Brief Definitive Report Natural Killer (NK) Cell–mediated Cytotoxicity: Differential Use of TRAIL and Fas Ligand by Immature and Mature Primary Human NK Cells By Loris Zamai, Manzoor Ahmad, Ian M. Bennett, Livio Azzoni, Emad S. Alnemri, and Bice Perussia From the Jefferson Medical College, Department of Microbiology and Immunology, Kimmel Cancer Institute, Philadelphia, Pennsylvania 19107 Summary Mature natural killer (NK) cells use Ca21-dependent granule exocytosis and release of cyto- toxic proteins, Fas ligand (FasL), and membrane-bound or secreted cytokines (tumor necrosis factor [TNF]-a) to induce target cell death. Fas belongs to the TNF receptor family of mole- cules, containing a conserved intracytoplasmic “death domain” that indirectly activates the caspase enzymatic cascade and ultimately apoptotic mechanisms in numerous cell types. Two additional members of this family, DR4 and DR5, transduce apoptotic signals upon binding soluble TNF-related apoptosis-inducing ligand (TRAIL) that, like FasL, belongs to the grow- ing TNF family of molecules. Here, we report that TRAIL produced or expressed by different populations of primary human NK cells is functional, and represents a marker of differentiation or activation of these, and possibly other, cytotoxic leukocytes. During differentiation NK cells, sequentially and differentially, use distinct members of the TNF family or granule exocy- tosis to mediate target cell death. Phenotypically immature CD1611/CD562 NK cells mediate TRAIL-dependent but not FasL- or granule release–dependent cytotoxicity, whereas mature CD561 NK cells mediate the latter two. Key words: natural killer cells • differentiation • cytotoxicity • TRAIL • Fas ligand ytotoxic T lymphocytes (CTLs) and NK cells use a but anchored to the membrane via glycosyl phosphatidyl- Ccombination of several mechanisms to lyse different inositol and lacking intracellular domain and apoptosis- target cells. These include (a) Ca21-dependent granule inducing capability (14), has been suggested to function as a exocytosis and release of cytotoxic proteins (perforin and decoy receptor, protecting normal cells against TRAIL- granzymes) from intracytoplasmic granules; (b) FasL, con- induced apoptosis. stitutively expressed or induced upon interaction with tar- Engagement of the TCR/CD3 complex on T cells in- get cells and inducing Ca21-independent, Fas (CD95/Apo duces increased functional expression of FasL (15). Al- 1)-mediated apoptosis; and (c) membrane-bound or se- though most CD41 T cell–mediated cytotoxicity is Fas/ creted cytokines (TNF-a) (1–5; for a review, see reference FasL dependent (16), one report indicates Fas/FasL-inde- 6). Fas and the TNF-R (CD120a, b) belong to a family of pendent CD41 cell–mediated lysis of certain melanoma cell molecules containing a conserved intracytoplasmic “death lines (17), suggesting that different members in the same domain” (7, 8) that, through interaction with distinct inter- families may also be involved in target cell lysis by CTLs. mediary adaptor molecules, indirectly results in activation Upon stimulation with cytokines (18), appropriate target of the caspase enzymatic cascade (9) and ultimately apop- cells (4, 19), or FcgRIIIA ligands (20), functional FasL is totic mechanisms in numerous cell types (7). Additional induced on NK cells at significant levels and in appropriate members of this family include the death receptors DR4 configuration to cross-link Fas on positive target cells (e.g., (R1) and DR5 (R2) (10–12), transducing apoptotic signals Jurkat) and induce their death. TRAIL expression, and its upon binding their soluble ligand, the TNF-related apop- possible role in cytotoxicity mediated by these cells, has not tosis-inducing ligand (TRAIL [13]). A third receptor (R3), been analyzed. Here we demonstrate that TRAIL pro- homologous to the other two in its extracellular domain duced and/or expressed by different populations of human 2375 J. Exp. Med. The Rockefeller University Press • 0022-1007/98/12/2375/06 $2.00 Volume 188, Number 12, December 21, 1998 2375–2380 http://www.jem.org primary NK cells is functional and represents a marker of S. Wolf, Genetics Institute, Andover, MA). J32 cell death was an- differentiation and/or activation of these and possibly other alyzed in a 6-h 51Cr-release assay with the indicated reagents present cytotoxic leukocytes. throughout the assay. rTNF-a (specific activity 107 U/mg protein on L929 cells, a subline), was provided by Dr. J.S. Price, Cetus Corp., Emeryville, CA. Materials and Methods RT-PCR Analysis. RT-PCR was performed as described (23) on total RNA extracted from the different cell populations (5 3 mAbs and Polyclonal Sera. mAbs to CD2 (B67.1, B67.6), CD4 104 cells/sample) with RNAzol (Biotecx Laboratories, Houston, (B66.6), CD5 (B36.1), CD8 (B116.1), CD11b (B43.4), CD14 TX). FasL and TRAIL primers (produced at the Kimmel Cancer (B52.1), CD15 (B40.9), CD56 (B159.5 [21, 22]), CD161/NKR- Center Nucleic Acid Facility) used for RT were, respectively, P1A (B199.2) used for cell purification (23), and the TNF-a– TGGTTGCCTTGGTAGGATTGGGC (59) and GAGCTTAT- neutralizing mAb (B154.2, B154.7 [24]) have been reported pre- ATAAGCCGAAAAACG (39) (29), and AACCTCTGAGGAA- viously. mAbs to CD3 (OKT3), CD21 (THB5), CD34, CD32 ACCAT (59) and TTAGCCAACTAAAAAGGC (39). b-actin (IV.3), CD64 (32.2), and the irrelevant P3x63.Ag8.653 Ig were primers were published previously (23). RT-PCR products were produced from cells from the American Type Culture Collection identified on agarose gels after ethidium bromide staining. (Rockville, MD). The Fas-blocking ZB4 mAb and the Fas-trig- gering CH11 mAb (25) were from Upstate Biotechnology, Inc. (Lake Placid, NY). The goat anti–mouse Ig used for panning was Results and Discussion produced in our laboratory, adsorbed on human IgG, and affin- 2 ity-purified on mouse Ig Sepharose before use (26). NK cells induced to differentiate from Lin umbilical NK Cell Populations. Immature lineage negative (Lin2) pro- cord blood cells in cultures with IL-15 mediated lower lev- genitor cell populations were enriched, as described (23), from els of cytotoxicity against K562 target cells than those me- umbilical cord blood samples provided by Dr. R. Depp (Depart- diated by cells from cultures with IL-2 (Fig. 1 a), but cells ment of Obstetrics and Gynecology, Thomas Jefferson University from either culture condition, such as mature adult periph- Hospital, Philadelphia, PA). These were .99% CD32/CD1612/ eral or umbilical cord blood NK cells (26, 30), mediated 2 2 CD16 /CD56 (indirect immunofluorescence [23]), not cyto- similar levels of cytotoxicity after stimulation with IL-2 and toxic against K562 target cells, and did not express CD16 mRNA IL-12. In both cases cytotoxicity was restricted to the (reverse transcription [RT]-PCR) or CD161 (23; and data not 2 1 1 shown). Their differentiation to NK cells was induced upon co- CD3 /CD161 /CD56 NK cell population, the only one culture with the murine bone marrow stromal cell line Sl/Sl4 detected in cultures with IL-15 (our unpublished data; 1 2 hSCF220 (Sl/Sl4 [27]; provided by Dr. D. Williams, University Fig. 1, b and c). An additional immature CD161 /CD56 of Indiana, Indianapolis, IN) and rIL-2 (50 U/ml; Hoffman- NK cell population generated in cultures with IL-2 neither LaRoche, Nutley, NJ, through the Biological Response Modifiers Program, National Cancer Institute, Bethesda, MD) or rIL-15 (10 ng/ml, specific activity 2.95 3 108 U/mg; Immunex Corp., Seat- tle, WA) during a 20–30-d culture period (23, 28). CD1611/ CD562 immature and CD561 mature NK cells were purified (23) from CD32/CD1611 cells from 25–30-d cultures with IL-2. Homogeneous populations of CD32/CD561/CD161 NK cells were also obtained by negative selection from short-term, 10-d cultures of umbilical cord blood lymphocytes with 30 Gy–irradi- ated RPMI-8866 cells (22). Each population contained .98% cells expressing the appropriate phenotype (direct immunofluorescence). Soluble TRAIL, Fas, DR4, and DR5. As described (10), Fas, DR4, and DR5 extracellular ligand-binding domain–Fc fusion proteins were produced in human 293 cells transiently transfected with constructs encoding these proteins. Conditioned media were used as source of the soluble proteins. Recombinant His 6–tagged TRAIL was produced in bacteria and purified by affinity chroma- tography on Ni21 affinity resin. Cytotoxicity and Cell Death. Cell-mediated cytotoxicity was an- alyzed in 4- or 6-h 51Cr-release assays using, respectively, the Fas2 K562 and the Fas1/DR41 Jurkat cells (J32 clone) as targets (5 3 103/well) and a series of effector cell numbers; LU were calculated at 45% specific 51Cr release (21). When indicated, 1 mM EGTA and 2 mM MgCl2, the Fas-blocking ZB4 or the irrelevant P3x63.Ag8.653 mAb as control (each 1 mg/ml), the Fas-trigger- Figure 1. Development of granule exocytosis–dependent cytotoxicity ing CH11 mAb (0.2 mg/ml), the TNF-a–neutralizing mAb (as- during NK cell differentiation. (a) Lin2 umbilical cord blood cells were cites, 1:500 dilution), His 6-tagged TRAIL (supernatant, 1:400 cultured with the Sl/Sl4 cell line and IL-2 (r, j) or IL-15 (n, h) for 30 d, dilution), and DR4– and DR5–Fc fusion proteins (supernatants, incubated (18 h, 378C) without (r, n) or with IL-2 and IL-12 (j, h), and tested for cytotoxicity on K562 target cells. (b) Cytotoxicity of total 1:2 dilution) were present throughout the assay. When indicated, (r), CD561 (h), and CD562 (m) cells from cultures with IL-15, K562 6 effector cells were preincubated (5 3 10 cell/ml, 18 h, 378C) target cells. (c) Cytotoxicity of CD561 (r, m) and CD562 (n, X) NK with rIL-2 (50 U/ml) and rIL-12 (2 ng/ml, specific activity 4.5 3 cells from cultures with IL-2, K562 (r, h), or Jurkat (m, X) target cells. 106 U/mg protein in an IFN-g–inducing assay; provided by Dr.