences between human and murine stomach anatomy and histology.

Table 3. Adult/acquired clinical disorders with underlying disease mechanisms, diagnostic approach, and current therapies.

Table 1. Developmental/congenital Clinical Disorders with Underlying Disease Mechanisms, Diagnostic Approach, and Current Therapies Disorder Etiologies Diagnosistic Approach Therapies

Stomach Wall Outpouchings, Contrast Radiography and Surgical excision and association with epidermolysis Gastric Atresia Ultrasonography, novel novel gene replacement bullosa (ITGA6, ITGB6, PLEC1 gene genetic testing therapy mutations) Surgical treatment of Clinical symptoms with hernia, anchoring of Secondary to hernia, laxity of mesentary Gastric Volvulus barium studies and CT stomach to ligaments scans abdominal wall, and gastronomy tubes Congenital Failure of foregut growth, association Contrast Radiography and Surgical enlargement of Microgastria with VACTERL Ultrasonography stomach Congenital muscle weakness, lack of Gastric Surgical excision if peritoneal membrane, invading Radiological studies Diverticulum complications arterioles Gastric CT scan and Duplication Persistant embyronic invaginations Surgical excision Ultrasonography Cysts CT scan and monitoring of Surgical excision and Teratomas Aberrant primordial germ cells AFP and HCG serum chemotherapy tumor markers Motility See Chapter 3 and Chapter 6

Table 2. Differences Between Human and Murine Stomach Anatomy and Histology Mouse Human 3 (Forestomach, Body/Corpus, and 4 (Cardia, Fundus, Body/Corpus, and Anatomic Regions Antrum) Antrum) Histological Turnover Time See Figure 5.2 About twice that seen in Mice Isthmal stem cell ultrastructure Granule free Contain granules Parietal Cell Differentiation Luminally and Basally Basally Migration Major Intrinsic Factor Secretory Zymogenic Cells Parietal Cells Cell

Table 3. Adult/Acquired Clinical Disorders with underlying disease mechanisms, diagnostic approach, and current therapies Disorder Etiologies Diagnosistic Approach Therapies Foveolar Injury induced growth factors, loss of Shh, See Atrophic See Atrophic Gastrits/SPEM Hyperplasia hypergastrinemia Gastrits/SPEM Surface Pit Cells Alleviation of symptoms, Ménétrier Disease Increased TGF-α signaling Endoscopy and biopsy surgery, blocking TGF-α signaling Serum gastrin measurements, Gastrinomas, atrophic gastritis, inhibition of Hypergastrinemia secretin test of gastrin release, Treat underlying causes acid secretion, BMP signaling pathway and basal acid output Diagnosis by exclusion (High Zollinger-Ellison Gastrinoma due to genetic mutations, Surgery, novel MEN1 gene Enteroendocrine gastrin levels with gastric pH<2), syndrome associated with MEN1 therapy Cells MEN1 linkage testing Gastroscopy, biopsy, somatostatin Hypergastrinemia, associated with MEN1, Surgical resection, receptor scintigraphy Carcinoid Tumors growth promoting effects of gastrin and octreotide, chemotherapy, CT/ultrasound to look for histamine gastrin antagonists metastasis Serum screens for pepsinogen, Autoimmune Autoantibodies to PCs, immunologic inciting gastrin, ghrelin, and B12 replacement, new Parietal Cells Gastritis role of H pylori autoantibodies, endoscopy for immunologic therapies complications HP induced PC death (loss of differentiation HP eradication (triple and Atrophic Endoscopy testing for HP, serum signals, ZC metaplasia, foveolar hyperplasia, quadruple therapies), Gastritis/SPEM PGC tests hypergastrinemia vaccine development Intestinal SPEM progression, re-expression of CDXs Endoscopic biopsy, serum HP eradication Metaplasia and repression SOX2 biomarkers Zymogenic (Chief) Cells Surgery, chemotherapy, HP infection, remergence of developmental radiotherapy, targeting Early detection endoscopy and Gastric Cancer pathways, abberrant growth signals, and specific developmental biopsy chronic inflammation pathways, blocking growth signals, immunotherapies

CHAPTER 3: RAB26 and RAB3D are Direct Transcriptional Targets of MIST1 That Regulate Exocrine Granule Maturation

This chapter is adapted from the published work:

XT and RUJ contributed equally to this manuscript.

RAB26 and RAB3D are direct transcriptional targets of MIST1 that regulate exocrine granule maturation

Xiaolin Tian*,1,2,3, Ramon U. Jin*,1, Andrew J. Bredemeyer1,4, Edward J. Oates1, Katarzyna M. Błażewska5, Charles E. McKenna5, and Jason C. Mills1,2

*Contributed equally

Departments of 1Pathology and Immunology and 2Developmental Biology, Washington University School of Medicine, St. Louis, MO 63110; 3Current address: Neuroscience Center of Excellence, Louisiana State University Health Science Center, New Orleans, LA 70112; 4Current address: Partners HealthCare System, Boston, MA 02199; 5Department of Chemistry, University of Southern California, Los Angeles, California 90089-0744

Address correspondence to:

Jason C. Mills Department of Pathology and Immunology Washington University School of Medicine Box 8118 660 So. Euclid Ave. St. Louis, MO 63110 Phone 314 362-4258 FAX 314 362-7487 e-mail [email protected]

Running title: MIST1, RABS and exocrine secretory granules Key words: Bhlha15; phosphonocarboxylate; intronic enhancer; neck cell

Abstract

Little is known about how differentiating cells reorganize their cellular structure to perform specialized physiological functions. MIST1, an evolutionarily conserved transcription factor, is

required for the formation of large, specialized secretory vesicles in gastric zymogenic (chief)

cells (ZCs) as they differentiate from their mucous neck cell progenitors. Here, we show that

MIST1 binds to highly conserved CATATG E-boxes to directly activate transcription of 6 genes,

including the small GTPases RAB26 and RAB3D. We next show that RAB26 and RAB3D expression

−/− is significantly downregulated in Mist1 ZCs, suggesting that MIST1 establishes large secretory

granules by inducing RAB transcription. To test this hypothesis, we transfected human gastric

cancer cell lines stably expressing MIST1 with RFP-tagged pepsinogen C, a key secretory product

of ZCs. Those cells upregulate expression of RAB26 and RAB3D to form large secretory granules,

whereas control, non- MIST1-expressing cells do not. Moreover, granule formation in MIST1-

expressing cells requires RAB activity because treatment with a RAB prenylation inhibitor and

transfection of dominant negative RAB26 abrogate granule formation. Together, our data establish the molecular process by which a transcription factor can directly induce fundamental cellular architecture changes by increasing transcription of specific cellular effectors that act to

organize a unique subcellular compartment.

93 Introduction

Developmentally regulated transcription factors (TFs) play central roles in cell fate

specification and differentiation of all cell types. During the complex process of specified

cellular differentiation, certain TFs are turned on only at the final steps of the transcription

regulation hierarchy. Presumably, those TFs directly activate major cell effector genes and in

turn govern the establishment of a differentiated cell’s designated morphology and function.

There is emerging evidence that there might indeed be a limited number of TFs that are employed in diverse tissues to induce specific gene cassettes that regulate cell structure. For example, it was recently shown that differentiation in general, no matter the tissue, induced preferential expression of the same types of genes that govern secretion and communication with extracellular space (13). Further, it has been shown that X-box binding protein 1 (XBP1), a

transcription factor that is also developmentally regulated and required for wholesale changes in cell structure in certain cell lineages, directly activates multiple secretory pathway genes that help establish the abundant rough endoplasmic reticulum and mitochondria needed by specialized secretory cells, such as plasma cells, pancreatic acinar cells, and intestinal Paneth cells (30, 33, 56, 59). Another example of a developmentally important TF that regulates cell structure is TFEB, a bHLH recently shown to upregulate a cohort of target genes that specifically regulate lysosome function and biogenesis(54).

The corpus of the adult murine stomach is a useful system for studying the role of developmentally regulated TFs in coordinating cell structural changes because the gastric epithelium comprises multiple secretory cell lineages that are constantly renewed in a spatiotemporally organized fashion (6, 28, 39). The zymogenic (aka chief) cell (ZC) lineage occupies the base of the gastric unit, migrating from the stem cell zone and passing first through

94 a distinct mucous neck cell progenitor phase, before rapid terminal differentiation that includes

dramatic expansion of the rER and apical accumulation of large secretory vesicles filled with

pepsinogen and other digestive enzymes (5, 29).

The bHLH transcription factor MIST1 is critical for ZC architectural maturation (50) (Fig.

1). MIST1 is a developmentally regulated and highly cell lineage specific TF, with onset of

expression only during terminal differentiation of – along with ZCs – a handful of secretory cells

in mammals (26, 48, 49). MIST1-expressing cells, ranging from immunoglobulin-secreting

plasma cells (4) to alveolar breast lobular cells (69), are scattered in diverse tissues and have

little in common in either their developmental origins or in the specific substances they

elaborate. However, they do share a specialized physiological function: high-capacity secretion

of proteins, indicating that MIST1 may be the transcriptional architect initiating the subset of

structural changes required for such functionality. Indeed, loss of MIST1 leads to smaller cell

cytoplasms, with smaller secretory granules, reduced secretory protein stores, and a decrease in

secretory capacity (5, 34, 50). Modulating cell architecture is likely a critical feature of normal

development because MIST1 is a highly conserved gene from Drosophila to Zebrafish to

mammals, reflected not only by the high degree of homology among MIST1 orthologs but also the

specific sequence of the genomic cis-element they bind, CATATG-type E-boxes (18-20, 45, 46).

To coordinate specific changes in cell structure, MIST1 must directly activate transcription

of a group of cellular effector genes that coordinate structural changes. This cassette of structure- modifying genes would likely be conserved across tissues and species. However, no MIST1

targets that might coordinate such structural changes have yet been identified. Ras-like, small

GTPases are important regulators of vesicular formation and transport in eukaryotic cells, making them potential structure-regulating genes (15, 17). It has been shown that Rab3d

95 expression is decreased in Mist1−/− pancreatic acinar cells, but Rab3d has not yet been shown to be a direct target of MIST1, and Rab3d is expressed in non-Mist1-expressing cells as well.

Furthermore, transgenic expression of Rab3d was insufficient to restore the defects caused by loss of MIST1 function in pancreatic acinar cells (26), indicating that other, as yet unidentified,

MIST1 targets must also play a role. A paralogous RAB to RAB3D, RAB26, has not been

extensively studied, but its expression is restricted to a limited number of highly secretory cells

where it has been proposed to be involved in regulated vesicular secretion (40, 64, 68).

Here, we show that MIST1 is sufficient to upregulate 16 genes in 2 different gastric cell lines. We further show that it directly associates with CATATG E-boxes in 6 of those genes that

have highly evolutionarily conserved CATATG E-boxes within the first intron. Two MIST1–

induced genes, RAB3D and RAB26, stood out as representing a possible mechanism by which

MIST1, acting at the level of transcription, could regulate formation of exocrine secretory

granules in differentiating cells. We show that RAB3D and RAB26 are expressed in gastric ZCs in

the corpus of mouse stomach in a MIST1-dependent manner. We next developed a system to test

the functional importance of MIST1 induction of these RABs. We show that gastric epithelial cells

stably expressing MIST1, but not control cell lines, produce large ZC-like secretory granules when they are transfected with RFP-tagged pepsinogen C (PGC). Expression levels of RAB26

and RAB3D were also specifically induced in those cell lines. Finally, we show that formation of

large granules in these cells is dependent on RAB activity, because granule formation is abrogated by: 1) inhibition of RAB26 and RAB3D function by disrupting RAB prenylation and 2) transfection with a dominant negative RAB26 construct. We therefore propose that MIST1 regulates large

secretory granule formation, a key aspect of differentiated secretory cell function, via activating

transcription of RAB26 and RAB3D. Together, our data demonstrate how a developmentally

96 regulated TF can induce secretory cell architectural changes by transcriptionally regulating specific membrane trafficking genes.

97 Materials and Methods

Mice

All experiments involving animals were performed according to protocols approved by the

Washington University School of Medicine Animal Studies Committee. Germline Mist1−/− mice

were generated as described previously (49) and maintained in a specific pathogen free barrier facility. Control mice were the littermates of Mist1−/− mice resulting from heterozygote by

heterozygote crosses.

Immunofluorescence

Stomachs were prepared and stained as described (50). Briefly, stomachs were inflated with

freshly prepared methacarn fixative and suspended in fixative for 15-30 mins at RT, followed by

multiple rinses in 70% ETOH, arrangement in 2% agar in a tissue cassette, and routine paraffin

processing. Sections (5 μm) were deparaffinized and rehydrated, then antigen retrieval was

performed by boiling in 50 mM Tris-HCl, pH 9.0. Slides were blocked in 1% BSA, 0.3%

Triton-X100 in PBS, then incubated in primary followed by secondary antibodies (see below).

Slides were incubated 5 mins in 1 μg/ml bisbenzimide (Invitrogen, Carlsbad, CA) prior to mounting in 1:1 glycerol:PBS.

For immunofluorescent analysis of cultured cells, cells were grown in Lab-Tek Chamber

Slide 4 Well Permanox slides (Thermo Fisher Scientific, Rochester, NY) and fixed in 4% paraformaldehyde for 10 mins at RT. For antibody staining, slides were permeabilized by 0.1%

Triton-X100 in PBS and blocked in 2% BSA, 0.05% Triton-X100 in PBS. Fluorescence microscopy and imaging were performed using a Zeiss Axiovert 200 microscope with Axiocam

MRM camera at RT. Optical sectioning was performed using the Apotome adaptor following

98 calibration. In most cases, 1 μm sections were taken from cell-substrate interface to the full height of the cell. Contrast (maximal, minimal, and midtone) adjustment and fluorescent channel overlay, and pseudocoloring were performed in Adobe Photoshop (Adobe Systems, San Jose,

CA). All adjustments were performed on the entire image equally. Cartoon cell traces and illustrations were performed using Adobe Illustrator (Adobe Systems, San Jose, CA).

The following primary antibodies were used for immunostaining: goat (1:2000) anti- human gastric intrinsic factor (GIF) (gift of Dr. David Alpers, Washington University); sheep anti-PGC (1:10,000, Abcam), rabbit anti-actin (1:200, gift of Dr. Thaddeus Stappenbeck, clone

AC-40; Sigma, St Louis, MO). Secondary antibodies used were: Alexa Fluor 488, 594 or 647 conjugated donkey anti-goat, anti-rabbit, anti-sheep, or anti-mouse (1:500, Invitrogen).

Immunoflurescent quantification

Immunofluroescent quantification to determine cytoplasmic fluorescence intensity was performed in ImageJ software. For tissue sections, the cytoplasm was divided into regions fully apical to and fully basal to the nucleus. Mean fluorescent intensity was determined in each region after subtraction of background; background was determined by averaging PGC fluorescence in

4 parietal cells – which do not express PGC – in the same unit. Results were compiled from 51 cells from 7 gastric units in two separate knockout mice and 50 cells from 6 units in two control mice.

For cell line vesicle quantification, MIST1 stably expressing lines were transfected with

PGC-RFP and appropriate treatment. Number of large vesicular cells (defined as cells containing 3 or more vesicles, each ≥ 1.5 μm), diffuse vesicular cells (cells with no visible vesicles), and total number of PGC-RFP transfected cells were scored. For eGFP-hRAB26T77N

99 fluorescence intensity quantification, MIST1 stable cell lines were co-transfected with PGC-RFP

and eGFP-hRAB26T77N. 16 bit images captured in Zeiss Axiovision software were analyzed in

ImageJ as follows: mean green and red cytoplasmic fluorescent intensities were determined for large vesicular cells (defined as above) and diffuse vesicular cells (defined as ≥135 intensity units above background, no vesicles ≥1 μm) in each region after subtraction from the median

background (green and red fluorescence in an area with no cells) and normalization to average

nuclear green fluorescence (nuclei were green due to expression of MIST1-eGFP) for ≥10 cell

nuclei/field. 245 cells were scored across 3 transfections.

Electron microscopy

For transmission electron microscopic studies, stomachs were fixed, sectioned, stained, and

imaged as described (50). For tEM of cell lines, cells were plated on Lab-Tek Chamber Slide 4

Well Permanox slides (Thermo Fisher Scientific). After rinsing in PBS, they were fixed in

modified Karnovky’s fixative (2.5% glutaraldehyde, 2% paraformaldehyde in 0.1 mmol/l

cacodylate buffer). tEM thin sections were cut directly from cell cultures embedded on the

original Permanox substrate. To quantify vesicle size, fields of MIST1-stable and eGFP-control

cells were randomly selected, digital images captured at 4000x magnification, and ImageJ was

used to determine areas of all vesicle profiles in all cells in the field in each TIFF image. 20 cells

were analyzed from each cell line (~500 total vesicles scored).

Cell lines and transient transfection

HGC-27 cells (HPACC, Porton Down, UK) were maintained at 37°C in 5% CO2 in DMEM

supplemented with 10% fetal bovine serum, 1% non essential aminoacids, 1% glutamine and 100

100 ng/ml each of penicillin and streptomycin. AGS cells (from ATCC, Manassas, VA) were grown

in RPMI-1640 supplemented with 10% fetal bovine serum, 0.9% glutamine, 0.4% HEPES, 1%

Na pyruvate, 2.5% glucose, and 100 ng/ml each of penicillin and streptomycin. Cells were passaged every 3 days using Trypsin-EDTA. For transient transfection, 1 x 106 AGS or HGC-27

cells were transfected via electroporation using the Nucleofector I (Amaxa-Lonza, Basel,

Switzerland), program B-023, and cell line transfection solution V. The following plasmids

were used per electroporation: 3 μg PGCRFP (see below), 5 μg eGFP-hRAB26T77N (see below),

or 3 μg pmaxGFP (Amaxa-Lonza). Cells were replated on Lab-Tek Chamber Slide 4 Well

Permanox slides and routinely analyzed 24 hours post transfection.

GeneChip analysis

Untransfected HGC and AGS control plates were grown to 70-80% confluency on 10 cm dishes.

6 For cells transfected with either MIST1-eGFP or Control eGFP vector, 1 x 10 AGS or HGC-27

cells were transfected with 1.5 μg pmaxGFP plus either 3 μg MIST1 cDNA or 3 μg empty vector

using the transfection conditions described in the text. The GFP+ population of each transfectant

was isolated by flow cytometric cell sorting using a FACSVantage (Becton-Dickinson, San Jose,

CA) at 24 hours post-transfection and then replated for an additional 24 hours before harvesting.

Cells were harvested with trypsin-EDTA. RNA was extracted using a QIAGEN RNAeasy kit,

and RNA quality was verified by visualization on an agarose gel. 5 ug total RNA was used to

prepare labeled target using Affymetrix GeneChip One-Cycle Target Labeling reagents. 10 μg

labeled target cRNA was hybridized to HGU133_Plus_2 GeneChips. For both AGS and HGC-27

cells, expression profiles of MIST1 + pmaxGFP-transfected cells were compared with profiles of

empty vector + pmaxGFP-transfected cells. An initial, inclusive candidate MIST1 target list was

101 generated by determining by dChip analysis (70) the transcripts that had a 90% confidence lower

bound fold-change increase of ≥ 1.2 and an intensity greater than 100 in 4 independent

comparisons, combined as follows: (AGS-MIST1 vs. vector transfected AND vs. untransfected) OR

(HGC-27 vs. vector AND vs. untransfected). This list of 211 genes was then filtered to generate

AGS- and HGC- MIST1-induced transcripts by filtering genes whose expression intensity was

<100 in MIST1-transfected cells and whose mean fold-change was <1.5 in MIST1-transfected cells

vs. either control population. 32 AGS and 59 HGC probe sets met those criteria, and 18 of those,

representing 16 individual genes were shared (Fig. 2A). GeneChip datasets have been deposited

in GEO (GSE16924).

Bioinformatic analysis of MIST1 targets

ECR Browser (44) was used to analyze the human genomic sequence for each gene 5’ to the

transcription start. Sequence was analyzed up to 50 kb or until an exon from the neighboring

gene was reached. The first intron up to 50 kb was also analyzed. When alternate splice forms

exist, the farthest documented 5’ exon was used, and the intron following it was considered the

first intron. CATATG sequences were identified within analyzed sequences using the dreg

application in the EMBOSS suite. Conservation among species aligned in the ECR Browser was

then determined at each of these CATATG sites. Note that only human, chimp, cow, dog, rat,

mouse, opossum, and chicken were available in the ECR Browser at time of analysis, so

conservation undoubtedly extends across numerous species not diagrammed in Fig. 3. All 16

putative MIST1 targets were analyzed in this way. 6 genes showed the conserved intronic pattern depicted in Fig. 3A,B. 7 genes showed scattered or no CATATG sequence with any conservation restricted to primates. Two genes (MAP2K5 and FIGN) were slight variants. MAP2K5 was highly

102 conserved throughout and showed sporadic CATATGs that were conserved with no single, predominant site and no particular pattern to the species conservation (not shown). FIGN has a short intron 1 and has two highly conserved CATATGs in the second intron (not shown). In addition to the 16 putative targets, we also analyzed the following RAB family members for conserved CATATGs: RAB3A,B,C; RAB27A,B; RAB37; RAB9A,B. Many of those had no CATATG sites; none had sites conserved outside primates.

Establishment of MIST1-eGFP and eGFP stable lines

6 1 x 10 HGC-27 cells were transfected with 3 μg MIST1-eGFP cDNA or 3 μg eGFP cDNA using the transfection conditions described above. After 24 hours, transfectants were replated at limiting dilution under selection with 500 ng/µl Geneticin (Gibco-Invitrogen). Wells that grew out over 14-21 days were analyzed by flow cytometry for level and homogeneity of GFP signal.

Chromatin Immunoprecipitation

Chromatin immunoprecipitation (ChIP) was performed after Im and coworkers (22). 10̴̴ 8 HGC cells that stably express MIST1GFP fusion proteins were harvested for one ChIP experiment. 15

μl of MIST1 antiserum (rabbit polyclonal anti-human MIST1) or serum from the rabbit prior to immunization (“pre-immune” control) together with protein A/G plus agarose (Santa Cruz

Biotechnology, Santa Cruz, CA) was added to the cell lysate for immunoprecipitation. Regular

PCR and quantitative-real-time PCR were performed (these and all other primer sequences available upon request) to assess quantity of genomic sequences immunoprecipitated by either pre-immune or MIST1 antiserum, as well as a 1:10 dilution of the cell extract prior to immunoprecipitation.

103

RAB inhibitor studies

3-PEHPC, an analog of the bisphosphonate drug risedronate, was generated as previously

described (10). 3-PEHPC was stored in a stock solution of 106 mM at 4°C in aqueous solution

at pH 6.3. For cell culture experiments, 3-PEHPC was added directly to the appropriate dilution in tissue culture media. Multiple concentrations were tested up to 5mM, and effectiveness was determined by dispersion of transfected eGFP-RAB26 plasmid (Jin et al., unpublished

observations). Based on these experiments, a final concentration of 5mM was used in all

experiments described in this manuscript.

In situ hybridization

Rab26 cDNA was obtained from OpenBiosystems (MMM1013-98478848). Rab3d cDNA was

obtained via amplification from a mouse stomach cDNA library and cloned into T-easy vector

(Promega, Madison, WI). DIG-labeled RNA probes were synthesized via in vitro transcription following plasmid linearization (Roche Applied Sciences, Indianapolis, IN; 11277073910). The anti-sense RNA probe was synthesized with T7 RNA polymerase, the sense using Sp6 RNA polymerase. Adult B6 strain mice were perfused with 0.9% NaCl and 4%PFA sequentially, the stomachs was removed and further fixed in 4% PFA at 4°C for 8 h or more. Tissue was blocked, frozen, and sectioned as previously described (50). Sections (20 μm) were dipped in water several times to remove OTC, fixed in 4% PFA, treated with Proteinase K, refixed in 4% PFA and then treated with 0.1 M triethanolamine before incubating in hybridization buffer (50%

Formamide, 5x SSC, 1x Denhart’s, 250 µg/ml yeast tRNA, 500 µg/ml Salmon Sperm DNA,

100ug/ml Heparin, 5mM EDTA and 0.1% Tween-20) for 1-2h at 65°C. The tissue sections were

104 incubated with DIG-labeled RNA probes in hybridization buffer overnight at 65°C. After RNA

hybridization, slides were washed in 2x SSC at 65°C for 15 min and then at room temperature

for 5 min, followed by Rnase (1µg/ml in 2x SSC) incubation at 37°C for 30 min and washes with

2x SSC (RT) for 5 min twice and 0.2x SSC (60°C) for 30 min twice. DIG-RNA hybridized to

tissue sections was visualized by incubating the slides first in blocking solution (1% BSA in

PBS) for 1h and with anti-digoxigenin antibody (Roche; 1:2000) at 4°C overnight, followed by washing in PBT (PBS, 0.1% Tween-20), equilibrating in alkaline phosphatase (AP) staining buffer (100 mM Tris, pH 9.5; 50 mM MgCl2; 100 mM NaCl and 0.1% tween-20) and color development with NBT/BCIP (Roche) until a strong signal was detected in the sections hybridized to anti-sense probes; specificity was confirmed by lack of signal in sense-hybridized sections developed in the same experiments for the same length of time. Reactions were stopped by PBT, and sections were mounted in 1:1 glycerol:PBS.

Graphing and statistics

All graphs and statistics were performed in GraphPad Prism, except the Venn diagram which was generated using BioVenn(21) and then traced using Adobe Illustrator. Statistical analysis was, in the case of simple control vs experimental comparison by student’s t test. Otherwise, significances determined by one-way ANOVA test with Dunnett’s Multiple Comparison correction.

Laser-capture microdissection (LCM) and qRT-PCR

Preparation of stomach frozen sections for LCM has been described previously (50). Briefly,

stomachs were excised immediately following sacrifice, quickly flushed with RT PBS, inflated

105 by duodenal injection of O.C.T. (Sakura Finetek, Torrance, CA), frozen in Cytocool II (Richard-

Allen Scientific, Kalamazoo, MI) and cut into serial 7 µm-thick cryosections which were mounted on Superfrost slides (Fisher Scientific), fixed in 70% ETOH, rehydrated in nuclease- free water (nuclease-free solutions from Ambion, Austin, TX) and then incubated in Alexa Fluor

488 conjugated Griffonia simplicifolia-II (GS-II) (diluted 1:500 in nuclease-free water) for 15 mins. Sections were washed in nuclease-free water and dehydrated in graded ethanol, followed by xylene. ZCs were identified as corpus cells that were basal to GS-II labeling and which did not show the dark silhouettes and characteristic shape of parietal cells following xylene dehydration. Four wildtype and 5 Mist1−/− of mice were used for dissection (PixCell II LCM

apparatus, 7.5 µm spot diameter; CapSure HS LCM caps, Arcturus, Mountain View, CA) to

generate two caps per mouse. RNA was purified by PicoPure kit (Arcturus), and RNA integrity

was confirmed by Agilent 2100 Bioanalyzer (Palo Alto, CA). QRT-PCR was only performed on

RNA that had sharp 18s and 28s bands. All RNA from each cap was treated with DNAse I

(Invitrogen) and then reverse transcribed using the SuperScript III (Invitrogen) standard protocol

(most cDNA syntheses started with 10 ng of total RNA). Measurements of cDNA levels were performed by qRT-PCR using a Stratagene (La Jolla, CA) MX3000P Detection System, and

Absolute QPCR SYBR Green Mix (Thermo Scientific) fluorescence was used to quantify relative amplicon amount of mouse RAB3D, RAB26, CCPG1, and 18S. Data analysis to allow

expression of qRT-PCR data in terms of cycles above background, normalized to 18s amplicon

intensity, was performed as described in detail (5).

QRT-PCR from stable MIST1-expressing and eGFP-control HGC cells was performed

after RNA isolation using TRIzol-solubilized tissue extract (Invitrogen) following the manufacturer's protocol, quantification using the Beckman Coulter DU 640 Spectrophotometer

106 (Fullerton, CA), and cDNA synthesis as described (5) (1 µg of starting total RNA was used).

Measurements of cDNA levels for RAB3D, RAB26 and 18S were performed and analyzed as described above.

Plasmid preparation phMist1-EGFP-C1 expression plasmid was constructed with the coding region of human MIST1

cDNA (Open Biosystems, Huntsville, AL, IMAGE ID: 8322448) followed by a 30 aa peptide

linker added in-frame to the amino terminus of EGFP in pEGFP-C1 (Clontech Laboratories, Inc.,

Mountain View, CA) by the restriction site-free PCR method of ribocloning ((1), http://barnes1.wustl.edu/~wayne/riboclon.htm) using Klentaq-LA enzyme (2), a kind gift of

Wayne Barnes, Washington University, and accurate PCR conditions. The riboprimers used did not match the vector or target products so they were first elongated on longer bandaid primer templates. The vector region was amplified by PCR using primers DNA3as and pEGFP-DNA3sb with V5s and EGFP-V5asb on pEGFP-C1 DNA. The hMist1 target was PCR amplified using

DNA3s and hMist-DNA3b with V5as after sequential elongations on bandaids hMist-V5b3, hMist-V5b2, and hMist-V5b1. The construct coding region pMT6-5 (5416 bp) was verified correct by DNA sequencing.

The ‘pcDNA3.1 PGCRFP’ fusion construct was generated using a modified sequence overlap extension PCR strategy. The PGC fragment was amplified by PCR from a

‘pcDNA3.1PGC’ plasmid (a kind gift of Dr. Susan Guttentag, University of Pennsylvania; (16)) with T7 primer (forward) and a reverse primer that contained both the PGC 3’end and RFP 5’ end coding sequence separated by a small linker sequence. The RFP sequence was amplified by

PCR from a ‘pCS2 Notch-RFP’ plasmid (kind gift of Dr. Rafi Kopan, Washington University)

107 and a forward primer (complementary to the reverse primer used to amplify the PGC fragment)

and a reverse primer. The PGC and RFP fragments were then purified and mixed together with

T7 and RFP reverse primer to amplify the PGC-RFP fusion fragment. This PCR fragment was then digested with EcoRI and XhoI and cloned into pcDNA3.1 vector that was linearized with the same pair of restriction enzymes.

pEGFP- hMist1-C1 (designed by a similar method to phMist1-EGFP-C1) was monomerized to pmEGFP-hMist1-C1 by site-directed mutagenesis using reverse and forward primers (58) to convert leucine 222 to lysine and introduce a new restriction site, AflII. meGFP- hRab26 expression plasmid was constructed with the coding region of hRab26 cDNA (Open

Biosystems, IMAGE ID: 5262795) added in-frame to the carboxyl terminus of EGFP replacing the hMist1 coding region in pEGFP-hMist1-C1 by the restriction site-free PCR method of ribocloning, (1), http://barnes1.wustl.edu/~wayne/riboclon.htm) using Klentaq-LA enzyme (2) and accurate PCR conditions as above. The vector region was PCRed using primers DNA3as and pcD3LKs on pmEGFP-hMist1-C1 DNA. The hRab26 target was PCR amplified using DNA3s and hRab26-DNA3b with pcD3LKas and hRab26-pcD3LKs. The construct coding region (5583 bp) was verified correct by DNA sequencing.

meGFP-hRab26 was mutagenized to meGFP-hRab26T77N by site-directed mutagenesis to convert threonine at amino acid position 77 to an asparagine and introducing a new BbsI restriction site. The construct coding region was verified correct by DNA sequencing.

108 Results

Identifying MIST1 direct targets that might regulate secretory cell granule formation and

establishment of apical-basal polarity

During maturation, ZCs undergo three dramatic changes in cell biology; they: 1) greatly upregulate their rER network, 2) form large exocrine secretory granules; 3) expand their apical cytoplasm, with their nuclei moving basally. Mist1 expression begins as zymogenic cells (ZCs) start to differentiate from their mucous neck cell precursors (50); it is involved in both formation/maintenance of the secretory granules and in the apical-basal reorganization. In the absence of Mist1, ZCs exhibit markedly smaller zymogen-containing, secretory vesicles relative to wildtype (Fig. 1A,C,E). Vesicle size, as measured on tEM from multiple ZCs in multiple gastric units, decreases from a mean of 0.40±0.03 μm2 (wildtype) to 0.14±0.02 μm2

(Mist1−/−mice; p<0.001; Fig. 1B,C). The defects in apical-basal organization are illustrated in

Fig. 1B,D. The ratio of supranuclear to infranuclear secretory vesicle fluorescence decreases

from an apical predominance of 4.2±0.7:1 to essentially equal distribution of apical and basal

granules (ratio of 1.49±0.06:1) in Mist1−/− ZCs (Fig. 1D). The changes reflect inappropriate

basolateral trafficking of granules and/or overly apical positioning of the nucleus. MIST1 loss of

function defects are summarized in the diagram in Fig. 1E. Loss of MIST1 does not result in

decreased rER(50).

To determine the genes that might be activated by MIST1 to regulate cellular structural changes, we transiently transfected either MIST1 or empty vector control plasmid into two human

gastric cell lines (AGS and HGC-27). eGFP plasmid was cotransfected under both conditions,

and high GFP-expressing (i.e., highly transfected cells) were isolated by fluorescence activated

cell sorting (FACS). Global gene expression changes specific to MIST1 transfection were

109 assayed by Affymetrix HGU133_Plus_2 GeneChips. A total of 16 genes exhibited increased

expression (90% confidence interval ≥1.2-fold change, intensity difference ≥100) in both MIST1-

transfected cell lines relative to respective parental and empty vector-transfected control

populations (Fig. 2 and Table 1).

MIST1 directly associates with conserved CATATG E-boxes in 6 MIST1–induced genes

To determine which MIST1-induced genes were likely direct targets of MIST1, we first

examined the entire genomic region upstream to the transcription start sites and the entire first

intron of each gene for conserved E-box sequences of the CATATG type, shown previously to

be the binding site for both mammalian MIST1 (62) and DIMMED, its fly ortholog (19, 45, 46).

ARRDC3, CCPG1, FNDC3A, and SERPINI1 all contain remarkably conserved CATATG sequences

within the first intron (Fig.3A). The RAB3D gene has the canonical MIST1 binding site in a region

between 167 and 205 bp downstream of the end of the first exon in multiple species (Fig. 3B).

RAB26 has a similarly located CATATG that is conserved in multiple mammalian genomes;

however, the only CATATG in the 5’ upstream and intronic genomic DNA we examined is in a

region 11.3 kb upstream of the RAB26 transcription start (Chr16: 2127505), a location also

conserved in chimpanzee (Fig. 3C). The remainder of the 16 MIST1-activated genes showed no conserved CATATG sites in the first intron.

To confirm direct MIST1 binding to the conserved CATATG sites, we performed

chromatin immunoprecipitation (ChIP) on HGC-27 gastric cells stably expressing a MIST1-eGFP

plasmid (henceforth, HGC-MIST1). Primers closely flanking the conserved CATATG sites shown

in Fig.3A,B,C generated amplicons in the MIST1-immunoprecipitated genomic DNA fragments

with greater efficiency than from preimmune-precipitated DNA in all 6 genes (Fig. 4). In

110 contrast, primers to control regions without CATATG sequences generated little to no amplicon in the MIST1-immunoprecipitated DNA. We also examined non-conserved CATATG sites in

CCPG1, SERPINI1, and FNDC3A (FIG. 4). Only the site in CCPG1 showed possible occupation by

MIST1, though this site was within 5 kb of the conserved CATATG, and genomic DNA was fragmented to an average size of 1 kb in these experiments. Hence, we cannot rule out that a small population of longer genomic DNA fragments derived from precipitation of MIST1 at the conserved site might account for amplification at this region. Overall, the results indicate that

MIST1 occupies specific transcription regulatory elements in ARRDC3, CCPG1, FNDC3A, SERPINI1,

RAB26, and RAB3D genes.

Rab3d and Rab26 are ZC-specific and Mist1-dependent in vivo

Of the 6 MIST1-regulated genes, two, RAB3D and RAB26, have been previously proposed to play a role in regulated secretion (15). Thus, we reasoned that these two RABs might be the cellular effectors that MIST1 induces to govern maintenance and formation of large secretory granules in exocrine secretory cells. We examined other related RAB genes purported to be involved in regulated exocytosis (RAB3A,B,C; RAB27A,B; and RAB37) and did not find similarly conserved CATATG sequences (not shown), nor was expression of these other RAB family members affected by forced MIST1 expression (Fig. 2B). Thus, RAB3D and RAB26 appear to be specific and direct targets of MIST1 transcriptional regulation.

If RAB3D and RAB26 regulate secretory granule formation, they should be expressed in

ZCs and be MIST1-dependent in vivo. In situ hybridization showed that RAB26 and RAB3D expression in mouse stomach was confined to MIST1–expressing ZCs in wildtype mice (Fig.

5A,B). To determine whether either Rab depended on MIST1 expression, we laser-capture

111 microdissected ZCs from the bases of Mist1−/− mice and their wildtype littermates. In Mist1−/−

mice, RAB26 message was barely detectable above background signal (1.9 cycles above water;

n=3 independent mice and dissections), whereas it was expressed at 11-fold higher levels in

−/− wildtype mice (p<0.01; FIG 5C). Mist1 mice also showed a significant decrease (8-fold,

p<0.001) in RAB3D expression (Fig 5C). Hence Rab26 and Rab3d are transcriptionally regulated by MIST1 in vivo as well.

Expression of pepsinogen-RFP in MIST1-expressing stable lines causes formation of large

exocrine secretory granules

Our results so far showed that: 1) loss of MIST1 leads to small secretory granules and

defects in the apical compartment where those granules mature; 2) expression of two putative

regulators of exocrine granule homeostasis, RAB3D and RAB26, is directly regulated in vitro by

MIST1; and 3) RAB3D and RAB26 expression is MIST1-regulated in vivo specifically in Mist1

expressing cells. Thus, the data indicate that MIST1 regulates vesicle maturation via direct transcriptional activation of RAB3D and RAB26. To functionally test that hypothesis, we needed an in vitro system where the role of RABs in large secretory vesicle dynamics could be assessed

mechanistically. We designed a construct comprising one of the principal constituents of ZC

secretory granules, pepsinogen C (PGC) fused at the carboxyl terminus to red fluorescent protein

(RFP). Fig. 6 shows that stable HGC-MIST1 cells transiently transfected with this construct

developed multiple large PGC-containing granules. The results of multiple (n=8) separate

transfections showed, highly reproducibly, that 23.0±1.2% of the cells with RFP fluorescence

detectable above background had ≥3 vesicles of ≥1 µm in size. In control HGC cultures stably

expressing eGFP alone (without MIST1), cells with these large secretory granules were rarer

112 (7.5±1.5%, p<0.001 by one-tailed t-test between MIST1 and control), whereas cells with bright

diffuse PGC-RFP were far more common (4.3±0.2% MIST1 vs. 11.2±0.6% control, p<0.001; Fig.

6A,B).

When examined on their tissue culture substrate using transmission EM, both MIST1- expressing and control cells with PGC-RFP contained multiple secretory vesicles (Fig. 6C), whereas non-transfected cells did not (not shown). However HGC-MIST1 cells formed vesicles

that tended to cluster together and were each over twice as large as the vesicles found in control

cells (0.70±0.12 μm2 vs. 0.34±0.11 μm2, p<1x106; Fig. 6C-E). Fig. 6D demonstrates how

vesicles could be seen undergoing exocytosis. We observed no consistent difference in cell proliferation, apoptosis, or cell morphology between MIST1-expressing cell lines and controls

(not shown). Finally, we treated cultures of MIST1-expressing, PGC-RFP transfected cells with

the secretagogue, carbachol (100 μm), which greatly increased formation and trafficking of large

PGC-RFP granules (not shown), indicating that these cell lines can respond to a physiologic,

muscarinic agonist that induces release of zymogen-containing granules in ZCs in vivo.

Large exocrine granule formation requires RAB prenylation and RAB26 activity

Using qRT-PCR, we confirmed that cells stably expressing MIST1, as expected,

constitutively expressed higher levels of RAB transcripts. RAB26 was constitutively expressed at

4.1±0.9 and RAB3D at 15.0±8.2- fold higher levels (n=6 independent experiments; p<0.001 and

<0.005) in HGC-MIST1 cells relative to those stably expressing a control eGFP vector alone (Fig.

7A).

We next sought to ascertain whether formation of large PGC-RFP granules required the

RAB expression induced by MIST1. We transfected HGC-MIST1 cells with PGC-RFP in the

113 presence of 5mM 3-PEHPC (3, 10), an inhibitor of RAB geranylgeranyl transferase (RGGT), the

enzyme that catalyzes the addition of geranylgeranyl groups to the carboxy terminal di-cysteine

(CC or CXC) motifs in RAB3D and RAB26 (55). We used the minimal concentration of 3-PEHPC

that completely dispersed the normal cellular localization of an eGFP-RAB26 construct. Once

RABs lose the ability to localize to their defined cellular compartments, they no longer function.

As hypothesized, inhibition of RAB function led to loss of the large PGC-RFP granules (Fig.

7B,C). Cells with large granules decreased ~4-fold in the presence of inhibitor (p<0.001),

equivalent to levels in the non-MIST1-expressing control cells (Fig 7E).

The cellular localization and expression of RAB3D in exocrine secretion has been relatively well studied (38, 66). RAB3D is important for secretory-granule homeostasis in diverse

secretory cells. Although there is some controversy about its primary function (51, 63), it is

generally thought that RAB3D regulates release of mature secretory granules, likely by tethering

them to elements of the cortical actomyosin mesh (7, 37). Given that RAB3D already had an

established role in exocrine granule homeostasis, we decided to further examine the role of

RAB26 in this process.

To determine if more targeted disruption of RAB26 function could inhibit large

zymogenic vesicle formation, we designed a point mutant RAB26 (eGFP-RAB26T77N) based on

close conservation of the RAB26 GTP binding region with the analogous RAB3D sequence

(RAB3DT36N), which acts as a dominant negative when the equivalent threonine is mutated to

asparagine in the G2 box region responsible for coordinating Mg2+ binding (7); for structure of

RAB26, see: (65)). As expected, eGFP-RAB26T77N did not localize to a specific membrane

compartment like wildtype RAB26, which is perinuclear (Jin et al., unpublished observations).

114 Rather eGFP-RAB26T77N distributed throughout the cytoplasm in a pattern similar to that of

wildtype RAB26 in the presence of 3-PEHPC (not shown).

Transfection of the dominant negative construct inhibited large granule formation in

HGC-MIST1 cells cotransfected with PGC-RFP (Fig. 7D). Overall, the percentage of cells

expressing large granules (n=3 independent experiments) decreased 28±5% (p<0.01; Fig. 7E).

When the effects of transfection of the dominant negative construct on the large, PGC-RFP

granular phenotype were correlated on a cell-by-cell basis, almost none of the cells with large

zymogenic granules were seen to express cytoplasmic eGFP-RAB26T77N (Fig. 7F,H).

Conversely, among those cells transfected with eGFP-RAB26T77N above background, almost

none showed the large vesicular phenotype (Fig. 7F), confirming that expression of eGFP-

RAB26T77N prevented formation of the large PGC-RFP vesicles. In a control experiment, we

transfected a plasmid with eGFP alone in lieu of eGFP-RAB26T77N (Fig. 7G, H). Expression of eGFP alone had no effect on formation of large PGC-RFP granules, indicating that the effects of eGFP-RAB26T77N were specific to its function as a dominant negative RAB. Together, the data

demonstrate that RAB26 function is required for the formation of the large PGC granules.

A previous study showed that RAB3D was not sufficient to rescue granulogenesis in

−/− Mist1 cells(26). We tested whether RAB26 was sufficient to induce large granules in control

HGC cells, stably transfected with eGFP and not MIST1. Transfection of eGFP-RAB26 in these

cells in three independent experiments led to a higher fraction of cells with large PGC granules

(from 7.5±2.3% to 10.9±0.4%; not shown) that approached a statistically significant increase

(p<0.06 by one-tailed T-test) but did not approach the level seen in HGC-MIST1 cells. Thus,

although required for maturation of granules, RAB26, like RAB3D, does not seem to be sufficient

to rescue the loss of MIST1 function phenotype in the absence of other MIST1 targets.

115 Discussion

Here, we demonstrate the role of MIST1 in establishing the characteristic secretory

phenotype of zymogen exocrine cells through direct transcriptional activation of RAB3D and

RAB26. These two RABs were the only ones increased following MIST1 transfection and the only

RABs of those thought to be associated with secretory granule homeostasis that had conserved

MIST1-binding E-box elements. Furthermore, ChIP confirmed that MIST1 directly associated with

RAB3D and RAB26 E-boxes. We next showed that RAB3D and RAB26 expression was specific to

MIST1–expressing cells in vivo and was also Mist1-dependent. Finally, we established an in vitro

system to test the functional importance of RAB3D and RAB26. Cells stably expressing MIST1, as

expected, have constitutively increased levels of both RAB3D and RAB26. When transfected with

an RFP-tagged zymogenic granule component PGC, these cells, but not controls, formed large

zymogenic secretory granules. Large granule formation required increased RAB activity, because

inhibition of RAB prenylation resulted in cells with smaller granules, indistinguishable from those

of non MIST1-expressing control cells. Previous studies have shown that RAB3D participates in

exocrine granule homeostasis but is not itself sufficient to induce large granule formation in

MIST1-expressing cells(26, 38, 42, 51, 66). Here we show that forced expression of a RAB26

dominant negative construct completely abrogates large vesicle formation, yet transfection of

RAB26 alone does not substantially rescue the mist1 loss of function granule phenotype. Thus,

like RAB3D, RAB26 is required but not sufficient for exocrine granulogenesis.

MIST1 is expressed by a limited number of specialized secretory cells in diverse tissues.

Loss of Mist1, in all reported cases, does not lead to a decrease in steady-state survival or formation of these cell lineages, nor does it lead to a change in their cell fate. The fundamental feature of loss of Mist1 function is that the cells that would express Mist1 are still generated,

116 occupy their same in vivo niches, and secrete the same substances (32, 50, 73). However, loss of

MIST1 has profound effects on cell shape/architecture and cell function. With loss of MIST1,

zymogen-secreting cells in stomach, pancreas, and salivary gland don't achieve their full size,

and their zymogenic granules become smaller as well. Pancreatic acinar cells grown in vitro

show smaller zymogen stores, altered Ca2+ currents, and loss of normal apical, perinuclear Golgi

localization (34).

Mist1 protein is highly conserved across species. The Drosophila ortholog of Mist1,

DIMMED, shares 78% identity through the bHLH region and binds the same CATATG E-box

sequence in its known target gene (46, 62). Conservation between the two genes in these distantly related organisms is such that expression of MIST1 can induce a DIMMED target gene in

vitro (45). The zebrafish Mist1 orthologue shares 77% identity with mouse MIST1 in the bHLH domain (18). Loss of zebrafish Mist1 leads to morphologic abnormalities in pancreatic, enzyme- secreting cells (18). Gain of function experiments show that DIMMED is sufficient to orchestrate

increased secretory vesicle size (19, 20, 45) analogous to MIST1 gain of function in the current

manuscript. Thus, MIST1 is a developmentally regulated TF whose expression is induced during

terminal differentiation of selected secretory cells in diverse tissues with highly evolutionarily

conserved function.

Which genes might a single TF activate to effect complete remodeling of cellular

architecture? Two previously reported targets of MIST1 in vitro in pancreatic cells are the gap

junction gene Connexin32 (GJB1) (52) and the cell cycle regulating p21(CIP1/WAF1;

Cdkn1a)(24). We do not detect GJB1 expression in the gastric cell lines used in this manuscript

by GeneChip or qRT-PCR (Tian et al., unpublished observations), so we do not think this is a

MIST1 target in our system. CDKN1 is expressed in ZCs in vivo and in gastric cell lines, but

117 expression is not MIST1-dependent in cell lines. Furthermore, in vivo, expression of CDKN1 is lower in ZCs than in other MIST1-negative gastric epithelial cells (Tian et al., unpublished

observations), so this also seems an unlikely target to mediate the morphological changes

induced by MIST1.

It is possible that MIST1 activates both tissue-specific and universal sets of genes. In this

work, we identified 16 genes whose expression is activated by MIST1 in two different gastric cell

lines. The majority of these genes are thought to function in secretion or membrane trafficking,

reinforcing our understanding of MIST1 as a TF that enables terminally differentiating cells to

upregulate cellular effectors that establish a high capacity secretory architecture. In addition to

RAB3D and RAB26, the subjects of the current manuscript, four other genes, including CCPG1

were also direct targets of MIST1 as indicated by our chromatin immunoprecipitation studies (Fig.

4). CCPG1 did not appear to be regulated by MIST1 in gastric ZCs (Figure 5C, and data not

shown); however, CCPG1 is a large gene with multiple splice variants, and we have assayed only

one variant so far. We are currently analyzing the 10 genes without conserved CATATGs to

determine whether any of them bind MIST1 in a non-canonical fashion.

Are the increases in granule size and trafficking sufficient in themselves to effect the

apical-basal cell shape reorganization also induced by MIST1, or are other MIST1 targets involved?

We already know from previous studies that the cytoskeletal adaptor, CD2AP, is critical in the

absence of MIST1 for maintaining cell shape, specifically cell height and ordered cell-cell

adhesion (Fig. 8), though CD2AP does not appear to be a target of MIST1(5). The experiments do

suggest, in any case, a role for other genes besides just Rab26 and Rab3d in the cell shape

changes MIST1induces.

118 RAB26 clusters by sequence homology with the RAB37, RAB27 and RAB3 subfamilies,

which are critical for regulated secretion. However, whereas RAB27 and RAB3 family members

(such as RAB3D) are relatively ubiquitously expressed in specialized secretory cells in numerous tissues, expression of RAB26 appears to be more limited, with highest previously reported

expression in pancreatic and submandibular enzyme-secreting acinar cells, both of which express

MIST1 (40, 64, 68). A functional genomic screen also identified RAB26 as a normal gastric gene

whose expression is downregulated in human cancer (67). The only previous functional study of

RAB26 showed that in salivary gland zymogen-secreting cells, RAB26 was associated with

secretory granules (by cell fractionation and western blot), and injection of RAB26 antibodies inhibited exocytosis, consistent with our findings (40).

It is currently unclear what mechanisms RAB3D and RAB26 use to induce formation of

larger secretory granules. Our current results and those of previous studies indicate that both

RAB26 and RAB3D are required but not individually sufficient for the formation of large secretory

granules. The simplest model would be that MIST1 mediated vesicle maturation and trafficking is

dependent on a balance between RAB26 and RAB3D activity (Fig. 8), though we cannot currently

rule out a role for other direct targets. In a series of ongoing experiments (Jin et al., unpublished

observations), we have learned that RAB26 helps organize the apical cellular compartment where

immature secretory granules form and mature. RAB3D has been implicated downstream in tethering vesicles to the apical cytoskeleton. Tethering vesicles would encourage vesicle enlargement, because it would delay vesicle secretion and facilitate fusion of smaller, immature vesicles. Thus, RAB3D and RAB26 might coordinate sequential membrane compartments, RAB26

encouraging homotypic fusion of immature granules and/or larger budding from the trans-Golgi

and RAB3D tethering maturing granules to the cortical cytoskeleton to await a signal for granule

119 fusion with the plasma membrane. Together, these two RABs may represent the key cellular

effectors that carry out the developmental signal encoded by MIST1.

Prospectus

The process of cellular differentiation is typically understood as a sequence of transcription

factor inductions, each of which specifies the next step in the developmental program of a given

cell lineage. Any given terminally differentiated cell is thus ultimately specified by its unique

history of sequential transcription factor induction steps. That view explains well how each

differentiated cell in an organism ultimately comes to produce the unique set of proteins that

distinguish it from all other cells. But what induces the genes that high-capacity, secretory cells

all share, no matter what they actually secrete–the genes that lay down the secretory

architecture? Given the parsimony of evolution, it would make sense if these secretory cassettes

were induced by a limited number of tissue-independent but still developmentally regulated transcription factors. Indeed, our recent survey of gene expression across multiple adult tissues indicates this is so (13). In the current paper, we show how MIST1, a transcription factor critical

for enacting cellular architecture, activates RAB26 and RAB3D, which in turn organize vesicle

trafficking to maximize apical production and maintenance of large secretory granules. The

mechanism we describe here will undoubtedly be only part of a much larger story, as we

continue to dissect the mechanisms of transcriptional regulation of cell architecture change.

120

Acknowledgments

We thank the Washington University Multiplexed Gene Analysis Core of the Siteman Cancer

Center (supported in part by National Cancer Institute Grant P30-CA-91842). Further grant

support: JCM (R01 DK-079798-01, ACS DDC-115769), XT (T32-AI007172), CEM (grant from

Procter & Gamble). Thanks also to Karen Green for EM, to Liwei Zhang for ideas on gene

alignments, and to Dr. Indira Mysorekar for thoughtful review of the manuscript.

Abbreviations Used: TF – Transcription Factor; ZC – Zymogenic Cell; PGC – Pepsinogen C;

EM – electron microscopy; eGFP – enhanced green fluorescent protein; RFP – red fluorescent protein, LCM – laser-capture microdissection; rER – rough endoplasmic reticulum; tEM – transmission electron microscopy; qRT-PCR – quantitative real time polymerase chain reaction;

RGGT - Rab geranylgeranyl transferase

121 References

1. Barnes, W. M. 2003. Chapter29: Ribocloning. In C. W. Dieffenbach and G. S. Dveksler (ed.), PCR Primer: A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. 2. Barnes, W. M. 1994. PCR amplification of up to 35-kb DNA with high fidelity and high yield from lambda bacteriophage templates. Proc Natl Acad Sci U S A 91:2216-20. 3. Baron, R. A., R. Tavare, A. C. Figueiredo, K. M. Blazewska, B. A. Kashemirov, C. E. McKenna, F. H. Ebetino, A. Taylor, M. J. Rogers, F. P. Coxon, and M. C. Seabra. 2009. Phosphonocarboxylates inhibit the second geranylgeranyl addition by Rab geranylgeranyl transferase. J Biol Chem 284:6861-8. 4. Bhattacharya, D., M. T. Cheah, C. B. Franco, N. Hosen, C. L. Pin, W. C. Sha, and I. L. Weissman. 2007. Transcriptional profiling of antigen-dependent murine B cell differentiation and memory formation. J Immunol 179:6808-19. 5. Bredemeyer, A. J., J. H. Geahlen, V. G. Weis, W. J. Huh, B. H. Zinselmeyer, S. Srivatsan, M. J. Miller, A. S. Shaw, and J. C. Mills. 2009. The gastric epithelial progenitor cell niche and differentiation of the zymogenic (chief) cell lineage. Dev Biol 325:211-24. 6. Capoccia, B. J., W. J. Huh, and J. C. Mills. 2009. How form follows functional genomics: gene expression profiling gastric epithelial cells with a particular discourse on the parietal cell. Physiol Genomics 37:67-78. 7. Chen, X., J. A. Edwards, C. D. Logsdon, S. A. Ernst, and J. A. Williams. 2002. Dominant negative Rab3D inhibits amylase release from mouse pancreatic acini. J Biol Chem 277:18002-9. 8. Cohen, M. M., Jr. 2003. The hedgehog signaling network. Am J Med Genet A 123A:5-28. 9. Cox, G. A., C. L. Mahaffey, A. Nystuen, V. A. Letts, and W. N. Frankel. 2000. The mouse fidgetin gene defines a new role for AAA family proteins in mammalian development. Nat Genet 26:198-202. 10. Coxon, F. P., F. H. Ebetino, E. H. Mules, M. C. Seabra, C. E. McKenna, and M. J. Rogers. 2005. Phosphonocarboxylate inhibitors of Rab geranylgeranyl transferase disrupt the prenylation and membrane localization of Rab proteins in osteoclasts in vitro and in vivo. Bone 37:349-58. 11. Davis, R. L., A. E. Shrimpton, R. W. Carrell, D. A. Lomas, L. Gerhard, B. Baumann, D. A. Lawrence, M. Yepes, T. S. Kim, B. Ghetti, P. Piccardo, M. Takao, F. Lacbawan, M. Muenke, R. N. Sifers, C. B. Bradshaw, P. F. Kent, G. H. Collins, D. Larocca, and P. D. Holohan. 2002. Association between conformational mutations in neuroserpin and onset and severity of dementia. Lancet 359:2242-7. 12. Davis, R. L., A. E. Shrimpton, P. D. Holohan, C. Bradshaw, D. Feiglin, G. H. Collins, P. Sonderegger, J. Kinter, L. M. Becker, F. Lacbawan, D. Krasnewich, M. Muenke, D. A. Lawrence, M. S. Yerby, C. M. Shaw, B. Gooptu, P. R. Elliott, J. T. Finch, R. W. Carrell, and D. A. Lomas. 1999. Familial dementia caused by polymerization of mutant neuroserpin. Nature 401:376-9. 13. Doherty, J. M., M. J. Geske, T. S. Stappenbeck, and J. C. Mills. 2008. Diverse adult stem cells share specific higher-order patterns of gene expression. Stem Cells 26:2124-30.

122 14. Ea, C. K., L. Sun, J. Inoue, and Z. J. Chen. 2004. TIFA activates IkappaB kinase (IKK) by promoting oligomerization and ubiquitination of TRAF6. Proc Natl Acad Sci U S A 101:15318-23. 15. Fukuda, M. 2008. Regulation of secretory vesicle traffic by Rab small GTPases. Cell Mol Life Sci 65:2801-13. 16. Gerson, K. D., C. D. Foster, P. Zhang, Z. Zhang, M. M. Rosenblatt, and S. H. Guttentag. 2008. Pepsinogen C proteolytic processing of surfactant protein B. J Biol Chem 283:10330-8. 17. Grosshans, B. L., D. Ortiz, and P. Novick. 2006. Rabs and their effectors: achieving specificity in membrane traffic. Proc Natl Acad Sci U S A 103:11821-7. 18. Guo, X., L. Cheng, Y. Liu, W. Fan, and D. Lu. 2007. Cloning, expression, and functional characterization of zebrafish Mist1. Biochem Biophys Res Commun 359:20-6. 19. Hamanaka, Y., D. Park, Y. Ping, T. Edwards, J. W. Sweedler, I. A. Meinertzhagen, and P. H. Taghert. In press. Transcriptional Orchestration of the Regulated Secretory Pathway in Neurons by the bHLH protein DIMM. Curr Biol. 20. Hewes, R. S., D. Park, S. A. Gauthier, A. M. Schaefer, and P. H. Taghert. 2003. The bHLH protein Dimmed controls neuroendocrine cell differentiation in Drosophila. Development 130:1771-81. 21. Hulsen, T., J. de Vlieg, and W. Alkema. 2008. BioVenn - a web application for the comparison and visualization of biological lists using area-proportional Venn diagrams. BMC Genomics 9:488. 22. Im, H., J. A. Grass, K. D. Johnson, M. E. Boyer, J. Wu, and E. H. Bresnick. 2004. Measurement of protein-DNA interactions in vivo by chromatin immunoprecipitation. Methods Mol Biol 284:129-46. 23. Inase, N., K. Fushimi, K. Ishibashi, S. Uchida, M. Ichioka, S. Sasaki, and F. Marumo. 1995. Isolation of human aquaporin 3 gene. J Biol Chem 270:17913-6. 24. Jia, D., Y. Sun, and S. F. Konieczny. 2008. Mist1 regulates pancreatic acinar cell proliferation through p21 CIP1/WAF1. Gastroenterology 135:1687-97. 25. Jiang, M., X. Gu, X. Feng, Z. Fan, F. Ding, and Y. Liu. 2009. The molecular characterization of the brain protein 44-like (Brp44l) gene of Gekko japonicus and its expression changes in spinal cord after tail amputation. Mol Biol Rep 36:215-20. 26. Johnson, C. L., A. S. Kowalik, N. Rajakumar, and C. L. Pin. 2004. Mist1 is necessary for the establishment of granule organization in serous exocrine cells of the gastrointestinal tract. Mech Dev 121:261-72. 27. Kanamori, M., H. Suzuki, R. Saito, M. Muramatsu, and Y. Hayashizaki. 2002. T2BP, a novel TRAF2 binding protein, can activate NF-kappaB and AP-1 without TNF stimulation. Biochem Biophys Res Commun 290:1108-13. 28. Karam, S. M., and C. P. Leblond. 1993. Dynamics of epithelial cells in the corpus of the mouse stomach. I. Identification of proliferative cell types and pinpointing of the stem cell. Anat Rec 236:259-79. 29. Karam, S. M., and C. P. Leblond. 1993. Dynamics of epithelial cells in the corpus of the mouse stomach. III. Inward migration of neck cells followed by progressive transformation into zymogenic cells. Anat Rec 236:297-313. 30. Kaser, A., A. H. Lee, A. Franke, J. N. Glickman, S. Zeissig, H. Tilg, E. E. Nieuwenhuis, D. E. Higgins, S. Schreiber, L. H. Glimcher, and R. S. Blumberg. 2008. XBP1 links ER

123 stress to intestinal inflammation and confers genetic risk for human inflammatory bowel disease. Cell 134:743-56. 31. Kostenko, E. V., O. O. Olabisi, S. Sahay, P. L. Rodriguez, and I. P. Whitehead. 2006. Ccpg1, a novel scaffold protein that regulates the activity of the Rho guanine nucleotide exchange factor Dbs. Mol Cell Biol 26:8964-75. 32. Kowalik, A. S., C. L. Johnson, S. A. Chadi, J. Y. Weston, E. N. Fazio, and C. L. Pin. 2007. Mice lacking the transcription factor Mist1 exhibit an altered stress response and increased sensitivity to caerulein-induced pancreatitis. Am J Physiol Gastrointest Liver Physiol 292:G1123-32. 33. Lee, A. H., G. C. Chu, N. N. Iwakoshi, and L. H. Glimcher. 2005. XBP-1 is required for biogenesis of cellular secretory machinery of exocrine glands. Embo J 24:4368-80. 34. Luo, X., D. M. Shin, X. Wang, S. F. Konieczny, and S. Muallem. 2005. Aberrant localization of intracellular organelles, Ca2+ signaling, and exocytosis in Mist1 null mice. J Biol Chem 280:12668-75. 35. Ma, Y., A. Erkner, R. Gong, S. Yao, J. Taipale, K. Basler, and P. A. Beachy. 2002. Hedgehog-mediated patterning of the mammalian embryo requires transporter-like function of dispatched. Cell 111:63-75. 36. Mannan, A. U., E. Roussa, C. Kraus, M. Rickmann, J. Maenner, K. Nayernia, K. Krieglstein, A. Reis, and W. Engel. 2004. Mutation in the gene encoding lysosomal acid phosphatase (Acp2) causes cerebellum and skin malformation in mouse. Neurogenetics 5:229-38. 37. Marchelletta, R. R., D. T. Jacobs, J. E. Schechter, R. E. Cheney, and S. F. Hamm- Alvarez. 2008. The class V myosin motor, myosin 5c, localizes to mature secretory vesicles and facilitates exocytosis in lacrimal acini. Am J Physiol Cell Physiol 295:C13-28. 38. Millar, A. L., N. J. Pavios, J. Xu, and M. H. Zheng. 2002. Rab3D: a regulator of exocytosis in non-neuronal cells. Histol Histopathol 17:929-36. 39. Mills, J. C., N. Andersson, C. V. Hong, T. S. Stappenbeck, and J. I. Gordon. 2002. Molecular characterization of mouse gastric epithelial progenitor cells. Proc Natl Acad Sci U S A 99:14819-24. 40. Nashida, T., A. Imai, and H. Shimomura. 2006. Relation of Rab26 to the amylase release from rat parotid acinar cells. Archives of oral biology 51:89-95. 41. Obholz, K. L., A. Akopyan, K. G. Waymire, and G. R. MacGregor. 2006. FNDC3A is required for adhesion between spermatids and Sertoli cells. Dev Biol 298:498-513. 42. Ohnishi, H., S. A. Ernst, N. Wys, M. McNiven, and J. A. Williams. 1996. Rab3D localizes to zymogen granules in rat pancreatic acini and other exocrine glands. Am J Physiol 271:G531-8. 43. Oka, S., H. Masutani, W. Liu, H. Horita, D. Wang, S. Kizaka-Kondoh, and J. Yodoi. 2006. Thioredoxin-binding protein-2-like inducible membrane protein is a novel vitamin D3 and peroxisome proliferator-activated receptor (PPAR)gamma ligand target protein that regulates PPARgamma signaling. Endocrinology 147:733-43. 44. Ovcharenko, I., M. A. Nobrega, G. G. Loots, and L. Stubbs. 2004. ECR Browser: a tool for visualizing and accessing data from comparisons of multiple vertebrate genomes. Nucleic Acids Res 32:W280-6. 45. Park, D., O. T. Shafer, S. P. Shepherd, H. Suh, J. S. Trigg, and P. H. Taghert. 2008. The Drosophila basic helix-loop-helix protein DIMMED directly activates PHM, a gene encoding a neuropeptide-amidating enzyme. Mol Cell Biol 28:410-21.

124 46. Park, D., and P. H. Taghert. 2009. Peptidergic neurosecretory cells in insects: organization and control by the bHLH protein DIMMED. Gen Comp Endocrinol 162:2-7. 47. Patel, S., and M. Latterich. 1998. The AAA team: related ATPases with diverse functions. Trends Cell Biol 8:65-71. 48. Pin, C. L., A. C. Bonvissuto, and S. F. Konieczny. 2000. Mist1 expression is a common link among serous exocrine cells exhibiting regulated exocytosis. Anat Rec 259:157-67. 49. Pin, C. L., J. M. Rukstalis, C. Johnson, and S. F. Konieczny. 2001. The bHLH transcription factor Mist1 is required to maintain exocrine pancreas cell organization and acinar cell identity. J Cell Biol 155:519-30. 50. Ramsey, V. G., J. M. Doherty, C. C. Chen, T. S. Stappenbeck, S. F. Konieczny, and J. C. Mills. 2007. The maturation of mucus-secreting gastric epithelial progenitors into digestive-enzyme secreting zymogenic cells requires Mist1. Development 134:211-22. 51. Riedel, D., W. Antonin, R. Fernandez-Chacon, G. Alvarez de Toledo, T. Jo, M. Geppert, J. A. Valentijn, K. Valentijn, J. D. Jamieson, T. C. Sudhof, and R. Jahn. 2002. Rab3D is not required for exocrine exocytosis but for maintenance of normally sized secretory granules. Mol Cell Biol 22:6487-97. 52. Rukstalis, J. M., A. Kowalik, L. Zhu, D. Lidington, C. L. Pin, and S. F. Konieczny. 2003. Exocrine specific expression of Connexin32 is dependent on the basic helix-loop-helix transcription factor Mist1. J Cell Sci 116:3315-25. 53. Saftig, P., D. Hartmann, R. Lullmann-Rauch, J. Wolff, M. Evers, A. Koster, M. Hetman, K. von Figura, and C. Peters. 1997. Mice deficient in lysosomal acid phosphatase develop lysosomal storage in the kidney and central nervous system. J Biol Chem 272:18628-35. 54. Sardiello, M., M. Palmieri, A. di Ronza, D. L. Medina, M. Valenza, V. A. Gennarino, C. Di Malta, F. Donaudy, V. Embrione, R. S. Polishchuk, S. Banfi, G. Parenti, E. Cattaneo, and A. Ballabio. 2009. A gene network regulating lysosomal biogenesis and function. Science 325:473-7. 55. Seabra, M. C., J. L. Goldstein, T. C. Sudhof, and M. S. Brown. 1992. Rab geranylgeranyl transferase. A multisubunit enzyme that prenylates GTP-binding proteins terminating in Cys- X-Cys or Cys-Cys. J Biol Chem 267:14497-503. 56. Shaffer, A. L., M. Shapiro-Shelef, N. N. Iwakoshi, A. H. Lee, S. B. Qian, H. Zhao, X. Yu, L. Yang, B. K. Tan, A. Rosenwald, E. M. Hurt, E. Petroulakis, N. Sonenberg, J. W. Yewdell, K. Calame, L. H. Glimcher, and L. M. Staudt. 2004. XBP1, downstream of Blimp-1, expands the secretory apparatus and other organelles, and increases protein synthesis in plasma cell differentiation. Immunity 21:81-93. 57. Shan, S. W., D. Y. Lee, Z. Deng, T. Shatseva, Z. Jeyapalan, W. W. Du, Y. Zhang, J. W. Xuan, S. P. Yee, V. Siragam, and B. B. Yang. 2009. MicroRNA MiR-17 retards tissue growth and represses fibronectin expression. Nat Cell Biol 11:1031-8. 58. Snapp, E. L., R. S. Hegde, M. Francolini, F. Lombardo, S. Colombo, E. Pedrazzini, N. Borgese, and J. Lippincott-Schwartz. 2003. Formation of stacked ER cisternae by low affinity protein interactions. J Cell Biol 163:257-69. 59. Sriburi, R., H. Bommiasamy, G. L. Buldak, G. R. Robbins, M. Frank, S. Jackowski, and J. W. Brewer. 2007. Coordinate regulation of phospholipid biosynthesis and secretory pathway gene expression in XBP-1(S)-induced endoplasmic reticulum biogenesis. J Biol Chem 282:7024-34.

125 60. Stoeckli, E. T., P. F. Lemkin, T. B. Kuhn, M. A. Ruegg, M. Heller, and P. Sonderegger. 1989. Identification of proteins secreted from axons of embryonic dorsal-root-ganglia neurons. Eur J Biochem 180:249-58. 61. Takatsuna, H., H. Kato, J. Gohda, T. Akiyama, A. Moriya, Y. Okamoto, Y. Yamagata, M. Otsuka, K. Umezawa, K. Semba, and J. Inoue. 2003. Identification of TIFA as an adapter protein that links tumor necrosis factor receptor-associated factor 6 (TRAF6) to interleukin-1 (IL-1) receptor-associated kinase-1 (IRAK-1) in IL-1 receptor signaling. J Biol Chem 278:12144-50. 62. Tran, T., D. Jia, Y. Sun, and S. F. Konieczny. 2007. The bHLH domain of Mistl is sufficient to activate gene transcription. Gene Expr 13:241-53. 63. Valentijn, J. A., L. van Weeren, A. Ultee, and A. J. Koster. 2007. Novel localization of Rab3D in rat intestinal goblet cells and Brunner's gland acinar cells suggests a role in early Golgi trafficking. Am J Physiol Gastrointest Liver Physiol 293:G165-77. 64. Wagner, A. C., M. Z. Strowski, B. Goke, and J. A. Williams. 1995. Molecular cloning of a new member of the Rab protein family, Rab 26, from rat pancreas. Biochem Biophys Res Commun 207:950-6. 65. Wang, J., W. Tempel, Y. Shen, L. Shen, D. Yaniw, C. Arrowsmith, A. Edwards, M. Sundstrom, J. Weigelt, A. Bochkarev, and H. Park. 2006. Crystal structure of human RAB26 in complex with a GTP analogue. 66. Williams, J. A., X. Chen, and M. E. Sabbatini. 2009. Small G proteins as key regulators of pancreatic digestive enzyme secretion. Am J Physiol Endocrinol Metab 296:E405-14. 67. Wu, M. S., Y. S. Lin, Y. T. Chang, C. T. Shun, M. T. Lin, and J. T. Lin. 2005. Gene expression profiling of gastric cancer by microarray combined with laser capture microdissection. World J Gastroenterol 11:7405-12. 68. Yoshie, S., A. Imai, T. Nashida, and H. Shimomura. 2000. Expression, characterization, and localization of Rab26, a low molecular weight GTP-binding protein, in the rat parotid gland. Histochem Cell Biol 113:259-63. 69. Zhao, Y., C. Johansson, T. Tran, R. Bettencourt, Y. Itahana, P. Y. Desprez, and S. F. Konieczny. 2006. Identification of a basic helix-loop-helix transcription factor expressed in mammary gland alveolar cells and required for maintenance of the differentiated state. Mol Endocrinol 20:2187-98. 70. Zhong, S., C. Li, and W. H. Wong. 2003. ChipInfo: Software for extracting gene annotation and gene ontology information for microarray analysis. Nucleic Acids Res 31:3483-6. 71. Zhou, B., and J. Gitschier. 1997. hCTR1: a human gene for copper uptake identified by complementation in yeast. Proc Natl Acad Sci U S A 94:7481-6. 72. Zhou, G., Z. Q. Bao, and J. E. Dixon. 1995. Components of a new human protein kinase signal transduction pathway. J Biol Chem 270:12665-9. 73. Zhu, L., T. Tran, J. M. Rukstalis, P. Sun, B. Damsz, and S. F. Konieczny. 2004. Inhibition of Mist1 homodimer formation induces pancreatic acinar-to-ductal metaplasia. Mol Cell Biol 24:2673-81.

126 Figure Legends

Figure 1. Mist1 is required for development and maintenance of large zymogenic secretory

granules and apical-basal orientation. A, tEMs of ZCs from wildtype and Mist1−/− mice. Note

central position of nucleus along with reduced size of mature apical secretory vesicles in the

Mist1−/− ZC. "SV", mature secretory vesicles “N”, nucleus. B, Epifluorescence of wildtype and

Mist1−/− ZCs in the base of a gastric unit (oriented with stomach lumen to left, base to right).

Cell and granule orientation observed by immunolabeling with anti-gastric intrinsic factor (GIF,

red) labeling granules, anti-β-actin (green) labeling mesenchymal cells at base of cells and

gastric unit lumen, anti-E-cadherin (purple) labeling basolateral cell-cell borders, and

bisbenzimide (blue) labeling nuclei. Dashed white line: basement membrane. Right- cartoons of

fluorescently labeled cells. Note that Mist1−/− ZCs have nuclei closer to the lumen with fewer, more basally localized secretory granules. C, Secretory vesicle areas from multiple ZCs were quantified from tEM photomicrographs (“**” – p<0.01; “***” – p <0.001, for all figures). D,

Multiple ZCs from multiple mice were quantified for apical (luminal to the nucleus) and basal

(basal to nucleus) secretory granule immunofluorescence in immunolabeling experiments like

those in panel B. Each point is the ratio of apical to basal mean fluorescent intensity determined

by anti-pepsinogen C (PGC, a principal component of zymogenic granules) in an individual ZC.

Note that wildtype ZCs have predominately apical distribution of granules, whereas apical and

basal granule distribution is nearly equal in Mist1−/− ZCs. E, Cartoon showing ZCs arising from

mucous neck cell progenitors in the neck of the gastric unit. In the absence of Mist1, ZCs

migrating into the base exhibit apical-basal organization and granule formation/maintenance deficits (panels C,E adapted from ref (50)).

127 Figure 2. Transient transfection with MIST1 in AGS and HGC-27 gastric cell lines increases expression of a common cohort of genes. A, Venn diagram showing the number of Affymetrix

HGU133_Plus_2 GeneChips probe sets increased in two different gastric epithelial cell lines

(HGC-27 and AGS) following transient transfection with MIST1. B, The expression intensities on

the GeneChips for the 18 probe sets (16 genes) that were increased in both cell lines relative to

vector-transfected and untransfected controls.

Figure 3. Several genes activated by MIST1 overexpression have evolutionarily conserved, first

intronic canonical MIST1 E-box sequences. A, All MIST1-type E-boxes (CATATG) were identified in the first introns and 5’ to transcription start for the 16 human genes from Fig. 2 (see

methods). Evolutionary conservation was then determined relative to the other vertebrate species

listed in legend (species identified by 2 letter abbreviations of species names; eg, ‘Gg’ = Gallus

gallus). Genes are schematized to scale with numbered exons in blue and region of gene

analyzed in bold line. Note dramatic conservation of CATATGs located within 1 kb of end of the

first exon in these 4 genes (red brackets). Primers to each of these conserved intronic sequences

were analyzed for MIST1 binding in Fig. 4; control primers were generated to assess MIST1

binding to regions with no CATATG (amplicons indicated by arrows with boxed “C”s). In some

cases, MIST1 binding to regions with non-conserved CATATGs (denoted by arrows with boxed

“M”s) was also assessed. B,C Schematic as in panel A for the two RAB genes induced by MIST1

transfection but with detailed sequence alignment at each CATATG. “*”-depicted consensus

sequence runs on antiparallel strand for the given species. Note that the conserved intronic

CATATG in RAB26 has a single point mutation in humans and chimpanzees destroying the E-

128 box. The genomes of those species have another MIST1 binding site ~11.5 kb upstream of the

transcription start; bovine genomes have both intronic and 5’ sites.

Figure 4. Conserved MIST1 E-box sequences are directly bound by MIST1. Gel electrophoresis

images of PCR amplicons representative of ≥3 independent chromatin immunoprecipitation

(ChIP) experiments using anti-MIST1 antibody followed by primers either to the conserved

intronic CATATG (“Mist1 site conserved”) or to non-conserved CATATG and control regions

denoted in Fig. 3. "Input 1:10" – genomic DNA prior to immunoprecipitation diluted 1:10;

"Preimmune" – immunoprecipitation from non-specific rabbit antiserum. All images taken from

PCR reactions run for 35 cycles, though each reaction was sampled at multiple cycles to ensure

amplification had not plateaued. Note conserved CATATG sequences show much stronger

amplification of MIST1-bound DNA than pre-immune-bound DNA, and no MIST1-bound DNA was detectable at control sites without CATATGs. Non-conserved CATATG sites showed little to no amplifiable MIST1-bound DNA.

Figure 5. Rab3d and Rab26 expression are zymogenic cell-specific and MIST1-dependent in vivo.

A,B In situ hybridization of mouse fundic gastric gland sections showing antisense RAB3D and

RAB26 signal confined to the ZCs at the base of the glands. Note the absence of signal in parietal

cells (arrowheads in the higher magnification view below each main panel). C, Quantitative RT-

−/− PCR of LCM-dissected ZCs from Mist1 mice. RAB3D and RAB26 expression are significantly

decreased in these mice. Note y-axis expressed as Log2 relative to levels in wells containing no

cDNA following 18s normalization; hence, 0=essentially no detectable levels of given amplicon;

−/− RAB26 expression in the Mist1 mice is nearly completely abrogated. Primers to another

129 potential MIST1 target, CCPG1, indicate no significant change in expression, indicating loss of

MIST1 specifically affects levels of the two RABs.

Figure 6. HGC-MIST1 cells form large exocrine granules upon PGC-RFP transfection. A,

Fluorescent microscopic image of HGC-27 cells stably expressing MIST1-eGFP (green nuclear

staining) showing large PGC vesicles (arrowheads) that do not form in control cells (stable

expressing eGFP alone) upon transfection with PGC-RFP. B, The fraction of cells with multiple

(≥3), large (≥1 μm) vesicles and diffuse, bright vesicles is quantified across multiple experiments

(note the remaining cells showed above-background RFP but were too dim to categorize). C,

tEM of ZCs from HGC- MIST1 and control cells. Note the reduced size of secretory vesicles in

the (control) HGC-27 cells. “SV” – secretory vesicle. D, tEM showing exocytosis of vesicle

contents (arrowhead) in an HGC- MIST1 cell. E, Vesicle sizes were quantified from tEM of

multiple HGC- MIST1 and control cells.

Figure 7. Large PGC-RFP vesicles in HGC-MIST1 cells are RAB function dependent. A, qRT-

PCR from 6 separate cultures of stable, HGC- MIST1 cells showing constitutively increased expression of RAB26 and RAB3D in MIST1-expressing cells relative to cells stably expressing

eGFP instead of MIST1-eGFP. B, Fluorescent microscopy showing PGC-RFP (red) vesicles after

transient transfection in HGC-MIST1 cells. C, Dispersion of PGC-RFP vesicles in HGC-MIST1

cells treated with 5 mM of the RAB inhibitor 3-PEHPC. D, Dispersion of vesicles in HGC-MIST1

cells transfected with RAB26T77N, a dominant negative RAB26 construct. E, Effects of inhibition

of RAB function on fraction of cells with large PGC vesicles is quantified. (p values by one-way

ANOVA test with Dunnett’s Multiple Comparison correction). “eGFP Ctrl” denotes stable

130 eGFP-expressing control cells. F, The effects of dominant negative RAB26 transfection on PGC-

RFP vesicle formation were assessed by quantifying green (RAB26T77N) fluorescence intensity in each cell, correlated with the distribution of red (PGC-RFP) fluorescence in the same cell.

“Large vesicular” cells were those with multiple (≥3), large (≥1 μm) vesicles; small vesicular cells were those with substantial (see methods) red fluorescence that was not distributed in large vesicles. The large vesicular phenotype occurred almost exclusively in cells with limited to undetectable expression of dominant negative RAB26: only 5.16% of such cells had green mean

fluorescence intensity (mfi) ≥300 in 16 bit images, following background subtraction (blue line).

In contrast, 64.4% of cells effectively (≥300 mfi) co-transfected with RAB26T77N had the diffuse

or “small vesicular” phenotype, indicating those cells did not form large secretory vesicles (red

line). G, Transiently transfected eGFP has minimal effects on PGC-RFP vesicle formation,

indicating inhibition of large PGC granules is specific to effects of RAB26, not cytoplasmic GFP.

H, Graphical representation of mean green pixel intensity above background in HGC-MIST1 cells with either small (diffuse) or large PGC-RFP vesicular phenotype following transient transfection with meGFP-RAB26T77N or eGFP. Note that the large vesicular cells show little to

no meGFP-RAB26T77N expression. There is no correlation between expression of eGFP alone

and PGC vesicle phenotype.

Figure 8. Schematic illustrating how MIST1 expression is induced as mucous neck cells

differentiate into zymogenic cells. MIST1 is modeled as acting primarily through RAB3D and

RAB26 to regulate large zymogenic granules, though a role for other MIST1 targets in this process

has not necessarily been ruled out. Other targets of MIST1 are probably involved in the apical-

basal cell shape reorganization induced by MIST1. Based on an earlier study, the cytoskeletal

131 adaptor Cd2ap plays a role in this process but is not a target of MIST1 (5). Expansion of rER is not affected by loss of Mist1 expression.

Table 1. Function of genes upregulated by MIST1 transfection

132

133

134

135

136

137

138

139

140

Table 1. Function of genes upregulated by MIST1 transfection Gene Potential Functions Reference

Genes that directly regulate vesicular formation and transport RAB3D Regulates vesicular Millar et al.(38) docking and fusion during regulated exocytosis RAB26 Involved in regulated Yoshie et al., Wagner et al., Nashida vesicular secretion et al. (40, 64, 68)

Factors that are secreted or associate with specialized membrane compartments ACP2 Regulates lysosomal Saftig et al.,(53) acid phosphatase 2, functions. Its deficiency Mannan et al.(36) lysosomal causes abnormal lysosomal storage and inclusions. SLC31A2 Cellular Copper uptake Zhou and Gitschier(71) solute carrier family 31 (copper transporters), member 2 SERPINI1 Secreted protein. Stoeckli et al.,(60) Davis et al.(11, serpin peptidase Mutations associate with 12) inhibitor, clade I two families with (neuroserpin), member 1 FENIB, an autosomal dominant form of dementia. Ma et al.(35) Cohen et al.(8) DISP1 Multitransmembrane protein, hedgehog dispatched homolog 2 transporter

Other genes that may potentially regulate vesicular transportation and cellular architecture Novel scaffolding Kostenko et al.(31) CCPG1 protein that regulates guanine nucleotide cell cycle progression factor Dbs and promote gene 1 CDC42 activation by Dbs FNDC3A Obholz et al.(41), fibronectin type III Cell adhesion migration Shan et al.(57) domain containing 3A

AQP3 Water channel in many Inase et al.(23) aquaporin 3 cell types

141

ARRDC3 Associated with the Oka et al.(43) Arresting domain- plasma membrane, containing 3 endosomes, and lysosomes during endocytosis; Plays a regulatory role in cell proliferation

FIGN One of the “Meiotic” or Patel and Latterich(47), Cox GA et Fidgetin subfamily-7 group of al.(9) AAA proteins. AAA proteins are molecular chaperones involved in a variety of activities like proteolysis, peroxisome biogenesis, membrane fusion, endosome sorting, and meiotic spindle formation.

Signaling molecules TIFA Associates with TRAF Ea et al.(14), TRAF-interacting protein and regulates tumor Kanamori et al.(27), Takatsuna et with forkhead-associated necrosis factor receptor al.(61) domain signaling MAP2K5 Interacts with MAPK7. Zhou et al.(72) Mitogen-activated MAP2K5/MAPK7 protein kinase kinase 5 protein cascade is a novel signaling pathway Genes whose molecular function are unclear BRP44L Unknown Jiang et al.(25) Brain protein 44 like MGC13057 Unknown chromosome 2 open reading frame 88

FAM63A Unknown family with sequence similarity 63, member A

142 CHAPTER 4: RAB26 Coordinates Lysosome Traffic and Mitochondrial Localization

This chapter is adapted from the published work:

Jin, R. U. and Mills, J. C. (2014). RAB26 Coordinates Lysosome Traffic and Mitochonrial Localization. J Cell Sci 127, 1018-1032.

143

RAB26 Coordinates Lysosome Traffic and Mitochondrial Localization

Ramon U. Jin1 and Jason C. Mills1, 2, 3

Division of Gastroenterology, Departments of 1Medicine , 2Developmental Biology, 3Pathology & Immunology, Washington University School of Medicine, St. Louis, MO 63110

Address correspondence to:

Jason C. Mills Department of Medicine Washington University School of Medicine, Box 8124 660 So. Euclid Ave. St. Louis, MO 63110 Phone: 314 362-4258 FAX: 314 362-7487 e-mail [email protected]

Running Title: RAB26, lysosome and mitochondria

Word Count: 7982 (excluding references)

Key words: MIST1; zymogenic cell; LAMP1; vesicle trafficking

Author Contributions

RUJ performed all experiments and drafted the manuscript. JCM edited the manuscript and

provided funding. RUJ and JCM conceptualized, designed, and interpreted the experiments.

143

SUMMARY

As they mature, professional secretory cells like pancreatic acinar and gastric chief cells induce

the transcription factor MIST1 (BHLHA15) to substantially scale up production of large

secretory granules in a process that involves expansion of apical cytoplasm and redistribution of

lysosomes and mitochondria. How a scaling factor like MIST1 rearranges cellular architecture

simply by regulating expression levels of its transcriptional targets is unknown. RAB26 is a

MIST1 target whose role in MIST1-mediated secretory cell maturation is also unknown. Here,

we confirm that RAB26 expression, unlike most Rabs which are ubiquitously expressed, was

tissue specific and largely confined to MIST1-expressing secretory tissues. Surprisingly, functional studies showed RAB26 predominantly associated with LAMP1/cathepsin D lysosomes and not directly with secretory granules. Moreover, increasing RAB26 expression – by inducing differentiation of zymogen-secreting cells or by direct transfection – caused lysosomes to coalesce in a central, perinuclear region. Lysosome clustering in turn caused redistribution of mitochondria into distinct subcellular neighborhoods. The data elucidate a novel function for RAB26 and suggest a mechanism for how cells could increase transcription of key effectors to reorganize subcellular compartments during differentiation.

INTRODUCTION

Rab proteins are the largest members of the Ras family of small protein GTPases with more than 70 members identified in humans (Schwartz et al., 2007). They are important regulators of intracellular membrane and vesicle positioning and trafficking. By cycling between

GTP- and GDP-bound forms, they work like simple machines to define specific membrane- associated compartments within cells. Many Rabs - like RAB4, RAB5, RAB7, and RAB11 - are

144

ubiquitously expressed (Gurkan et al., 2005; Jin et al., 2012; Zhang et al., 2007) performing

essentially the same function in diverse cells. RAB7, for example, aids the maturation of early

endosomes into late endosomes and ultimately coordinates transport to lysosomes (Bucci et al.,

2000; Feng et al., 1995).

In contrast, expression of some Rabs is largely confined to cells that perform specific

physiological functions. Among the best studied are the RAB27 and RAB3 families which are expressed highly in specialized secretory cells. RAB27A and B function in the transport and docking of mature vesicles destined for secretion (Fukuda, 2013) in melanocytes (Hume et al.,

2001) and T lymphocytes (Menasche et al., 2000). The RAB3 family includes RAB3A, B, C, and D; the first three isoforms are predominantly neuronal, involved in neurotransmitter and neuroendocrine hormone release (Geppert et al., 1994; Johannes et al., 1994; Schluter et al.,

2004; Weber et al., 1994), while RAB3D is expressed in a variety of extraneuronal secretory cells, in particular exocrine serous cells in the pancreas, salivary glands, and stomach (Chen et al., 2002; Millar et al., 2002; Ohnishi et al., 1997). Functionally, RAB3 isoforms all share a similar role in mature secretory vesicle docking (Fukuda, 2008).

The primary function of serous exocrine cells is to synthesize, store, and secrete digestive enzyme precursors. MIST1 (BHLHA15) is a bHLH transcription factor that acts as a scaling factor in these cells (Mills and Taghert, 2012). MIST1 expression is a feature of all serous exocrine cells (Lemercier et al., 1997; Pin et al., 2000). Recent work has begun to identify the molecular targets that it scales up to establish a high-capacity, polarized secretory apparatus

(Capoccia et al., 2013; Direnzo et al., 2012; Garside et al., 2010; Jia et al., 2008; Johnson et al.,

2004; Pin et al., 2001; Rukstalis et al., 2003; Tian et al., 2010). For example, RAB3D was identified as a target in both pancreatic and gastric exocrine cells (Johnson et al., 2004; Tian et

145

al., 2010). We also identified RAB26, which is phylogenetically related to RAB3D (Fukuda,

2008; Pereira-Leal and Seabra, 2001) as a direct MIST1 target that is required for establishment

of large secretory granules (Tian et al., 2010). However, the mechanism of RAB26 function in secretory cells has not been characterized (Azouz et al., 2012).

Here, we present work showing that RAB26 is not like other members of its phylogenetic family because it does not directly associate with secretory vesicles, but rather with lysosomes.

Accordingly, scaling up expression of RAB26 causes increasing centripetal coalescence of

lysosomes to the perinuclear region in a GTP cycling dependent fashion. Furthermore, using

electron microscopy, immunofluorescence microscopy, and immunoblotting, we demonstrate

that the lysosomal coalescence caused by increased RAB26 also results in redistribution of

mitochondria into distinct cellular neighborhoods. Taken together, our data establish a role for

RAB26 as a novel lysosome-associated Rab whose expression is transcriptionally induced

specifically in secretory tissues to reorganize the cellular distribution of lysosomes and,

indirectly, mitochondria.

RESULTS

RAB26 Expression is Induced in Acinar Secretory Cells by MIST1

Previous reports have shown RAB26 to be expressed in secretory tissues (Nashida et al.,

2006; Tian et al., 2010; Wagner et al., 1995; Yoshie et al., 2000). To further elucidate the role of

RAB26, we assayed the expression pattern of this gene in a human tissue panel (Ge et al., 2005)

(http://sbmdb.genome.rcast.u-tokyo.ac.jp/refexa/) (Fig. 1A). In contrast to a more ubiquitously

expressed Rab (e.g., RAB7), RAB26 showed variable expression with high expression levels in

exocrine secretory tissues and in parts of the brain. The two RAB26 probesets showed strong

146 correlation among the tissues examined (Pearson’s correlation coefficient of 0.9145) and mirrored the known tissue distribution of the secretory cell transcription factor MIST1

(Lemercier et al., 1997; Mills and Taghert, 2012; Pin et al., 2000). Moreover, within specific organs, RAB26 expression was confined to MIST1 expressing cell lineages like the serous exocrine, digestive-enzyme-secreting zymogenic (chief) cells of the stomach, but not their precursors, the mucus-secreting “neck cells” ((Capoccia et al., 2013; Geahlen et al., 2013); Fig.

1B). RAB26 expression was not scaled up in the absence of the transcription factor MIST1 in either gastric units from Mist1−/− mice (Fig. 1B) or in another tissue populated by digestive- enzyme secreting cells, the pancreas (Fig. 1C). We next decided to investigate RAB26 scalability in a cell culture system that would facilitate analysis of RAB26 expression level relative to its subcellular distribution and function. First, we analyzed the well-established secretory pancreatic cell line, AR42J, which expresses MIST1 (Jia et al., 2008) and can be differentiated with dexamethasone treatment to upregulate MIST1 target gene expression (Limi et al., 2012; Qiu et al., 2001) and increase amylase containing secretory vesicles (Logsdon, 1986;

Rinn et al., 2012) (Fig. 1D). In these cells, we found that upon differentiation, as in the stomach and pancreas in vivo, RAB26 expression was induced substantially (Fig. 1D). We confirmed this relationship between MIST1 and RAB26 in human gastric cell lines (Fig. 1E). Expression of

RAB26 was endogenously low in both AGS and HGC-27 cells (absent in non-epithelial U937 monocyte cells), but increased in a scalable manner upon MIST1 (not GFP control) transfection

(Fig. 1E; Pearson’s coefficient of 0.9660, indicating strong correlation). These data confirm that

RAB26 expression is MIST1-dependent and, based on our earlier studies showing direct MIST1 binding to the RAB26 promoter (Tian et al., 2010), we conclude that RAB26 is a direct transcriptional target whose expression is scaled up by MIST1.

147

RAB26 Localizes Specifically to LAMP1 Lysosomal Membrane-Associated Vesicles

To study the functional role of RAB26, we performed experiments in HGC-27 cells because 1) they express low-level endogenous RAB26, even without MIST1 transfection (Fig.

1E); 2) we have previously shown that co-transfection of MIST1 and a cargo of digestive enzyme induces a network of large secretory granules that would allow us to study the interaction between RAB26 and those vesicles (Tian et al., 2010); and 3) they are more easily transfected and larger than AGS or AR42J cells, facilitating detailed microscopy. We engineered an N-terminus monomerized EGFP fused version of RAB26 (EGFP-RAB26) to aid in subsequent localization and trafficking studies.

We had previously shown that interfering with RAB26 function inhibited MIST1- mediated granulogenesis (Tian et al., 2010) and hypothesized, based on the initial descriptive publications (Nashida et al., 2006; Wagner et al., 1995; Yoshie et al., 2000), that RAB26 would function somehow to traffic nascent or maturing secretory granules. To study RAB26-secretory granule interactions, we induced a network of secretory granules by transfecting secretory cargo,

RFP-tagged Pepsinogen C, in cells stably expressing MIST1, a system we have previously described (Tian et al., 2010). Using live cell, timelapse confocal microscopy, we observed, unexpectedly, that the smaller EGFP-RAB26 vesicles did not fuse, or move in concert with the larger PGC-RFP containing secretory granules (Movie 1). In addition, RAB26 vesicles showed no overlap with immature secretory vesicles labeled with antibody against the prohormone convertase, Furin (Fig. S1A). Finally, EGFP-RAB26 did not interact directly with amylase secretory granules in AR42J cells (not shown).

RAB26 associated vesicles similarly did not overlap substantially with markers of the

148 following other organelles: the ER (Calregulin), early endosomal (EEA1), Golgi (giantin), cis-

Golgi (GM130), or trans-Golgi markers (TGN46) compartments (Fig. S1B-F). The lack of

RAB26 association with the Golgi was of interest, because recent studies demonstrated that

RAB26 may occupy a recycling endosomal (Chan et al., 2011) or giantin positive Golgi compartment (Li et al., 2012). Because of the proximity, if not substantial direct overlap, of

RAB26 vesicles with our trans-Golgi marker, we next examined membrane compartments that interact with the trans-Golgi. RAB26 showed slight overlap but were often also proximal to vesicles of the post Golgi sorting compartment, as marked by antibodies against CI-M6PR, AP1, and GGA2 (Fig. S1G-J). The only other principal destination for microtubule associated vesicles emerging from the Golgi – besides secretory vesicles – is lysosomes, so, by process of elimination, we reasoned RAB26 was likely associated with lysosomes. Accordingly, antibodies against the late endosome/ lysosome marker, LAMP1, substantially co-labeled RAB26- associated vesicles (Fig. 2A, B). Confocal microscopy in RAB26-transfected HGC-27 cells showed near complete colocalization of RAB26 with LAMP1 (Fig. 2B). Furthermore, confocal live imaging of EGFP-RAB26 with LysoTracker revealed nearly identical movement of the two fluors (Movie 2), indicating they both clearly defined the same, dynamic vesicle population. In addition, transfection of a plasmid that was independently designed to encode endogenous, full- length, non-fluorescent tagged RAB26 revealed colocalization with anti-RAB26 and anti-

LAMP1 antibodies (Fig. 2C). Finally, using immunoelectron microscopy, we found RAB26- transfected cells showed significant labeling of large vesicular structures with both 12 nm anti-

RAB26 and 18 nm anti-LAMP1 gold particles. 82.4% of total cellular RAB26 particles and

91.9% of LAMP1 associated with these structures, which sometimes contained identifiable cellular debris, consistent with lysosomes (Fig. 2D, E).

149

As a control for potential mislocalization caused by overexpression, we next surveyed

endogenous RAB26 localization. Though expression of native RAB26 in HGC cells is relatively

low (Fig. 1E, 3C), we found endogenous RAB26 associated with LAMP1 lysosomes in rare untransfected cells with higher levels (Fig. 3A, B). Immunoelectron microscopy showed that, although untransfected cells lacked the larger grouped LAMP1-associated vesicular complexes found in RAB26 overexpressing cells, the LAMP1-labeled vesicles that were present were also decorated with lower-level RAB26 labeling (Fig. 3D). Cell fractionation density gradients further confirmed that both EGFP-RAB26 (detectable by antibodies to both GFP and RAB26) and endogenous RAB26 protein were enriched in the purified lysosomal fraction as defined by positive LAMP1 immunoreactivity (Fig. 3E). Finally, as an additional control, we designed and transfected an N-terminal EGFP fused RAB3D plasmid, a close family member of RAB26 and also a MIST1 target (Johnson et al., 2004; Tian et al., 2010). RAB3D had a distinct cellular distribution apart from RAB26 with no lysosomal colocalization (Fig. S2A).

Our findings were applicable beyond HGC-27 cells as similar lysosome-RAB26 colocalization occurred in another gastric cell line (Fig. S2B), and epithelial cells from other tissues including 5637 bladder cells (Fig. S2C). Likewise, in pancreatic AR42J cells, we found that RAB26 vesicles formed a unique vesicle population separate from amylase containing secretory vesicles (not shown), and again overlapping nearly completely with LAMP1 (Fig. S2D,

E).

There was also significant overlap of RAB26 and LAMP1 with the lysosomal acid hydrolase, cathepsin D (CTSD) (Fig. 4A-C). RAB26 and LAMP1 often defined the membrane portion of vesicles, whose interiors were filled with cathepsin D, as expected (Fig. 4A).

Moreover, we designed an RFP-tagged cathepsin D protein (CTSD-RFP) that also showed

150

significant colocalization with EGFP-RAB26 upon co-transfection (Fig. 4C), providing an independent non-antibody confirmation of the direct association of RAB26 with the lysosomal compartment. EGFP-RAB26 also overlapped with another known Rab protein, RAB7 (Fig. 4D), whose role in lysosomal trafficking has been well-established (Bucci et al., 2000). Combined, these experiments definitively show that RAB26 defines the lysosomal subcellular location in multiple cells.

To confirm that RAB26 associates with lysosomes actively, based on normal GTP/GDP cycling and trafficking, we next designed single point mutant EGFP-RAB26 variants: one with a

threonine to an asparagine (EGFP-RAB26T77N) and another with glutamine to a leucine

(EGFP-RAB26Q123L) (Fig. 5A). Based on published RAB26 structural models (Protein Data

Bank accession code 2G6B) (Wang et al., 2006) and previous studies of Ras (Barbacid, 1987;

Feig, 1999; Scheffzek et al., 1997) and orthologous Rabs (Brondyk et al., 1993; Burstein et al.,

1992; Chen et al., 2002), EGFP-RAB26T77N would abolish Mg2+ coordinated GTP binding in the G2 box region, and EGFP-RAB26Q123L would disrupt G3 box region mediated GTP hydrolysis (Fig. 5B). When transfected, EGFP-RAB26T77N showed a diffuse cytoplasmic

distribution (Fig. 5C), and EGFP-RAB26Q123L showed a more dispersed vesicular distribution

(Fig. 5D). Neither EGFP-RAB26T77N nor EGFP control localized with LAMP1, and EGFP-

RAB26Q123L showed some correlation with lysosomes. Specifically, while most lysosomes

still co-localized with EGFP-RAB26Q123L, some EGFP-RAB26Q123L overlapped with non-

LAMP1 labeled structures (Fig. 5D, E; Pearson’s coefficient of 0.384 compared to wildtype

EGFP-RAB26 with substantial co-labeling and Pearson’s coefficient of 0.702). We next analyzed RAB26-EGFP transfected cells in the presence of a prenylation inhibitor and found wildtype RAB26 no longer trafficked to lysosomes, and we blocked GTP hydrolysis with non-

151

hydrolyzable GTP analogs and found that RAB26-EGFP trafficked only partially to lysosomes,

phenocopying the Q123L GTP hydrolysis deficient mutant (not shown). To further investigate extra-lysosomal EGFP-RAB26Q123L vesicle localization, we co-stained with EEA1, giantin, and the CI-M6PR (not shown) revealing no substantial co-localization with Golgi, but partial overlap with the endosomal compartments. Thus, we conclude RAB26 requires prenylation and

GTP binding to target to lysosomes, and dynamic GTP cycling to maintain localization on lysosomes and avoid trafficking to other membranes as lysosomes recycle (Sridhar et al., 2013).

Increased RAB26 is Sufficient to Traffic Lysosomes Centripetally

To determine the consequences of RAB26 association with lysosomes, we analyzed the effects of scaling up RAB26 expression, which occurs in tissues as differentiating secretory cells increase RAB26 in response to the transcription factor MIST1. To analyze the effects specifically of scaling up RAB26 without the effects of other MIST1 targets, we took advantage

of the varying levels of expression induced by transient transfection in HGC-27 cells, whose

endogenous RAB26 levels are usually low. We noticed that HGC-27 cells with the highest levels of RAB26 by EGFP fluorescence intensity showed lysosomal coalescence into a central, perinuclear region, whereas cells with lower levels showed more diffuse, peripheral lysosomes

(Fig. 6A, B). Moreover, when we quantified this on a cell-by-cell basis, we found cells with coalesced lysosomes almost always showed higher levels of RAB26 (MFI > 1000 on normalized, 16 bit scale) than cells retaining diffuse lysosomes (MFI < 1000; Fig. 6B).

Transfection of the two RAB26 point mutants did not recapitulate this lysosome repositioning phenomenon (Fig. 6C, D), indicating that the ability of RAB26 to bind and cycle GTP is necessary for this process. In addition, cells transfected with EGFP or EGFP-RAB3D also failed

152

to show centripetal lysosomal movement (Fig. 6C, D), revealing that this process is independent

of GFP overexpression and RAB26-specific. Quantification showed that, of cells with detectable

EGFP-RAB26, 30% displayed this central perinuclear lysosomal phenotype (Fig. 6D), whereas only about 5-10% of EGFP+ cells transfected with various control constructs (EGFP alone,

EGFP-RAB26T77N, EGFP-RAB26Q123L, EGFP-RAB3D) showed this pattern of lysosome distribution. These other transfected cells showed no change in lysosome distribution no matter the levels of expression.

In addition, we examined the AR42J pancreatic acinar cell system, in which we were able to differentiate, increase MIST1 and, scale-up RAB26 levels from moderate to high detectable levels. Increasing RAB26 (marked by anti-RAB26) correlated with striking centripetal coalescence of LAMP1 vesicles to the perinuclear region (Fig. 6E). In other words, endogenous

RAB26 scaled up by cellular differentiation phenocopied transfection-mediated RAB26 scaling.

Localization of other vesicular structures including endosomes, the Golgi, and late endosomes (not shown and Fig. S3A, B) were unaffected by transfection of EGFP-RAB26 or

any of its mutant forms. Transfection of RAB26 and RAB26 mutants had no significant effect

on: 1) overall levels of LAMP1 protein in cell cultures, 2) levels of cathepsin D; 3) lysosome- mediated processing of cathepsin D to its smaller active form; 4) mTOR/S6K signaling, which depends in part on lysosomal function (Fig. S4A). In sum, RAB26 specifically localizes

predominately with lysosomes in a GTP/GDP dependent manner, and, as RAB26 levels are

scaled up, it reorients only lysosomes and not other vesicular compartments. Although global

lysosomal function does not appear affected by RAB26, more experiments would be needed to analyze how RAB26 may mediate the many additional aspects of lysosome trafficking and function.

153

RAB26 Coordinates Reorganization of Mitochondria

To begin to address the potential cellular effects of scaling up RAB26, we returned to

ultrastructural analyses of transfected cells. Supporting our immunofluorescence and

immunoelectron microscopy data, we found large clusters of electron-lucent vesicles, morphologically consistent with lysosomes (Fig. 2D), only in the RAB26 transfected cells (Fig.

7A-E). In our control cells, or in cells transfected with EGFP-RAB26T77N, EGFP-

RAB26Q123L, or EGFP, lysosomes were smaller and dispersed throughout the cytoplasm (Fig.

7C-E). We noticed that the lysosome clusters in the EGFP-RAB26 expressing cells largely excluded mitochondria (Fig. 7A, B). Thus, instead of the diffuse mitochondrial network seen in cells transfected with various control constructs (Fig. 7C-E), the mitochondria in RAB26- transfected were clustered into distinct cellular neighborhoods. In fact, upon returning to our initial immunoelectron micrographs, we found RAB26 occasionally labeling mitochondrial membranes (3.17% of total labeling) adjacent to LAMP1-labeled lysosomes. Thus, RAB26 might also directly or indirectly affect cellular mitochondrial organization.

Accordingly, in cells expressing abundant EGFP-RAB26, we found mitochondria, like lysosomes, were also clustered but into distinct subcellular regions that were specifically free of lysosomes (Fig. 8A, B). Control cells showed mitochondria organized in the expected diffuse, lattice-like network throughout the cell (Fig. 8A). Using live cell confocal microscopy, we were able to observe mitochondrial interaction on the borders of the EGFP-RAB26 and LAMP1 lysosomal clusters (Movie 2,) including temporary areas of overlap with apparent mitochondrial- lysosomal fusion or membrane exchange highlighted in frames from Movie 2 (Fig. 8C). When we quantified the cell area of mitochondria as a percentage of total cell area in EGFP-RAB26

154 transfected cells, we found it to be significantly reduced relative to controls (Fig. 8D). In fact, when whole cellular populations were analyzed for mitochondrial density by western blot for the mitochondrial outer membrane marker, TOM20, we found a significant reduction (n = 3 independent transfections per construct) only when functional RAB26 was transfected, indicating trimming of mitochondria across the whole population (Fig. 8E). However, when mitochondrial function was analyzed using dyes sensitive to mitochondrial membrane potential

(CMXRos (Poot et al., 1996)) and superoxide damage production (MitoSOX Red

(Mukhopadhyay et al., 2007)), we found that while mitochondria were reduced in cells overexpressing RAB26, those that remained were largely intact and functional, as was the case for all controls analyzed (Supp Fig. 4B, C). Taken together, our data show that RAB26 repositions lysosomes and reorganizes mitochondria.

DISCUSSION

Here, we find, in multiple cell types, that RAB26 associates with and traffics lysosomes, which is surprising both because lysosome-associated Rabs are rare and because RAB26 was initially characterized in the rat pancreas as being associated with secretory vesicles (Wagner et al., 1995). However, these earlier results were generated using antibody staining in fixed tissue sections and cell fractionation density gradient enrichment of granules (Nashida et al., 2006;

Yoshie et al., 2000). In fact, secretory granules and lysosomes are not easily distinguishable by density gradient properties (Pasquali et al., 1999), and the mature secretory granule markers, syntaxin 6 and γ-adaptin, used as markers of secretory granules in previous analyses of RAB26, are also involved in Golgi sorting to lysosomes and late endosomes (Ghosh et al., 2003;

Robinson, 1990). Those markers have been found to be specifically removed from mature

155

secretory granules (Klumperman et al., 1998). Moreover, in a large screen of mast cell Rabs that

regulate secretion, transfected RAB26, which mast cells do not normally express, was also found

to be perinuclear and associated with a vesicular compartment that was expected to be LAMP1

positive (Azouz et al., 2012).

Recent studies found RAB26 to be associated with RAB11 recycling endosomes (Chan et

al., 2011) in Drosophila neurons, and a giantin-positive Golgi sorting compartment (Li et al.,

2012) when transfected into HEK293 cells. These results would seem to contradict those of the

current manuscript, though we have focused here exclusively on exocrine secretory cells, trying

to mimic the effects of scaling RAB26 as occurs in differentiating cells in tissue. Thus, RAB26

may traffic differently depending on cell type; however, there are other possible explanations as

well for our seemingly differing findings. There is overlap between Golgi, endosome, and

lysosome markers as lysosomes mature through sorting and trafficking (Ghosh et al., 2003;

Griffiths et al., 1990; Luzio et al., 2000; Moore et al., 2004; Peden et al., 2004; Saftig and

Klumperman, 2009). RAB7, the most well studied lysosomal Rab protein (Bucci et al., 2000),

has also been implicated in endosomal trafficking (Feng et al., 1995). In fact, its close relative,

RAB7B, is found to co-localize with both Golgi and lysosomal markers (Progida et al., 2010).

The transient nature of these dynamic and constantly communicating compartments (Saraste and

Goud, 2007) complicate all subcellular localization studies. In the current manuscript, we have

used multiple secretory cell types and multiple modalities to examine both endogenous and

transfected RAB26, which we argue reinforces our conclusions that RAB26 is predominantly

lysosome-associated in dedicated secretory cells.

That lysosomes cycle between peripheral and central regions has been well documented

with various motor proteins (Hollenbeck and Swanson, 1990; Lin and Collins, 1992), and

156

cytoskeletal filaments (Cordonnier et al., 2001; Matteoni and Kreis, 1987) implicated in this

traffic. Much work has also elucidated the role of the Rab family in lysosomal movement and function. Specifically, RAB4, 5, 9, and 11 have been shown to coordinate endosomal traffic into and out of maturing lysosomes (Saftig and Klumperman, 2009). However, only RAB7 has been well established as the key cellular regulator of late endosome to lysosome trafficking, and overexpression of RAB7 causes central lysosome movement, while T22N and N125I point mutants leave lysosomes dispersed (Bucci et al., 2000). There is some evidence that two other ubiquitously expressed Rabs, RAB34 (Wang and Hong, 2002) and RAB36 (Chen et al., 2010), also function to redistribute lysosomes centrally (Colucci et al., 2005). Interestingly, these Rabs share a common effector, RILP (RAB7-interating lysosomal protein), crucial for inducing dynein mediated movement (Cantalupo et al., 2001; Jordens et al., 2001; Wang and Hong, 2005).

RAB26 may also mediate lysosomal rearrangement through RILP interactions.

Mitochondria are constantly pruned and recycled in post-mitotic cells. Under conditions of oxidative stress, the normal steady-state mitochondrial recycling (Lipsky and Pedersen, 1981;

Terman et al., 2010) is scaled up to maintain physiological function and forestall apoptosis in a process that depends on lysosome-mediated pruning (Green and Kroemer, 2004). Mitochondria are delivered to lysosomes via many routes (Ashrafi and Schwarz, 2013). For example, damaged mitochondria, as tracked by their membrane marker TOM20, can be delivered directly to lysosomes (Soubannier et al., 2012).

Our findings indicate that scaling up RAB26 might enhance the ongoing baseline direct trafficking events between lysosomes and mitochondria. Little is known about lysosome- mitochondria interactions in tissues that are not under constant oxidative damage. In exocrine tissues, mitochondria play a crucial role in secretagogue mediated calcium signaling (Tinel et al.,

157

1999) that depends on their subcellular positioning (Park et al., 2001). Increasing RAB26 may be an inherent mechanism for secretory cells to reorganize mitochondria and to focus them in areas where they can facilitate calcium delivery to secretory granules. We observed only partial reduction in mitochondrial numbers, no matter how high expression of RAB26 in a given cell; thus, RAB26 may prune or cluster, rather than destroy, mitochondria.

Our studies have confirmed that RAB26 is not ubiquitous but, rather, is specifically expressed in only certain cell lineages. Thus, we expect that it would be sufficient but not required for lysosome mediated mitochondrial reorganization because other more universal mechanisms must be present in all cells. In fact, our two point mutants do not act as dominant negatives in affecting lysosomal movement or preventing oxidative damage initiated mitochondrial degradation (not shown). In addition, siRNA mediated knockdown of endogenous

RAB26 similarly had no effect on lysosomes or mitochondria (not shown). RAB3D, another direct MIST1 target and secretory cell specific Rab protein shows a similar ability to “scale-up” vesicle dynamics; when overexpressed in acinar cells, RAB3D enhances regulated secretion

(Ohnishi et al., 1997). However, when Rab3D is deleted regulated secretion is unaffected

(Riedel et al., 2002). Thus, these exocrine cell specific Rabs represent a subset of “scale-able” cellular effectors that enhance cellular dynamics.

In digestive-enzyme secreting tissues such as the pancreas and stomach, RAB26 expression is almost wholly dependent on the transcription factor, MIST1 (Tian et al., 2010). In the absence of MIST1 and, thus RAB26, exocrine secretory cells display aberrant secretory vesicle organization, maturation, and secretion (Direnzo et al., 2012; Johnson et al., 2004; Luo et al., 2005; Pin et al., 2001; Ramsey et al., 2007; Tian et al., 2010). Interestingly, Mist1−/− exocrine cells also exhibit aberrant lysosomal trafficking (Capoccia et al., 2013; Direnzo et al.,

158

2012; Pin et al., 2001). Furthermore, in wildtype MIST1-expressing cells mitochondria are

organized into distinct subcellular neighborhoods (similar to what we see with increased

RAB26), while in Mist1−/− cells, mitochondria are dispersed throughout the cell, resulting in

abnormal calcium flux (Luo et al., 2005). From our previous study, no other direct MIST1

targets seem to have clear roles in lysosome movement, mitochondria reorganization, or Rab

protein function (e.g., neither guanine nucleotide exchange factors, GTPase-activating proteins,

nor other identified Rab effectors are known MIST1 targets) (Tian et al., 2010). Thus, RAB26

function may be an important and crucial unrecognized aspect in MIST1 regulated cell secretory

function.

Loss of MIST1 results in increased susceptibility to pancreatitis (Alahari et al., 2011;

Kowalik et al., 2007; Zhu et al., 2004), and, in wildtype mice, pancreatitis leads to silencing of

Mist1 (Shi et al., 2013; Shi et al., 2009). Acute pancreatitis is caused by inappropriate interaction between lysosomal enzymes and zymogen constituents of secretory granules (Gaiser et al., 2011; Halangk et al., 2000; Saluja et al., 1997), which leads to mitochondrial disorganization (Mareninova et al., 2006; Odinokova et al., 2009). Thus, one mechanism for how MIST1 might suppress acute pancreatitis is by trafficking of lysosomes and mitochondria through RAB26. Future experiments will have to address whether loss of RAB26 in MIST1- expressing cells causes disrupted lysosome/mitochondrial mediated damage, though deletion of tissue-specific Rabs in vivo has not been that informative (e.g., Rab3d null mice have only a mild phenotype (Riedel et al., 2002)) perhaps because they are sufficient for scaling up specific aspects of secretion but not absolutely required.

Our data clearly show that coalescence of lysosomes and mitochondria is caused by expression of higher levels of RAB26. The changes occur whether endogenous RAB26

159

expression is increased by MIST1 during differentiation or if it is directly transfected to higher

levels. Thus, our studies exemplify how a transcription factor like MIST1 can scale up a specific

target gene during maturation to redistribute organelles in a way that enhances the specific physiological function the cell must perform in the adult organism. In other words, we provide mechanistic evidence for how transcription factors like MIST1 can act as scaling factors to control cell architecture simply by increasing expression of specific genes that encode cellular effectors (Mills and Taghert, 2012). It will be interesting to determine how the scaling of

RAB26 by MIST1 might work in more detail, whether RAB26 acts as a rheostat (i.e., the more

RAB26 expression increases, the more centralized lysosomal trafficking there is) or more like a binary switch (i.e. low levels do not change lysosomal distribution, high levels cause lysosomes to coalesce centrally).

In summary, we propose a mechanism whereby a transcriptionally controlled novel Rab protein can regulate critical, physiologically relevant cell structural adaptations. RAB26 through its ability to reposition lysosomes can, in turn, effect mitochondrial reorganization.

Mitochondria and lysosomes are critical for the formation, maintenance, and secretion of

zymogen granules. Therefore, we posit that RAB26 is a novel, lysosome-associated, tissue and

cell-type specific, small protein GTPase that can be “scaled-up” by the transcription factor

MIST1 to enhance the secretory function of exocrine cells.

MATERIALS AND METHODS

GeneChip analysis.

Human tissue expression data was obtained from the LSBM RefExA database

(http://sbmdb.genome.rcast.u-tokyo.ac.jp/refexa/) (Ge et al., 2005). Human cell line expression

160 data prepared as previously discussed (Tian et al., 2010). Mouse gene chip arrays were generated as previously discussed (Capoccia et al., 2013). Heat maps of RAB26 expression levels were generated by dChip analysis (Zhong et al., 2003). Correlation between RAB26 probesets was calculated using GraphPad Prism to generate Pearson’s correlation coefficients based on raw read values.

Cell Lines / Transfection

HGC-27 and AGS cells were maintained as previously described (Tian et al., 2010). 5637 cells

(gift from Dr. Indira Mysorekar, Washington University) were maintained at 37°C in 5% CO2 in

RPMI 1640 supplemented with 10% fetal bovine serum, 0.9% glutamine, 0.4% HEPES, 1% Na pyruvate, 2.5% glucose, and 100 ng/mL each of penicillin and streptomycin. AR42J cells

(ATCC, Manassas, VA) were maintained in F12K media supplemented with 20% fetal bovine serum, 1.0% glutamine, and 100 ng/mL each of penicillin and streptomycin. Dexamethasone

(100 nM, Sigma-Aldrich, St. Louis, MO) was added to cells for 48 hours to induce secretory differentiation. For transient transfection, AGS or HGC-27 cells were transfected via electroporation using Nucleofector II (Lonza, Basel, Switzerland), program B-023, and cell line transfection solution V. For each electroporation, 3 µg PGC-RFP (see below), 5 µg EGFP-

RAB26 (see below), 5 µg EGFP-RAB26T77N (see below), 5 µg EGFP-RAB26Q123L (see below), 5 µg EGFP-RAB3D (see below), 3 µg CTSD-RFP (see below), or 3 µg pmaxGFP

(Lonza) plasmid was used. In some experiments and other cell lines, we also used TransIT-2020 and TransIT-LT1 Transfection Reagent (Mirus, Madison, WI) according to manufacturer’s protocol. For visualization, cells were replated on Lab-Tek Chamber Slide 4-well Permanox slides (Thermo Fisher Scientific, Rochester, NY) and routinely analyzed 24-72h posttransfection.

161

MIST1-EGFP expressing stable cell lines were established as previously described (Tian et al.,

2010).

Immunofluorescence / Cell Imaging

For immunofluorescence analysis, cultured cells were transfected and stained as described

previously (Tian et al., 2010). Fluorescence microscopy and imaging were performed using a

Zeiss Axiovert 200 microscope 20X (Plan-Apochromat, 0.8 NA), 40X (Plan-Neofluar 0.85 NA) and 63X objectives (Plan-Apochromat, 1.4 NA) with Axiocam MRM camera and AxioVision software. Additional, confocal microscopy and imaging were performed using a Zeiss LSM510 microscope with 40X (EC Plan-Neofluar, 0.75 NA) and 63X (Plan-Apochromat, 1.4 NA) objectives using LSM510 software. Live cell imaging was performed using an Olympus

FluoView FV1000 microscope equipped with 60X objective (PLAPON 60XO, 1.42 NA) maintained at 37°C in 5% CO2 with images captured using the FV10-ASW software or using a

Zeiss LSM510 confocal microscope with 63X objectives (Plan-Apochromat, 1.4 NA) maintained at 37°C in 5% CO2 with images captured using the Zeiss LSM510 software. Contrast (maximal, minimal, and midtone) adjustment and fluorescent channel overlay and pseudocoloring were performed with Photoshop (Adobe Systems, San Jose, CA). All adjustments were performed on the entire image equally.

The primary antibodies used for cell immunostaining: rabbit anti-amylase (1:100,

Calbiochem, CA), rabbit anti-RAB26 (1:100, ProteinTech Group, Chicago, IL), rabbit anti- giantin (1:1000, Covance), rabbit anti-EEA1 (1:250, Abcam), rabbit anti-furin (1:500, Thermo

Scientific), goat anti-calregulin (1:100, Santa Cruz), rabbit anti-GM130 (1:250, BD Biosciences,

San Jose, CA), sheep anti-TGN46 (1:250, Serotec, Oxford, UK), rabbit anti-CI-M6PR (1:500);

162

mouse anti-AP1 (1:500); rabbit anti-CTSD (1:150); and mouse anti-GGA2 (1:500) (gifts from

Dr. Stuart Kornfeld, Washington University), mouse anti-LAMP1 (1:40, Santa Cruz, Santa Cruz,

CA), mouse anti-LAMP1 (1:50, clone H4A3, developed by J. Thomas August and James E. K.

Hildreth and obtained from the Developmental Studies Hybridoma Bank under the auspices of

the NICHD maintained by The University of Iowa), rabbit anti-RAB7 (1:150, Cell Signaling

Technology, Danvers, MA). Secondary antibodies used were Alexa Fluor 488-, 594-, and 647- conjugated donkey anti-goat, anti-rabbit, anti-sheep, and anti-mouse antibodies (1:500;

Invitrogen, Carlsbad, CA). LysoTracker and MitoTracker (Invitrogen) were used at 75 nM and

250 nM concentrations, respectively, according to manufacturer’s instructions. MitoTracker

CMXRos and MitoSOX Red (Invitrogen) were used at 100 nM and 2 µM concentrations, respectively, according to manufacturer’s instructions.

Immunofluorescence Quantification

For pixel-to-pixel overlap of EGFP-RAB26, EGFP-RAB26T77N, EGFP-RAB26Q123L, and

GFP with LAMP1, cells were transfected and stained for LAMP1 as described and confocal images were taken from at least 10 cells per condition. Thresholded Pearson’s correlation coefficients were calculated using Volocity image analysis software (PerkinElmer, Waltham,

MA).

For lysosome distribution quantification, cells were transfected as described with EGFP-

RAB26, EGFP-RAB26T77N, EGFP-RAB26Q123L, EGFP-RAB3D, or GFP plasmids. Post transfection, lysosomes were stained with a LAMP1 antibody as described. Blinded to treatment conditions, sixteen-bit images captured in Zeiss Axiovision software were analyzed with ImageJ

software as follows. Central lysosomes (bright concentrated staining around perinuclear region),

163

diffuse lysosomes (disperse cytoplasmic staining), transfected cells, and total cells determined by

total nuclei counted using technique developed by (Selinummi et al., 2005) were scored. 65 low

power fields comprising three independent experiments were examined totaling approximately

10,000 cells counted per condition.

For enhanced green fluorescent protein EGFP-RAB26 fluorescence intensity

quantification, cells were transfected with EGFP-RAB26 and stained for LAMP1. Sixteen-bit

images captured in Zeiss Axiovision software were analyzed with ImageJ software as follows.

We determined mean green cytoplasmic fluorescence intensities in each region after subtraction from the median background (green in an area with no cells). These same cells were then scored individually for their lysosome distribution (as defined above). A total of 180 cells were scored across three transfection experiments.

For mitochondrial area quantification, cells were transfected and stained as previously described. Sixteen-bit images captured in Axiovision software were analyzed with ImageJ

software as follows. Area selection tool was used to outline mitochondria, and area was

measured using the Analyze area measurement tool. Multiple cells were scored across three

transfection experiments.

Plasmid Preparation

PGC-RFP, EGFP-RAB26, and EGFP-RAB26T77N mammalian expression plasmids were

constructed as previously detailed (Tian et al., 2010). To generate EGFP-RAB26Q123L, EGFP-

RAB26 was mutagenized by site-directed mutagenesis to convert the glutamine at amino acid

position 123 to a leucine, and a new XhoI restriction site was introduced. pcDNA3.1-RAB26

plasmid was constructed using the same approach as EGFP-RAB26 using backbone plasmid

164

pcDNA3.1/V5-His-TOPO (Invitrogen) with the first amino acid of the His-tag modified to a stop

codon. The monomeric EGFP-RAB3D expression plasmid was constructed with the coding region of human RAB3D cDNA (IMAGE identification number 3861912; Open Biosystems) added in frame to the carboxyl terminus of EGFP, replacing the RAB26 coding region in EGFP-

RAB26 by ribocloning (Barnes, 1994; Barnes, 2006). PCR was performed on the vector region by using primers DNA3as (GGCAATTCCACCACACTGGACTAGu) and pcD3LKs

(GGGCAATTCTGCAGATATCCAGCAc) on EGFP-RAB26 DNA. The RAB3D target was

PCR amplified using DNA3s (ACTAGTCCAGTGTGGTGGAATTGCc) and hRAB3D-DNA3b

(GGGTGTCTCCAGCTGATGCCATGGCGGCAATTCCACCACACTGGACTAGTG) with pcD3LKas (GTGCTGGATATCTGCAGAATTGCCc) and hRAB3D-pcD3LKs

(GATGCTCCAGCCCCCCAGCCCTCCTCTTGTAGCTGCTAGGGCAATTCTGCAGATATC

CAGCAC). The pcDNA3.1 CTSD-RFP fusion construct was generated with the human CTSD region of pcDNA3.1-hCTSD-myc (gift from Dr. Stuart Kornfeld) added in frame to the amino terminus of RFP, replacing the PGC coding region in PGC-RFP by ribocloning. PCR was performed on the vector region by using primers DNA3as and RFPs

(GCCTCCTCCGAGGACGTCAu). The hCTSD target was PCR amplified using DNA3s and hCTSD-DNA3b (GCTGGAGGGCTGCATGGCGGCAATTCCACCACACTGGACTAGT) with

RFPas (ATGACGTCCTCGGAGGAGGc) and hCTSD-RFPs

(CGAGGCTGCCCGCCTCGCCTCCTCCGAGGACGTCAT). All construct coding regions were verified to be correct by DNA sequencing.

Density Gradient Ultracentrifugation Lysosomal Enrichment

165

Lysosomes were isolated with the Pierce Lysosomal Enrichment Kit of Tissue and Cultured

Cells (Rockford, IL) according to manufacturer’s protocol. Briefly, cells were transfected as

described, pelleted, and homogenized using a Dounce tissue grinder. Nuclei were removed and

then lysate was ultracentrifuged on prepared Optiprep density gradients using Beckman Coulter

Optima L-100 XP ultracentrifuge (Fullerton, CA). Fractions were removed and subjected to western blot analysis.

Western Blot Analysis

Mouse tissue was flash frozen in liquid nitrogen and homogenized in RIPA buffer using a

PowerGen700 (Fischer Scientific, Pittsburg, PA). Cells were transfected as described and lysed in RIPA buffer. Proteins were quantified by DC protein assay (Bio-Rad) and then separated on

NuPAGE Bis-Tris gels (Invitrogen), transferred to Immobilon polyvinylidene difluoride

(Millipore, Bedford, MA) or Amersham Hybond ECL nitrocellulose (GE Healthcare,

Buckinghamshire, United Kingdom) membranes, and detected by Immobilon chemiluminescence (Millipore). Primary antibodies used were mouse anti-LAMP1 (1:1000,

Developmental Studies Hybridoma Bank), rabbit anti-GFP (1:1500, Santa Cruz), rabbit anti-

RAB26 (1:800, ProteinTech Group Chicago, IL), rabbit anti-MIST1 (1:500, described previously in (Pin et al., 2000)), mouse anti-TOM20 (1:1000, BD Biosciences), rabbit anti-cathepsin D

(1:2000, gift from Dr. Stuart Kornfeld, Washington University), rabbit anti-mTOR (1:1000, Cell

Signaling Technology), rabbit anti-phospho-p70 S6 kinase (1:1000, Cell Signaling Technology), rabbit anti-p70 S6 Kinase (1:1000, Cell Signaling Technology), and rabbit anti- α/β tubulin

(1:1500, Cell Signaling Technology). Secondary antibodies were horseradish peroxidase– conjugated donkey anti-rabbit, and anti-mouse (Santa Cruz Biotechnology, Santa Cruz, CA).

166

Quantifications of immunoblots were done by scanning sixteen-bit images into ImageJ.

Band intensities for TOM20 and α/β tubulin were selected and calculated using Analyze mean

gray value measurement tool. Standardized values were calculated by the ratio of TOM20 signal

to α/β tubulin signal.

Protein Structure Analysis

RAB26 protein structure was obtained from Protein Data Bank, accession code 2G6B (Wang et

al., 2006). Image was generated using Protein Workshop (Moreland et al., 2005) with surfaces

(Xu and Zhang, 2009).

Electron Microscopy

For transmission electron microscopy studies, cells were transfected as previously described and

plated on Lab-Tek Chamber Slide 4-well Permanox slides (Thermo Fisher Scientific). After

being rinsed in PBS, they were fixed in modified Karnovsky’s fixative (2.5% glutaraldehyde, 2%

paraformaldehyde in 0.1 mmol/liter cacodylate buffer). TEM thin sections were cut directly from

cell cultures embedded on the original Permanox substrate.

For immunoelectron microscopy studies, EGFP-RAB26 or EGFP controltransfected

HGC-27 cells were trypsinized, pelleted, and fixed on ice for 1 hour in PBS, 4% paraformaldehyde, 0.05% glutaraldehyde. Subsequent sample processing was performed as

previously described (Beatty, 2008). After incubation with primary antibodies against RAB26

(1:50, ProteinTech Group) and LAMP1 (1:25, Developmental Studies Hybridoma Bank) sections were then washed and probed with anti-rabbit conjugated to 12 nm and anti-mouse conjugated to

18 nm colloidal gold (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA).

167

Quantification of labeling specificity of RAB26 and LAMP1 was performed by calculating

cellular areas of lysosomes, mitochondria, nucleus, cytoplasm, and plasma membrane using

ImageJ Area selection tool and Analyze area measurement tool. Areas were compared to

counted 12 nm RAB26 and 18 nm LAMP1 labeling within 100 nm of the same cellular areas.

Multiple cells from 5 fields were counted.

Graphing and Statistics

All graphs and statistics were determined with GraphPad Prism and then visualized using Adobe

Illustrator. Statistical analysis was, in the case of simple control-versus-experimental condition

comparison, by Student’s t-test. Otherwise, significances were determined by one-way analysis

of variance (ANOVA) test with Dunnett’s multiple-comparison correction.

ACKNOWLEDGEMENTS

The authors wish to thank Edward Oates and Xavier Jirau for plasmid preparation

assistance, Wandy Beatty and Karen Green for EM sample preparation and expertise, Saso

Cemerski, Wandy Beatty, and Dennis Oakley for confocal microscopy help, Indira Mysorekar

for use of 5637 cells, and David Sibley for use of ultracentrifuge. In addition, we would like to

thank Marielle Boonen, Eline van Meel, and Stuart Kornfeld for sharing valuable antibodies.

We acknowledge the Advanced Imaging and Tissue Analysis Core of the Washington University

Digestive Disease Core Center (DDRCC). Thanks also go to Benjamin Moore and Benjamin

Cappocia for thoughtful review of the manuscript.

168

This work was supported by grants to Jason C. Mills from the National Institutes of

Health (R01 DK-079798, DK094989, 2P30 DK052574) and the American Cancer Society

(DDC-115769).

169

REFERENCES

Alahari, S., Mehmood, R., Johnson, C. L. and Pin, C. L. (2011). The absence of MIST1 leads to increased ethanol sensitivity and decreased activity of the unfolded protein response in mouse pancreatic acinar cells. PLoS One 6, e28863. Ashrafi, G. and Schwarz, T. L. (2013). The pathways of mitophagy for quality control and clearance of mitochondria. Cell Death Differ 20, 31-42. Azouz, N. P., Matsui, T., Fukuda, M. and Sagi-Eisenberg, R. (2012). Decoding the regulation of mast cell exocytosis by networks of Rab GTPases. J Immunol 189, 2169-80. Barbacid, M. (1987). ras genes. Annu Rev Biochem 56, 779-827. Barnes, W. M. (1994). PCR amplification of up to 35-kb DNA with high fidelity and high yield from lambda bacteriophage templates. Proc Natl Acad Sci U S A 91, 2216-20. Barnes, W. M. (2006). Ribocloning: DNA cloning and gene construction using PCR primers terminated with a ribonucleotide. CSH Protoc 2006. Beatty, W. L. (2008). Late endocytic multivesicular bodies intersect the chlamydial inclusion in the absence of CD63. Infect Immun 76, 2872-81. Brondyk, W. H., McKiernan, C. J., Burstein, E. S. and Macara, I. G. (1993). Mutants of Rab3A analogous to oncogenic Ras mutants. Sensitivity to Rab3A-GTPase activating protein and Rab3A-guanine nucleotide releasing factor. J Biol Chem 268, 9410-5. Bucci, C., Thomsen, P., Nicoziani, P., McCarthy, J. and van Deurs, B. (2000). Rab7: a key to lysosome biogenesis. Mol Biol Cell 11, 467-80. Burstein, E. S., Brondyk, W. H. and Macara, I. G. (1992). Amino acid residues in the Ras- like GTPase Rab3A that specify sensitivity to factors that regulate the GTP/GDP cycling of Rab3A. J Biol Chem 267, 22715-8. Cantalupo, G., Alifano, P., Roberti, V., Bruni, C. B. and Bucci, C. (2001). Rab-interacting lysosomal protein (RILP): the Rab7 effector required for transport to lysosomes. EMBO J 20, 683-93. Capoccia, B. J., Jin, R. U., Kong, Y. Y., Peek, R. M., Jr., Fassan, M., Rugge, M. and Mills, J. C. (2013). The ubiquitin ligase Mindbomb 1 coordinates gastrointestinal secretory cell maturation. J Clin Invest 123, 1475-91. Chan, C. C., Scoggin, S., Wang, D., Cherry, S., Dembo, T., Greenberg, B., Jin, E. J., Kuey, C., Lopez, A., Mehta, S. Q. et al. (2011). Systematic discovery of Rab GTPases with synaptic functions in Drosophila. Curr Biol 21, 1704-15. Chen, L., Hu, J., Yun, Y. and Wang, T. (2010). Rab36 regulates the spatial distribution of late endosomes and lysosomes through a similar mechanism to Rab34. Mol Membr Biol 27, 24-31. Chen, X., Edwards, J. A., Logsdon, C. D., Ernst, S. A. and Williams, J. A. (2002). Dominant negative Rab3D inhibits amylase release from mouse pancreatic acini. J Biol Chem 277, 18002- 9. Colucci, A. M., Campana, M. C., Bellopede, M. and Bucci, C. (2005). The Rab-interacting lysosomal protein, a Rab7 and Rab34 effector, is capable of self-interaction. Biochem Biophys Res Commun 334, 128-33. Cordonnier, M. N., Dauzonne, D., Louvard, D. and Coudrier, E. (2001). Actin filaments and myosin I alpha cooperate with microtubules for the movement of lysosomes. Mol Biol Cell 12, 4013-29.

170

Direnzo, D., Hess, D. A., Damsz, B., Hallett, J. E., Marshall, B., Goswami, C., Liu, Y., Deering, T., Macdonald, R. J. and Konieczny, S. F. (2012). Induced Mist1 expression promotes remodeling of mouse pancreatic acinar cells. Gastroenterology 143, 469-80. Feig, L. A. (1999). Tools of the trade: use of dominant-inhibitory mutants of Ras-family GTPases. Nat Cell Biol 1, E25-7. Feng, Y., Press, B. and Wandinger-Ness, A. (1995). Rab 7: an important regulator of late endocytic membrane traffic. J Cell Biol 131, 1435-52. Fukuda, M. (2008). Regulation of secretory vesicle traffic by Rab small GTPases. Cell Mol Life Sci 65, 2801-13. Fukuda, M. (2013). Rab27 effectors, pleiotropic regulators in secretory pathways. Traffic 14, 949-63. Gaiser, S., Daniluk, J., Liu, Y., Tsou, L., Chu, J., Lee, W., Longnecker, D. S., Logsdon, C. D. and Ji, B. (2011). Intracellular activation of trypsinogen in transgenic mice induces acute but not chronic pancreatitis. Gut 60, 1379-88. Garside, V. C., Kowalik, A. S., Johnson, C. L., DiRenzo, D., Konieczny, S. F. and Pin, C. L. (2010). MIST1 regulates the pancreatic acinar cell expression of Atp2c2, the gene encoding secretory pathway calcium ATPase 2. Exp Cell Res 316, 2859-70. Ge, X., Yamamoto, S., Tsutsumi, S., Midorikawa, Y., Ihara, S., Wang, S. M. and Aburatani, H. (2005). Interpreting expression profiles of cancers by genome-wide survey of breadth of expression in normal tissues. Genomics 86, 127-41. Geahlen, J. H., Lapid, C., Thorell, K., Nikolskiy, I., Huh, W. J., Oates, E. L., Lennerz, J. K., Tian, X., Weis, V. G., Khurana, S. S. et al. (2013). Evolution of the human gastrokine locus and confounding factors regarding the pseudogenicity of GKN3. Physiol Genomics 45, 667-83. Geppert, M., Bolshakov, V. Y., Siegelbaum, S. A., Takei, K., De Camilli, P., Hammer, R. E. and Sudhof, T. C. (1994). The role of Rab3A in neurotransmitter release. Nature 369, 493-7. Ghosh, P., Dahms, N. M. and Kornfeld, S. (2003). Mannose 6-phosphate receptors: new twists in the tale. Nat Rev Mol Cell Biol 4, 202-12. Green, D. R. and Kroemer, G. (2004). The pathophysiology of mitochondrial cell death. Science 305, 626-9. Griffiths, G., Matteoni, R., Back, R. and Hoflack, B. (1990). Characterization of the cation- independent mannose 6-phosphate receptor-enriched prelysosomal compartment in NRK cells. J Cell Sci 95 ( Pt 3), 441-61. Gurkan, C., Lapp, H., Alory, C., Su, A. I., Hogenesch, J. B. and Balch, W. E. (2005). Large- scale profiling of Rab GTPase trafficking networks: the membrome. Mol Biol Cell 16, 3847-64. Halangk, W., Lerch, M. M., Brandt-Nedelev, B., Roth, W., Ruthenbuerger, M., Reinheckel, T., Domschke, W., Lippert, H., Peters, C. and Deussing, J. (2000). Role of cathepsin B in intracellular trypsinogen activation and the onset of acute pancreatitis. J Clin Invest 106, 773-81. Hollenbeck, P. J. and Swanson, J. A. (1990). Radial extension of macrophage tubular lysosomes supported by kinesin. Nature 346, 864-6. Hume, A. N., Collinson, L. M., Rapak, A., Gomes, A. Q., Hopkins, C. R. and Seabra, M. C. (2001). Rab27a regulates the peripheral distribution of melanosomes in melanocytes. J Cell Biol 152, 795-808. Jia, D., Sun, Y. and Konieczny, S. F. (2008). Mist1 regulates pancreatic acinar cell proliferation through p21 CIP1/WAF1. Gastroenterology 135, 1687-97.

171

Jin, E. J., Chan, C. C., Agi, E., Cherry, S., Hanacik, E., Buszczak, M. and Hiesinger, P. R. (2012). Similarities of Drosophila rab GTPases based on expression profiling: completion and analysis of the rab-Gal4 kit. PLoS One 7, e40912. Johannes, L., Lledo, P. M., Roa, M., Vincent, J. D., Henry, J. P. and Darchen, F. (1994). The GTPase Rab3a negatively controls calcium-dependent exocytosis in neuroendocrine cells. EMBO J 13, 2029-37. Johnson, C. L., Kowalik, A. S., Rajakumar, N. and Pin, C. L. (2004). Mist1 is necessary for the establishment of granule organization in serous exocrine cells of the gastrointestinal tract. Mech Dev 121, 261-72. Jordens, I., Fernandez-Borja, M., Marsman, M., Dusseljee, S., Janssen, L., Calafat, J., Janssen, H., Wubbolts, R. and Neefjes, J. (2001). The Rab7 effector protein RILP controls lysosomal transport by inducing the recruitment of dynein-dynactin motors. Curr Biol 11, 1680- 5. Klumperman, J., Kuliawat, R., Griffith, J. M., Geuze, H. J. and Arvan, P. (1998). Mannose 6-phosphate receptors are sorted from immature secretory granules via adaptor protein AP-1, clathrin, and syntaxin 6-positive vesicles. J Cell Biol 141, 359-71. Kowalik, A. S., Johnson, C. L., Chadi, S. A., Weston, J. Y., Fazio, E. N. and Pin, C. L. (2007). Mice lacking the transcription factor Mist1 exhibit an altered stress response and increased sensitivity to caerulein-induced pancreatitis. Am J Physiol Gastrointest Liver Physiol 292, G1123-32. Lemercier, C., To, R. Q., Swanson, B. J., Lyons, G. E. and Konieczny, S. F. (1997). Mist1: a novel basic helix-loop-helix transcription factor exhibits a developmentally regulated expression pattern. Dev Biol 182, 101-13. Li, C., Fan, Y., Lan, T. H., Lambert, N. A. and Wu, G. (2012). Rab26 modulates the cell surface transport of alpha2-adrenergic receptors from the Golgi. J Biol Chem 287, 42784-94. Limi, S., Ojakian, G. and Raffaniello, R. (2012). Rab3D regulates amylase levels, not agonist- induced amylase release, in AR42J cells. Cell Mol Biol Lett 17, 258-73. Lin, S. X. and Collins, C. A. (1992). Immunolocalization of cytoplasmic dynein to lysosomes in cultured cells. J Cell Sci 101 ( Pt 1), 125-37. Lipsky, N. G. and Pedersen, P. L. (1981). Mitochondrial turnover in animal cells. Half-lives of mitochondria and mitochondrial subfractions of rat liver based on [14C]bicarbonate incorporation. J Biol Chem 256, 8652-7. Logsdon, C. D. (1986). Glucocorticoids increase cholecystokinin receptors and amylase secretion in pancreatic acinar AR42J cells. J Biol Chem 261, 2096-101. Luo, X., Shin, D. M., Wang, X., Konieczny, S. F. and Muallem, S. (2005). Aberrant localization of intracellular organelles, Ca2+ signaling, and exocytosis in Mist1 null mice. J Biol Chem 280, 12668-75. Luzio, J. P., Rous, B. A., Bright, N. A., Pryor, P. R., Mullock, B. M. and Piper, R. C. (2000). Lysosome-endosome fusion and lysosome biogenesis. J Cell Sci 113 ( Pt 9), 1515-24. Mareninova, O. A., Sung, K. F., Hong, P., Lugea, A., Pandol, S. J., Gukovsky, I. and Gukovskaya, A. S. (2006). Cell death in pancreatitis: caspases protect from necrotizing pancreatitis. J Biol Chem 281, 3370-81. Matteoni, R. and Kreis, T. E. (1987). Translocation and clustering of endosomes and lysosomes depends on microtubules. J Cell Biol 105, 1253-65.

172

Menasche, G., Pastural, E., Feldmann, J., Certain, S., Ersoy, F., Dupuis, S., Wulffraat, N., Bianchi, D., Fischer, A., Le Deist, F. et al. (2000). Mutations in RAB27A cause Griscelli syndrome associated with haemophagocytic syndrome. Nat Genet 25, 173-6. Millar, A. L., Pavios, N. J., Xu, J. and Zheng, M. H. (2002). Rab3D: a regulator of exocytosis in non-neuronal cells. Histol Histopathol 17, 929-36. Mills, J. C. and Taghert, P. H. (2012). Scaling factors: transcription factors regulating subcellular domains. Bioessays 34, 10-6. Moore, R. H., Millman, E. E., Alpizar-Foster, E., Dai, W. and Knoll, B. J. (2004). Rab11 regulates the recycling and lysosome targeting of beta2-adrenergic receptors. J Cell Sci 117, 3107-17. Moreland, J. L., Gramada, A., Buzko, O. V., Zhang, Q. and Bourne, P. E. (2005). The Molecular Biology Toolkit (MBT): a modular platform for developing molecular visualization applications. BMC Bioinformatics 6, 21. Mukhopadhyay, P., Rajesh, M., Yoshihiro, K., Hasko, G. and Pacher, P. (2007). Simple quantitative detection of mitochondrial superoxide production in live cells. Biochem Biophys Res Commun 358, 203-8. Nashida, T., Imai, A. and Shimomura, H. (2006). Relation of Rab26 to the amylase release from rat parotid acinar cells. Arch Oral Biol 51, 89-95. Odinokova, I. V., Sung, K. F., Mareninova, O. A., Hermann, K., Evtodienko, Y., Andreyev, A., Gukovsky, I. and Gukovskaya, A. S. (2009). Mechanisms regulating cytochrome c release in pancreatic mitochondria. Gut 58, 431-42. Ohnishi, H., Samuelson, L. C., Yule, D. I., Ernst, S. A. and Williams, J. A. (1997). Overexpression of Rab3D enhances regulated amylase secretion from pancreatic acini of transgenic mice. J Clin Invest 100, 3044-52. Park, M. K., Ashby, M. C., Erdemli, G., Petersen, O. H. and Tepikin, A. V. (2001). Perinuclear, perigranular and sub-plasmalemmal mitochondria have distinct functions in the regulation of cellular calcium transport. EMBO J 20, 1863-74. Pasquali, C., Fialka, I. and Huber, L. A. (1999). Subcellular fractionation, electromigration analysis and mapping of organelles. J Chromatogr B Biomed Sci Appl 722, 89-102. Peden, A. A., Oorschot, V., Hesser, B. A., Austin, C. D., Scheller, R. H. and Klumperman, J. (2004). Localization of the AP-3 adaptor complex defines a novel endosomal exit site for lysosomal membrane proteins. J Cell Biol 164, 1065-76. Pereira-Leal, J. B. and Seabra, M. C. (2001). Evolution of the Rab family of small GTP- binding proteins. J Mol Biol 313, 889-901. Pin, C. L., Bonvissuto, A. C. and Konieczny, S. F. (2000). Mist1 expression is a common link among serous exocrine cells exhibiting regulated exocytosis. Anat Rec 259, 157-67. Pin, C. L., Rukstalis, J. M., Johnson, C. and Konieczny, S. F. (2001). The bHLH transcription factor Mist1 is required to maintain exocrine pancreas cell organization and acinar cell identity. J Cell Biol 155, 519-30. Poot, M., Zhang, Y. Z., Kramer, J. A., Wells, K. S., Jones, L. J., Hanzel, D. K., Lugade, A. G., Singer, V. L. and Haugland, R. P. (1996). Analysis of mitochondrial morphology and function with novel fixable fluorescent stains. J Histochem Cytochem 44, 1363-72. Progida, C., Cogli, L., Piro, F., De Luca, A., Bakke, O. and Bucci, C. (2010). Rab7b controls trafficking from endosomes to the TGN. J Cell Sci 123, 1480-91. Qiu, X., Valentijn, J. A. and Jamieson, J. D. (2001). Carboxyl-methylation of Rab3D in the rat pancreatic acinar tumor cell line AR42J. Biochem Biophys Res Commun 285, 708-14.

173

Ramsey, V. G., Doherty, J. M., Chen, C. C., Stappenbeck, T. S., Konieczny, S. F. and Mills, J. C. (2007). The maturation of mucus-secreting gastric epithelial progenitors into digestive- enzyme secreting zymogenic cells requires Mist1. Development 134, 211-22. Riedel, D., Antonin, W., Fernandez-Chacon, R., Alvarez de Toledo, G., Jo, T., Geppert, M., Valentijn, J. A., Valentijn, K., Jamieson, J. D., Sudhof, T. C. et al. (2002). Rab3D is not required for exocrine exocytosis but for maintenance of normally sized secretory granules. Mol Cell Biol 22, 6487-97. Rinn, C., Aroso, M., Prussing, J., Islinger, M. and Schrader, M. (2012). Modulating zymogen granule formation in pancreatic AR42J cells. Exp Cell Res 318, 1855-66. Robinson, M. S. (1990). Cloning and expression of gamma-adaptin, a component of clathrin- coated vesicles associated with the Golgi apparatus. J Cell Biol 111, 2319-26. Rukstalis, J. M., Kowalik, A., Zhu, L., Lidington, D., Pin, C. L. and Konieczny, S. F. (2003). Exocrine specific expression of Connexin32 is dependent on the basic helix-loop-helix transcription factor Mist1. J Cell Sci 116, 3315-25. Saftig, P. and Klumperman, J. (2009). Lysosome biogenesis and lysosomal membrane proteins: trafficking meets function. Nat Rev Mol Cell Biol 10, 623-35. Saluja, A. K., Donovan, E. A., Yamanaka, K., Yamaguchi, Y., Hofbauer, B. and Steer, M. L. (1997). Cerulein-induced in vitro activation of trypsinogen in rat pancreatic acini is mediated by cathepsin B. Gastroenterology 113, 304-10. Saraste, J. and Goud, B. (2007). Functional symmetry of endomembranes. Mol Biol Cell 18, 1430-6. Scheffzek, K., Ahmadian, M. R., Kabsch, W., Wiesmuller, L., Lautwein, A., Schmitz, F. and Wittinghofer, A. (1997). The Ras-RasGAP complex: structural basis for GTPase activation and its loss in oncogenic Ras mutants. Science 277, 333-8. Schluter, O. M., Schmitz, F., Jahn, R., Rosenmund, C. and Sudhof, T. C. (2004). A complete genetic analysis of neuronal Rab3 function. J Neurosci 24, 6629-37. Schwartz, S. L., Cao, C., Pylypenko, O., Rak, A. and Wandinger-Ness, A. (2007). Rab GTPases at a glance. J Cell Sci 120, 3905-10. Selinummi, J., Seppala, J., Yli-Harja, O. and Puhakka, J. A. (2005). Software for quantification of labeled bacteria from digital microscope images by automated image analysis. Biotechniques 39, 859-63. Shi, G., DiRenzo, D., Qu, C., Barney, D., Miley, D. and Konieczny, S. F. (2013). Maintenance of acinar cell organization is critical to preventing Kras-induced acinar-ductal metaplasia. Oncogene 32, 1950-8. Shi, G., Zhu, L., Sun, Y., Bettencourt, R., Damsz, B., Hruban, R. H. and Konieczny, S. F. (2009). Loss of the acinar-restricted transcription factor Mist1 accelerates Kras-induced pancreatic intraepithelial neoplasia. Gastroenterology 136, 1368-78. Soubannier, V., McLelland, G. L., Zunino, R., Braschi, E., Rippstein, P., Fon, E. A. and McBride, H. M. (2012). A vesicular transport pathway shuttles cargo from mitochondria to lysosomes. Curr Biol 22, 135-41. Sridhar, S., Patel, B., Aphkhazava, D., Macian, F., Santambrogio, L., Shields, D. and Cuervo, A. M. (2013). The lipid kinase PI4KIIIbeta preserves lysosomal identity. EMBO J 32, 324-39. Terman, A., Kurz, T., Navratil, M., Arriaga, E. A. and Brunk, U. T. (2010). Mitochondrial turnover and aging of long-lived postmitotic cells: the mitochondrial-lysosomal axis theory of aging. Antioxid Redox Signal 12, 503-35.

174

Tian, X., Jin, R. U., Bredemeyer, A. J., Oates, E. J., Blazewska, K. M., McKenna, C. E. and Mills, J. C. (2010). RAB26 and RAB3D are direct transcriptional targets of MIST1 that regulate exocrine granule maturation. Mol Cell Biol 30, 1269-84. Tinel, H., Cancela, J. M., Mogami, H., Gerasimenko, J. V., Gerasimenko, O. V., Tepikin, A. V. and Petersen, O. H. (1999). Active mitochondria surrounding the pancreatic acinar granule region prevent spreading of inositol trisphosphate-evoked local cytosolic Ca(2+) signals. EMBO J 18, 4999-5008. Wagner, A. C., Strowski, M. Z., Goke, B. and Williams, J. A. (1995). Molecular cloning of a new member of the Rab protein family, Rab 26, from rat pancreas. Biochem Biophys Res Commun 207, 950-6. Wang, J., Tempel, W., Shen, Y., Shen, L., Yaniw, D., Arrowsmith, C., Edwards, A., Sundstrom, M., Weigelt, J., Bochkarev, A. et al. (2006). Crystal structure of human RAB26 in complex with a GTP analogue, Structural Genomics Consortium (SGC). Wang, T. and Hong, W. (2002). Interorganellar regulation of lysosome positioning by the Golgi apparatus through Rab34 interaction with Rab-interacting lysosomal protein. Mol Biol Cell 13, 4317-32. Wang, T. and Hong, W. (2005). Assay and functional properties of Rab34 interaction with RILP in lysosome morphogenesis. Methods Enzymol 403, 675-87. Weber, E., Berta, G., Tousson, A., St John, P., Green, M. W., Gopalokrishnan, U., Jilling, T., Sorscher, E. J., Elton, T. S., Abrahamson, D. R. et al. (1994). Expression and polarized targeting of a rab3 isoform in epithelial cells. J Cell Biol 125, 583-94. Xu, D. and Zhang, Y. (2009). Generating triangulated macromolecular surfaces by Euclidean Distance Transform. PLoS One 4, e8140. Yoshie, S., Imai, A., Nashida, T. and Shimomura, H. (2000). Expression, characterization, and localization of Rab26, a low molecular weight GTP-binding protein, in the rat parotid gland. Histochem Cell Biol 113, 259-63. Zhang, J., Schulze, K. L., Hiesinger, P. R., Suyama, K., Wang, S., Fish, M., Acar, M., Hoskins, R. A., Bellen, H. J. and Scott, M. P. (2007). Thirty-one flavors of Drosophila rab proteins. Genetics 176, 1307-22. Zhong, S., Li, C. and Wong, W. H. (2003). ChipInfo: Software for extracting gene annotation and gene ontology information for microarray analysis. Nucleic Acids Res 31, 3483-6. Zhu, L., Tran, T., Rukstalis, J. M., Sun, P., Damsz, B. and Konieczny, S. F. (2004). Inhibition of Mist1 homodimer formation induces pancreatic acinar-to-ductal metaplasia. Mol Cell Biol 24, 2673-81.

175

Figure Legends

Figure 1. Expression of RAB26 is cell and tissue-dependent, and inducible by the transcription factor MIST1. A. Expression of RAB7 and RAB26 in REFEXA database of human tissues (http://sbmdb.genome.rcast.u-tokyo.ac.jp/refexa/). All tissues are labeled with

highly RAB26 expressing secretory tissues highlighted below. Gene expression is shown with

relative scale (0 to 200) with red=high, blue=low expression. B. Microarray analysis of RAB26

gene expression from isolated populations of gastric ZCs and their precursor neck cells from

wild-type and Mist1−/− mice. Arrows indicate location of isolated cell populations in

representative H&E gastric gland images. Gene expression for microarray analyses are shown with relative expression scale (-3.0 to 3.0) with red=high, blue=low expression. C. Western blot

analysis of indicated proteins from two wildtype and two Mist1−/− mice. D.

Immunofluorescence of AR42J acinar cell differentiation upon treatment with dexamethasone

(Dex); amylase secretory vesicles are red; endogenous RAB26 are green. E. Gene expression

analysis of RAB26 expression from AGS and HGC-27 gastric cell lines before and after

transfection with either GFP or MIST1; a non-epithelial monocyte control cell line is also shown

(U937). Scale bars = 20 µm.

Figure 2. RAB26 localizes to LAMP1 positive lysosomal vesicles. A. Immunofluorescence

of HGC-27 cells transfected with EGFP-RAB26 (green) and co-immunostained with LAMP1

(red). B. Confocal image of EGFP-RAB26 (green) transfected HGC-27 cells stained for

LAMP1 (red). Insets show unmerged RAB26 (green) and LAMP1 (red) positive membranes.

(Cell border outlined, “N” – nucleus). C. RAB26 without GFP tag (pcDNA3.1-RAB26)

176

transfected HGC-27 cells co-stained with anti-LAMP1 (green) and anti-RAB26 (purple). D.

Immunoelectron micrographs of HGC-27 cells transfected with EGFP-RAB26. Representative low magnification cell shown with insets and additional panel highlighting large labeled vesicles with anti-RAB26 (12 nm gold particles, yellow arrowheads) and anti-LAMP1 (18 nm gold particles, white arrowheads). E. Graph with left bar showing average percent total cellular area of lysosomes, mitochondria, nucleus, cytoplasm, and plasma membrane in multiple quantified cells. Right bars show fraction of total RAB26 or LAMP1 gold particles associated with each of those compartments. Scale bars = 20 µm unless indicated.

Figure 3. Endogenous RAB26 is also lysosome-associated. A. Immunofluorescence imaging of endogenous RAB26 staining (green) in a rare HGC-27 cell with moderate RAB26 levels co- stained for LAMP1 (red). B. Confocal immunomicroscopy of endogenous RAB26 (green) and

LAMP1 (red) (“N” – nucleus). Arrowheads indicate colocalization of RAB26 and LAMP1 vesicles. C. Lower magnification epifluorescence of HGC-27 cells with more representative, low-level endogenous RAB26 (green) and LAMP1 (red). D. Immunoelectron micrographs of control GFP transfected HGC-27 cells. A representative cell is shown at low magnification with several panels showing electron lucent structures labeled with anti-LAMP1 (18 nm, white arrowheads) and sparsely labeled with anti-RAB26 (12 nm, yellow arrowheads). E. Density gradient cell fractionation experiment with numbered density fractions analyzed for lysosomes with anti-LAMP1 antibody; EGFP-tagged RAB26 by both anti-GFP and anti-RAB26 antibodies

(middle and lower panel); and endogenous RAB26 by anti-RAB26 immunoblotting (lower panel). Scale bars = 20 µm unless indicated.

177

Figure 4. RAB26 localizes with other lysosomal markers. A. Confocal image of a HGC-27

cell transfected with EGFP-RAB26 (green) and immunostained for LAMP1 (red) and cathepsin

D (blue) (Cell border outlined, “N” – nucleus). Inset highlights higher magnification of a

lysosomal vesicle (arrowhead) that contains membranous RAB26 and LAMP1 with interior

cathepsin D. B. Immunofluorescence staining of EGFP-RAB26 (green) transfected HGC-27

cells with cathepsin D (red). C. Epifluorescence microscopy of HGC-27 cells co-transfected

with EGFP-RAB26 (green) and RFP-tagged cathepsin D (CTSD-RFP, red). E.

Immunofluorescence staining of EGFP-RAB26 (green) transfected HGC-27 cells with RAB7

(red). Scale bars = 20 µm.

Figure 5. Design and characterization of RAB26 point mutants. A. Amino acid sequence of

EGFP-RAB26 plasmid with EGFP sequence (green) and human RAB26 sequence (black) labeled. The EGFP-RAB26T77N and EGFP-RAB26Q123L were constructed by the indicated point mutations (shown in red) in the RAB26 sequence converting a threonine to an asparagine, and a glutamine to a leucine, respectively. B. Ribbon diagram of the crystal structure of RAB26 generated by FirstGlance in Jmol (ver. 1.03) from http://molvis.sdsc.edu/fgij/fg.htm?mol=2G6B

(PDB ID: 2G6B; (Wang et al., 2006)). GNP bound RAB26 with the mutated threonine (T77) and glutamine (Q123) labeled and emphasized with their atomic structures. C. Confocal fluorescence microscopy of the distribution of EGFP-RAB26T77N (green) transfected HGC-27 cells immunostained with LAMP1 antibody (red) (Cell border outlined, “N” – nucleus). Right panels show epifluorescence microscopy of EGFP-RAB26T77N (green) co-stained for LAMP1

(red). D. Confocal fluorescence microscopy of the localization of EGFP-RAB26Q123L (green) transfected HGC-27 cells immunostained with LAMP1 antibody (red). Inset indicates areas of

178

overlap (solid white arrowheads) of EGFP-RAB26Q123L vesicles with lysosomes (transparent arrowhead) (Cell border outlined, “N” – nucleus). Right panels show epifluorescence microscopy of EGFP-RAB26Q123L (green) co-stained for LAMP1 (red). E. Pearson’s correlation coefficient quantification of pixel-to-pixel colocalization of multiple cells transfected with EGFP-RAB26, EGFP-RAB26T77N, EGFP-RAB26Q123L, and GFP with LAMP1 lysosomes. (“***” – p < 0.001, one-way ANOVA test with Dunnett’s correction). Scale bars =

20 µm.

Figure 6. Scaling of RAB26 expression leads to perinuclear localization of lysosomes. A.

Fluoresence microscopy of HGC-27 cells transfected with EGFP-RAB26 (green) and stained for anti-LAMP1 (red). A long and short exposure is shown to highlight the differences in RAB26 levels with the cells expressing highest (“*”) and more moderate (solid white arrow) levels of

RAB26 indicated. B. Histogram of EGFP-RAB26 transfected cells immunostained for LAMP1 with either diffuse (red line) or clustered (blue line) LAMP1 lysosomal distribution plotted vs. binned fluorescence intensity of EGFP-RAB26. C. Epifluorescence microscopy of HGC-27 cells transfected with EGFP-RAB26T77N, EGFP-RAB26Q123L, EGFP-RAB3D, and EGFP expression plasmids (green) co-stained with anti-LAMP1 (red). D. The percentage of EGFP-

RAB26, EGFP-RAB26T77N, EGFP-RAB26Q123L, EGFP-RAB3D, and EGFP transfected

HGC-27 cells from multiple cell fields with coalesced perinuclear LAMP1 structures quantified by cell count and plotted (“***” – p <0.001, one-way ANOVA test with Dunnett’s correction).

E. Immunofluorescence microscopy of untreated (-Dex) or dexamethasone treated (+Dex)

AR42J cells stained for endogenous RAB26 (green) and LAMP1 (red). Scale bars = 20 µm.

179

Figure 7. RAB26 overexpressing cells show ultrastructural rearrangements. A. B.

Transmission electron micrographs of EGFP-RAB26 HGC-27 cells with clustered electron-

lucent lysosome vesicles (‘L’) highlighted in the insets with electron-dense mitochondrial

clusters indicated (‘M’) (“N” – nucleus, scale bars as shown). Transmission electron

micrographs of C. EGFP-RAB26T77N, D. EGFP-RAB26Q123L, and E. EGFP transfected

HGC-27 cells (scale bars = 10 µm). F. G. H. Panels of immunoelectron microscopy of EGFP-

RAB26 transfected HGC-27 cells labeled with LAMP1 (18 nm, white arrowheads) and RAB26

(12 nm, yellow arrowheads) with mitochondria (‘M’) and lysosomes (‘L’) highlighted (scale bars as shown).

Figure 8. RAB26 induced lysosomal clustering leads to mitochondrial reorganization. A.

Fluorescence microscopy of EGFP-RAB26, EGFP-RAB26T77N, EGFP-RAB26Q123L, and

EGFP transfected HGC-27 cells (green) co-stained for lysosomes (anti-LAMP1, red) and mitochondria (MitoTracker, purple). B. Confocal section of EGFP-RAB26 expressing cell

(green) with stained for lysosomes labeled in red (anti-LAMP1) and mitochondria labeled in purple (MitoTracker). Perinuclear mitochondria free zones are indicated (‘*’) (Cell border outlined, “N” – nucleus). C. Live confocal timelapse microscopy of EGFP-RAB26 (green),

LysoTracker labeled lysosome (red), and MitoTracker labeled mitochondria (purple) vesicle dynamics. Insets highlight RAB26 (green, filled white arrowhead) and mitochondria (purple, open white arrowhead) interactions (time stamps of images from Movie 2 shown, “N” – nucleus). D. Quantification of mitochondrial area/total cell area measured from multiple HGC-

27 cells transfected with EGFP-RAB26, EGFP-RAB26T77N, EGFP-RAB26Q123L, and EGFP

(‘*’- p <0.05, one-way ANOVA test with Dunnett’s correction). E. Densitometry quantification

180 of western blots (triplicate experiments) of mitochondrial membrane density using TOM20 and

α/β tubulin markers for EGFP-RAB26, EGFP-RAB26T77N, EGFP-RAB26Q123L, and EGFP transfected HGC-27 cells (“***” – p <0.001, one-way ANOVA test with Dunnett’s correction).

Scale bars = 20 µm.

181

Supplemental Figure Legends

Supplemental Figure 1. RAB26 does not localize to the immature secretory vesicle,

endosomal, Golgi, or post-Golgi sorting compartments. EGFP-RAB26 (green) transfected

HGC-27 cells immunostained for: A. immature secretory vesicle marker, Furin (red); B. endoplasmic reticulum marker, Calregulin (red); C. early endosomal marker, EEA1 (red); D.

Golgi marker, Giantin (red); E. cis-Golgi marker, GM130 (red); F. trans-Golgi marker, TGN46

(red); and G. post-Golgi/late endosome marker, CI-M6PR (red). Confocal microscopy of EGFP-

RAB26 (green) transfected HGC-27 cells immunostained for post-Golgi/endosomal markers: B.

CI-M6PR (red) C. AP1 (red), D. GGA2 (red). Insets indicate RAB26 vesicles (white filled arrowheads) overlap with stained markers (open arrowheads) (Cell border outlined, “N” – nucleus). Scale bars = 20 µm.

Supplemental Figure 2. RAB26 not RAB3D localizes to lysosomes. A. Immunofluorescence microscopy of HGC-27 cells transfected with EGFP-RAB3D and co-stained for LAMP1 (red) and cathepsin D (purple). Epifluorescence images of EGFP-RAB26 transfected: B. AGS, gastric cells; C. 5637, bladder cells; and D. AR42J, pancreatic cells co-labeled for LAMP1 (red).

Panels indicate unmerged green and red channels. E. Confocal microscopy of an AR42J cell transfected with EGFP-RAB26 and immunostained for LAMP1 (red). Arrowheads indicate areas of overlap (Cell border outlined, “N” – nucleus). Scale bars = 20 µm unless indicated.

Supplemental Figure 3. RAB26 does not affect Golgi or late endosomal distribution.

Fluorescence microscopy of EGFP-RAB26, EGFP-RAB26T77N, EGFP-RAB26Q123L, and

182

EGFP transfected HGC-27 cells (green) co-stained for: A. giantin (red) and B. CI-M6PR (red).

Low magnification panels of EGFP-RAB26 transfected cells highlight giantin and CI-M6PR

distribution in transfected (green) and untransfected cells. Scale bars = 20 µm.

Supplemental Figure 4. RAB26 does not affect lysosomal or mitochondrial function. A.

Western blots (triplicate experiments) of EGFP-RAB26, EGFP-RAB26T77N, EGFP-

RAB26Q123L, and EGFP transfected HGC-27 cells comparing levels of LAMP1, cathepsin D, mTOR, phosphorylated S6 kinase, total S6 kinase, and tubulin. B. Fluorescence microscopy of

EGFP-RAB26, EGFP-RAB26T77N, EGFP-RAB26Q123L, and EGFP transfected HGC-27 cells

(green) co-stained for: B. MitoTracker CMXRos (red) and C. MitoSOX Red (red) and

MitoTracker Deep Red (purple). Scale bars = 20 µm.

Movie 1. RAB26 does not co-localize with secretory vesicles. Live confocal timelapse microscopy of HGC-27 cells transfected with EGFP-RAB26 (green) and PGC-RFP (red).

Images were taken at 3 second intervals and movie is displayed at 5 frames/second. White arrows highlight RAB26 vesicle movement. Yellow arrows and circles show vesicle fusion or fission events. Time stamp is shown in upper left corner and scale bar = 20 μm.

Movie 2. RAB26 localizes with lysosomes in mitochondrial free subcellular areas. Live

confocal timelapse microscopy of HGC-27 cells transfected with EGFP-RAB26 (green) stained for lysosomes (LysoTracker, red) and mitochondria (MitoTracker Deep Red, Blue). Images were taken at 40 second intervals and movie is displayed at 3 frames/second. White arrows

183 highlight RAB26/LysoTracker vesicle movement. Time stamp is shown in upper left corner and scale bar = 20 μm.

184

185

186

187

188

189

190

191

192

193

194

195

196

CHAPTER 5: MIST1 Facilitates Secretory Vesicle Maturation by Regulation of Lysosomal Trafficking in Exocrine Secretory Cells

197

MIST1 facilitates secretory vesicle maturation by regulation of lysosomal trafficking in exocrine secretory cells

Ramon U. Jin1, Greg Sibbel1, 2, Stephen F. Konieczny3, Stuart Kornfeld1, and Jason C. Mills1, 2, 4

Division of Gastroenterology, Departments of 1Medicine , 2Developmental Biology, 4Pathology & Immunology, Washington University School of Medicine, St. Louis, MO 63110

3Department of Biological Sciences, Purdue University, West Lafayette, IN 47907

Address correspondence to: Jason C. Mills Department of Medicine Washington University School of Medicine, Box 8124 660 So. Euclid Ave. St. Louis, MO 63110 Phone: 314 362-4258 FAX: 314 362-7487 e-mail [email protected]

Condensed title: MIST1, lysosomes, and exocrine vesicles

Key words: BHLHA15; zymogenic cell; LAMP1; transcriptional regulation

198

Abstract

Exocrine cells like pancreatic acinar and zymogenic chief cells have a highly developed secretory architecture that is rapidly established upon maturation. The evolutionarily conserved transcription factor MIST1 governs normal apical secretory vesicle organization in these cells.

These effects have been attributed to MIST1 inducing transcriptional targets that directly interact with the regulated secretory pathway. How MIST1 may influence trafficking of non secretory vesicles has yet to be explored. In mouse exocrine cells that are null for Mist1, we found disorganized subcellular distribution of lysosomes. Normally, lysosomes cluster in a centralized basal compartment away from secretory granules, whereas in Mist1−/− exocrine cells, they accumulate apically, associate with secretory vesicles, and ultrastructural examination shows partially degraded cargo in lysosomes. Secretory vesicles in Mist1−/− exocrine cells are smaller, though vesicle size is partially rescued by disrupting normal lysosomal hydrolase trafficking.

Thus, we propose MIST1 promotes normal accumulation of secretory granules in part by protecting them from the cellular degradation/recycling machinery. These results illustrate how a transcription factor can regulate cell architecture and have implications for disease processes like acute pancreatitis where MIST1 is lost, and secretory vesicles are targeted by lysosomal enzymes.

199

Introduction

Survival of the whole organism is crucially tied to the function of each cell type that

constitutes its tissues and organs. These functions are inherently tied to the form or subcellular

architecture of these cells. The dramatic importance of this concept is best illustrated in single

celled prokaryotes, in which all aspects of shape are actively honed for the survival of the cell in

response to its environment (Young, 2006). In eukaryotes, form and function are collectively

referred to as “differentiation”. In the last decade, it has become clear that a cell can

dedifferentiate, effectively stripping it of its identity and function (Takahashi and Yamanaka,

2006). In fact, this cellular identity crisis is a common link in many diseases including diabetes, heart disease, and cancer (Kubin et al., 2011; Schwitalla et al., 2013; Talchai et al., 2012).

Specifically, loss of form and function is apparent in gastric and pancreatic cancer tumorigenesis. In both cases dedifferentiation has been well studied and shown to progress stepwise (Correa, 1992; Hezel et al., 2006) as mature cellular structure and function is lost.

In the pancreas and the stomach, studies have shown that the bHLH transcription factor,

MIST1, is one of these factors that maintains a secretory cell’s functionality (Pin et al., 2001;

Ramsey et al., 2007). Its loss has been found to directly render the cell more susceptible to injury, metaplasia, and carcinogenesis ((Alahari et al., 2011; Kowalik et al., 2007; Lennerz et al.,

2010; Nam et al., 2010; Nozaki et al., 2008; Shi et al., 2013; Shi et al., 2009). Studies from our lab using an inducible model of gastric atrophy and metaplasia show that MIST1 is one of the first factors that is lost as mature zymogenic chief cells respond to injury and dedifferentiate in a process known as pseudopyloric metaplasia (Huh et al., 2012). Additional studies in the pancreas using an inducible MIST1 knockout model, reveal that within hours of MIST1 loss,

200

mature pancreatic acinar cells began to remodel their granules, cytoskeleton, and cellular junctions (Direnzo et al., 2012).

Functionally, MIST1 does not act as a traditional differentiating factor in that in its absence, cells still acquire mature characteristics but have compromised functionality (Capoccia et al., 2013; Direnzo et al., 2012; Johnson et al., 2004; Pin et al., 2001; Ramsey et al., 2007). In other words, MIST1 does not impart lineage-specific properties to those maturing cells that express it. For example, in the stomach, in the absence of MIST1, mature gastric zymogenic cells still express their usual array of endogenous secretory products (Bredemeyer et al., 2009).

However, these products are no longer packaged, maintained, or secreted normally (Capoccia et al., 2013; Ramsey et al., 2007; Tian et al., 2010). Analogously, the MIST1 ortholog in

Drosophila (called DIMM) is sufficient to confer many aspects of the regulated secretory pathway when expressed ectopically but does not change the content of the vesicles (Hamanaka et al., 2010; Park et al., 2011). Thus, MIST1 functions more to enhance the baseline secretory machinery that all cells already possess (i.e., it is a Scaling Factor (Mills and Taghert, 2012)).

To understand its importance in physiology and pathophysiology, the critical question becomes how MIST1 can effect substantial changes in cellular architecture by regulating expression of specific genetic targets. Separate studies have identified various direct MIST1 targets (Garside et al., 2010; Jia et al., 2008; Rukstalis et al., 2003) but how the targets come together to regulate an interconnected pathway is still unclear. MIST1 does control two small

GTPases, RAB3D and RAB26 (Direnzo et al., 2012; Johnson et al., 2004; Tian et al., 2010).

RAB3D has been shown to function in secretory vesicle maturation, and preliminary work based only on subcellular localization indicated a similar role for RAB26 (Millar et al., 2002; Nashida et al., 2006; Yoshie et al., 2000). However, recent studies from our lab have implicated a novel

201

role of RAB26 in lysosomal movement and trafficking (Jin and Mills, manuscript in

preparation). Thus, MIST1 might directly affect the degradative compartment in secretory

exocrine cells.

Here we dissect how a transcription factor might regulate the exocrine secretory

apparatus by suppressing the degradative lysosomal machinery to prevent premature destruction

of developing secretory granules. We show that, in addition to the reduction in secretory vesicle

size and general granule disorganization seen in exocrine tissues in Mist1−/− mice, there is a

dramatic increase in functional lysosomes. Normally in gastric zymogenic cells, these

degradative vesicles are small, limited in number, and reside basally to large apical secretory

vesicles. But in the absence of MIST1, they expand apically out of the basal compartment to

engulf and degrade many of the forming vesicles. The phenomenon occurs rapidly upon MIST1

loss and persists for the lifetime of mature zymogenic cells in the absence of MIST1. Lysosome

up-scaling occurs in all another exocrine secretory tissue, the pancreas, once MIST1 is lost.

Lysosomal enzyme trafficking defective Gnptab−/− mice crossed to Mist1−/− showed partial

rescue of secretory vesicle size through prevention of the lysosomal mediated secretory vesicle

destruction in that there was a dramatic increase in undegraded secretory content inside the

accumulated lysosomes. We conclude that MIST1 is a transcription factor that governs

trafficking in more than one vesicular compartment. In other words, MIST1 in part increases stores of large secretory granules by suppressing their targeting to cellular degradative pathways.

Results

The bHLH Transcription Factor, MIST1, is Required for Large Granule Homeostasis

202

Previous reports have shown that MIST1 (Bredemeyer et al., 2009; Capoccia et al., 2013;

Ramsey et al., 2007; Tian et al., 2010) is required for the formation of large secretory vesicles in

gastric zymogenic cells. To confirm these results, we examined the structure of gastric units

from WT and Mist1−/− mice. Both by H&E and transmission electron microscopy we found

aberrant secretory architecture in Mist1−/− ZCs (Fig. 1A). WT mice displayed the typical apical

cytoplasm containing large secretory vesicles (Fig. 1B, C). Mist1−/− mice lack this prominent apex and, displaying smaller, apically localized secretory vesicles and more basally mislocalized granules (Fig. 1B, C). In fact, when whole stomach levels of secretory vesicle constituents are examined, Mist1−/− mice show an almost fifty percent reduction in global quantities of

pepsinogen C and gastric instrinic factor (Fig. 1B, C). When quantified on a vesicle by vesicle

basis, WT mice have a greater proportion of large secretory vesicles and bigger mean vesicle size

(Fig. 6C, D) compared to vesicles seen in Mist1−/−mice.

Lysosomes Accumulate and Engulf Secretory Vesicles in the Absence of MIST1

To address this possibility that the granular aberrations could be due to increased

destruction, we assayed for lysosomal distribution using the well-established LAMP1 membrane

marker. We found that in WT mice, lysosomes were sparse in mature zymogenic cells, and

those present were mostly basal, localized away from the apically maturing secretory vesicles

(Fig. 2A-D). In Mist1−/− ZCs, however, we saw a dramatic increase in LAMP1 lysosomes.

Again, most of these lysosomes were seen basal to the nucleus. But the basal compartment was

greatly expanded by accumulations of large lysosomes, labeled with LAMP1, LAMP2, or

Cathepsin D (Fig. 2A-D), while the nucleus was displaced to nearly the apical plasma

203

membrane. Thus, in addition to secretory vesicular aberrations, Mist1−/− ZCs also display an

alteration in their lysosomes.

We next investigated whether accumulation of lysosomes was responsible for the smaller

secretory vesicles. Using transmission electron microscopy we surveyed multiple Mist1−/− ZCs

and consistently found engulfed secretory vesicles characterized by electron density in various

stages of degradation inside lysosomal structures, whereas neither degrading secretory vesicles

nor increased lysosomes were seen in WT ZCs (Fig. 3A, B). Based on these results, we used

confocal immunofluorescence microscopy to look for enhanced secretory vesicle-lysosome

overlap in Mist1−/− ZCs. Consistent with our tEM findings, Mist1−/− ZCs displayed many regions, especially basal to the nucleus, where PGC containing vesicles resided within LAMP1 marked lysosomes (Fig. 3C, D). When quantified, almost 30% of all secretory vesicles in

Mist1−/− ZCs displayed LAMP1 overlap (Fig. 6E). WT mice showed small dispersed lysosomal

staining with no colocalization with PGC secretory vesicles (Fig 3D, 6E).

Lysosome Accumulation occurs immediately upon MIST1 loss

To test if lysosome accumulation was directly concomitant with MIST1 loss, first we

took advantage of Mist1−/− mice in which the Mist1 null allele has a LacZ cassette knock-in (Pin

et al., 2001), thereby allowing us to track when and where MIST1 would normally be expressed

by charting expression of the Mist1 promoter (Fig. 4A). Importantly, during normal

differentiation, ZCs terminally differentiate towards the base of each gastric unit from a non-

MIST1 expressing mucous neck cell precursor. In the Mist1−/− animals the basic elements of

this terminal differentiation step occur despite absence of MIST1 expression (Bredemeyer et al.,

2009; Ramsey et al., 2007).

204

Our data show that upon emergence of these MIST deficient ZCs from their mucous

secreting precursors, they accumulated lysosomes, and they did so as early as the Mist1 promoter

became active (Fig. 4A). Furthermore, aberrant lysosomes persisted for the lifetime of the cell,

because ZCs from the earliest to most mature at the very base of the gastric unit showed the same

lysosomal phenotype (Fig. 2A-D, 3C, 4A).

In parallel experiments, we assayed the effects of conditionally knocking out MIST1 on

the two vesicle compartments using the Mist1BT/BT mouse model. Briefly, these mice have

knocked in an N-terminal BT tagged, C-terminal 6XHis-Myc tagged Mist1 and two loxP sites introduced via homologous recombination into the endogenous Mist1 locus. Upon crossing to

Mist1CreERT mice (Shi et al., 2009), Mist1BT/Cre mice were generated in which the remaining allele of Mist1 is susceptible to tamoxifen induced cre recombinase excision to generate induced

functional nulls. The Mist1BT/BT mouse served as a control in which both transgenic alleles of

myc-tagged MIST1 are expressed (Fig. S1A, 4B, C). One week after tamoxifen induced Mist1

deletion in the Mist1BT/Cre mice, we saw a mosaic pattern of secretory vesicle and lysosome

changes in cells losing MIST1 (Fig. S1B, 4B, C). Units that retained MIST1 expression, as

marked by myc staining, also preserved robust secretory vesicle apical distribution and scarce

basal scattered lysosomal as per WT and Mist1BT/BT mice (Fig. S1B, 4B, C). However, at two

weeks after Mist1 deletion, all gastric units exhibited MIST1 loss, scant apical secretory vesicles,

and accumulation of lysosomes (Fig. S1C, 4B, C). When quantified, average secretory vesicle

size decreased and overlap of those vesicles with lysosomes increased to over 90% (Fig. 4C).

These data show that the process of stomach lysosomal accumulation in Mist1−/− exocrine cells

is not a gradual, additive, or indirect effect that occurs as the cells age. But rather, it is a rapid defect that ensues directly concomitant to failed induction of MIST1 expression.

205

Other Acinar Tissues also exhibit Lysosome Accumulation upon MIST1 loss

Because MIST1 is expressed and functions analogously in all exocrine secretory tissues

(Lemercier et al., 1997; Pin et al., 2000), we investigate if this aberrant lysosomal accumulation

occurred in these other tissues. To this end, we surveyed LAMP1 staining in formalin fixed

paraffin embedded pancreatic sections using immunofluorescence microscopy. Consistent with

gastric zymogenic cells, pancreatic acinar cells also display an increase in lysosomes and

associated secretory vesicle disorganization (Fig. 5A). Upon closer examination, we observed

increased lysosomal structures in the Mist1−/− mice by high-magnification, single cell confocal

microscopy (Fig. 5B). By western blot we confirmed that in pancreatic acinar cells, Mist1−/−

mice showed dramatic increase in lysosomal markers, LAMP1 and CTSD (Fig. 5C). CTSD has

a distinctive pattern of degradation on western blot, which was increased in the absence of

MIST1 indicating increased global lysosomal activity. Finally, we found using the Mist1BT/Cre

mice that conditional knockout of MIST1, as in the stomach, induced rapid lysosomal

accumulation in the pancreas (Fig. 5D). Of note, the pattern of MIST1 loss (mosaic loss at one

week and complete acinar cell loss at two weeks post tamoxifen induced cre recombinase

excision) paralleled the results we found in the stomach. Thus, loss of MIST1 causes the same

increase in lysosomes in multiple exocrine secretory tissues, suggesting a shared mechanism of

MIST1 mediated lysosomal suppression.

Disruption of Lysosome Degradative Capacity Rescues Mist1-/- Secretory Vesicle Destruction

If MIST1 functions to suppress lysosomes in acinar secretory tissues to protect maturing

secretory vesicles, then if we disrupted lysosomal function in these cells we reasoned we should

206

see rescue of secretory vesicles from degradation (but not initial lysosome targeting), that would manifest as 1) an increase in vesicle size and 2) an increase in undegraded secretory vesicles inside lysosomes. Importantly, the degradative effects exist in concert with the secretory vesicle

formation defects previously reported in the absence of MIST1 (Capoccia et al., 2013; Direnzo et

al., 2012; Johnson et al., 2004; Pin et al., 2001; Ramsey et al., 2007), so we did not anticipate

complete restoration to WT levels of secretory vesicle appearance. We decided to investigate

mice with reduced lysosomal function due to genetic ablation of the α/β catalytic subunits of

GlcNAc-1-phosphotransferase (Gelfman et al., 2007). This enzyme is involved in the addition of mannose 6-phosphate moieties to lysosomal acid hydrolases, and in its absence, mice exhibit

reduced lysosomal function (Boonen et al., 2011; Vogel et al., 2009). Intriguingly, these Gnptab-

/- mice exhibit accumulation of undegraded vesicles at baseline, most predominantly in the

exocrine secretory cells (Boonen et al., 2011; Vogel et al., 2009).

Histologic examination showed that the basal zymogenic cell regions of Mist1-/-Gnptab-/-

gastric units exhibited an increase in eosin staining compared to WT or Mist1-/- (Fig. 6A),

suggesting increased intracellular vesicular membranes. Western blot examination of whole

stomach secretory vesicle components and markers of lysosomal function revealed that Mist1-/-

Gnptab-/- mice partially restored WT levels of secretory components (Fig. 6B). Accumulation of

LC3 (indicative of autolysosomes) and aberrant cathepsin D processing was observed consistent

with reported findings of lysosome and autolysosome abnormalities in Gnptab-/- mice. Partial

restoration to WT levels of secretory proteins in Mist1-/-Gnptab-/- mice would be expected as

MIST1 also coordinates secretory vesicle formation and maturation (Capoccia et al., 2013;

Direnzo et al., 2012; Johnson et al., 2004; Pin et al., 2001; Ramsey et al., 2007).

207

To tease out the effects of lysosomal inhibition on secretory vesicles, we used confocal

microscopy to examine multiple mice of each genotype (WT, Mist1−/−, Gnptab−/−, and

Mist1−/−Gnptab−/−) for PGC granules and LAMP1 lysosomes (Fig. 6C). Subsequently, we

analyzed each genotype for vesicle number, secretory vesicle area size, and engulfment by

LAMP1 marked membranes (Fig. 6C-E). For WT mice, as expected, we saw that the majority

(>58%) of secretory vesicles were large (1 µm or greater) with mean vesicle size of 1.17 µm, and

essentially no lysosomal interaction (< 1% of vesicles) (Fig. 6C-E). In Mist1−/− mice, in line

with our reported findings, we saw a shift of vesicle distribution to smaller sizes (>52% of vesicles were 0.1-0.3 µm) with mean vesicle size dropping to 0.34 µm and an increase in lysosome overlap (28% of vesicles) (Fig. 6C-E). Scaled up lysosomal attack on secretory vesicles was more apparent for the larger secretory vesicles such that only 20% of secretory vesicles smaller than 0.7 µm were engulfed by lysosomes, whereas 75% of secretory vesicles larger than 0.7 µm were targeted to lysosomes (Fig. 6C-E). Interestingly, Gnptab−/− mice alone

exhibited a subtle shift towards smaller secretory vesicles and reduction in mean vesicle size

(0.87 µm). Interactions with lysosomes increased to 15% compared to WT hinting at a possible

baseline interdependent relationship of secretory vesicles and lysosomes (Fig. 6C-E). The

lysosomal interactions in Gnptab−/− mice occurred with all sizes of secretory vesicles uniformly.

Finally, Mist1−/−Gnptab−/− mice displayed an upwards shift in vesicle size distribution (all

binned vesicle sizes above 0.3 µm showed proportional increase in number compared to

Mist1−/−) and increased mean vesicle size (0.44 µm) compared to Mist1−/− mice (Fig. 6C, D). A

dramatic increase in secretory vesicle-lysosome interaction also occurred in these mice with 59%

of secretory vesicles positioned inside lysosomes (Fig. 6E). In addition, the preferential overlap

of larger secretory vesicles with lysosomes seen in Mist1−/− mice was abrogated in

208

Mist1−/−Gnptab−/− mice (55% of vesicles smaller than 0.7 µm and 76% of vesicles larger than

0.7 µm were lysosome assocaited). These data suggest that in Mist1−/− all vesicles are targeted to lysosomes and degraded, especially larger vesicles. But small vesicles are more rapidly and efficiently degraded because of their size. Upon inhibition of lysosomal function, this entire process is slowed, and emergence of these smaller group of vesicles is apparent as evidenced by

increased lysosomal overlap and a size distribution shift for the small vesicles in the

Mist1−/−Gnptab−/− mice. These results were corroborated by staining for other markers of

secretory vesicles (gastric intrinsic factor) and lysosomes (cathepsin D) (Fig. S2A, S3A), and

examination of another exocrine secretory tissue (Fig. S2B, S3B). Taken together, our data show that MIST1 functions to suppress lysosomal accumulation and resulting degradative function in

maturing exocrine cells. Loss of MIST1 resulted in immediate and active degradation of

secretory vesicles. These vesicles are restored upon inhibition of lysosome function in the

Mist1−/−Gnptab−/− mice revealing the extent of Mist1−/− vesicle destruction.

Discussion

The idea that specific cellular organelles and/or subcellular pathways might be under

direct transcriptional control is not a novel concept (Nunnari and Walter, 1996); however only recently have clear examples been elucidated (Mills and Taghert, 2012). In fact, new advances have revealed elegant examples of this concept as applied to lysosomes. The basic helix-loop- helix (bHLH)-Zip transcription factor, TFEB, was demonstrated to control the expression of a network of lysosomal genes that augments lysosomal number and degradative function

(Sardiello et al., 2009). Elegantly, the same group showed that levels of TFEB, and thus degradative capacity, are directly regulated by extracellular nutrient signaling pathways

209

(Settembre et al., 2012). GATA1, an important hematopoietic transcription factor, has been

shown to induce several lysosomal genes and the degradative function of maturing erythroblasts

(Kang et al., 2012). In addition, the caudal-type homeo box transcription factor, CDX2, with

known roles in gut maturation (Verzi et al., 2011), induces lysosomal genes and trafficking

proteins to establish proper cell polarity (Gao and Kaestner, 2010). These examples highlight that all mature cells might need to strictly regulate autodegradative function. Regulation of

intracellular degradative pathways may be especially crucial during times of development when

cells engage in dramatic reorganizations of cellular architecture, and, conversely, it may be

critical for mature, long-lived cells to have mechanisms to suppress autodegradation.

For example, as exocrine secretory cells assemble into high-output secretory machines, it would be expected that they would need to strictly regulate cellular degradative processes. The transcription factor, MIST1, is a critical mediator of multiple, mostly exocrine, long-lived

secretory cell function (Capoccia et al., 2011; Lemercier et al., 1997; Pin et al., 2000). In all

tissues, those cells retain the ability to terminally differentiate even when MIST1 is lost.

However, MIST1-deficient cells exhibit a dramatic disorganization in secretory vesicle homeostasis, with markedly smaller secretory granules and decreased response to stimulated exocytosis. The secretory apparatus-regulating, scaling factor function of MIST1 is highly conserved evolutionarily. Loss of function experiments in Zebrafish (Guo et al., 2007) and gain

of function studies with the Drosophila ortholog of MIST1, DIMMED (Hamanaka et al., 2010;

Hewes et al., 2003; Park et al., 2011; Park et al., 2008), confirm MIST1/DIMM is sufficient and required to establish pro-secretory cell function across evolution. We and others have assumed that MIST1/DIMM would establish/maintain stores of secretory granules by regulating levels of targets directly involved in granule formation or trafficking (Capoccia et al., 2013; Johnson et al.,

210

2004; Rukstalis et al., 2003; Tian et al., 2010). Understandably, accumulation of degradative

vesicles in the pancreas and seminal vesicles of MIST1-deficient mice was previously attributed

as secondary to aberrant regulation of secretion (Pin et al., 2008; Pin et al., 2001).

Thus, our results here are unexpected and are the first to suggest that a key, if not the salient, way that MIST1 maintains secretory granules is by suppressing their destruction. That mechanism of MIST1 would explain at least two previous observations. Clearly, it suggests that the induction of degradation in Mist1−/− acinar cells (Pin et al., 2008; Pin et al., 2001) might be

directly due to aberrant lysosomal trafficking, rather than a secondary phenomenon. Also, it

would explain why transitional cells in Mist1−/− mice that are just beginning to emerge from

neck cell progenitors with Mist1 promoter expression show abundant, if not increased, stores of

normal-sized granules, in Mist1−/− mice relative to wildtype (Bredemeyer et al., 2009; Huh et al.,

2010; Ramsey et al., 2007). It is possible that MIST1 is not required solely for granule

formation, but rather functions in concert to also suppress the normal cellular autodegradative

attack on long-lived vesicles needed for mature granule maintenance (Fig. 7).

Whatever the teleological reason, there is clearly aberrant interaction between the

secretory and the degradative compartments in Mist1−/− mice. There are several possible

explanations why this occurs, based on our in vitro finding that RAB26 repositions lysosomes centrally. Interestingly, centralization of the degradative machinery has been recently found to augment secretory function and facilitate efficiency of secretion (Narita et al., 2011). Lack of

MIST1 and thus, RAB26, as a centralizing force, will by default move lysosomes further to the cell periphery, where their proximity with mature secretory vesicles would increase, resulting in direct degradation of the secretory granules by the process deemed crinophagy (Klionsky et al.,

2007; Marsh et al., 2007) or possibly by a microautophagic like process (Mijaljica et al., 2011;

211

Santambrogio and Cuervo, 2011). Similarly, MIST1, through RAB26, may inhibit direct

autophagosome targeting of zymogenic granules for ultimate autolysosome degradation, recently

termed zymophagy (Grasso et al., 2011) by separating the macroautophagy and lysosomal

machinery. Alternatively, lysosomal machinery may normally associate with secretory vesicles,

and RAB26 may be required for sorting lysosomal components from maturing secretory vesicles.

Multiple reports have shown that mechanistic defects or alterations in the normal maturation

process or trafficking of various vesicles or membrane-associated proteins will result in aberrant interaction of contents across vesicular compartments that are normally spatiotemporally separate (Arvan and Castle, 1998; Blott and Griffiths, 2002; Boonen et al., 2011; Hunziker and

Geuze, 1996; Kogel and Gerdes, 2010; Meister et al., 2010; Morvan and Tooze, 2008; Saftig and

Klumperman, 2009).

Furthermore, our work with RAB26 has also implicated its role in mitochondrial reorganization. These effects are also seen in vivo. In the absence of MIST1, both mitochondrial organization and mitochondria mediated calcium signaling were effected resulting in secretory defects (Luo et al., 2005). Because calcium signaling is intimately tied to the secretory pathway

(Rizzuto et al., 2012), the effects of MIST1 on secretory vesicles may be even more complex then suppression of lysosome degradation. The ultimate function of MIST1 may be to enhance some compartments (secretory pathway), shrink and sequester other parts (degradative lysosomes), and re-organize ancillary components to facilitate and maintain physiological operation (mitochondria mediating calcium flux).

It is unlikely that RAB26 is the sole direct target to facilitate the MIST1 mediated lysosomal effects. Other direct MIST1 targets may play complementary roles in these same

pathways. In fact, studies have found that the MIST1 target SPCA2 mediates calcium signaling

212

(Garside et al., 2010), and work from our lab has shown the MIST1 target MIB1 coordinates

digestive enzyme cargo accumulation in secretory vesicles – but not their size – via its effects on

endolysosomal trafficking (Capoccia et al., 2013). Additional, yet uncharacterized direct MIST1

targets may also be important. From our previous studies, we identified targets with potential

roles in vesicle maturation and trafficking, including ACP2 (a regulator of lysosome function),

CCPG1 (promotes CDC42 activation by regulating DBS), ARRDC3 (membrane protein with

known roles in cell proliferation), and FIGN (AAA protein involved in membrane fusion and

endosome sorting) (Tian et al., 2010). Clearly, MIST1 induces expression of multiple factors to

effect various vesicle, cytoskeletal, and organelle compartments through direct and indirect

interactions, all in order to facilitate and maintain the dynamic and highly organized secretion

apparatus.

In a differentiated exocrine cell, aside from protecting maturing secretory vesicles, what

other purpose does MIST1 mediated suppression of lysosomal function and localization serve?

Perhaps, MIST1 functions in mature cells to suppress the innate cellular defense mechanism that

cells mount against intracellular pathogens that hijack vesicles for latent infection (Levine et al.,

2011). In gastric epithelial cells, Helicobacter pylori, the pathogen linked to gastritis and

stomach cancer development has been postulated to persist within autophagic vesicles via its

VacA toxin (Raju et al., 2012; Terebiznik et al., 2009; Terebiznik et al., 2006); likely this occurs

through subversion of lysosome fusion. In the exocrine pancreas, acute pancreatitis involves

damaging auto activation of secretory enzymes (Gaiser et al., 2011). Lysosomal enzymes have been shown to activate zymogen constituents of secretory granules (Halangk et al., 2000; Saluja et al., 1997). Interestingly, loss of MIST1 and thus the lysosome suppression, results in increased susceptibility to pancreatitis (Alahari et al., 2011; Kowalik et al., 2007; Zhu et al.,

213

2004). Those examples demonstrate that precise control of lysosomal function should be critical for all acinar cells. The mechanism described here will likely be a component of a larger network of MIST1 regulated structural and organizational genes that influence additional aspects of acinar cell secretory function.

Materials and Methods

Mice

All experiments involving animals were performed according to protocols approved by the

Washington University School of Medicine Animal Studies Committee. Germ line Mist1−/− mice

(Pin et al., 2001) were maintained in a specific-pathogen-free barrier facility. Control mice were the littermates of Mist1−/− mice resulting from heterozygote-by-heterozygote crosses. Mist1BT/BT

mice (a kind gift from Dr. Stephen Konieczny) were generated via inserting an N-terminal BT tagged, C-terminal 6XHis-Myc tagged Mist1 and two loxP sites into the endogenous Mist1 locus.

Mist1CreERT mice were generated as previously described (Shi et al., 2009). Mist1BT/Cre mice were

generated by het crossing of Mist1BT/Cre mice generated from breeding Mist1BT/BT mice with

Mist1CreERT mice; mice at 8 weeks of age were given 5 consecutive daily intraperitoneal

injections of tamoxifen (1 mg/20 g BW; Sigma-Aldrich). Littermate Mist1BT/BT mice served as

the controls in these experiments. Gnptab−/− mice (a kind gift from Dr. Stuart Kornfeld) were

generated as described (Gelfman et al., 2007). Mist1−/−Gnptab−/− were generated from crossing

Mist1+/−Gnptab+/− mice. Other genotypes (Mist1+/+Gnptab+/+, Mist1−/−Gnptab+/+, and

Mist1+/+Gnptab−/−) served as littermate controls. Mist1+/+Gnptab+/+ and Mist1−/−Gnptab+/+

were phenotypically the same as WT and Mist1−/− mice, respectively.

214

Immunofluorescence / Imaging

Stomachs were prepared and stained as described previously (Ramsey et al., 2007). Briefly, stomachs were inflated with freshly prepared methacarn fixative and suspended in fixative for 15 to 30 min at room temperature or 10% formalin fixative for 12 hrs at 4C, followed by multiple rinses in 70% ethyl alcohol (EtOH), arrangement in 2% agar in a tissue cassette, and routine paraffin processing. Pancreases were dissecting and suspended in 10% formalin fixative for 12 hrs at 4C, followed by multiple rinses in 70% ethyl alcohol (EtOH), arrangement in 2% agar in a tissue cassette, and routine paraffin processing. Sections (5 µm) were deparaffinized and rehydrated, and antigen retrieval was performed by boiling in Trilogy (Cell Marque, Hot Springs,

AR) or 50 mM Tris-HCl, pH 9.0. Slides were blocked in 1% bovine serum albumin (BSA) and

0.3% Triton X-100 in phosphate-buffered saline (PBS) and then incubated in primary antibodies followed by secondary antibodies (see below). Slides were incubated for 5 min in 1 µg/ml bisbenzimide (Invitrogen, Carlsbad, CA) prior to mounting in Cytoseal XYL (Rishard-Allan

Scientific, Kalamazoo, MI).

Fluorescence microscopy and imaging were performed using a Zeiss Axiovert 200 microscope 20X (Plan-Apochromat, 0.8 NA), 40X (Plan-Neofluar 0.85 NA) and 63X objectives

(Plan-Apochromat, 1.4 NA) with Axiocam MRM camera and AxioVision software. Additional, confocal microscopy and imaging were performed using a Zeiss LSM510 META microscope with 40X (EC Plan-Neofluar, 0.75 NA) and 63X (Plan-Apochromat, 1.4 NA) objectives using

LSM510 software. Contrast (maximal, minimal, and midtone) adjustment and fluorescent channel overlay and pseudocoloring were performed with Photoshop (Adobe Systems, San Jose,

CA). All adjustments were performed on the entire image equally. Cartoon cell traces and illustrations were produced using Illustrator (Adobe Systems, San Jose, CA).

215

The primary antibodies used for mouse tissue immunostaining: rat anti-LAMP1 (1:250, clone 1D4B, developed by J. Thomas August and obtained from the Developmental Studies

Hybridoma Bank under the auspices of the NICHD maintained by The University of Iowa), mouse anti-β-Gal (1:500, Promega, Madison, WI), sheep anti-PGC (1:1000, Abcam, Cambridge,

MA), mouse anti-c-Myc (1:200, clone 9E 10, developed by J. Michael Bishop and obtained from the Developmental Studies Hybridoma Bank under the auspices of the NICHD maintained by

The University of Iowa), rabbit anti-amylase (1:100, Calbiochem, CA), rabbit (1:10,000) and

goat (1:2000) anti-human gastric intrinsic factor (gifts of Dr. David Alpers, Washington

University), rat anti-LAMP2 (1:40), rabbit anti-CTSD (1:200), and rabbit anti-CI-M6PR (1:500)

(gifts of Dr. Stuart Kornfeld, Washington University). Secondary antibodies used were Alexa

Fluor 488-, 594-, and 647-conjugated donkey anti-goat, anti-rabbit, anti-sheep, and anti-mouse antibodies (1:500; Invitrogen).

For immunohistochemical analyses, stomach sections were deparaffinized as stated above and subsequently immersed in 3% H2O2 to quench endogenous peroxidase activity. Antigen retrieval was performed as above. Avidin and biotin were applied consecutively to prevent endogenous biotin related background staining. Sections were incubated with 1:250 mouse anti-

LAMP1 (clone 1D4B) overnight followed by incubation for one hour with biotinylated goat anti-

mouse Abs (Santa Cruz). After rinsing (0.1% Tween-20), tissue sections were incubated with

horseradish peroxidase-conjugated streptavidin (Dako) for 20 minutes at room temperature.

Slides were washed (0.1% Tween-20), and the chromogen was developed for 5 minutes with

liquid 3,30-diaminobenzidine (DiNonA, Seoul, Korea) before counterstaining with Meyer’s

hematoxylin. After dehydration sections were mounted as described.

216

Immunofluorescence Quantification

Secretory vesicle quantification was performed on immunostained stomachs for PGC and

LAMP1 as prepared above. Images were analyzed in ImageJ as follows. PGC secretory vesicles were traced using circle tool and tracked using ROI manager. After all vesicles were traced,

individual areas were measured using the Analyze area measurement tool. Using ROI manager,

traced secretory vesicles were overlayed onto LAMP1 stained images and vesicle/LAMP1

overlap was noted for each of the traced vesicles. Three WT, Mist1−/−, Gnptab−/−, and five

Mist1−/−Gnptab−/− mice were analyzed.

Western Blot Analysis

Tissue was flash frozen in liquid nitrogen and homogenized in RIPA buffer using a PowerGen

700 (Fischer Scientific, Pittsburg, PA). Proteins were then separated on NuPAGE Bis-Tris gels

(Invitrogen), transferred to Immobilon polyvinylidene difluoride (Millipore, Bedford, MA) or

Amersham Hybond ECL nitrocellulose (GE Healthcare, Buckinghamshire, United Kingdom)

membranes, and detected by Immobilon chemiluminescence (Millipore, Billerica, MA). Primary

antibodies used were mouse anti-LAMP1 (1:1000, clone H4A3, developed by J. Thomas August

and James E. K. Hildreth and obtained from the Developmental Studies Hybridoma Bank under

the auspices of the NICHD maintained by The University of Iowa), rabbit anti-CTSD (1:2000, gift of Dr. Stuart Kornfeld, Washington University), sheep anti-Pepsinogen C (1:3000, Abcam), mouse anti-LC3 (1:1000, Cosmo Bio, Carlsbad, CA), and rabbit anti-Tubulin (1:2000, Cell

Signaling Technology, Beverly, MA). Secondary antibodies were horseradish peroxidase– conjugated donkey anti-rabbit, anti-rat and anti-mouse (Santa Cruz Biotechnology, Santa Cruz,

CA).

217

PGC and GIF Western blot intensity were quantified using ImageJ and normalized to

actin control band intensities.

Transmission Electron Microscopy

For transmission electron microscopy (TEM) studies, stomachs were fixed, sectioned, stained,

and imaged as described previously (Ramsey et al., 2007).

Graphing and Statistics

All graphs and statistics were determined with GraphPad Prism and then visualized using Adobe

Illustrator. Statistical analysis was, in the case of simple control-versus-experimental condition comparison, by Student’s t test. Otherwise, significances were determined by a one-way analysis of variance (ANOVA) test with Dunnett’s multiple-comparison correction.

ACKNOWLEDGEMENTS

The authors wish to thank Karen Green for EM, and Wandy Beatty and Dennis Oakley for confocal microscopy assistance. In addition, we would like to thank Marielle Boonen, Eline van Meel, and Stuart Kornfeld for sharing valuable antibodies and Gnptab-/- mice, and Stephen

Konieczny for providing Mist1BT/BT mice. We acknowledge the Advanced Imaging and Tissue

Analysis Core of the Washington University Digestive Disease Core Center (DDRCC) for

histologic slide processing.

This work was supported by grants to Jason C. Mills from the National Institutes of

Health (R01 DK-079798-01, DK094989, 2P30 DK052574-12) and the American Cancer Society

(DDC-115769).

218

REFERENCES

Alahari, S., Mehmood, R., Johnson, C. L. and Pin, C. L. (2011). The absence of MIST1 leads to increased ethanol sensitivity and decreased activity of the unfolded protein response in mouse pancreatic acinar cells. PLoS One 6, e28863. Arvan, P. and Castle, D. (1998). Sorting and storage during secretory granule biogenesis: looking backward and looking forward. Biochem J 332 ( Pt 3), 593-610. Blott, E. J. and Griffiths, G. M. (2002). Secretory lysosomes. Nat Rev Mol Cell Biol 3, 122-31. Boonen, M., van Meel, E., Oorschot, V., Klumperman, J. and Kornfeld, S. (2011). Vacuolization of mucolipidosis type II mouse exocrine gland cells represents accumulation of autolysosomes. Mol Biol Cell 22, 1135-47. Bredemeyer, A. J., Geahlen, J. H., Weis, V. G., Huh, W. J., Zinselmeyer, B. H., Srivatsan, S., Miller, M. J., Shaw, A. S. and Mills, J. C. (2009). The gastric epithelial progenitor cell niche and differentiation of the zymogenic (chief) cell lineage. Dev Biol 325, 211-24. Capoccia, B. J., Jin, R. U., Kong, Y. Y., Peek, R. M., Jr., Fassan, M., Rugge, M. and Mills, J. C. (2013). The ubiquitin ligase Mindbomb 1 coordinates gastrointestinal secretory cell maturation. J Clin Invest 123, 1475-91. Capoccia, B. J., Lennerz, J. K., Bredemeyer, A. J., Klco, J. M., Frater, J. L. and Mills, J. C. (2011). Transcription factor MIST1 in terminal differentiation of mouse and human plasma cells. Physiol Genomics 43, 174-86. Correa, P. (1992). Human gastric carcinogenesis: a multistep and multifactorial process--First American Cancer Society Award Lecture on Cancer Epidemiology and Prevention. Cancer Res 52, 6735-40. Direnzo, D., Hess, D. A., Damsz, B., Hallett, J. E., Marshall, B., Goswami, C., Liu, Y., Deering, T., Macdonald, R. J. and Konieczny, S. F. (2012). Induced Mist1 expression promotes remodeling of mouse pancreatic acinar cells. Gastroenterology 143, 469-80. Gaiser, S., Daniluk, J., Liu, Y., Tsou, L., Chu, J., Lee, W., Longnecker, D. S., Logsdon, C. D. and Ji, B. (2011). Intracellular activation of trypsinogen in transgenic mice induces acute but not chronic pancreatitis. Gut 60, 1379-88. Gao, N. and Kaestner, K. H. (2010). Cdx2 regulates endo-lysosomal function and epithelial cell polarity. Genes Dev 24, 1295-305. Garside, V. C., Kowalik, A. S., Johnson, C. L., DiRenzo, D., Konieczny, S. F. and Pin, C. L. (2010). MIST1 regulates the pancreatic acinar cell expression of Atp2c2, the gene encoding secretory pathway calcium ATPase 2. Exp Cell Res 316, 2859-70. Gelfman, C. M., Vogel, P., Issa, T. M., Turner, C. A., Lee, W. S., Kornfeld, S. and Rice, D. S. (2007). Mice lacking alpha/beta subunits of GlcNAc-1-phosphotransferase exhibit growth retardation, retinal degeneration, and secretory cell lesions. Invest Ophthalmol Vis Sci 48, 5221- 8. Grasso, D., Ropolo, A., Lo Re, A., Boggio, V., Molejon, M. I., Iovanna, J. L., Gonzalez, C. D., Urrutia, R. and Vaccaro, M. I. (2011). Zymophagy, a novel selective autophagy pathway mediated by VMP1-USP9x-p62, prevents pancreatic cell death. J Biol Chem 286, 8308-24. Guo, X., Cheng, L., Liu, Y., Fan, W. and Lu, D. (2007). Cloning, expression, and functional characterization of zebrafish Mist1. Biochem Biophys Res Commun 359, 20-6.

219

Halangk, W., Lerch, M. M., Brandt-Nedelev, B., Roth, W., Ruthenbuerger, M., Reinheckel, T., Domschke, W., Lippert, H., Peters, C. and Deussing, J. (2000). Role of cathepsin B in intracellular trypsinogen activation and the onset of acute pancreatitis. J Clin Invest 106, 773-81. Hamanaka, Y., Park, D., Yin, P., Annangudi, S. P., Edwards, T. N., Sweedler, J., Meinertzhagen, I. A. and Taghert, P. H. (2010). Transcriptional orchestration of the regulated secretory pathway in neurons by the bHLH protein DIMM. Curr Biol 20, 9-18. Hewes, R. S., Park, D., Gauthier, S. A., Schaefer, A. M. and Taghert, P. H. (2003). The bHLH protein Dimmed controls neuroendocrine cell differentiation in Drosophila. Development 130, 1771-81. Hezel, A. F., Kimmelman, A. C., Stanger, B. Z., Bardeesy, N. and Depinho, R. A. (2006). Genetics and biology of pancreatic ductal adenocarcinoma. Genes Dev 20, 1218-49. Huh, W. J., Esen, E., Geahlen, J. H., Bredemeyer, A. J., Lee, A. H., Shi, G., Konieczny, S. F., Glimcher, L. H. and Mills, J. C. (2010). XBP1 controls maturation of gastric zymogenic cells by induction of MIST1 and expansion of the rough endoplasmic reticulum. Gastroenterology 139, 2038-49. Huh, W. J., Khurana, S. S., Geahlen, J. H., Kohli, K., Waller, R. A. and Mills, J. C. (2012). Tamoxifen induces rapid, reversible atrophy, and metaplasia in mouse stomach. Gastroenterology 142, 21-24 e7. Hunziker, W. and Geuze, H. J. (1996). Intracellular trafficking of lysosomal membrane proteins. Bioessays 18, 379-89. Jia, D., Sun, Y. and Konieczny, S. F. (2008). Mist1 regulates pancreatic acinar cell proliferation through p21 CIP1/WAF1. Gastroenterology 135, 1687-97. Johnson, C. L., Kowalik, A. S., Rajakumar, N. and Pin, C. L. (2004). Mist1 is necessary for the establishment of granule organization in serous exocrine cells of the gastrointestinal tract. Mech Dev 121, 261-72. Kang, Y. A., Sanalkumar, R., O'Geen, H., Linnemann, A. K., Chang, C. J., Bouhassira, E. E., Farnham, P. J., Keles, S. and Bresnick, E. H. (2012). Autophagy driven by a master regulator of hematopoiesis. Mol Cell Biol 32, 226-39. Klionsky, D. J., Cuervo, A. M., Dunn, W. A., Jr., Levine, B., van der Klei, I. and Seglen, P. O. (2007). How shall I eat thee? Autophagy 3, 413-6. Kogel, T. and Gerdes, H. H. (2010). Maturation of secretory granules. Results Probl Cell Differ 50, 1-20. Kowalik, A. S., Johnson, C. L., Chadi, S. A., Weston, J. Y., Fazio, E. N. and Pin, C. L. (2007). Mice lacking the transcription factor Mist1 exhibit an altered stress response and increased sensitivity to caerulein-induced pancreatitis. Am J Physiol Gastrointest Liver Physiol 292, G1123-32. Kubin, T., Poling, J., Kostin, S., Gajawada, P., Hein, S., Rees, W., Wietelmann, A., Tanaka, M., Lorchner, H., Schimanski, S. et al. (2011). Oncostatin M is a major mediator of cardiomyocyte dedifferentiation and remodeling. Cell Stem Cell 9, 420-32. Lemercier, C., To, R. Q., Swanson, B. J., Lyons, G. E. and Konieczny, S. F. (1997). Mist1: a novel basic helix-loop-helix transcription factor exhibits a developmentally regulated expression pattern. Dev Biol 182, 101-13. Lennerz, J. K., Kim, S. H., Oates, E. L., Huh, W. J., Doherty, J. M., Tian, X., Bredemeyer, A. J., Goldenring, J. R., Lauwers, G. Y., Shin, Y. K. et al. (2010). The transcription factor MIST1 is a novel human gastric chief cell marker whose expression is lost in metaplasia, dysplasia, and carcinoma. Am J Pathol 177, 1514-33.

220

Levine, B., Mizushima, N. and Virgin, H. W. (2011). Autophagy in immunity and inflammation. Nature 469, 323-35. Luo, X., Shin, D. M., Wang, X., Konieczny, S. F. and Muallem, S. (2005). Aberrant localization of intracellular organelles, Ca2+ signaling, and exocytosis in Mist1 null mice. J Biol Chem 280, 12668-75. Marsh, B. J., Soden, C., Alarcon, C., Wicksteed, B. L., Yaekura, K., Costin, A. J., Morgan, G. P. and Rhodes, C. J. (2007). Regulated autophagy controls hormone content in secretory- deficient pancreatic endocrine beta-cells. Mol Endocrinol 21, 2255-69. Meister, T., Niehues, R., Hahn, D., Domschke, W., Sendler, M., Lerch, M. M. and Schnekenburger, J. (2010). Missorting of cathepsin B into the secretory compartment of CI- MPR/IGFII-deficient mice does not induce spontaneous trypsinogen activation but leads to enhanced trypsin activity during experimental pancreatitis--without affecting disease severity. J Physiol Pharmacol 61, 565-75. Mijaljica, D., Prescott, M. and Devenish, R. J. (2011). Microautophagy in mammalian cells: revisiting a 40-year-old conundrum. Autophagy 7, 673-82. Millar, A. L., Pavios, N. J., Xu, J. and Zheng, M. H. (2002). Rab3D: a regulator of exocytosis in non-neuronal cells. Histol Histopathol 17, 929-36. Mills, J. C. and Taghert, P. H. (2012). Scaling factors: transcription factors regulating subcellular domains. Bioessays 34, 10-6. Morvan, J. and Tooze, S. A. (2008). Discovery and progress in our understanding of the regulated secretory pathway in neuroendocrine cells. Histochem Cell Biol 129, 243-52. Nam, K. T., Lee, H. J., Sousa, J. F., Weis, V. G., O'Neal, R. L., Finke, P. E., Romero-Gallo, J., Shi, G., Mills, J. C., Peek, R. M., Jr. et al. (2010). Mature chief cells are cryptic progenitors for metaplasia in the stomach. Gastroenterology 139, 2028-2037 e9. Narita, M., Young, A. R., Arakawa, S., Samarajiwa, S. A., Nakashima, T., Yoshida, S., Hong, S., Berry, L. S., Reichelt, S., Ferreira, M. et al. (2011). Spatial coupling of mTOR and autophagy augments secretory phenotypes. Science 332, 966-70. Nashida, T., Imai, A. and Shimomura, H. (2006). Relation of Rab26 to the amylase release from rat parotid acinar cells. Arch Oral Biol 51, 89-95. Nozaki, K., Ogawa, M., Williams, J. A., Lafleur, B. J., Ng, V., Drapkin, R. I., Mills, J. C., Konieczny, S. F., Nomura, S. and Goldenring, J. R. (2008). A molecular signature of gastric metaplasia arising in response to acute parietal cell loss. Gastroenterology 134, 511-22. Nunnari, J. and Walter, P. (1996). Regulation of organelle biogenesis. Cell 84, 389-94. Park, D., Hadzic, T., Yin, P., Rusch, J., Abruzzi, K., Rosbash, M., Skeath, J. B., Panda, S., Sweedler, J. V. and Taghert, P. H. (2011). Molecular organization of Drosophila neuroendocrine cells by Dimmed. Curr Biol 21, 1515-24. Park, D., Shafer, O. T., Shepherd, S. P., Suh, H., Trigg, J. S. and Taghert, P. H. (2008). The Drosophila basic helix-loop-helix protein DIMMED directly activates PHM, a gene encoding a neuropeptide-amidating enzyme. Mol Cell Biol 28, 410-21. Pin, C. L., Bonvissuto, A. C. and Konieczny, S. F. (2000). Mist1 expression is a common link among serous exocrine cells exhibiting regulated exocytosis. Anat Rec 259, 157-67. Pin, C. L., Johnson, C. L., Rade, B., Kowalik, A. S., Garside, V. C. and Everest, M. E. (2008). Identification of a transcription factor, BHLHB8, involved in mouse seminal vesicle epithelium differentiation and function. Biol Reprod 78, 91-100.

221

Pin, C. L., Rukstalis, J. M., Johnson, C. and Konieczny, S. F. (2001). The bHLH transcription factor Mist1 is required to maintain exocrine pancreas cell organization and acinar cell identity. J Cell Biol 155, 519-30. Raju, D., Hussey, S., Ang, M., Terebiznik, M. R., Sibony, M., Galindo-Mata, E., Gupta, V., Blanke, S. R., Delgado, A., Romero-Gallo, J. et al. (2012). Vacuolating cytotoxin and variants in Atg16L1 that disrupt autophagy promote Helicobacter pylori infection in humans. Gastroenterology 142, 1160-71. Ramsey, V. G., Doherty, J. M., Chen, C. C., Stappenbeck, T. S., Konieczny, S. F. and Mills, J. C. (2007). The maturation of mucus-secreting gastric epithelial progenitors into digestive- enzyme secreting zymogenic cells requires Mist1. Development 134, 211-22. Rizzuto, R., De Stefani, D., Raffaello, A. and Mammucari, C. (2012). Mitochondria as sensors and regulators of calcium signalling. Nat Rev Mol Cell Biol 13, 566-78. Rukstalis, J. M., Kowalik, A., Zhu, L., Lidington, D., Pin, C. L. and Konieczny, S. F. (2003). Exocrine specific expression of Connexin32 is dependent on the basic helix-loop-helix transcription factor Mist1. J Cell Sci 116, 3315-25. Saftig, P. and Klumperman, J. (2009). Lysosome biogenesis and lysosomal membrane proteins: trafficking meets function. Nat Rev Mol Cell Biol 10, 623-35. Saluja, A. K., Donovan, E. A., Yamanaka, K., Yamaguchi, Y., Hofbauer, B. and Steer, M. L. (1997). Cerulein-induced in vitro activation of trypsinogen in rat pancreatic acini is mediated by cathepsin B. Gastroenterology 113, 304-10. Santambrogio, L. and Cuervo, A. M. (2011). Chasing the elusive mammalian microautophagy. Autophagy 7, 652-4. Sardiello, M., Palmieri, M., di Ronza, A., Medina, D. L., Valenza, M., Gennarino, V. A., Di Malta, C., Donaudy, F., Embrione, V., Polishchuk, R. S. et al. (2009). A gene network regulating lysosomal biogenesis and function. Science 325, 473-7. Schwitalla, S., Fingerle, A. A., Cammareri, P., Nebelsiek, T., Goktuna, S. I., Ziegler, P. K., Canli, O., Heijmans, J., Huels, D. J., Moreaux, G. et al. (2013). Intestinal tumorigenesis initiated by dedifferentiation and acquisition of stem-cell-like properties. Cell 152, 25-38. Settembre, C., Zoncu, R., Medina, D. L., Vetrini, F., Erdin, S., Erdin, S., Huynh, T., Ferron, M., Karsenty, G., Vellard, M. C. et al. (2012). A lysosome-to-nucleus signalling mechanism senses and regulates the lysosome via mTOR and TFEB. EMBO J 31, 1095-108. Shi, G., DiRenzo, D., Qu, C., Barney, D., Miley, D. and Konieczny, S. F. (2013). Maintenance of acinar cell organization is critical to preventing Kras-induced acinar-ductal metaplasia. Oncogene 32, 1950-8. Shi, G., Zhu, L., Sun, Y., Bettencourt, R., Damsz, B., Hruban, R. H. and Konieczny, S. F. (2009). Loss of the acinar-restricted transcription factor Mist1 accelerates Kras-induced pancreatic intraepithelial neoplasia. Gastroenterology 136, 1368-78. Takahashi, K. and Yamanaka, S. (2006). Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126, 663-76. Talchai, C., Xuan, S., Lin, H. V., Sussel, L. and Accili, D. (2012). Pancreatic beta cell dedifferentiation as a mechanism of diabetic beta cell failure. Cell 150, 1223-34. Terebiznik, M. R., Raju, D., Vazquez, C. L., Torbricki, K., Kulkarni, R., Blanke, S. R., Yoshimori, T., Colombo, M. I. and Jones, N. L. (2009). Effect of Helicobacter pylori's vacuolating cytotoxin on the autophagy pathway in gastric epithelial cells. Autophagy 5, 370-9.

222

Terebiznik, M. R., Vazquez, C. L., Torbicki, K., Banks, D., Wang, T., Hong, W., Blanke, S. R., Colombo, M. I. and Jones, N. L. (2006). Helicobacter pylori VacA toxin promotes bacterial intracellular survival in gastric epithelial cells. Infect Immun 74, 6599-614. Tian, X., Jin, R. U., Bredemeyer, A. J., Oates, E. J., Blazewska, K. M., McKenna, C. E. and Mills, J. C. (2010). RAB26 and RAB3D are direct transcriptional targets of MIST1 that regulate exocrine granule maturation. Mol Cell Biol 30, 1269-84. Verzi, M. P., Shin, H., Ho, L. L., Liu, X. S. and Shivdasani, R. A. (2011). Essential and redundant functions of caudal family proteins in activating adult intestinal genes. Mol Cell Biol 31, 2026-39. Vogel, P., Payne, B. J., Read, R., Lee, W. S., Gelfman, C. M. and Kornfeld, S. (2009). Comparative pathology of murine mucolipidosis types II and IIIC. Vet Pathol 46, 313-24. Yoshie, S., Imai, A., Nashida, T. and Shimomura, H. (2000). Expression, characterization, and localization of Rab26, a low molecular weight GTP-binding protein, in the rat parotid gland. Histochem Cell Biol 113, 259-63. Young, K. D. (2006). The selective value of bacterial shape. Microbiol Mol Biol Rev 70, 660- 703. Zhu, L., Tran, T., Rukstalis, J. M., Sun, P., Damsz, B. and Konieczny, S. F. (2004). Inhibition of Mist1 homodimer formation induces pancreatic acinar-to-ductal metaplasia. Mol Cell Biol 24, 2673-81.

223

Figure Legends

Figure 1. MIST1 is required for large secretory granule homeostasis. A. H&E micrographs

of representative gastric units (outlined in black) from WT and Mist1−/− mice with transmission

electron micrographs highlighting the basal zymogenic cell zones. Immunofluorescence staining

of WT and Mist1−/− gastric units with zymogenic cell secretory markers: B. pepsinogen C (PGC,

red) and C. gastric intrinsic factor (GIF, purple). Representative units are outlined in black and

parietal cells which do not express ZC secretory markers are shown in yellow. Western blots for

PGC and GIF levels between WT and Mist1−/− stomachs from triplicate experiments are shown

below with quantification of signal normalized to actin. (“*” – p <0.05, “**” – p <0.01, two-

tailed Student’s t-test). Scale bars = 20 µm unless indicated.

Figure 2. Gastric zymogenic cells show accumulation of lysosomes in the absence of

MIST1. A. Fluorescence microscopy of an outlined WT gastric unit showing only light,

perinuclear LAMP1-positivity (green) in ZCs (stained red for PGC and purple for GIF

expression) compared to the bright diffuse LAMP1 staining ZCs from a Mist1−/− gland. Yellow

tracing demarcates parietal cells which do not express MIST1 and do not change in LAMP1

staining between WT and Mist1−/− gastric glands, thus serving as internal controls for relative

immunofluorescence intensity. B. Immunohistochemistry for LAMP1 in WT and Mist1−/−

gastric glands. Two representative units highlighted in black and parietal cell staining control

outlined in yellow. Epiflourescence staining of WT and Mist1−/− gastric glands for additional

lysosomal markers: C. cathepsin D (CTSD, green) and D. LAMP2 (green) co-stained with GIF

(red). Glands are demarcated in white with parietal cells shown in yellow. Scale bars = 20 µm.

224

Figure 3. Mist1−/− ZCs display degraded secretory vesicles inside accumulating lysosomes.

A. Transmission electron micrograph of WT ZCs with large apical secretory vesicles and basally located nuclei. B. tEM of Mist1−/− ZCs with a reduction in large apical vesicles and an

increase in degrading secretory granules. Panels represent higher magnification of boxed regions

containing vesicles (arrows) in various states of degradation (later stages “*”). C. Confocal

sections of WT and Mist1−/− basal gastric units (outlined) stained for LAMP1 (green) and PGC

(red). D. Higher magnified region of Mist1−/− ZCs through multiple serial optical sections. “*”

indicates LAMP1 labeled lysosomal structures with various stages of degraded PGC entrapped.

Scale bars = 20 µm unless indicated.

Figure 4. Lysosomes accumulate rapidly in the absence of MIST1. A. In Mist1−/− mice,

which have a LacZ cassette inserted into the endogenous Mist1 locus, the transitional cells where

MIST1 should be expressed can be identified by nuclear β-galactosidase expression (red). Left

inset – Higher magnification of the boxed region with nuclei in blue. Note that staining for

LAMP1 (green) is absent in mucus precursor neck cells (NC, “*” marks their nuclei), becomes

stronger in the earliest transitional cells that begin to express the Mist1 promoter (arrows) and

continues to be strong in all mature ZC cells trying to express Mist1 (arrowheads). B. Confocal

images of Mist1BT/BT and Mist1BT/Cre mice (see Materials and Methods) treated with tamoxifen

after one or two weeks stained for LAMP1 (green) and PGC (red). Units are highlighted. C.

Quantification of confocal immunofluorescent microscopy gastric units shown in B. PGC

secretory vesicles were counted and areas measured, and percentage of vesicles with LAMP1

overlap was determined. Mean vesicle size is indicated in red. Scale bars = 20 µm.

225

Figure 5. Mist1−/− pancreatic acinar cells have lysosomal accumulations. A. Fluorescence microscopy of WT and Mist1−/− mice stained for amylase (red) and LAMP1 (green). Acini are outlined in white. B. Confocal image of a single Mist1−/− pancreatic acinar cell showing the large vesicular nature of the lysosomes (“*” in lumen of individual vesicles, “N” – nucleus). C.

Western blot analysis of two wildtype and two Mist1−/− mice showing protein levels of LAMP1, cathepsin D, and tubulin. D. Immunofluorescence of Mist1BT/BT and Mist1BT/Cre mice treated with tamoxifen after one or two weeks stained for LAMP1 (green) and c-Myc (purple). Acini are outlined in white. Scale bars = 20 µm.

Figure 6. Inhibition of lysosome degradation partially rescues Mist1−/− secretory vesicles.

A. H&E histology panel of WT, Mist1−/−, Gnptab−/−, and Mist1−/−Gnptab−/− gastric units

(labeled in black, parietal cells outlined in yellow). B. Western blots of multiple mice for each of the indicated genotypes (WT, Mist1−/−, Gnptab−/−, and Mist1−/−Gnptab−/−) probed for PGC,

LC3, cathepsin D, and tubulin. C. Confocal immunofluorescence images of WT, Mist1−/−,

Gnptab−/−, and Mist1−/−Gnptab−/− mouse stomachs stained for LAMP1 (green) and PGC (red).

Gastric units highlighted in white. For each genotype, multiple mice were stained, PGC containing secretory vesicles were counted and sizes measured, and PGC LAMP1 vesicle overlap was quantified (see Materials and Methods). Binned percentage of total secretory vesicles (red bars) for each binned size (from 0.1 to 1.0 and greater µm) is graphed below. For each red bar, proportion of those secretory vesicles engulfed by LAMP1 lysosomes is shown to the right (green bars). D. Graphed PGC vesicle areas and numbers for multiple WT, Mist1−/−,

Gnptab−/−, and Mist1−/−Gnptab−/−immunostained murine stomachs (Averaged vesicle size for

226

multiple mice for each genotype shown in red). E. Percentage of PGC vesicles enclosed in

LAMP1 lysosomes for multiple WT, Mist1−/−, Gnptab−/−, and Mist1−/−Gnptab−/− immunostained murine stomachs. Scale bars = 20 µm.

Figure 7. MIST1 induces direct targets to reorganize subcellular architecture. All WT ZCs

(left) initiate and maintain expression of MIST1. Subsequent expression of Rab26 and Rab3D

along with other yet unidentified MIST1 transcriptional targets (labeled “A” and “B”) is also

induced. RAB26 functions to maintain lysosomes in a basal perinuclear distribution and RAB3D

serves to mature secretory vesicles. This ensures proper segregation of the destructive basal

lysosomes from the maturing apical secretory vesicles. In the absence of MIST1 (right), and

thus no direct target induction, ZCs have lysosomes that are no longer maintained basally

coupled with a secretory vesicle formation defect. Together, this manifests as more aberrant

lysosomal-secretory vesicle interactions and overall smaller, more disorganized secretory

vesicles in the Mist1−/− ZCs.

227

Supplemental Figure Legends

Supplemental Figure 1. Conditional deletion of Mist1 results in lysosomal accumulation.

Immunofluorescence of a conditional Mist1 knockout model (See Materials and Methods)

stained for LAMP1 (green), PGC (red), and c-Myc (purple). A. Mist1BT/BT represents the control

condition, in two copies of an N-terminal BT tagged, C-terminal 6XHis-Myc tagged Mist1 and

two loxP sites were introduced via homologous recombination into the endogenous Mist1 locus.

Mist1BT/Cre mice were generated by crossing Mist1BT/BT with Mist1CreERT mice, the Mist1 loci in excised by 5 consecutive intraperitoneal injections of tamoxifen (1 mg/20 g BW; Sigma-

Aldrich), and phenotypes were examined at B. one and C. two weeks. Units expressing Mist1

detectable by c-Myc staining (purple) are outlined in white (present in all Mist1BT/BT stoamchs;

mosaic pattern of deletion in one week post tamoxifen injected Mist1BT/Cre mice) and parietal

cells are outlined in yellow. Scale bars = 20 µm.

Supplemental Figure 2. Inhibition of lysosome degradation partially rescues secretory

vesicles in Mist1−/− gastric ZCs and pancreatic acinar cells. A. Immunofluorescence images

of WT, Mist1−/−, Gnptab−/−, and Mist1−/−Gnptab−/− mouse stomachs stained for LAMP1 (green)

and PGC (red). Gastric units are outlined in white. B. Immunofluorescence images of WT,

Mist1−/−, Gnptab−/−, and Mist1−/−Gnptab−/− murine pancreases stained for amylase (red) and

LAMP1 (green). Acini are outlined in white. Scale bars = 20 µm.

Supplemental Figure 3. Other markers show partial rescue of secretory vesicles in Mist1−/−

gastric ZCs and pancreatic acinar cells. A. Immunofluorescence images of WT, Mist1−/−,

228

Gnptab−/−, and Mist1−/−Gnptab−/− mouse stomachs stained for cathepsin D (green), LAMP1

(red), and GIF (purple). Gastric units are outlined in white. B. Immunofluorescence images of

WT, Mist1−/−, Gnptab−/−, and Mist1−/−Gnptab−/− murine pancreases stained for cathepsin D

(green) and LAMP1 (red). Acini are outlined in white. Scale bars = 20 µm.

229

230

231

232

233

234

235

236

237

238

239

CHAPTER 6: Conclusions and Future Directions

240

As a whole, this work has focused on the role of MIST1 and its direct transcriptional

target RAB26 in zymogenic chief cells of the stomach. Chief cells are an ideal system to study

transcriptional regulation of subcellular organization because 1) they are organized spatio-

temporally within the stomach, 2) they have a well-structured secretory architecture, and 3)

establishment of their secretory function occurs rapidly from a relatively long-lived

developmental precursor. Using complementary in vivo mouse genetic approaches and in vitro

cell culture techniques, I have uncovered a MIST1 regulatory network that is crucial for

establishment and maintenance of secretory cell architecture in all exocrine tissues.

MIST1 Induces a Gene Network for Integrated Control of Secretion

In Chapter 2, I show that MIST1 directly induces the expression of 16 genes and that it

directly binds highly-conserved first intronic CATATG E-boxes in 6 of those genes. Focusing on two targets, RAB3D and RAB26, I show that they are expressed in gastric ZCs in the corpus of mouse stomach in a MIST1-dependent manner. To address the function of these two small protein GTPases, I developed a MIST1 dependent secretory vesicle formation system, in which gastric epithelial cells stably expressing MIST1 produce large ZC-like secretory granules upon transfection with RFP-tagged pepsinogen C (PGC). In contrast, control cell lines expressing

GFP lacked the ability to form large granules when given the same secretory load. Using this system, I confirm that expression levels of RAB26 and RAB3D were also specifically induced in

the MIST1 overexpressing cell lines. Finally, I show that formation of the large granules in these cells is dependent on MIST1-induced Rab activity. Granule formation is abrogated by disrupting

Rab prenylation and overexpression of dominant negative RAB26 mutant. These data show that

MIST1 activates a network of genes including RAB26 and RAB3D, to enact mature secretory

241

cell architecture, organize vesicle trafficking, and maintain production of large secretory

granules.

Future Directions

From the list of direct MIST1 targets, we only have yet explored the functions of two of

those genes. I chose these two genes, RAB3D and RAB26, because they stood out as

representing a possible mechanism by which MIST1, could regulate formation of exocrine

secretory granules in differentiating cells. Because these targets were generated from two gastric

cell lines, I wanted to confirm their in vivo relationship with MIST1 expression. To this end, I

performed laser capture microdissection (LCM) to isolate zymogenic cells (ZCs) and precursor neck cells (NCs) from nine WT and nine Mist1−/− mice (Capoccia et al., 2013). A pooled sample of RNA from four mice for each group (WT NC, WT ZC, KO NC, and KO ZC) was sent for gene expression profiling with Affymetrix Mouse Gene 1.0ST arrays. Upon analyses, I found

MIST1 dependent expression patterns, in which expression was preferentially restricted to WT

ZCs, for 8 of the 16 genes (Fig. 1A).

Among these in vivo MIST1 targets were two genes, CCPG1 and SERPINI1, for which we had previously shown direct MIST1 binding by chromatin immunoprecipitation and that they were induced in cell culture by MIST1 overexpression (Tian et al., 2010). In collaboration with

Dr. Xiaolin Tian, I confirmed these Genechip results using in situ hybridization to show specific expression of both CCPG1 and SERPINI in zymogenic cells from wildtype mice only (Fig. 1B).

Further support for these two targets includes immunofluorescence microscopy indicating protein expression patterns that match our gene expression and in situ hybridization results (Fig.

242

1C). These data indicate that CCPG1 and SERPINI1 are direct MIST1 targets that are expressed in mature zymogenic cells.

The published functions of both these genes warrant further study of their roles in zymogenic cell biology. In the only study of its function, CCPG1 was found to bind and regulate the activity of the RhoA and CDC42 guanine nucleotide exchange factor (Kostenko et al., 2006).

Rho GTPases are key regulators of the actin cytoskeleton (Hall, 1998), and may reveal a yet unstudied function of MIST1. The morphology of Mist1−/− zymogenic cells includes a disorganized and contracted apical cytoplasmic region resulting in luminal expansion

(Bredemeyer et al., 2009; Tian et al., 2010). CCPG1 may represent a mechanism by which

MIST1 controls the cytoskeletal rearrangements necessary to expand the apical cytoplasm.

SERPINI1 or NEUROSERPIN functions as a secreted serine proteinase inhibitor and regulator of cell adhesion whose role is has been extensively studied in the nervous system

(Kinghorn et al., 2006; Lee et al., 2008; Osterwalder et al., 1998). Mutations in SERPINI1 affecting conformational stability results in a familial form of dementia (Davis et al., 2002; Davis et al., 1999). These studies suggest the possibility of novel roles of MIST1 in the brain.

Unpublished work from our group and other studies (Luo et al., 2005) have shown MIST1 expression in the brain where it retains its ability to regulate secretory function. In addition, our collaborator, Dr. Paul Taghert, has comprehensively studied the role of DIMM, the Drosophila ortholog of MIST1, in the fly brain (Hamanaka et al., 2010; Hewes et al., 2003; Park et al., 2011;

Park et al., 2008a; Park and Taghert, 2009; Park et al., 2008b). On top of its well established neuronal function, SERPINI1 has recently been implicated to have tumor suppressive effects in gastric cancer (Yamanaka et al., 2012). Clearly, these data suggest that SERPINI1 may have an important physiological role in MIST1 expressing tissues including the stomach.

243

Additional work should examine CCPG1 and SERPINI1 using the tools that we have

already developed. The roles of these two proteins should be examined in secretory vesicle

formation using the MIST1-stably expressing PGC-RFP system. Overexpression and

knockdown experiments should reveal novel secretion effects. In addition, other subcellular

compartments should be examined including lysosomes and mitochondria. We can also apply

our AR42J differentiation system to these two MIST1 targets by using these polarized cells to

mimic in vivo development. This system will further confirm and reveal structural effects (e.g.,

actin cytoskeletal and cell-cell junctional defects) that might be induced by overexpression or

knockdown of these two targets. These functional experiments will augment our preliminary

data (Fig. 1) to assign functional roles to these two proteins; adding two more genes to our

network of MIST1 regulated genes. Ultimately, a murine model for CCPG1 deficiency should

be engineered, and the gastric phenotype for the SERPINI1 knockout mice (Gelderblom et al.,

2013) needs to examined to see if any component of the Mist1−/− phenotype is recapitulated.

An additional intriguing target that has been confirmed in our gastric cells and our in vivo

studies is Lysosomal Acid Phosphotase (ACP2). This enzyme is involved in lysosome

homeostasis with a role in dephosphorylation of M6P containing acid hydrolyases (Makrypidi et

al., 2012). Deficiency in mice leads to formation of lysosomal accumulations (characterized by enhanced LAMP1 and cathepsin D immunostaining) in many tissues (Mannan et al., 2004; Saftig et al., 1997).

Finally, the in vivo Genechip data might prove to more informative than our in vitro genechip results, specifically by providing us with a more physiologically relevant list of MIST1 targets (Capoccia et al., 2013). More work needs to be done with this data to analyze, refine, and

add to our current list of MIST1 regulated genes.

244

RAB26 Functions to Reorganize Lysosomes and Prune Mitochondria

In Chapter 3, I present work showing that RAB26 expression in tissues and cells depends on MIST1 induction. In contrast to previous studies, I show direct association of RAB26 not with secretory vesicles but with lysosomes. By immunofluorescent microscopy, both endogenous and EGFP-tagged RAB26 localize to a LAMP1 and cathepsin D positive lysosome compartment. These data were confirmed by immunoelectron microscopy, gradient density cell fractionation, and live imaging of vesicle dynamics. Furthermore, forced expression of RAB26, but not the GTP cycling null point mutants (T77N, Q123L), specifically repositions lysosomes from the cell periphery to a perinuclear central region. As a consequence of this RAB26 mediated lysosomal reorganization, I demonstrate by electron microscopy, immunofluorescence microscopy, and immunoblotting that mitochondria are concomitantly pruned and reorganized into distinct cellular neighborhoods. Taken together, our data establish a role for RAB26 as a novel lysosome-associated Rab whose expression is transcriptionally induced by MIST1 specifically in a subset of highly secretory tissues to reorganize the cellular distribution of lysosomes and, indirectly, mitochondria.

Future Directions

Many unanswered and interesting questions remain from this work involving RAB26 and the mechanistic details required for it to effect lysosome positioning, degradative function, and mitochondrial organization. Further characterization of Rab mechanistic function has usually meant assaying for additional Rab effectors. Preliminarily, I have observed that EGFP-RAB26 in transfected HGC-27 cells is trafficked along microtubules in a nocodazole-dependent manner

245

(Fig. 2A). This is consistent with the known mechanism of Rab mediated lysosome movement.

It has been shown that RAB7, RAB34, and RAB36 all function to reposition lysosomes upon

overexpression (Bucci et al., 2000; Chen et al., 2010; Wang and Hong, 2002). Interestingly, all

three of these Rab proteins interact with the same effector, RILP (RAB7 interacting lysosomal

protein) (Cantalupo et al., 2001; Colucci et al., 2005; Jordens et al., 2001; Wang and Hong,

2005). In fact, RILP has been well established in its ability to recruit the microtubule motor

protein, dynein, and induce trafficking of lysosomes towards the minus ends of microtubules

adjacent to the microtubule organizing center near the center of the cell. (Cantalupo et al., 2001;

Jordens et al., 2001). Thus, RILP is an intriguing Rab effector that might also regulate RAB26

mediated lysosome movement. In addition to this specific protein, other RAB26 effectors can be

assayed in unbiased screens including well-established yeast two-hybrid (Fukuda et al., 2008) or

mass spectroscopy (Seals et al., 2000) assays for protein-protein interactions. These screens will

be augmented by using the point mutants (T77N and Q123L) or non-hydrolyzable GTP analogs

(GTPγS or Gpp(NH)p) to elucidate nucleotide binding dependent effector interactions.

In addition to further RAB26 biochemical analyses, I propose to study the effects of

“scaling up” RAB26 on the degradative process of autophagy. Briefly, this pathway involves the

sequestration of proteins and organelles in a double membrane autophagosome for degradation

upon fusion with lysosomes (Klionsky and Emr, 2000). RAB7, a protein with homologous

function and localization as RAB26, has been found to be critical in the final fusion of

autophagosomes with lysosomes (Jager et al., 2004). I posit that RAB26 mediated repositioning of lysosomes might affect the degradative capacity of the cell through a similar mechanism. In fact, I have found that overexpression of RAB26 in HGC-27 cells causes a similar aggregation of autophagosome markers (LC3 and p62) (Fig. 2B, C). These aggregations of LC3 marked

246

vesicles remained upon induction of the pathway by rapamycin treatment (Fig. 2B) or serum

starvation. Immunofluorescence staining for p62 (a marker for autophagocytic flux) in these

rapamycin treated cells revealed less p62 in the EGFP-RAB26 overexpressing cells, suggesting that autophagocytic degradation is induced in these cells (Fig. 2B). I confirmed this finding using a mCherry-EGFP-LC3 plasmid in which fluor intensity indicates progression along this

degradative pathway. Specifically, both EGFP and mCherry mark the autophagosome, but upon

lysosome fusion, EGFP is degraded, and more stable mCherry remains. Co-transfection of this

plasmid with untagged-RAB26 (marked by increased RAB26 immunostaining) revealed that

cells overexpressing RAB26 clustered autophagosomes (red and green) along with lysosomes

(red) (Fig. 2C). These preliminary data suggest a role of RAB26 in regulating autophagy.

Additional studies would need to address if RAB26 overexpressing increases

autophagosome formation, trafficking, or fusion with lysosomes. Specifically, we can use well

established assays to measure levels of each of these steps (Klionsky et al., 2008a). It would also be interesting to address if RAB26 has the ability to function as a complement to RAB7 by knocking down RAB7 and assaying for rescue of degradative capacity upon restoration with

RAB26. Based on our previous findings with lysosomal function (Chapter 3), it would be

unlikely that reducing cellular levels of RAB26 would influence autophagy, but this would be

another avenue needing further study. Involvement in any of the steps in autophagy would be an

important finding, and would mean that autophagy as a process may be scaled up in secretory

cells in response to MIST1 induction.

How RAB26 prunes and reorganizes mitochondria is also an area that merits further

study. Two separate pathways have been found to mediate the actual delivery of mitochondria to

lysosomes (Ashrafi and Schwarz, 2013). Mitophagy is a subset of autophagy that involves

247

formation of isolation membranes around damaged mitochondria before subsequent delivery to,

fusion with, and degradation in lysosomes (Youle and Narendra, 2011). Cells may also use an autophagy independent route that involves direct vesicular transport of damaged mitochondria to lysosomes (Soubannier et al., 2012). Both pathways of lysosome mediated mitochondrial degradation can be induced pharmacologically (Jin and Youle, 2012; Soubannier et al., 2012).

Mitophagy can be induced by addition of the mitochondrial membrane uncoupler carbonyl cyanide m-chlorophenylhydrazone (CCCP) in cells that express the ubiquitin ligase, Parkin, which functions to mark damaged mitochondria for degradation (Narendra et al., 2008). Using

HGC-27 cells, which do not express much endogenous Parkin, I show that mitophagy is induced upon CCCP treatment and mCherry-Parkin transfection (Fig. 2D). This process is characterized by Parkin and LC3 (an autophagosome marker) recruitment to mitochondria and co-localization.

Upon addition of RAB26, I find that these Parkin positive structures (damaged mitochondria) become marked with RAB26 and LAMP1 vesicles (Fig. 2E). Recruitment of lysosomes to these damaged Parkin bound mitochondria was not affected by transfection of RAB26 point mutants

(Fig. 2E).

Conveniently, the autophagy-independent mitochondria degradation pathway is also inducible chemically (Soubannier et al., 2012). Glucose oxidase can stimulate direct vesicular interactions between lysosomes and the TOM20 mitochondrial membrane marker. Interestingly, this is the same mitochondrial marker that I used to monitor RAB26 induced mitochondrial reorganization (Chapter 3). In sum, I have provided preliminary data indicating that RAB26 is recruited to damaged mitochondrial through both autophagy (i.e., mitophagy) dependent and independent processes.

248

Using the tools that I have developed, specifically live cell imaging, it would be

interesting to visualize the timing and capacity of RAB26 recruitment to mitochondria upon

pharmacologic damage. At baseline, overexpressing RAB26 is already accelerating the pruning of mitochondria, it would also be important to quantify the effects of RAB26 overexpression in the setting of mitochondrial damage. Are damaged mitochondria more efficiently degraded upon

RAB26 transfection? Using confocal live imaging, I can measure the decrease in mitochondrial area as a function of time after addition of drug. I can then compare the effects on timing and reduction of mitochondrial area upon overexpressing RAB26 or the point mutants.

In addition, the contribution by both pathways can be teased out pharmacologically using drugs which can block autophagosome-lysosome fusion (bafilomycin A1,(Klionsky et al.,

2008b)) or inhibit lysosome proteolysis (leupeptin, (Haspel et al., 2011). I would look for

abrogation of RAB26 mediated baseline mitochondrial pruning (shown in Chapter 3) or

prevention of any additional RAB26 mediated effects upon damaging mitochondria by the

methods previously discussed. If treatment with bafilomycin does not inhibit baseline or

pharmacologic damage induced RAB26 mediated mitochondrial degradation, then this process

would be autophagy independent (i.e., RAB26 shuttles damaged mitochondria directly to

lysosomes without an autophagosome intermediate). Treatment with leupeptin should delay

mitochondrial degradation no matter the pathway they take to reach the lysosomes. In summary,

all proposed experiments would further elucidate the sufficiency and necessity of RAB26 in

lysosome mediated mitochondria degradation, and the exact vesicular trafficking pathways that

are involved.

The relationship between RAB26 and secretory vesicles remains to be fully investigated.

My initial characterization of RAB26 showed that the T77N point mutant inhibited formation of

249

large PGC-RFP secretory vesicles in MIST1 overexpressing cells (Tian et al., 2010). I assume

based on subsequent studies that this effect is an indirect one. In these cells, as in chief cells in

vivo, lysosomes must be moved and organized away from the secretory vesicles. MIST1- induced RAB26 mediated perinuclear lysosomal movement would shuttle lysosomes away from developing secretory vesicles. To prove this, I would use live imaging in this PGC-RFP

expressing secretory vesicle system to monitor lysosome-secretory vesicle interactions upon

transfection of RAB26 or any of its point mutants. Specifically, I would monitor for increased

lysosome-secretory vesicle interaction upon T77N or even Q123L overexpression. In addition,

the AR42J differentiation system would be an independent method to test the effects of RAB26

on secretion. These cells would be induced with dexamethasone treatment to induce expression

of MIST1 and RAB26, increase amylase secretory vesicles, and cluster their lysosomes. Using

siRNA knockdown or point mutant transfection, I would again assay by microscopy for increased lysosome-secretory vesicle interaction. This system would also be amenable to assays

for secretion by measurement of amylase in the media upon RAB26 overexpression or

knockdown either by siRNA or functionally through transfection with point mutants. The effects

of RAB26 on secretory vesicle maturation may be indirectly related to its ability to position

lysosomes.

Ultimately, a murine model of RAB26 deficiency and RAB26 overexpression should be

engineered. The former should recapitulate the lysosomal phenotype of Mist1−/− mice, and the

latter should rescue the lysosomal phenotype in the setting of MIST1 loss. Discouragingly,

murine Rab knockout models have been difficult to interpret. For example, when RAB3D,

another MIST1 target with well-established roles in secretory vesicle docking was overexpressed

in Mist1−/− mice, secretory vesicle disorganization was not rescued (Johnson et al., 2004). When

250

exocrine tissues were examined in RAB3D deficient mice, no secretion defect was found (Riedel

et al., 2002). As a result, results from in vivo genetic models of RAB26 deficiency or

overexpression should be carefully interpreted, because redundancy among Rabs might mask

loss of function effects.

MIST1 Suppresses Lysosome Mediated Degradation in Mature Exocrine Cells

In Chapter 4, I demonstrate that MIST1 regulates the exocrine secretory apparatus by

suppression of the degradative lysosomal machinery. Specifically, I show that, in addition to the

reduction in secretory vesicle size and general granule disorganization seen in Mist1−/− mice,

there is a dramatic increase in functional lysosomes. Normally in these exocrine secretory

tissues, lysosomes are small, diffuse, and organized away from larger maturing secretory

vesicles. But upon MIST1 loss, this degradative compartment expands apically engulfing and

degrading many of the forming vesicles. In collaboration with Greg Sibbel, I assayed the timing

of this lysosome accumulation using an inducible mouse model of MIST1 loss. We found that

lysosomes accumulate rapidly upon loss of MIST1 in all exocrine tissues. I confirm the

functionality of these increasing lysosomes and the severity of secretory vesicle degradation by

crossing Gnptab−/− mice with Mist1−/− mice. Because these Gnptab−/− mice exhibit impaired acid hydrolase trafficking and reduced lysosomal capacity, we were able to partially rescue the secretory destruction in Mist1−/− mice as measured by increased vesicle size and undegraded

secretory vesicle content inside lysosomes. In other words, we were able to rescue subsequent

destruction of the vesicles once inside lysosomes but did not effect on the aberrant targeting of

vesicles to lysosomes. These data demonstrate the effects of MIST1 on other vesicular

compartments and hint at the role of RAB26 in exocrine cells to effectively move and organize

251

lysosomes. In cells that lack MIST1, and have nominal levels of RAB26, lysosomes are

ineffectively trafficked away from secretory vesicles causing promiscuous interactions between

the two compartments.

Future Directions

These proposed experiments would shed light as to the exact pathway secretory vesicles

take to reach lysosomes in the absence of MIST1 in vivo. Previous work from our lab has shown

that in the absence of MIST1, as precursor mucous secreting neck cells differentiate into

zymogenic chief cells, there is a transient increase of secretory vesicles (Ramsey et al., 2007).

These “transition cells” express both precursor neck cell and mature zymogenic cell markers,

and, in wildtype mice, would be increasing expression of MIST1 and its gene targets. Because

MIST1 is not expressed, lysosomal degradation is not suppressed, and subsequent secretory

vesicles show fewer secretory vesicles by immunofluorescence microscopy compared to these

Mist1−/− “transition cells”. Interestingly, I have found that in WT mice, most mature secretory vesicles are marked with markers of autophagosomes (Fig. 3A). However, in contrast, in the absence of MIST1, only these “transition cells” with their transient increase in secretory vesicles exhibit the same staining for LC3 and p62 autophagosome markers (Fig. 3A, B). Once lysosomes are increased in Mist1−/− mice, these markers along with secretory vesicle proteins are

all decreased as visualized by immunostaining (Fig. 3B). Therefore, this data suggest that at

baseline mature secretory vesicles are tagged and poised to be degraded by lysosomes. It is only

MIST1 suppression of the degradative compartment that prevents this process. So, when MIST1

is lost, these vesicles that are formed and tagged at the transition (arrowheads, Fig. 3B) become

readily degraded as shown in Chapter 4.

252

Why would mature zymogenic cells maintain their secretory vesicles in a state of high- alert, ready to be immediately destroyed? I suggest that the answer lies in the evolutionary

relationship between pathogen and host. Helicobacter pylori is the main constituent of the

gastric microbiome (Fox and Sheh, 2013). Recent studies have revealed that people with defects

in the degradative pathway increases susceptibility to H. pylori infection (Raju et al., 2012). In

fact, intracellular survival has been found to be an important part of the pathogenesis of this

bacterium (Deen et al., 2013; Terebiznik et al., 2009). H. pylori intracellular survival is

dependent on entry into these autophagosomes and prevention of subsequent lysosome fusion by

vacuolating toxin binding and sequestration of RAB7 (Terebiznik et al., 2006). As a whole,

these studies indicate that the careful balance between formation of secretory vesicles and their

degradation to prevent H. pylori infection is an important task for mature secretory cells in the

stomach.

To test the involvement of autophagy in the degradation of secretory vesicles in Mist1−/−

mice, I propose to use a mouse model in which autophagy can be conditionally downregulated.

Using the well characterized Atg7flox/flox mice, in which the autophagy essential Atg7 gene is

deleted under the control of Cre recombinase (Komatsu et al., 2005), I propose to turn off

autophagy in exocrine cells and in all cells using Mist1CreERT2 and CAGGCreERTM, respectively.

Preliminary results show that Atg7 is deleted by message and protein levels in the stomach by

induction with CAGGCreERTM (Fig. 3C). Interesting in these whole mouse inducible ATG7

knockouts, by immunofluorescence microscopy, we see aggregation of undegraded LC3 and p62

(consistent with previous reports (Riley et al., 2010)) preferentially in the exocrine secretory

cells of the stomach (Fig. 3D, E) and the pancreas (Fig. 3F). Crossing these MIST1 expressing

cell specific and whole mouse ATG7 knockouts to Mist1−/− mice and then assaying for the

253 effects on secretory vesicle degradation through established assays (Chapter 4) will reveal the effects and necessity of autophagy in lysosome mediated secretory vesicle destruction. If in the absence of MIST1 and the ATG7, secretory granules are rescued from degradation, specifically no longer targeted to lysosomes, this would prove that autophagy is indeed the intermediate pathway by which secretory vesicles are targeted to lysosomes. Further exploration of autophagy in MIST1 regulated secretory vesicle maintenance will have critical importance for our cell biological and microbiological understanding of zymogenic chief cells.

Loss of MIST1 Induces Lysosome Mediated Downscaling During Gastric Metaplasia

In Chapter 1, I highlighted the zymogenic cell lineage and its involvement in many of the critical diseases that affect the stomach. Specifically, these post mitotic mature secretory cells have been shown to possess the ability in response to tissue damage to dedifferentiate, become metaplastic (Goldenring et al., 2011; Nam et al., 2010), and regain stem cell-like properties

(Stange et al., 2013). Thus, understanding the process by which these cells initiate this dedifferentiation program may be critical to furthering our knowledge of gastric carcinogenesis.

Future Directions

MIST1 and the maintenance of secretory architecture may be a key factor in preventing these cells from this metaplastic transformation. In fact, this may be a theme for all exocrine tissues including the pancreas. Specifically, loss of MIST1 has been found to directly render gastric chief and pancreatic acinar cells susceptible to injury, metaplasia, and carcinogenesis

(Alahari et al., 2011; Kowalik et al., 2007; Lennerz et al., 2010; Nam et al., 2010; Nozaki et al.,

2008; Shi et al., 2013; Shi et al., 2009). Studies using a pharmacologic (high dose tamoxifen)

254

inducible model of gastric atrophy and metaplasia show that MIST1 is one of the first factors that

is lost as mature zymogenic cells respond to injury (Huh et al., 2012). Additional studies in the

pancreas using an inducible MIST1 knockout model revealed that within hours of MIST1 loss,

mature pancreatic acinar cells began to remodel their granules, cytoskeleton, and cellular

junctions (Direnzo et al., 2012).

In the stomach, I have found that concomitant with early MIST1 loss upon high dose

tamoxifen induced injury, LAMP1 stained lysosomes significantly increased. This increase in

lysosomes is accompanied by loss of mature PGC secretory vesicles and re-expression of

mucous neck cell markers (GSII) (Fig. 4A). By higher magnification confocal microscopy, I

observed increasing lysosome and secretory vesicle interactions until 24 hours post tamoxifen

injury (Fig. 4B). These degradation events were restricted to mature native PGC secretory

vesicles and excluded newly formed metaplastic GSII-marked mucous vesicles. After 24 hours,

the majority of zymogenic cells had turned over all their PGC vesicles, replaced with GSII

vesicles. These data show that MIST1 loss and LAMP1 mediated lysosomal attack on secretory vesicles occur as early events during gastric tissue injury response, prior to and independent from synthesis of neck cell mucous granules.

These animal data are supported by observations made in human gastric biopsy samples containing regions of normal stomach adjacent to metaplastic areas. In the normal areas, large

PGC secretory vesicles are preserved apically and lysosomes are small and diffusely distributed basally, consistent with our mouse model (Fig. 4D). However, in these areas of metaplasia characterized, as in our murine model, by metaplastic re-expression of precursor markers (GSII) and associated decrease in mature PGC vesicles, we find aberrant lysosome-secretory vesicle interactions (Fig. 4E). These lysosome mediated degradation events only occur for the PGC

255

vesicle population; the newly forming metaplastic mucous granules are excluded from this

destruction.

Based on these findings, this process of lysosome mediated vesicle attack during injury

response warrants further characterization. First, other injury models of murine gastric metaplasia (elicited by Helicobacter species (Nomura et al., 2004), other pharmacologic agents

(Goldenring et al., 2000), or genetically (Li et al., 1996; Nomura et al., 2005)) should be examined to confirm this lysosome mediated attack on secretory vesicles is a universal feature of early gastric metaplasia. Next, as with the increase in lysosomes seen in our Mist1−/− mice, the

role of autophagy should be investigated by looking for co-localization of autophagy markers

with secretory vesicles in these early time points after injury induction.

All findings should be related to pancreatic metaplasia models (Habbe et al., 2008; Shi et al., 2013) to establish lysosome downscaling of mature secretory cell architecture as a common first step during injury response in MIST1 expressing tissues. Encouragingly, in the exocrine pancreas, acute pancreatitis (an injury state preceeding metaplasia and carcinogenesis (Hezel et al., 2006)) often involves damaging auto activation of secretory enzymes (Gaiser et al., 2011).

Studies have shown that this process involves fusion of lysosomes and activation of secretory zymogens by lysosomal hydrolases (Halangk et al., 2000; Saluja et al., 1997).

After these experiments that characterize the process, I propose a series of functional

experiments to address the requirement of MIST1 and upregulation of degradation in the

metaplastic response of zymogenic chief cells. The former will be addressed by using an

inducible model of MIST1 overexpression (Direnzo et al., 2012). Pharmacologic provocation of

gastric metaplasia will be studied in the setting of continued MIST1 overexpression through Cre

recombinase excision of a Lox-STOP-Lox cassette allowing constitutive CAG promoter driven

256

expression of MIST1. These experiments will assay the requirement of MIST1 loss during

gastric metaplasia. In other words, if loss of MIST1 is needed for the metaplastic

dedifferentiation of zymogenic cells, then these constitutive MIST1 expressing mice will retain

morphologically normal chief cells upon gastric injury.

In addition, the mechanistic requirement for lysosomal degradation of secretory vesicles

will also be addressed. Metaplasia will be induced in mice defective in lysosomal hydrolases,

the Gnptab−/− mice, and ability of mature zymogenic cells to degrade mature PGC vesicles and

form mucous precursor granules will be tracked. Complementary experiments exploring the role

of autophagy in this process are also possible using ATG7fl/fl mice as described or additional

well-established genetic models of autophagy inhibition (Hara et al., 2006; Ichimura and

Komatsu, 2011).

Ultimately, the role RAB26 in this process should also be addressed. As previously mentioned, a murine model of RAB26 overexpression must first be constructed. With this tool in hand, metaplasia can be induced in gastric zymogenic cells overexpressing RAB26 and the lysosomal degradation of secretory vesicles can be examined. If RAB26 is the critical MIST1 target whose maintained expression is needed to suppress lysosome-secretory vesicle interactions, then these mice should exhibit increased PGC vesicles and resiliency against metaplasia. In summary, these proposed experiments will explore the physiologic role of

MIST1, RAB26, and degradative cell architectural reorganization.

Final Remarks

The goal of this thesis was to determine the direct transcriptional targets of the exocrine cell specific transcription factor, MIST1. From this process, I found and focused on a specific

257

MIST1 target, RAB26, and elucidated its novel role in lysosome movement and mitochondrial reorganization. These findings led me to uncover the function of MIST1 in suppression of lysosome mediated degradation of mature secretory vesicles in exocrine cells. As a whole, this work demonstrates the importance of basic transcriptional factor controlled gene networks in the establishment of cellular form and function. I hope these findings will elucidate a physiologic correlate in and uncover a previously unrecognized feature of gastric pathologies.

258

References Alahari, S., Mehmood, R., Johnson, C. L. and Pin, C. L. (2011). The absence of MIST1 leads to increased ethanol sensitivity and decreased activity of the unfolded protein response in mouse pancreatic acinar cells. PLoS One 6, e28863. Ashrafi, G. and Schwarz, T. L. (2013). The pathways of mitophagy for quality control and clearance of mitochondria. Cell Death Differ 20, 31-42. Bredemeyer, A. J., Geahlen, J. H., Weis, V. G., Huh, W. J., Zinselmeyer, B. H., Srivatsan, S., Miller, M. J., Shaw, A. S. and Mills, J. C. (2009). The gastric epithelial progenitor cell niche and differentiation of the zymogenic (chief) cell lineage. Dev Biol 325, 211-24. Bucci, C., Thomsen, P., Nicoziani, P., McCarthy, J. and van Deurs, B. (2000). Rab7: a key to lysosome biogenesis. Mol Biol Cell 11, 467-80. Cantalupo, G., Alifano, P., Roberti, V., Bruni, C. B. and Bucci, C. (2001). Rab-interacting lysosomal protein (RILP): the Rab7 effector required for transport to lysosomes. EMBO J 20, 683-93. Capoccia, B. J., Jin, R. U., Kong, Y. Y., Peek, R. M., Jr., Fassan, M., Rugge, M. and Mills, J. C. (2013). The ubiquitin ligase Mindbomb 1 coordinates gastrointestinal secretory cell maturation. J Clin Invest 123, 1475-91. Chen, L., Hu, J., Yun, Y. and Wang, T. (2010). Rab36 regulates the spatial distribution of late endosomes and lysosomes through a similar mechanism to Rab34. Mol Membr Biol 27, 24-31. Colucci, A. M., Campana, M. C., Bellopede, M. and Bucci, C. (2005). The Rab-interacting lysosomal protein, a Rab7 and Rab34 effector, is capable of self-interaction. Biochem Biophys Res Commun 334, 128-33. Davis, R. L., Shrimpton, A. E., Carrell, R. W., Lomas, D. A., Gerhard, L., Baumann, B., Lawrence, D. A., Yepes, M., Kim, T. S., Ghetti, B. et al. (2002). Association between conformational mutations in neuroserpin and onset and severity of dementia. Lancet 359, 2242- 7. Davis, R. L., Shrimpton, A. E., Holohan, P. D., Bradshaw, C., Feiglin, D., Collins, G. H., Sonderegger, P., Kinter, J., Becker, L. M., Lacbawan, F. et al. (1999). Familial dementia caused by polymerization of mutant neuroserpin. Nature 401, 376-9. Deen, N. S., Huang, S. J., Gong, L., Kwok, T. and Devenish, R. J. (2013). The impact of autophagic processes on the intracellular fate of Helicobacter pylori: more tricks from an enigmatic pathogen? Autophagy 9, 639-52. Direnzo, D., Hess, D. A., Damsz, B., Hallett, J. E., Marshall, B., Goswami, C., Liu, Y., Deering, T., Macdonald, R. J. and Konieczny, S. F. (2012). Induced Mist1 expression promotes remodeling of mouse pancreatic acinar cells. Gastroenterology 143, 469-80. Fox, J. and Sheh, A. (2013). The role of the gastrointestinal microbiome in Helicobacter pylori pathogenesis. Gut Microbes 4. Fukuda, M., Kanno, E., Ishibashi, K. and Itoh, T. (2008). Large scale screening for novel rab effectors reveals unexpected broad Rab binding specificity. Mol Cell Proteomics 7, 1031-42. Gaiser, S., Daniluk, J., Liu, Y., Tsou, L., Chu, J., Lee, W., Longnecker, D. S., Logsdon, C. D. and Ji, B. (2011). Intracellular activation of trypsinogen in transgenic mice induces acute but not chronic pancreatitis. Gut 60, 1379-88. Gelderblom, M., Neumann, M., Ludewig, P., Bernreuther, C., Krasemann, S., Arunachalam, P., Gerloff, C., Glatzel, M. and Magnus, T. (2013). Deficiency in serine protease inhibitor neuroserpin exacerbates ischemic brain injury by increased postischemic inflammation. PLoS One 8, e63118.

259

Goldenring, J. R., Nam, K. T. and Mills, J. C. (2011). The origin of pre-neoplastic metaplasia in the stomach: chief cells emerge from the Mist. Exp Cell Res 317, 2759-64. Goldenring, J. R., Ray, G. S., Coffey, R. J., Meunier, P. C., Haley, P. J., Barnes, T. B. and Car, B. D. (2000). Reversible drug-induced oxyntic atrophy in rats. Gastroenterology 118, 1080- 93. Habbe, N., Shi, G., Meguid, R. A., Fendrich, V., Esni, F., Chen, H., Feldmann, G., Stoffers, D. A., Konieczny, S. F., Leach, S. D. et al. (2008). Spontaneous induction of murine pancreatic intraepithelial neoplasia (mPanIN) by acinar cell targeting of oncogenic Kras in adult mice. Proc Natl Acad Sci U S A 105, 18913-8. Halangk, W., Lerch, M. M., Brandt-Nedelev, B., Roth, W., Ruthenbuerger, M., Reinheckel, T., Domschke, W., Lippert, H., Peters, C. and Deussing, J. (2000). Role of cathepsin B in intracellular trypsinogen activation and the onset of acute pancreatitis. J Clin Invest 106, 773-81. Hall, A. (1998). Rho GTPases and the actin cytoskeleton. Science 279, 509-14. Hamanaka, Y., Park, D., Yin, P., Annangudi, S. P., Edwards, T. N., Sweedler, J., Meinertzhagen, I. A. and Taghert, P. H. (2010). Transcriptional orchestration of the regulated secretory pathway in neurons by the bHLH protein DIMM. Curr Biol 20, 9-18. Hara, T., Nakamura, K., Matsui, M., Yamamoto, A., Nakahara, Y., Suzuki-Migishima, R., Yokoyama, M., Mishima, K., Saito, I., Okano, H. et al. (2006). Suppression of basal autophagy in neural cells causes neurodegenerative disease in mice. Nature 441, 885-9. Haspel, J., Shaik, R. S., Ifedigbo, E., Nakahira, K., Dolinay, T., Englert, J. A. and Choi, A. M. (2011). Characterization of macroautophagic flux in vivo using a leupeptin-based assay. Autophagy 7, 629-42. Hewes, R. S., Park, D., Gauthier, S. A., Schaefer, A. M. and Taghert, P. H. (2003). The bHLH protein Dimmed controls neuroendocrine cell differentiation in Drosophila. Development 130, 1771-81. Hezel, A. F., Kimmelman, A. C., Stanger, B. Z., Bardeesy, N. and Depinho, R. A. (2006). Genetics and biology of pancreatic ductal adenocarcinoma. Genes Dev 20, 1218-49. Huh, W. J., Khurana, S. S., Geahlen, J. H., Kohli, K., Waller, R. A. and Mills, J. C. (2012). Tamoxifen induces rapid, reversible atrophy, and metaplasia in mouse stomach. Gastroenterology 142, 21-24 e7. Ichimura, Y. and Komatsu, M. (2011). Pathophysiological role of autophagy: lesson from autophagy-deficient mouse models. Exp Anim 60, 329-45. Jager, S., Bucci, C., Tanida, I., Ueno, T., Kominami, E., Saftig, P. and Eskelinen, E. L. (2004). Role for Rab7 in maturation of late autophagic vacuoles. J Cell Sci 117, 4837-48. Jin, S. M. and Youle, R. J. (2012). PINK1- and Parkin-mediated mitophagy at a glance. J Cell Sci 125, 795-9. Johnson, C. L., Kowalik, A. S., Rajakumar, N. and Pin, C. L. (2004). Mist1 is necessary for the establishment of granule organization in serous exocrine cells of the gastrointestinal tract. Mech Dev 121, 261-72. Jordens, I., Fernandez-Borja, M., Marsman, M., Dusseljee, S., Janssen, L., Calafat, J., Janssen, H., Wubbolts, R. and Neefjes, J. (2001). The Rab7 effector protein RILP controls lysosomal transport by inducing the recruitment of dynein-dynactin motors. Curr Biol 11, 1680- 5. Kinghorn, K. J., Crowther, D. C., Sharp, L. K., Nerelius, C., Davis, R. L., Chang, H. T., Green, C., Gubb, D. C., Johansson, J. and Lomas, D. A. (2006). Neuroserpin binds Abeta and

260

is a neuroprotective component of amyloid plaques in Alzheimer disease. J Biol Chem 281, 29268-77. Klionsky, D. J. Abeliovich, H. Agostinis, P. Agrawal, D. K. Aliev, G. Askew, D. S. Baba, M. Baehrecke, E. H. Bahr, B. A. Ballabio, A. et al. (2008a). Guidelines for the use and interpretation of assays for monitoring autophagy in higher eukaryotes. Autophagy 4, 151-75. Klionsky, D. J., Elazar, Z., Seglen, P. O. and Rubinsztein, D. C. (2008b). Does bafilomycin A1 block the fusion of autophagosomes with lysosomes? Autophagy 4, 849-950. Klionsky, D. J. and Emr, S. D. (2000). Autophagy as a regulated pathway of cellular degradation. Science 290, 1717-21. Komatsu, M., Waguri, S., Ueno, T., Iwata, J., Murata, S., Tanida, I., Ezaki, J., Mizushima, N., Ohsumi, Y., Uchiyama, Y. et al. (2005). Impairment of starvation-induced and constitutive autophagy in Atg7-deficient mice. J Cell Biol 169, 425-34. Kostenko, E. V., Olabisi, O. O., Sahay, S., Rodriguez, P. L. and Whitehead, I. P. (2006). Ccpg1, a novel scaffold protein that regulates the activity of the Rho guanine nucleotide exchange factor Dbs. Mol Cell Biol 26, 8964-75. Kowalik, A. S., Johnson, C. L., Chadi, S. A., Weston, J. Y., Fazio, E. N. and Pin, C. L. (2007). Mice lacking the transcription factor Mist1 exhibit an altered stress response and increased sensitivity to caerulein-induced pancreatitis. Am J Physiol Gastrointest Liver Physiol 292, G1123-32. Lee, T. W., Coates, L. C. and Birch, N. P. (2008). Neuroserpin regulates N-cadherin-mediated cell adhesion independently of its activity as an inhibitor of tissue plasminogen activator. J Neurosci Res 86, 1243-53. Lennerz, J. K., Kim, S. H., Oates, E. L., Huh, W. J., Doherty, J. M., Tian, X., Bredemeyer, A. J., Goldenring, J. R., Lauwers, G. Y., Shin, Y. K. et al. (2010). The transcription factor MIST1 is a novel human gastric chief cell marker whose expression is lost in metaplasia, dysplasia, and carcinoma. Am J Pathol 177, 1514-33. Li, Q., Karam, S. M. and Gordon, J. I. (1996). Diphtheria toxin-mediated ablation of parietal cells in the stomach of transgenic mice. J Biol Chem 271, 3671-6. Luo, X., Shin, D. M., Wang, X., Konieczny, S. F. and Muallem, S. (2005). Aberrant localization of intracellular organelles, Ca2+ signaling, and exocytosis in Mist1 null mice. J Biol Chem 280, 12668-75. Makrypidi, G., Damme, M., Muller-Loennies, S., Trusch, M., Schmidt, B., Schluter, H., Heeren, J., Lubke, T., Saftig, P. and Braulke, T. (2012). Mannose 6 dephosphorylation of lysosomal proteins mediated by acid phosphatases Acp2 and Acp5. Mol Cell Biol 32, 774-82. Mannan, A. U., Roussa, E., Kraus, C., Rickmann, M., Maenner, J., Nayernia, K., Krieglstein, K., Reis, A. and Engel, W. (2004). Mutation in the gene encoding lysosomal acid phosphatase (Acp2) causes cerebellum and skin malformation in mouse. Neurogenetics 5, 229- 38. Nam, K. T., Lee, H. J., Sousa, J. F., Weis, V. G., O'Neal, R. L., Finke, P. E., Romero-Gallo, J., Shi, G., Mills, J. C., Peek, R. M., Jr. et al. (2010). Mature chief cells are cryptic progenitors for metaplasia in the stomach. Gastroenterology 139, 2028-2037 e9. Narendra, D., Tanaka, A., Suen, D. F. and Youle, R. J. (2008). Parkin is recruited selectively to impaired mitochondria and promotes their autophagy. J Cell Biol 183, 795-803. Nomura, S., Baxter, T., Yamaguchi, H., Leys, C., Vartapetian, A. B., Fox, J. G., Lee, J. R., Wang, T. C. and Goldenring, J. R. (2004). Spasmolytic polypeptide expressing metaplasia to preneoplasia in H. felis-infected mice. Gastroenterology 127, 582-94.

261

Nomura, S., Yamaguchi, H., Ogawa, M., Wang, T. C., Lee, J. R. and Goldenring, J. R. (2005). Alterations in gastric mucosal lineages induced by acute oxyntic atrophy in wild-type and gastrin-deficient mice. Am J Physiol Gastrointest Liver Physiol 288, G362-75. Nozaki, K., Ogawa, M., Williams, J. A., Lafleur, B. J., Ng, V., Drapkin, R. I., Mills, J. C., Konieczny, S. F., Nomura, S. and Goldenring, J. R. (2008). A molecular signature of gastric metaplasia arising in response to acute parietal cell loss. Gastroenterology 134, 511-22. Osterwalder, T., Cinelli, P., Baici, A., Pennella, A., Krueger, S. R., Schrimpf, S. P., Meins, M. and Sonderegger, P. (1998). The axonally secreted serine proteinase inhibitor, neuroserpin, inhibits plasminogen activators and plasmin but not thrombin. J Biol Chem 273, 2312-21. Park, D., Hadzic, T., Yin, P., Rusch, J., Abruzzi, K., Rosbash, M., Skeath, J. B., Panda, S., Sweedler, J. V. and Taghert, P. H. (2011). Molecular organization of Drosophila neuroendocrine cells by Dimmed. Curr Biol 21, 1515-24. Park, D., Shafer, O. T., Shepherd, S. P., Suh, H., Trigg, J. S. and Taghert, P. H. (2008a). The Drosophila basic helix-loop-helix protein DIMMED directly activates PHM, a gene encoding a neuropeptide-amidating enzyme. Mol Cell Biol 28, 410-21. Park, D. and Taghert, P. H. (2009). Peptidergic neurosecretory cells in insects: organization and control by the bHLH protein DIMMED. Gen Comp Endocrinol 162, 2-7. Park, D., Veenstra, J. A., Park, J. H. and Taghert, P. H. (2008b). Mapping peptidergic cells in Drosophila: where DIMM fits in. PLoS One 3, e1896. Raju, D., Hussey, S., Ang, M., Terebiznik, M. R., Sibony, M., Galindo-Mata, E., Gupta, V., Blanke, S. R., Delgado, A., Romero-Gallo, J. et al. (2012). Vacuolating cytotoxin and variants in Atg16L1 that disrupt autophagy promote Helicobacter pylori infection in humans. Gastroenterology 142, 1160-71. Ramsey, V. G., Doherty, J. M., Chen, C. C., Stappenbeck, T. S., Konieczny, S. F. and Mills, J. C. (2007). The maturation of mucus-secreting gastric epithelial progenitors into digestive- enzyme secreting zymogenic cells requires Mist1. Development 134, 211-22. Riedel, D., Antonin, W., Fernandez-Chacon, R., Alvarez de Toledo, G., Jo, T., Geppert, M., Valentijn, J. A., Valentijn, K., Jamieson, J. D., Sudhof, T. C. et al. (2002). Rab3D is not required for exocrine exocytosis but for maintenance of normally sized secretory granules. Mol Cell Biol 22, 6487-97. Riley, B. E., Kaiser, S. E., Shaler, T. A., Ng, A. C., Hara, T., Hipp, M. S., Lage, K., Xavier, R. J., Ryu, K. Y., Taguchi, K. et al. (2010). Ubiquitin accumulation in autophagy-deficient mice is dependent on the Nrf2-mediated stress response pathway: a potential role for protein aggregation in autophagic substrate selection. J Cell Biol 191, 537-52. Saftig, P., Hartmann, D., Lullmann-Rauch, R., Wolff, J., Evers, M., Koster, A., Hetman, M., von Figura, K. and Peters, C. (1997). Mice deficient in lysosomal acid phosphatase develop lysosomal storage in the kidney and central nervous system. J Biol Chem 272, 18628-35. Saluja, A. K., Donovan, E. A., Yamanaka, K., Yamaguchi, Y., Hofbauer, B. and Steer, M. L. (1997). Cerulein-induced in vitro activation of trypsinogen in rat pancreatic acini is mediated by cathepsin B. Gastroenterology 113, 304-10. Seals, D. F., Eitzen, G., Margolis, N., Wickner, W. T. and Price, A. (2000). A Ypt/Rab effector complex containing the Sec1 homolog Vps33p is required for homotypic vacuole fusion. Proc Natl Acad Sci U S A 97, 9402-7. Shi, G., DiRenzo, D., Qu, C., Barney, D., Miley, D. and Konieczny, S. F. (2013). Maintenance of acinar cell organization is critical to preventing Kras-induced acinar-ductal metaplasia. Oncogene 32, 1950-8.

262

Shi, G., Zhu, L., Sun, Y., Bettencourt, R., Damsz, B., Hruban, R. H. and Konieczny, S. F. (2009). Loss of the acinar-restricted transcription factor Mist1 accelerates Kras-induced pancreatic intraepithelial neoplasia. Gastroenterology 136, 1368-78. Soubannier, V., McLelland, G. L., Zunino, R., Braschi, E., Rippstein, P., Fon, E. A. and McBride, H. M. (2012). A vesicular transport pathway shuttles cargo from mitochondria to lysosomes. Curr Biol 22, 135-41. Stange, D. E., Koo, B. K., Huch, M., Sibbel, G., Basak, O., Lyubimova, A., Kujala, P., Bartfeld, S., Koster, J., Geahlen, J. H. et al. (2013). Differentiated Troy Chief Cells Act as Reserve Stem Cells to Generate All Lineages of the Stomach Epithelium. Cell 155, 357-368. Terebiznik, M. R., Raju, D., Vazquez, C. L., Torbricki, K., Kulkarni, R., Blanke, S. R., Yoshimori, T., Colombo, M. I. and Jones, N. L. (2009). Effect of Helicobacter pylori's vacuolating cytotoxin on the autophagy pathway in gastric epithelial cells. Autophagy 5, 370-9. Terebiznik, M. R., Vazquez, C. L., Torbicki, K., Banks, D., Wang, T., Hong, W., Blanke, S. R., Colombo, M. I. and Jones, N. L. (2006). Helicobacter pylori VacA toxin promotes bacterial intracellular survival in gastric epithelial cells. Infect Immun 74, 6599-614. Tian, X., Jin, R. U., Bredemeyer, A. J., Oates, E. J., Blazewska, K. M., McKenna, C. E. and Mills, J. C. (2010). RAB26 and RAB3D are direct transcriptional targets of MIST1 that regulate exocrine granule maturation. Mol Cell Biol 30, 1269-84. Wang, T. and Hong, W. (2002). Interorganellar regulation of lysosome positioning by the Golgi apparatus through Rab34 interaction with Rab-interacting lysosomal protein. Mol Biol Cell 13, 4317-32. Wang, T. and Hong, W. (2005). Assay and functional properties of Rab34 interaction with RILP in lysosome morphogenesis. Methods Enzymol 403, 675-87. Yamanaka, S., Olaru, A. V., An, F., Luvsanjav, D., Jin, Z., Agarwal, R., Tomuleasa, C., Popescu, I., Alexandrescu, S., Dima, S. et al. (2012). MicroRNA-21 inhibits Serpini1, a gene with novel tumour suppressive effects in gastric cancer. Dig Liver Dis 44, 589-96. Youle, R. J. and Narendra, D. P. (2011). Mechanisms of mitophagy. Nat Rev Mol Cell Biol 12, 9-14.

263

Figure Legends

Figure 1. The expression of CCPG1 and SERPINI1 is MIST1 dependent. A. Microarray analysis from isolated populations of gastric ZCs and their precursor neck cells from wild-type and Mist1−/− mice. MIST1 expression is shown atop as a positive control validation of the microarray data. Expression of previously identified MIST1 targets from gastric cell lines are indicated and separated into groups exhibiting a MIST1 dependent pattern or a MIST1 independent pattern. Two of these MIST1 dependent targets, CCPG1 and SERPINI1 are highlighted in red. Gene expression for microarray analyses are shown with relative expression scale (-3.0 to 3.0) with red=high, blue=low expression. B. In situ hybridization of mouse fundic gastric gland sections showing antisense CCPG1 and SERPINI1 signal confined to the ZCs at the base of the glands in wild-type mice, and lack of staining in Mist1−/− mice. C.

Immunofluorescence microscopy of wild-type and Mist1−/− mice stained for CCPG1 and

SERPINI1 protein expression (green). Lysosomes (LAMP1, red) and secretory vesicles (GIF, purple) are also shown. Insets contain high magnification confocal images of CCPG1 and

SERPINI vesicle staining in basal zymogenic cells. Gastric units are outlined in white and scale bars = 20 µm.

Figure 2. RAB26 traffics along microtubules and co-localizes with autophagy and mitophagy markers. A. Live confocal timelapse microscopy of EGFP-RAB26 vesicles after treatment with 10 µg/mL of nocodazole. Three panels indicate images taken at one minute intervals with arrowheads indicating the static nature of previously motile RAB26 vesicles post treatment. B. Epifluorescence of HGC-27 cells transfected with EGFP-RAB26 (green) and

264

stained for LC3 (red) and p62 (purple) after 6 hour treatment with 10 µm rapamycin to induce

autophagy. C. Immunofluorescence staining of HGC-27 cells co-transfected with mCherry-

EGFP-LC3B (red and green) and RAB26 without GFP tag (pcDNA3.1-RAB26) stained with anti-RAB26 (purple). D. mCherry-Parkin (red) transfected HGC-27 cells stained for LC3

(green) upon 1 hour treatment with carbonyl cyanide m-chlorophenylhydrazone (+CCCP). E.

Fluorescence microscopy of CCCP treated EGFP-RAB26, EGFP-RAB26T77N, EGFP-

RAB26Q123L, and EGFP HGC-27 cells (green) co-transfected with mCherry-Parkin (red) stained for LAMP1 (purple). Scale bars = 20 µm.

Figure 3. Autophagocytic vesicles mark secretory vesicles and accumulate upon deletion of

Atg7. A. Fluorescence microscopy of outlined WT and Mist1−/− gastric units showing LC3

(green) and p62 (red) staining in ZCs (stained purple for PGC expression). Arrowheads

indicated higher expression levels of LC3, p62, and PGC in the transitional cells of Mist1−/−

gastric units. Parietal cells are shown in yellow. B. Immunofluorescence staining of a Mist1−/−

gastric unit showing LAMP1 (green), LC3 (red), and GIF (purple) staining. Arrowheads

indicated higher expression levels of LC3 and GIF in the Mist1−/− transitional cells before

expansion of the LAMP1 lysosome compartment. C. Western blot and PCR analysis of the

knockdown of ATG7 protein and mRNA for CAGGCreERTM+ATG7fl/fl (+) and CAGGCreERTM-

ATGfl/fl (-) mice after tamoxifen induction. D. Immunofluorescence microscopy of gastric units

from CAGGCreERTM-ATG7fl/fl (-) and CAGGCreERTM+ATG7fl/fl (+) mice 2 weeks after tamoxifen

induction stained for LC3 (green), p62 (red), and GIF (purple). E. Inset shows confocal image

of GIF (purple) stained basal zymogenic cells of CAGGCreERTM+ATG7fl/fl tamoxifen induced

mice with arrows highlighting LC3 (green) and p62 (red) aggregations. F. Immunofluorescence

265

and confocal microscopy of pancreatic acini from CAGGCreERTM-ATG7fl/fl (-) and

CAGGCreERTM+ATG7fl/fl (+) mice 2 weeks after tamoxifen induction stained for LC3 (green) and

p62 (red). Arrows show LC3 (green) and p62 (red) aggregations. Gastric units and pancreatic

acini are outlined in white and scale bars = 20 µm.

Figure 4. Lysosome mediated secretory vesicle destruction is an early event during gastric

metaplasia. A. Gastric units from untreated (control) mice and mice 12 and 24 hours post

tamoxifen induced metaplasia showing immunofluorescence staining of LAMP1 (green), GIF

(red), and the mucous neck cell marker (GSII, purple). Gastric units are outlined in white.

Higher magnification confocal microscopy of basal zymogenic cells B. 12 hours and C. 24 hours

post tamoxifen treatment stained for LAMP1 (green), GIF (red), and GSII (purple). Arrows

indicate GIF stained secretory vesicles inside LAMP1 labeled lysosomes. D.

Immunofluorescence imaging of human gastric cancer biopsy samples immunostained for

LAMP1 (green), PGC (red), and GSII (purple). Normal and adjacent metaplastic regions are

outlined. E. Confocal sections (basal to apical) of a metaplastic zymogenic cell stained for

LAMP (green), PGC (red), and GSII (purple). GSII vesicular regions devoid of LAMP1 overlap

indicated (‘*’).

266

267

268

269

270

Ramon Jin, MSTP Washington University School of Medicine

15 N. Boyle Ave. Email: [email protected] St Louis, MO 63108 Phone: 216-544-2529

EDUCATION Washington University School of Medicine St. Louis, MO M.D. / Ph.D. (expected graduation date: 2015) 08/06-present

Case Western Reserve University Cleveland, OH Summa cum laude, B.S. 08/02-05/06 Major: Biology

HONORS AND AWARDS Travel Award 04/2012 ASCI/AAP/APSA Annual Meeting

Viktor Hamburger Award 06/2011 Department of Developmental Biology Washington University School of Medicine

Travel Award 08/2009 FASEB Summer Research Conference: Gastrointestinal Tract XII: The Molecular and Integrative Basis for GI Development, Homeostasis and Disease

Trustees’ Scholarship Award 2002-2006 Case Western Reserve University

Case Alumni Association Junior/Senior Scholarship 2005-2006 Case Western Reserve University

PUBLICATIONS Jin R. U., Sibbel G., Konieczny S. F., Kornfeld S., Mills J.C. (2015). MIST1 facilitates secretory vesicle maturation by regulation of lysosomal trafficking in exocrine secretory cells. Manuscript in preparation.

Jin R. U. and Mills J.C. (2014). RAB26 Coordinates Lysosome Traffic and Mitochondrial Localization. J Cell Sci. 127(5):1018-32.

Jin R. U. and Mills J.C. (2014). Chapter 5: Congenital and Acquired Diseases of the Stomach. In Translational Gastroenterology, from Development to Disease, edited by Deborah L. Gumucio, Linda C. Samuelson, Jason R. Spence, 57-72.

271

Capoccia B. J., Jin R.U., Kong Y.Y., Peek R.M., Jr., Fassan M., Rugge M., Mills J.C. (2013). The ubiquitin ligase Mindbomb 1 coordinates gastrointestinal secretory cell maturation. J Clin Invest. 123(4):1475-91.

Yin Y., Lin C., Kim S.T., Roig I., Chen H., Liu L., Veith G.M., Jin R.U., Keeney S., Jasin M., Moley K., Zhou P., Ma L. (2011). The E3 ubiquitin ligase Cullin 4A regulates meiotic progression in mouse spermatogenesis. Dev Biol. 356(1):51-62.

Tian X.*, Jin R.U.*, Bredemeyer A.J., Oates E.J., Blazewska K.M., McKenna C.E., Mills J.C. (2010). RAB26 and RAB3D are direct transcriptional targets of MIST1 that regulate exocrine granule maturation. Mol Cell Biol. 30(5):1269-84. *co-first author

Jin R. U., Hodges C.A., Drumm M.L., Palmert M.R. (2005). The cystic fibrosis transmembrane conductance regulator (Cftr) modulates the timing of puberty in mice. The Journal of Medical Genetics. 43(6):e29.

POSTERS AND PRESENTATIONS “RAB26, a Direct Transcriptional Target of MIST1, is a Novel Steamboat Springs, CO Regulator of Lysosome Positioning” 08/2011 FASEB Summer Research Conference entitled: Gastrointestinal Tract XIV: Stem Cells, Adaptation, Inflammation and Cancer

“RAB26 is required for formation of large exocrine secretory vesicles New London, NH and is sufficient to reposition lysosomes” 07/2010 Gordon Research Conferences entitled: Proprotein Processing, Trafficking & Secretion

“RAB26, a direct transcriptional target of MIST1, is required for formation Snowmass, CO Of large exocrine secretory vesicles” 08/2009 FASEB Summer Research Conference entitled: Gastrointestinal Tract XII: The Molecular and Integrative Basis for GI Development, Homeostasis and Disease

“The cystic fibrosis transmembrane conductance regulator (Cftr) San Diego, CA modulates the timing of puberty in mice” 06/2005 The Endocrine Society’s 87th Annual International Meeting

LEADERSHIP/TEACHING/MENTORING EXPERIENCE Representative, MSTP Student Committee St. Louis, MO Washington University School of Medicine 10/10-present

Research Mentor, Lydia Espinoza, Summer Research Student St. Louis, MO Opportunities in Genomics Research Undergraduate Scholars Program 06/10-08/10 The Genome Institute, Washington University School of Medicine

Research Mentor, Xavier Jirau, Summer Research Student St. Louis, MO Opportunities in Genomics Research Undergraduate Scholars Program 06/09-08/09 The Genome Institute, Washington University School of Medicine 272

Teaching Assistant, Cell and Organ Systems Biology Histology St. Louis, MO Washington University School of Medicine 08/08-04/09

RESEARCH EXPERIENCE Jason Mills Lab, Washington University School of Medicine St. Louis, MO Graduate Student 07/08 - Present The role of MIST1 in zymogenic (chief) cell secretory maturation

Anthony Muslin Lab, Washington University School of Medicine St. Louis, MO Rotational Student 06/07-08/07 Cellular localization of AKT1/2 upon Insulin and IGF stimulation

Paul Hruz Lab, Washington University School of Medicine St. Louis, MO Rotational Student 06/06-08/06 Metabolic disturbances associated with antiretroviral therapy

Mark Palmert and Mitchell Drumm Labs, Case Western Reserve University Cleveland, OH Undergraduate Research Student 2002-2006 The role of CFTR in modulating the timing of puberty

273