DOCSLIB.ORG

Natural Killer (NK) Cell–Mediated Cytotoxicity: Differential Use of TRAIL and Fas Ligand by Immature and Mature Primary Human

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Natural Killer (NK) Cell–Mediated Cytotoxicity: Differential Use of TRAIL and Fas Ligand by Immature and Mature Primary Human Brief Definitive Report Natural Killer (NK) Cell–mediated Cytotoxicity: Differential Use of TRAIL and Fas Ligand by Immature and Mature Primary Human NK Cells By Loris Zamai, Manzoor Ahmad, Ian M. Bennett, Livio Azzoni, Emad S. Alnemri, and Bice Perussia From the Jefferson Medical College, Department of Microbiology and Immunology, Kimmel Cancer Institute, Philadelphia, Pennsylvania 19107 Summary Mature natural killer (NK) cells use Ca21-dependent granule exocytosis and release of cyto- toxic proteins, Fas ligand (FasL), and membrane-bound or secreted cytokines (tumor necrosis factor [TNF]-a) to induce target cell death. Fas belongs to the TNF receptor family of mole- cules, containing a conserved intracytoplasmic “death domain” that indirectly activates the caspase enzymatic cascade and ultimately apoptotic mechanisms in numerous cell types. Two additional members of this family, DR4 and DR5, transduce apoptotic signals upon binding soluble TNF-related apoptosis-inducing ligand (TRAIL) that, like FasL, belongs to the grow- ing TNF family of molecules. Here, we report that TRAIL produced or expressed by different populations of primary human NK cells is functional, and represents a marker of differentiation or activation of these, and possibly other, cytotoxic leukocytes. During differentiation NK cells, sequentially and differentially, use distinct members of the TNF family or granule exocy- tosis to mediate target cell death. Phenotypically immature CD1611/CD562 NK cells mediate TRAIL-dependent but not FasL- or granule release–dependent cytotoxicity, whereas mature CD561 NK cells mediate the latter two. Key words: natural killer cells • differentiation • cytotoxicity • TRAIL • Fas ligand ytotoxic T lymphocytes (CTLs) and NK cells use a but anchored to the membrane via glycosyl phosphatidyl- Ccombination of several mechanisms to lyse different inositol and lacking intracellular domain and apoptosis- target cells. These include (a) Ca21-dependent granule inducing capability (14), has been suggested to function as a exocytosis and release of cytotoxic proteins (perforin and decoy receptor, protecting normal cells against TRAIL- granzymes) from intracytoplasmic granules; (b) FasL, con- induced apoptosis. stitutively expressed or induced upon interaction with tar- Engagement of the TCR/CD3 complex on T cells in- get cells and inducing Ca21-independent, Fas (CD95/Apo duces increased functional expression of FasL (15). Al- 1)-mediated apoptosis; and (c) membrane-bound or se- though most CD41 T cell–mediated cytotoxicity is Fas/ creted cytokines (TNF-a) (1–5; for a review, see reference FasL dependent (16), one report indicates Fas/FasL-inde- 6). Fas and the TNF-R (CD120a, b) belong to a family of pendent CD41 cell–mediated lysis of certain melanoma cell molecules containing a conserved intracytoplasmic “death lines (17), suggesting that different members in the same domain” (7, 8) that, through interaction with distinct inter- families may also be involved in target cell lysis by CTLs. mediary adaptor molecules, indirectly results in activation Upon stimulation with cytokines (18), appropriate target of the caspase enzymatic cascade (9) and ultimately apop- cells (4, 19), or FcgRIIIA ligands (20), functional FasL is totic mechanisms in numerous cell types (7). Additional induced on NK cells at significant levels and in appropriate members of this family include the death receptors DR4 configuration to cross-link Fas on positive target cells (e.g., (R1) and DR5 (R2) (10–12), transducing apoptotic signals Jurkat) and induce their death. TRAIL expression, and its upon binding their soluble ligand, the TNF-related apop- possible role in cytotoxicity mediated by these cells, has not tosis-inducing ligand (TRAIL [13]). A third receptor (R3), been analyzed. Here we demonstrate that TRAIL pro- homologous to the other two in its extracellular domain duced and/or expressed by different populations of human 2375 J. Exp. Med. The Rockefeller University Press • 0022-1007/98/12/2375/06 $2.00 Volume 188, Number 12, December 21, 1998 2375–2380 http://www.jem.org primary NK cells is functional and represents a marker of S. Wolf, Genetics Institute, Andover, MA). J32 cell death was an- differentiation and/or activation of these and possibly other alyzed in a 6-h 51Cr-release assay with the indicated reagents present cytotoxic leukocytes. throughout the assay. rTNF-a (specific activity 107 U/mg protein on L929 cells, a subline), was provided by Dr. J.S. Price, Cetus Corp., Emeryville, CA. Materials and Methods RT-PCR Analysis. RT-PCR was performed as described (23) on total RNA extracted from the different cell populations (5 3 mAbs and Polyclonal Sera. mAbs to CD2 (B67.1, B67.6), CD4 104 cells/sample) with RNAzol (Biotecx Laboratories, Houston, (B66.6), CD5 (B36.1), CD8 (B116.1), CD11b (B43.4), CD14 TX). FasL and TRAIL primers (produced at the Kimmel Cancer (B52.1), CD15 (B40.9), CD56 (B159.5 [21, 22]), CD161/NKR- Center Nucleic Acid Facility) used for RT were, respectively, P1A (B199.2) used for cell purification (23), and the TNF-a– TGGTTGCCTTGGTAGGATTGGGC (59) and GAGCTTAT- neutralizing mAb (B154.2, B154.7 [24]) have been reported pre- ATAAGCCGAAAAACG (39) (29), and AACCTCTGAGGAA- viously. mAbs to CD3 (OKT3), CD21 (THB5), CD34, CD32 ACCAT (59) and TTAGCCAACTAAAAAGGC (39). b-actin (IV.3), CD64 (32.2), and the irrelevant P3x63.Ag8.653 Ig were primers were published previously (23). RT-PCR products were produced from cells from the American Type Culture Collection identified on agarose gels after ethidium bromide staining. (Rockville, MD). The Fas-blocking ZB4 mAb and the Fas-trig- gering CH11 mAb (25) were from Upstate Biotechnology, Inc. (Lake Placid, NY). The goat anti–mouse Ig used for panning was Results and Discussion produced in our laboratory, adsorbed on human IgG, and affin- 2 ity-purified on mouse Ig Sepharose before use (26). NK cells induced to differentiate from Lin umbilical NK Cell Populations. Immature lineage negative (Lin2) pro- cord blood cells in cultures with IL-15 mediated lower lev- genitor cell populations were enriched, as described (23), from els of cytotoxicity against K562 target cells than those me- umbilical cord blood samples provided by Dr. R. Depp (Depart- diated by cells from cultures with IL-2 (Fig. 1 a), but cells ment of Obstetrics and Gynecology, Thomas Jefferson University from either culture condition, such as mature adult periph- Hospital, Philadelphia, PA). These were .99% CD32/CD1612/ eral or umbilical cord blood NK cells (26, 30), mediated 2 2 CD16 /CD56 (indirect immunofluorescence [23]), not cyto- similar levels of cytotoxicity after stimulation with IL-2 and toxic against K562 target cells, and did not express CD16 mRNA IL-12. In both cases cytotoxicity was restricted to the (reverse transcription [RT]-PCR) or CD161 (23; and data not 2 1 1 shown). Their differentiation to NK cells was induced upon co- CD3 /CD161 /CD56 NK cell population, the only one culture with the murine bone marrow stromal cell line Sl/Sl4 detected in cultures with IL-15 (our unpublished data; 1 2 hSCF220 (Sl/Sl4 [27]; provided by Dr. D. Williams, University Fig. 1, b and c). An additional immature CD161 /CD56 of Indiana, Indianapolis, IN) and rIL-2 (50 U/ml; Hoffman- NK cell population generated in cultures with IL-2 neither LaRoche, Nutley, NJ, through the Biological Response Modifiers Program, National Cancer Institute, Bethesda, MD) or rIL-15 (10 ng/ml, specific activity 2.95 3 108 U/mg; Immunex Corp., Seat- tle, WA) during a 20–30-d culture period (23, 28). CD1611/ CD562 immature and CD561 mature NK cells were purified (23) from CD32/CD1611 cells from 25–30-d cultures with IL-2. Homogeneous populations of CD32/CD561/CD161 NK cells were also obtained by negative selection from short-term, 10-d cultures of umbilical cord blood lymphocytes with 30 Gy–irradi- ated RPMI-8866 cells (22). Each population contained .98% cells expressing the appropriate phenotype (direct immunofluorescence). Soluble TRAIL, Fas, DR4, and DR5. As described (10), Fas, DR4, and DR5 extracellular ligand-binding domain–Fc fusion proteins were produced in human 293 cells transiently transfected with constructs encoding these proteins. Conditioned media were used as source of the soluble proteins. Recombinant His 6–tagged TRAIL was produced in bacteria and purified by affinity chroma- tography on Ni21 affinity resin. Cytotoxicity and Cell Death. Cell-mediated cytotoxicity was an- alyzed in 4- or 6-h 51Cr-release assays using, respectively, the Fas2 K562 and the Fas1/DR41 Jurkat cells (J32 clone) as targets (5 3 103/well) and a series of effector cell numbers; LU were calculated at 45% specific 51Cr release (21). When indicated, 1 mM EGTA and 2 mM MgCl2, the Fas-blocking ZB4 or the irrelevant P3x63.Ag8.653 mAb as control (each 1 mg/ml), the Fas-trigger- Figure 1. Development of granule exocytosis–dependent cytotoxicity ing CH11 mAb (0.2 mg/ml), the TNF-a–neutralizing mAb (as- during NK cell differentiation. (a) Lin2 umbilical cord blood cells were cites, 1:500 dilution), His 6-tagged TRAIL (supernatant, 1:400 cultured with the Sl/Sl4 cell line and IL-2 (r, j) or IL-15 (n, h) for 30 d, dilution), and DR4– and DR5–Fc fusion proteins (supernatants, incubated (18 h, 378C) without (r, n) or with IL-2 and IL-12 (j, h), and tested for cytotoxicity on K562 target cells. (b) Cytotoxicity of total 1:2 dilution) were present throughout the assay. When indicated, (r), CD561 (h), and CD562 (m) cells from cultures with IL-15, K562 6 effector cells were preincubated (5 3 10 cell/ml, 18 h, 378C) target cells. (c) Cytotoxicity of CD561 (r, m) and CD562 (n, X) NK with rIL-2 (50 U/ml) and rIL-12 (2 ng/ml, specific activity 4.5 3 cells from cultures with IL-2, K562 (r, h), or Jurkat (m, X) target cells. 106 U/mg protein in an IFN-g–inducing assay; provided by Dr.
Load more

Recommended publications
  • Multiple Interactions of the Cytosolic Polyproline Region of the CD95
    FEBS 25561 FEBS Letters 509 (2001) 255^262 View metadata, citation and similar papers at core.ac.uk brought to you by CORE Multiple interactions of the cytosolic polyproline region ofprovided the by CD95 Elsevier - Publisher Connector ligand: hints for the reverse signal transduction capacity of a death factor1 Jennifer Wenzela;2, Ralf Sanzenbachera;2, Markus Ghadimia, Marc Lewitzkyb, Qingchun Zhouc, David R. Kapland, Dieter Kabelitza, Stephan M. Fellerb, Ottmar Janssena;* aInstitute for Immunology, Christian-Albrechts-University, MichaelisstraMe 5, 24105 Kiel, Germany bCell Signalling Laboratory, Imperial Cancer Research Fund, University of Oxford, Institute of Molecular Medicine, John Radcli¡e Hospital, Headington, Oxford, UK cInstitute of Organic Synthesis, Center China Normal University, 430079 Wuhan, PR China dDepartment of Pathology, Case Western Reserve University, 2085 Adelbert Road, Cleveland, OH 44106, USA Received 19 September 2001; revised 7 November 2001; accepted 7 November 2001 First published online 20 November 2001 Edited by Giulio Superti-Furga regulate activation of CD4- and CD8-positive T cells in Abstract The CD95/Fas/Apo-1 ligand is expressed on activated lymphocytes, NK cells, platelets, certain immune-privileged cells vivo. Upon stimulation with T cell receptor (TCR) agonists and some tumor cells and induces apoptosis through the death in the presence of CD95, cell cycle progression of CD4-pos- receptor CD95/Fas/Apo-1. In murine T cells, membrane-bound itive cells was found to be inhibited [14^16], while CD8-pos- CD95L (Fas ligand) also acts as a costimulatory receptor to itive cells were activated to proliferate [13^16]. The molecular coordinate activation and function in vivo.
    [Show full text]
  • Human Melanoma-Reactive CD4+ and CD8+ CTL Clones Resist Fas
    Human Melanoma-Reactive CD4+ and CD8+ CTL Clones Resist Fas Ligand-Induced Apoptosis and Use Fas/Fas Ligand-Independent Mechanisms for Tumor Killing This information is current as of September 29, 2021. Licia Rivoltini, Marina Radrizzani, Paola Accornero, Paola Squarcina, Claudia Chiodoni, Arabella Mazzocchi, Chiara Castelli, Paolo Tarsini, Vincenzo Viggiano, Filiberto Belli, Mario P. Colombo and Giorgio Parmiani J Immunol 1998; 161:1220-1230; ; Downloaded from http://www.jimmunol.org/content/161/3/1220 References This article cites 60 articles, 32 of which you can access for free at: http://www.jimmunol.org/content/161/3/1220.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists by guest on September 29, 2021 • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 1998 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Human Melanoma-Reactive CD41 and CD81 CTL Clones Resist Fas Ligand-Induced Apoptosis and Use Fas/Fas Ligand-Independent Mechanisms for Tumor Killing1 Licia Rivoltini,2* Marina Radrizzani,* Paola Accornero,* Paola Squarcina,* Claudia Chiodoni,* Arabella Mazzocchi,* Chiara Castelli,* Paolo Tarsini,* Vincenzo Viggiano,† Filiberto Belli,‡ Mario P.
    [Show full text]
  • Increased Expression of CD154 and FAS in SLE Patients’ Lymphocytes Maria Elena Manea, Ruediger B
    Increased expression of CD154 and FAS in SLE patients’ lymphocytes Maria Elena Manea, Ruediger B. Mueller, Doru Dejica, Ahmed Sheriff, Georg Schett, Martin Herrmann, Peter Kern To cite this version: Maria Elena Manea, Ruediger B. Mueller, Doru Dejica, Ahmed Sheriff, Georg Schett, et al.. Increased expression of CD154 and FAS in SLE patients’ lymphocytes. Rheumatology International, Springer Verlag, 2009, 30 (2), pp.181-185. 10.1007/s00296-009-0933-4. hal-00568285 HAL Id: hal-00568285 https://hal.archives-ouvertes.fr/hal-00568285 Submitted on 23 Feb 2011 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Increased expression of CD154 and FAS in SLE patients’ lymphocytes Maria Elena Manea1‡, MD, Ruediger B. Mueller2,3‡, MD, Doru Dejica1, PhD, Ahmed Sheriff2, PhD, Georg Schett2, MD, Martin Herrmann2, PhD, Peter Kern4, MD 1 Department of Immunopathology. “Iuliu Hatieganu" University of Medicine and Pharmacy, Str Croitorilor no 19-21, 3400 Cluj-Napoca, Romania. 2 Department for Internal Medicine 3 and Institute for Clinical Immunology, University of Erlangen-Nürnberg, Germany 3 Departement of Rheumatologie, Kantonsspital St. Gallen, Switzerland 4 Franz von Prümmer Klinik, Bahnhofstraße 16, 97769 Bad Brückenau, Germany ‡ both authors equally contributed to the work Address correspondence and reprint requests to: Ruediger B.
    [Show full text]
  • CD95 Ligand - Death Factor and Costimulatory Molecule?
    Cell Death and Differentiation (2003) 10, 1215–1225 & 2003 Nature Publishing Group All rights reserved 1350-9047/03 $25.00 www.nature.com/cdd Review CD95 ligand - death factor and costimulatory molecule? O Janssen*,1, J Qian1, A Linkermann1 and D Kabelitz1 Tissue and Cellular Expression of CD95L 1 Institute for Immunology, Medical Center Schleswig-Holstein, Campus Kiel, Michaelisstrasse 5, D-24105 Kiel, Germany The CD95 ligand (CD95L, Apo-1L, FasL, CD178) is a 281- * Corresponding author: O Janssen. Tel: þ 49-431-5973377; Fax: þ 49-431- amino-acid-containing type II transmembrane protein of the 5973335; E-mail: [email protected] TNF family of death factors (Figure 1).1 Its death-inducing function is best documented in the context of activation- Received 24.4.03; revised 12.6.03; accepted 20.6.03; published online 1 August 2003 induced cell death (AICD) in T cells.2 CD95L is expressed as a Edited by T Ferguson death factor in cytotoxic T lymphocytes (CTL) to kill virally infected or transformed target cells and in natural killer (NK) cells, where it is upregulated by CD16 engagement and 3 Abstract cytokines including IL-2 and IL-12. Similarly, high levels of intracellular CD95L have been detected in monocytic cells The CD95 ligand is involved as a death factor in the with an inducible release upon activation.4 Under physiologi- regulation of activation-induced cell death, establishment cal conditions, CD95L is implicated in the control of erythroid of immune privilege and tumor cell survival. In addition, differentiation,5 angiogenesis in the eye6 and skin home- 7 CD95L may serve as a costimulatory molecule for T-cell ostasis.
    [Show full text]
  • Interaction Apoptosis Mediated by Fas/Fas Ligand Osteoclast Formation In
    Effect of IL-12 on TNF-α-Mediated Osteoclast Formation in Bone Marrow Cells: Apoptosis Mediated by Fas/Fas Ligand Interaction This information is current as of October 6, 2021. Hideki Kitaura, Noriko Nagata, Yuji Fujimura, Hitoshi Hotokezaka, Noriaki Yoshida and Koji Nakayama J Immunol 2002; 169:4732-4738; ; doi: 10.4049/jimmunol.169.9.4732 http://www.jimmunol.org/content/169/9/4732 Downloaded from References This article cites 54 articles, 29 of which you can access for free at: http://www.jimmunol.org/content/169/9/4732.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on October 6, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2002 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Effect of IL-12 on TNF-␣-Mediated Osteoclast Formation in Bone Marrow Cells: Apoptosis Mediated by Fas/Fas Ligand Interaction1 Hideki Kitaura,2* Noriko Nagata,*† Yuji Fujimura,*† Hitoshi Hotokezaka,* Noriaki Yoshida,* and Koji Nakayama† Recently, it has been found that differentiation into osteoclasts is induced by TNF-␣.
    [Show full text]
  • Characterization of Murine CD70, the Ligand of the TNF Receptor Family Member CD 27
    UvA-DARE (Digital Academic Repository) Characterization of murine CD70, the ligand of the TNF receptor family member CD 27 Tesselaar, N.A.; Gravestein, L.A.; van Schijndel, G.; Borst, J.; van Lier, R.A.W. Publication date 1997 Published in The journal of immunology Link to publication Citation for published version (APA): Tesselaar, N. A., Gravestein, L. A., van Schijndel, G., Borst, J., & van Lier, R. A. W. (1997). Characterization of murine CD70, the ligand of the TNF receptor family member CD 27. The journal of immunology, 159, 4959-4965. General rights It is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), other than for strictly personal, individual use, unless the work is under an open content license (like Creative Commons). Disclaimer/Complaints regulations If you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please let the Library know, stating your reasons. In case of a legitimate complaint, the Library will make the material inaccessible and/or remove it from the website. Please Ask the Library: https://uba.uva.nl/en/contact, or a letter to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam, The Netherlands. You will be contacted as soon as possible. UvA-DARE is a service provided by the library of the University of Amsterdam (https://dare.uva.nl) Download date:30 Sep 2021 Characterization of Murine CD70, the Ligand of the TNF Receptor Family Member CD27' Kiki Tesselaar,* Loes A.
    [Show full text]
  • Signaling by the Epstein–Barr Virus LMP1 Protein Induces Potent
    Signaling by the Epstein–Barr virus LMP1 protein + + induces potent cytotoxic CD4 and CD8 T cell responses Il-Kyu Choia,b, Zhe Wanga,b, Qiang Kea,c, Min Honga,d, Yu Qiana,b, Xiujuan Zhaoa,e, Yuting Liuf, Hye-Jung Kimg, Jerome Ritza,b, Harvey Cantorg, Klaus Rajewskyh,1, Kai W. Wucherpfennigg, and Baochun Zhanga,b,g,1 aDepartment of Medical Oncology, Dana–Farber Cancer Institute, Boston, MA 02215; bDepartment of Medicine, Harvard Medical School, Boston, MA 02115; cDepartment of Diagnostics, School of Medicine, Hangzhou Normal University, Hangzhou, Zhejiang 311121, China; dDepartment of Medical Oncology, The First Affiliated Hospital of Kunming Medical University, Kunming, Yunnan 650032, China; eDepartment of Cell Biology, Tianjin Medical University, Tianjin 300070, China; fProgram in Cellular and Molecular Medicine, Boston Children’s Hospital, Boston, MA 02115; gDepartment of Cancer Immunology and Virology, Dana–Farber Cancer Institute, Boston, MA 02215; and hImmune Regulation and Cancer, Max Delbrück Center for Molecular Medicine, 13125 Berlin, Germany Contributed by Klaus Rajewsky, December 9, 2017 (sent for review August 3, 2017; reviewed by Alan B. Rickinson and Susan L. Swain) The B-lymphotropic Epstein–Barr virus (EBV), pandemic in humans, pressive molecules that foster local immune privilege (9, 10). is rapidly controlled on initial infection by T cell surveillance; there- Apparently, host immune cells, particularly T cells, keep EBV- after, the virus establishes a lifelong latent infection in the host. If infected cells under constant surveillance, and EBV-driven ma- surveillance fails, fatal lymphoproliferation and lymphomagenesis + lignancies only arise when surveillance fails. ensue. The initial T cell response consists of predominantly CD8 + T cell responses against EBV-infected or transformed B cells cytotoxic T cells and a smaller expansion of CD4 cells.
    [Show full text]
  • The Role of Fasl/Fas Signaling Network in Infections and Tumorigenesis
    The Role of FasL/Fas Signaling Network in Infections and Tumorigenesis T Cell-Mediated Cytotoxicity: All multicellular organisms are susceptible to tumor formation as well as infections from pathogenic viruses and bacteria, which serve as threats to the host organism. The host in turn deploys an immune response to ward off infections and eliminate malignant cells. T cell-mediated cytotoxicity is a complex and coordinated process that is critical for efficient immunological control of pathogenic infections and tumors (Kagi et al., 1996). This host defense mechanism is mediated by cytotoxic lymphocytes, a class of cells that includes CD8+ cytotoxic T lymphocytes (CTLs). As important effectors of the adaptive immune system, CTLs scan tissues for cellular abnormalities and infections and have the ability to directly destroy malignant/infected cells by inducing apoptosis. Briefly, CTLs screen potential target cells for expression of foreign peptide fragments from cellular proteins and then destroy identified cells. The specificity of this process is mediated through cell surface T cell receptors on CTLs, which interact with antigen-derived peptides presented by the class I molecules of the major histocompatibility complex (MHC1) on the surface of target cells. Once the CTL identifies its target cell, it delivers the “lethal hit” by one of two distinct mechanisms described below (Takayama et al., 1995). The initially characterized pathway is a Figure 1 calcium-dependent granule exocytosis pathway. In this pathway, effector cells secrete cytolytic proteins such as perforin and granzyme that penetrate target cells, initiate cytosolic and nuclear changes which culminate in apoptosis, thereby eliminating potentially harmful cells. The existence of an alternate pathway was proposed based on the observations that effector T cells from perforin knockout mice retained cytotoxic activity and were capable of inducing apoptosis in target cells.
    [Show full text]
  • CD70 CD27 Ligation Between Neural Stem Cells and CD4+ T Cells
    Lee et al. Stem Cell Research & Therapy 2013, 4:56 http://stemcellres.com/content/4/3/56 RESEARCH Open Access CD70–CD27 ligation between neural stem cells and CD4+ T cells induces Fas–FasL-mediated T-cell death Eun Mi Lee1,2, Sunghoon Hurh1, Bumrae Cho1, Kook-Hwan Oh3, Seung U Kim4, Charles D Surh5, Jonathan Sprent6, Jaeseok Yang7, Jae Young Kim8 and Curie Ahn1,3,7* Abstract Introduction: Neural stem cells (NSCs) are among the most promising candidates for cell replacement therapy in neuronal injury and neurodegenerative diseases. One of the remaining obstacles for NSC therapy is to overcome the alloimmune response on NSCs by the host. Methods: To investigate the mechanisms of immune modulatory function derived from the interaction of human NSCs with allogeneic T cells, we examined the immune regulatory effects of human NSCs on allogeneic T cells in vitro. Results: Significantly, NSCs induced apoptosis of allogeneic T cells, in particular CD4+ T cells. Interaction of CD70 on NSCs and CD27 on CD4+ T cells mediated apoptosis of T cells. Thus, blocking CD70–CD27 interaction prevented NSC-mediated death of CD4+ T cells. Conclusions: We present a rational explanation of NSC-induced immune escape in two consecutive stages. First, CD70 constitutively expressed on NSCs engaged CD27 on CD4+ T cells, which induced Fas ligand expression on CD4+ T cells. Second, CD4+ T-cell apoptosis was followed by Fas–Fas ligand interaction in the CD4+ T cells. Keywords: Neural stem cells, Co-stimulatory molecules, Immune escape mechanism Introduction Transplantation of rodent embryonic stem cells (ESCs) Neural stem cells (NSCs) are among the most promising into allogeneic recipients indicated that they may have candidates for cell replacement therapy in neuronal in- immune-privileged properties.
    [Show full text]
  • Proinflammatory Cytokine Activation Is Linked to Apoptotic Mediator, Soluble Fas Level in Patients with Chronic Heart Failure
    Proinflammatory Cytokine Activation Is Linked to Apoptotic Mediator, Soluble Fas Level in Patients With Chronic Heart Failure Toru Kinugawa,1 MD, Masahiko Kato,2 MD, Kazuhiro Yamamoto,2 MD, Ichiro Hisatome,3 MD, and Ryuji Nohara,4 MD Summary The Fas/Fas Ligand system is a major apoptosis signaling pathway that is up-regulated in patients with chronic heart failure (CHF). Serum soluble Fas (sFas) levels increase in proportion to the CHF severity and may have prognostic value, therefore, sFas is a promising biomarker of heart failure. In this study, we attempted to identify the determinants of sFas levels in patients with CHF. Serum levels of tumor necrosis factor (TNF)-α and its soluble receptors (sTNF-R1 & sTNF-R2), interleukin (IL)-6, soluble IL-6 receptor (sIL-6R), glycoprotein (gp)130, and sFas were measured in 106 pa- tients with CHF and 39 controls. All subjects performed a symptom-limited cycle ergometer exercise test with expired gas analysis. CHF patients had higher levels of TNF-α, sTNF-R1, sTNF-R2, IL-6, and gp130. Serum levels of sFas (con- trols versus CHF; 2.60 ± 0.88 versus 3.38 ± 1.23 ng/mL, P = 0.0004) were higher in CHF. On univariate analysis, age (P = 0.0003), NYHA functional class (P = 0.0012), peak VO2 (P < 0.0001), plasma norepinephrine (P = 0.0013), log IL-6 (P < 0.0001), log TNF-α (P = 0.0002), log sTNF-R1 (P < 0.0001), and log TNF-R2 (P < 0.0001) were significantly re- lated to log sFas levels. Multivariate analysis showed that age and log IL-6 and log sTNF-R1 levels were independently associated with log sFas levels (overall R = 0.603, P < 0.0001).
    [Show full text]
  • ©Ferrata Storti Foundation
    Malignant Lymphomas research paper Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) and Fas apoptosis in Burkitt’s lymphomas with loss of multiple pro-apoptotic proteins AZHAR HUSSAIN, JEAN-PIERRE DOUCET, MARINA I. GUTIÉRREZ, MANZOOR AHMAD, KHALED AL-HUSSEIN, DANIELA CAPELLO, GIANLUCA GAIDANO, KISHOR BHATIA Background and Objectives. Normal B-cells in the ger- nduction of cell death can result from signaling via minal center (GC) may be exposed to both tumor necro- external death receptors such as CD95/Fas and tumor sis factor-related apoptosis inducing ligand (TRAIL) and Inecrosis factor-related apoptosis-inducing ligand Fas-L. Whether abrogation of TRAIL apoptosis is a feature (TRAIL) receptors1-4 or it can result from exposure to in the genesis of B cell lymphomas of GC-phenotype is not chemicals, irradiation and serum starvation.5-7 Signal- known. We assessed the integrity of the TRAIL pathway in ing through external receptors activates the extrinsic Fas-resistant and Fas-sensitive Burkitt’s lymphomas (BLs). pathway8 headed by the apical caspases, caspase-8 and Design and Methods. Expression of TRAIL receptors caspase-10. On the other hand, death resulting from was determined by flow cytometry and Western blots. The chemotherapeutic agents appears to require exclusive- extent of apoptosis following exposure to TRAIL was mea- ly the intrinsic pathway9 involving the mitochondrial sured by annexin-V/propidium iodide dual staining. The release of death activators – cytochrome c and integrity of the Fas and TRAIL apoptotic pathways was Smac/Diablo, which in turn activate the caspase cas- determined by Western blotting to assess cleavage of cade led by caspase-9 via the apoptosome.10,11 While downstream caspases.
    [Show full text]
  • Fas Ligand Gene-Carrying Adeno-5 Adeasy Viruses Can Be Efficiently Propagated in Apoptosis-Sensitive Human Embryonic Retinoblast 911 Cells
    Gene Therapy (2000) 7, 70–74 2000 Macmillan Publishers Ltd All rights reserved 0969-7128/00 $15.00 www.nature.com/gt VIRAL TRANSFER TECHNOLOGY BRIEF COMMUNICATION Fas ligand gene-carrying adeno-5 AdEasy viruses can be efficiently propagated in apoptosis-sensitive human embryonic retinoblast 911 cells A Watzlik, Ch Dufter, M Jung, G Opelz and P Terness Department of Transplantation Immunology, Institute of Immunology, University of Heidelberg, INF-305, 69120-Heidelberg, Germany Recent reports have pointed out the difficulties in generating recombination (pShuttle-mFasL with pAdEasy-1) is perfor- recombinant adenoviral vectors expressing FasL using med first in bacteria and 911 cells are transfected thereafter eukaryotic cells. In the present study we cloned the murine with recombined AdEasy-mFasL, virus production starts FasL (mFasL) gene into the pCA14 or pShuttle vectors and immediately and the cells survive longer. The resulting recombined them with the adeno-5 virus backbone pBHG10 AdEasy-mFasL viruses are able to infect other eukaryotic or pAdEasy-1 in eukaryotic (911 cells) or prokaryotic (E. coli) cells and induce expression of functional mFasL. This study cells, respectively. Recombination of pCA14-mFasL with describes a method for efficient generation of recombinant pBHG10 in Fas-carrying 911 cells leads to rapid expression FasL adeno-5 viruses in eukaryotic cells. The method may of mFasL and cell death by apoptosis before virus replication be generally suitable for producing viruses carrying is initiated. The same effect is observed when 911 cells are deleterious genes. Gene Therapy (2000) 7, 70–74. transfected with the pCA14-mFasL shuttle vector only. If Keywords: FasL; adenovirus 5; vector; 911 cells; AdEasy system The Fas ligand (FasL) belongs to the tumor necrosis factor the graft (reviewed in Ref.
    [Show full text]