Wolf–Hirschhorn Syndrome Candidate 1 Is Involved in the Cellular Response to DNA Damage

Wolf–Hirschhorn syndrome candidate 1 is involved in the cellular response to DNA damage

Ildiko Hajdu, Alberto Ciccia, Susanna M. Lewis, and Stephen J. Elledge1

Department of Genetics, Howard Hughes Medical Institute, Division of Genetics, Brigham and Women’s Hospital, Harvard University Medical School, Boston, MA 02115

Contributed by Stephen J. Elledge, June 22, 2011 (sent for review June 3, 2011) Wolf–Hirschhorn syndrome (WHS) is a malformation syndrome as- neurological impairment. A-T, which is caused by mutations in sociated with growth retardation, mental retardation, and immu- ATM, is characterized by progressive neurologic impairment, nodeficiency resulting from a hemizygous deletion of the short cerebellar ataxia, variable immunodeficiency, and a predisposition arm of chromosome 4, called the WHS critical region (WHSC). The to malignancy (10). Other examples of DDR syndromes that affect WHSC1 gene is located in this region, and its loss is believed to the development and homeostasis of the nervous and immune be responsible for a number of WHS characteristics. We identified system include the Nijmegen breakage syndrome and the ataxia- WHSC1 in a genetic screen for genes involved in responding to telangiectasia–like disorder, which are due to mutations in the replication stress, linking Wolf–Hirschhorn syndrome to the DNA DDR factors NBS1 and MRE11, respectively (11, 12). Mutations damage response (DDR). Here, we report that the WHSC1 protein in ATR, and other components of the ATR pathway, have been is a member of the DDR pathway. WHSC1 localizes to sites of DNA identified in Seckel syndrome patients with microcephaly, facial damage and replication stress and is required for resistance to dysphormism, and growth defects (12). many DNA-damaging and replication stress-inducing agents. Wolf–Hirschhorn syndrome (WHS) is a malformation syn- Through its SET domain, WHSC1 regulates the methylation status drome characterized by brain developmental defects, immuno- of the histone H4 K20 residue and is required for the recruitment of deficiency, microcephaly, craniofacial phenotypes, and congenital 53BP1 to sites of DNA damage. We propose that Wolf–Hirschhorn heart defects (13). Defects in the production of immunogluobulin syndrome results from a defect in the DDR. A and common variable immunodeficiency (CVID) are fre- quently associated with WHS (14). WHS results from a hemi- CELL BIOLOGY checkpoint | histone methylation | MMSET zygous deletion of the subtelomeric region of the short arm of chromosome 4. The Wolf–Hirschhorn syndrome candidate 1 amage to DNA occurs continuously, threatening the in- gene (WHSC1/MMSET) is located in the WHS critical region Dtegrity of our genetic material. The ability to repair DNA and its loss is believed to be responsible for several phenotypes of lesions is critical for proper organismal development and sur- the syndrome (15). In addition to its role in WHS, WHSC1 is also vival. In response to DNA damage or replication stress, a signal targeted by the t(4;14)(p16.3;q32.3) chromosomal translocation, transduction cascade called the DNA damage response (DDR) which results in the overproduction of the WHSC1 protein in is activated to maintain genomic integrity (1, 2). The ATM and multiple myelomas (MMs) (16). Although studies have outlined ATR kinases are central components of the DDR. ATM is the involvement of WHSC1 in development, the pathogenic recruited and activated by the MRE11-RAD50-NBS1 complex at role of WHSC1 in WHS and MM remains to be elucidated. double-strand breaks (DSBs), where ATM phosphorylates the WHSC1 is a SET domain histone methyltranferase containing histone variant H2AX (3, 4). Phosphorylated H2AX then asso- proline-tryptophan-tryptophan-proline (PWWP), high-mobility ciates with the mediator protein MDC1, which leads to the ac- group (HMG box) and plant homeodomain (PHD) domains fi tivation of ubiquitination and sumoylation cascades required for (17). We identi ed WHSC1 in a genetic screen for proteins fi the recruitment of the BRCA1 ubiquitin ligase and the mediator involved in responding to DNA replication stress. This nding, protein 53BP1 to promote DNA repair (5, 6). Unlike ATM, the together with the fact that the protein domains of WHSC1 are ATR kinase is activated following its recruitment by its partner commonly found in DDR factors and that WHSC1 is phos- protein ATRIP to RPA-coated ssDNA regions generated at phorylated in response to DNA damage (18), prompted us to stalled or collapsed forks. RPA-ssDNA complexes also recruit the investigate whether WHSC1 is a member of the DDR machin- RAD17-RFC2-5 complex that loads the RAD1-RAD9-HUS1 (9- ery. Here, we report that the WHSC1 protein has a role in DNA 1-1) complex onto DNA. The 9-1-1 complex recruits RHINO (7) damage response via regulation of the methylation of the K20 and the mediator protein TOPBP1 to further activate ATR (8, 9). residue of histone H4 and the recruitment of 53BP1 to sites of ATM and ATR are known to control the phosphorylation of DNA damage. nearly 1,000 effector proteins involved in a wide number of cellular Results processes, such DNA repair, transcription, chromatin structure, Inactivation of WHSC1 Sensitizes Human Cells to DNA Damage and splicing, metabolism, induction of apoptosis, and senescence. Replication Stress. In an ongoing shRNA screen for genes involved The importance of the DDR in human physiology is underscored in resistance to hydroxyurea (HU)-induced DNA replication by the observation that dysregulation of DNA repair pathways can stress, we identified the WHSC1 gene. To explore a possible role lead to a range of human disorders exhibiting developmental for WHSC1 in the DDR, we first investigated if WHSC1 depletion defects, neurological defects, immunodeficiency, and cancer (2, 3). resulted in DNA damage sensitivity. HCT116 cells depleted with The developmental and neurological defects are likely due to the an shRNA targeting WHSC1 were compared with cells expressing requirement for extremely accurate DNA repair during the rapid expansion of progenitor cells occurring during embryonic development and for the maintenance of the homeostasis of the Author contributions: I.H., A.C., S.M.L., and S.J.E. designed research; I.H., A.C., and S.M.L. nervous system. performed research; I.H., A.C., S.M.L., and S.J.E. analyzed data; and I.H., A.C., and S.J.E. The number of syndromes associated with neurological and wrote the paper. developmental defects related to the DDR has rapidly expanded The authors declare no conflict of interest. in the last decade. Ataxia telangiectasia (A-T) is one of the most 1To whom correspondence should be addressed. E-mail: [email protected]. studied DNA repair deficiencies resulting in developmental and edu.

www.pnas.org/cgi/doi/10.1073/pnas.1110081108 PNAS Early Edition | 1of5 Downloaded by guest on October 1, 2021 the nontargeting firefly luciferase (FF) shRNA for their sensitivity WHSC1 shRNA-depleted cells. In addition, the siRNA-resistant to HU, mitomycin C (MMC), ionizing radiation (IR), campto- WHSC1 rescued the damage sensitivity conferred by the siRNA thecin (CPT), and UV light. The viability of these cells after DNA (Fig. 1 B and C). We conclude from these observations that damage treatment was measured using the CellTiter Blue reagent. WHSC1 contributes to the resistance of human cells to DNA WHSC1 depletion did not inhibit cell survival in the absence of damage and DNA replication stress. DNA-damaging treatments. However, exposure of the cells to HU, MMC, IR, CPT, and UV caused a reduction in the viability of WHSC1 Localizes to Sites of DNA Damage. To further explore the role cells depleted for WHSC1 (Fig. 1 A and C). of WHSC1 in the DDR, we investigated whether WHSC1 is To rule out off-target effects mediated by the WHSC1 shRNA, recruited to sites of DNA damage. We expressed an N-terminal we confirmed the DNA damage sensitivity of WHSC1-depleted GFP-WHSC1 fusion in U2OS cells and assayed for recruitment to cells using an siRNA targeting a different site. HCT116 cells were DNA lesions induced by UV laser microirradiation following sen- transfected with nontargeting FF siRNA, a WHSC1 targeting sitization of genomic DNA by BrdU treatment. BrdU-labeled cells siRNA, or a combination of the WHSC1-targeting siRNA and an were irradiated and subsequently fixed with formaldehyde and siRNA-resistant wild-type WHSC1 expression plasmid. At 48 h immunostained with antibodies against GFP to allow the detection posttransfection, cells were treated with 500 μM HU for 24 h or of GFP-WHSC1. WHSC1 showed a pan-nuclear staining in in- with 5 Gy IR, incubated for 48 h to allow recovery from the terphase cells and was associated with the mitotic chromosomes. damage, and assayed for viability using the Cell Titer-Blue re- However, within 45 min of microirradiation, WHSC1 was recruited agent. Both HU and IR treatments resulted in reduced cell via- to sites of DNA damage where it colocalized with γH2AX, a marker bility, confirming the DNA damage sensitivity also observed in the of sites of DNA damage (Fig. 2). This finding suggests that WHSC1 is likely to play a direct role in DNA damage sensing and/or repair.

100 A 95 90 AB 85 80 75 FFsh WHSC1sh 70 WHSC1sh Viability %Viability 65 + shRes 60 55 50 NT HU MMC CPT IR UV

100 B 95 90 CD 85 80 75 FF siRNA WHSC1 siRNA 70 WHSC1 siRNA Viability %Viability 65 + siRes 60 55 50 NT HU IR C E ++++----FFsh WHSC1 siRNA WHSC1 shRNA FF siRNA +siRes WHSC1 siRNA FF shRNA +shRes WHSC1 siRNA ----++++WHSC1sh anti-WHSC1 + + ++++++ HU anti-GADPH 0h 0h 6h 6h 24h 24h 48h 48h Release from HU (h) anti-pRPA32 (Ser33) Fig. 1. WHSC1 is required for resistance to DNA damage and DNA replication stress. (A) HCT116 cells expressing FF shRNA (FFsh, blue columns), anti-H2AX (Ser139) WHSC1 shRNA (WHSC1sh, red columns), or a combination of a WHSC1 shRNA and a WHCS1 cDNA resistant to the WHSC1 shRNA (WHSC1sh shRes, anti-pChk1 (Ser17) green columns) were treated with DNA-damaging agents as follows: 500 μM anti-GADPH HU for 24 h, 50 nM MMC, 50 nM CPT for 24 h, 5 Gy irradiation or 30 J/m2 UV. Two days later, the viability of these treated cells was determined using CellTiter-Blue reagent (Promega). Experiments were repeated four times, Fig. 2. WHSC1 localizes to sites of DNA damage and is required for recovery and the average viabilities were plotted. Error bars represent the SD of four from DNA replication stress. (A–D) U2OS cells expressing GFP-WHSC1 were experiments. P < 0.005. (B) HCT116 cells transfected with siRNAs targeting FF laser microirradiated, incubated for 45 min, and processed for immunoﬂu- (FFsiRNA, blue columns), WHSC1 (WHSC1siRNA, red columns), or a combi- orescence staining of GFP-WHSC1 (A) and γ-H2AX (B). The merged image (C) nation of a WHSC1 siRNA and a WHCS1 cDNA resistant to the WHSC1 siRNA shows the colocalization of p-H2AX and GFP-WHSC1 at the DNA damage (WHSC1siRNA siRes, green columns) were treated with 500 μM HU for 24 h sites. Nuclei were stained with DAPI (D). (E) DDR activation in HCT116 or with 5 Gy irradiation. Two days later, the viability of these treated cells cells expressing FF and WHSC1 hairpins upon HU treatment. Cells were was determined using CellTiter-Blue reagent (Promega). Experiments were treated with 500 μM HU for 24 h and released from the HU block for the repeated four times, and the average viabilities were plotted. Error bars are indicated times. Released cells were collected, lysed in the presence of as above. P < 0.005. (C) Depletion of WHSC1 by shRNA and siRNA, and the phosphatase inhibitors, and processed for Western blotting. The phosphor- expression of the shRNA-resistant and siRNA-resistant WHSC1 protein. ylation status of RPA32, Chk1, and H2AX were analyzed, and GADPH was Extracts form the indicated cells were immunoblotted for WHSC1 protein. used as a loading control.

2of5 | www.pnas.org/cgi/doi/10.1073/pnas.1110081108 Hajdu et al. Downloaded by guest on October 1, 2021 WHSC1 Depletion Causes Prolonged DNA Damage-Induced RPA, H2AX Phosphorylation. Prompted by the evidence suggesting a link between WHSC1 and DNA damage, we asked whether WHSC1 might be involved in DDR signaling. Upon activation, ATR activates CHK1 by phosphorylation on Ser317 and Ser345. We followed CHK1 activation upon HU treatment via monitoring its phosphorylation on Ser317 in the presence and absence of WHSC1 in HCT116 cells by Western blot. Cells were treated with 500 μM HU for 24 h and released into HU-free media. Samples were collected at the indicated times. No significant difference in the kinetics of CHK1 activation was observed. However, analysis of the kinetics of CHK1 phosphorylation after release from the HU block revealed that CHK1 activation persisted longer in WHSC1-depeted cells and was higher at 6 h after HU release compared with controls. Together, these observations suggest that DDR activation is intact in the absence of WHSC1, but that the DNA damage signaling generated by replication stress persists longer after release from the stress. This indicates that cells lacking WHSC1 generate more DNA damage than control cells upon replication stress, repair the DNA damage much less effi- ciently, or both. To explore whether more DNA damage is generated after replication stress in the absence of WHSC1, we examine two reporters of DNA damage in the same experiment as above. The first reporter was the phosphorylation status of RPA. In response to replication stress, the 32-kDa subunit of RPA (RPA32) becomes phosphorylated by ATR/ATRIP on residue S33. Phosphorylation

of S33 is an indicator of the presence of DNA damage and the CELL BIOLOGY activation status of ATR/ATRIP. We observed that RPA32 phosphorylation persisted longer in WHSC1-depleted cells compared Fig. 3. Chk2 activation in response to DNA replication stress requires with the control shRNA-expressing cells up to 48 h postremoval of WHSC1. (A) HCT116 cells expressing FF and WHSC1 shRNAs were treated HU, indicating a prolonged DNA damage response activation. with 500 μM HU for 24 h and processed for immunofluorescence staining of As a second reporter, we analyzed the kinetics of γH2AX for- p-Chk2 (Thr68) and p-H2AX. Nuclei were stained with DAPI. (B) Chk2 acti- mation after exposure to HU in HCT116 cells. Following HU vation in HCT116 cells expressing FF and WHSC1 hairpins upon HU treat- μ treatment, H2AX becomes phosphorylated in an ATR-dependent ment. Cells were treated with 500 M HU for 24 h and released from the manner to generate γH2AX. As seen in Fig. 2E, γH2AX is clearly treatment for the indicated times. Released cells were collected, lysed in the presence of phosphatase inhibitors, and immunoblotted. The phosphoryla- detected after 24 h of HU treatment at the same level in the tion status of Chk2 was analyzed. presence of FF and WHSC1 hairpins. However, following the release of cells into HU-free media, in the absence of WHSC1 the level of γH2AX increased at 6 h and slowly decreased throughout at all time points after release, becoming undetectable by 24 h. the 48-h time period. In contrast, the control cells showed no Throughout the course of the experiment, the amount of total significant increase of γH2AX after release. The increased H2AX CHK2 protein recovered in the extracts remained unchanged. phosphorylation seen in WHSC1-depleted cells, together with the These data indicate that WHSC1 promotes CHK2 phosphoryla- RPA and CHK1 phosphorylation data, suggest that WHSC1 acts tion in response to DNA replication stress. to allow recovery from DNA replication stress. Part of this increased H2AX signal could be due to apoptosis (19), but in that WHSC1 Is Required for 53BP1 Localization and HU-Induced Methylation case the H2AX staining is pan-nuclear as opposed to focal, which of the K20 Residue of Histone H4. The observation that Chk1 acti- we have not observed. Furthermore, the increase of H2AX vation remained intact in the absence of WHSC1, but that Chk2 phosphorylation 6 h after release from the HU block suggests that activation was impaired even in the presence of increased RPA and cells lacking WHSC1 create more DNA damage in the process of H2AX phosphorylation, suggested that ATR was functional but replication stress recovery than WT cells, and this damage persists. the ATM pathway may be impaired. Thus, we examined the con- sequences of WHSC1 depletion in the ATM portion of the DDR. CHK2 Activation Is Impaired in the Absence of WHSC1 Protein. To p53-binding protein 1 (53BP1) is a mediator/adaptor of the DNA further investigate the integrity of the DDR in the absence of damage response and is recruited to nuclear structures termed foci WHSC1, we examined the activation of CHK2. HCT116 cells in response to double-strand breaks in an ATM-dependent man- were treated with 500 μM HU for 24 h and released to HU-free ner. The recruitment of 53BP1to foci requires multiple protein– media. As shown in Fig. 3A, HU treatment resulted in the de- protein interactions and posttranslational modifications, and is not tection of Thr68 CHK2 phosphorylation in nuclear foci in WT understood completely. cells. However, the signal of CHK2 Thr68 foci showed a signifi- To investigate if 53BP1 localization is regulated by WHSC1, we cantly diminished intensity in the absence of WHSC1, suggesting depleted WHSC1 in HCT116 cells and examined HU-induced that HU-induced CHK2 phosphorylation depends upon WHSC1. 53BP1 foci formation. Cells were treated with 500 μM HU for 24 h Immunofluorescence with phosphoantibodies is potentially pro- and processed for immunostaining to visualize 53BP1 and γH2AX blematic due to cross-reaction with other phosphoepitopes. To foci formation. In cells expressing the FF hairpin, 24-h HU provide further support, we performed Western blotting for treatment resulted in the appearance of clear 53BP1and γH2AX CHK2 p-Thr68. In control cells, CHK2 became phosphorylated foci. However, in cells lacking full WHSC1 function, reduced on Thr68, and this phosphorylation gradually diminished over numbers of 53BP1foci were detectable after HU treatment. This time after release into HU-free media. In the WHSC1-depleted result suggests that WHSC1 is required for either the recruitment cells, CHK2 activation was significantly impaired at zero time and or the retention of 53BP1 at DNA damage sites (Fig. 4A).

Hajdu et al. PNAS Early Edition | 3of5 Downloaded by guest on October 1, 2021 53BP1 is recruited to sites of DNA damage in part through its complete disappearance of the bulk K20me2 form of H4 that Tudor domain, which binds methylated histone residues at the sites coincided with the appearance of significantly enhanced H4K20 of damage. Methyl-histone–mediated recruitment of 53BP1to trimethylation. In WHSC1-depleted cells, we did not observe an DNA-damaged sites has been described but remains controversial. HU-induced change in the methylation status of H4K20, sug- One of the residues implicated in this recruitment is the dime- gesting that WHSC1 mediates H4K20 trimethylation upon DNA thylated histone H4 lysine 20 (H4K20me2). However, a role for replication stress. H4K20me3 in the recruitment of 53BP1 to sites of damage has not been ruled out. WHSC1 has been previously shown to have histone Discussion methyltransferase activity through its SET domain. To examine Rapidly accumulating evidence suggests that in addition to their whether the methyltransferase activity of WHSC1 plays a role in apparent role in carcinogenesis, the DNA damage response play the recruitment of 53BP1to damage foci, we generated a point an important role in human development and neuronal homeo- – mutant in the WHSC1 SET domain (Y1092A), in a residue known stasis (2, 3). The Wolf Hirschhorn syndrome candidate 1 gene to be essential for histone methyltransferase activity. shRNA-re- (WHSC1/MMSET) is located on the short arm of chromosome 4, sistant forms of the WT and SET domain mutant WHSC1 gene deleted in WHS, and likely accounts for a number of the char- were expressed, infected with shRNA WHSC1 virus to deplete acteristic phenotypes of the syndrome. WHS is a developmental endogenous WHSC1. These cells were examined for 53BP1 re- syndrome with neurological and immunological impairment. Al- cruitment to foci in response to HU. WT WHSC1 rescued the though it shares phenotypes in common with a number of DDR- 53BP1 foci formation defect, whereas the SET domain mutant did defective syndromes, no link has been drawn between proteins not. Taken together, these results indicate that WHSC1 plays affected by the 4p deletion and DDR pathways. In this study we a role in the recruitment of 53BP1 to DNA damage foci via an identify WHSC1 as an integral component of the DDR. activity associated with its histone methyltransferase SET domain, The involvement of WHSC1 in the DDR is based on multiple lines of evidence. First, WHSC1 was identified in a HU sensitivity and also rule out a possible off-target effect on 53BP1 localization screen, suggesting a role in the DNA replication stress response. of the WHSC1 hairpin used in this study. Depletion of WHSC1 resulted in increased levels of DNA dam- To further investigate how the methyltransferase activity of age induced by HU, slower recovery kinetic from replication WHSC1 impacts the methylation status of H4K20, we followed stress, and, as a consequence, increased Chk1 activation. Second, the methylation status of the H4K20 residue by Western blot in WHSC1 depletion sensitizes cells to a wide variety of genotoxic HU-treated, WHSC1-depleted, and control cells. As shown in B μ agents, such as camptothecan, mitomycin C, IR, and UV light. Fig. 4 , in control cells, 2 h of 500- M HU treatment caused the Finally, like many DDR factors directly involved in controlling events at the sites of DNA damage, WHSC1 accumulates at the sites of DNA damage induced by laser microirradiation. To- A p-H2AX 53bp1 DAPI gether, these observations strongly suggest that WHSC1 is an integral member of the DDR network. The mechanism of WHSC1’s role in response to DNA damage FF shRNA is not completely clear, but a clue to its function comes from its domain structure. WHSC1 has a histone methyltransferase SET domain, and several proteins containing this domain have been WHSC1 shRNA implicated in the DDR. Lysine 20 of histone H4 is mono-, di-, or trimethylated in vivo, but the regulation and significance of the different methylation stages is poorly understood. It is believed that H4K20 methylation plays an important role in the DDR by WHSC1 shRNA contributing to the recruitment of 53BP1 to double-stranded +shRes breaks (20, 21). However, much uncertainty surrounds the role of H4K20 methylation in the focal recruitment of 53BP1 upon replication stress. Our study shows that upon HU treatment, WHSC1 shRNA +shRes SET H4K20 becomes trimethylated in bulk, and this trimethylation is dependent upon WHSC1. It has been recently shown that replication stress induces the relocalization of 53BP1 into nuclear +++---FFsh foci (22). According to our observations, the methyl transferase B ---+++ WHSC1sh activity of WHSC1 is essential for 53BP1 localization to sites --++ ++HU fi 0h 0h 6h 6h Release from HU (h) of replication stress. Consistent with this nding, we found that WHSC1 was also required for CHK2 phosphorylation upon anti-H4K20me2 replication stress. The defect in CHK2 activation in the absence of WHSC1 is consistent with the dysregulation of 53BP1 re- −/− anti-H4K20me3 cruitment to sites of replication stress, given that 53BP1 cells have impaired CHK2 activation. During the course of the study, anti-GADPH WHSC1 was also found to control 53BP1 localization in response to IR (23). Fig. 4. WHSC1 controls histone H4K20 methylation and 53BP1 localization Our findings suggest that control of trimethylation of the in response to DNA replication stress. (A) Impaired localization of 53BP1 to H4K20 residue by WHSC1 may be required for 53BP1 re- sites of replication stress in the absence of WHSC1. HCT116 cells expressing cruitment to sites of DNA replication stress. Alternatively, a FF, WHSC1 shRNAs, or WHSC1 shRNA together with an shRNA-resistant WT WHSC1 methylation substrate other than H4K20 could be re- μ or SET mutant WHSC1 cDNA were treated with 500 M HU for 24 h and sponsible for the recruitment. Although it has been shown in vitro processed for immunostaining to visualize p-H2AX (red) and 53BP1(green). Nuclei were stained with DAPI. (B) WHSC1 regulates the methylation status that 53BP1 binds H4K20me2 and does not bind H4K20me3 (21), of H4K20 upon DNA replication stress. HCT116 cells expressing FF or WHSC1 it is possible that in vivo, in the context of a replication stress, the shRNAs were treated with 500 μM HU. Cells were released into HU-free trimethylation marks function in the initial 53BP1 recruitment media and collected, lysed at the indicated times, and immunoblotted to directly or indirectly. One unexplained observation by Jackson determine H4K20 methylation. GADPH was used as a loading control. and coworkers (24), and also observed here, is that the bulk

4of5 | www.pnas.org/cgi/doi/10.1073/pnas.1110081108 Hajdu et al. Downloaded by guest on October 1, 2021 H4K20me2 appears to be converted to H4K20me3 in response to H4K20me3 Millipore 07-463; WHSC1 Abcam ab28470-50; P-H2AX Millipore HU-induced replication stress. If 53BP1 requires H4K20me2, 05-636; 53BP1 Bethyl A300-272A; Phospho-Chk2(T68) Cell Signaling no. converting it to H4K20me3 should interfere with 53BP1 locali- 2661S; GAPDH Santa Cruz sc-25778; Phospho-RPA32 Bethyl 800-338-9579. zation. Instead, if we deplete WHSC1, which allows H4K20me2 Plasmid DNA and siRNA transfections were performed using Lipofectamine to be maintained in the presence of replication stress, 53BP1 no 2000 or RNAiMAX, respectively, as suggested by the manufacturer, with the longer localizes to replication stress foci. Either the abundance of final siRNA concentration of 20 nM. WHSC1-targeting siRNA and shRNA H4K20me2 at sites of replication stress behaves differently from sequences used in this study were as follows: siRNA: uauagcugugaagga- bulk H4K20me2, or the requirements for 53BP1 localization after guggaucugc (10620319; Invitrogen); shRNA: ttcccgtaaggcttattacct. replication stress are different from those previously thought. fl This study describes a role for the SET methyltransferase Laser-Induced Damage and Immuno uorescence. Laser microirradiation and immunofluorescent studies were performed as described previously (25, 26). domain of WHSC1 in the localization of the mammalian DDR factor 53BP1 to chromosomal sites experiencing replicational Sensitiviy to DNA Damaging Agents. WHSC1-silenced and -nontargeting siRNA stress, and the activation of the Chk2 kinase. The discovery of or shRNA (FF)-transfected HCT116 cells were plated onto 96-well plates and a WHSC1-dependent H4K20 trimethylation upon replication treated with MMS (methyl methanesulfonate), Camptothecin, HU, and UV as stress uncovers an added level of complexity in replicational ’ indicated. Two days later, the viability of the cells was determined using the stress response processes. We propose that WHSC1 s role in the CellTiter-Blue reagent (Promega), and the average of four experiments DNA damage and DNA replication stress response is a cause of was plotted. the developmental and neurological impairment observed in Wolf–Hirschhorn syndrome patients, thereby linking WHS to Western Blots and Immunoprecipitation. HCT116 cells were transfected with other known DDR syndromes, such as Seckel and A-T. different combinations of expression plasmids, shRNA-expressing plasmid, or siRNA as indicated. At 48 h later, the cultures were split, treated with 500 μM Experimental Procedures HU for 24 h, and released into HU-free media for another 6 h. Cells were Cell Culture, Plasmids, and Antibodies. HCT116 and U2OS cells were grown in collected at the indicated times and lysed in buffer A [10 mM Tris·HCl (pH DMEM supplemented with 10% (vol/vol) FBS (Invitrogen), 100 units/mL 7.6), 1 mM EDTA, 400 mM NaCl, 15% glycerol, 0.5% Nonidet P-40, phos- penicillin, and 0.1 mg/mL streptomycin WHSC1 in pDONR223 was recombined phatase inhibitor cocktail (4906837001; Roche), and Complete Mini Protease into appropriate recipient vectors using LR Clonase (Invitrogen). Mutagenesis Inhibitor Tablet (1 836 153; Roche)]. was performed with the QuikChange Site-Directed Mutagenesis Kit using the following primers: shRNA-resistant WHSC1: ccccaccatacaagcacatcaaggtgaa- ACKNOWLEDGMENTS. We thank the members of the S.J.E. laboratory for CELL BIOLOGY taaaccgtatggaaaagtccagatctacac; siRNA-resistant WHSC1: ctggggcgcaccaaa- advice and reagents. This work was supported by grants from the National caattgcacgtgatactggcgtg; WHSC1 SET Y1092A: gggagaatttgttaacgaggccgt- Institutes of Health and the Department of Defense. S.J.E., I.H., and A.C. are tggggagctgatcgac. The antibodies used in this study were as follows: P-Chk1 long-term postdoctoral fellows of the European Molecular Biology Organi- (S317) Cell Signaling, no. 2344S; H4K20me2 Cell Signaling no. 9759S; zation. S.J.E. is an investigator with the Howard Hughes Medical Institute.

1. Harper JW, Elledge SJ (2007) The DNA damage response: Ten years after. Mol Cell 28: 14. Hanley-Lopez J, Estabrooks LL, Stiehm R (1998) Antibody deficiency in Wolf–Hirsch- 739–745. horn syndrome. J Pediatr 133:141–143. 2. Jackson SP, Bartek J (2009) The DNA-damage response in human biology and disease. 15. Hirschhorn K, Cooper HL (1961) Chromosomal aberrations in human disease. A review Nature 461:1071–1078. of the status of cytogenetics in medicine. Am J Med 31:442–470. 3. Ciccia A, Elledge SJ (2010) The DNA damage response: Making it safe to play with 16. Keats JJ, Reiman T, Belch AR, Pilarski LM (2006) Ten years and counting: So what do knives. Mol Cell 40:179–204. we know about t(4;14)(p16;q32) multiple myeloma. Leuk Lymphoma 47:2289–2300. 4. Lee JH, Paull TT (2005) ATM activation by DNA double-strand breaks through the 17. Nimura K, et al. (2009) Histone H3 lysine 36 trimethyltransferase links Nkx2-5 to Wolf– Mre11-Rad50-Nbs1 complex. Science 308:551–554. Hirschhorn syndrome. Nature 460:287–291. 5. Stucki M, Jackson SP (2006) gammaH2AX and MDC1: Anchoring the DNA-damage- 18. Matsuoka S, et al. (2007) ATM and ATR substrate analysis reveals extensive protein response machinery to broken chromosomes. DNA Repair (Amst) 5:534–543. networks responsive to DNA damage. Science 316:1160–1166. 6. Huen MS, et al. (2007) RNF8 transduces the DNA-damage signal via histone ubiq- 19. Lu C, et al. (2006) Cell apoptosis: Requirement of H2AX in DNA ladder formation, but uitylation and checkpoint protein assembly. Cell 131:901–914. not for the activation of caspase-3. Mol Cell 23:121–132. 7. Cotta-Ramusino C, et al. (2011) A DNA damage response screen identifies RHINO, a 20. Greeson NT, Sengupta R, Arida AR, Jenuwein T, Sanders SL (2008) Di-methyl H4 lysine 9-1-1 and TopBP1 interacting protein required for ATR signaling. Science 332: 20 targets the checkpoint protein Crb2 to sites of DNA damage. J Biol Chem 283: 1313–1317. 33168–33174. 8. Yang XH, Zou L (2006) Checkpoint and coordinated cellular responses to DNA dam- 21. Botuyan MV, et al. (2006) Structural basis for the methylation state-specific recog- age. Results Probl Cell Differ 42:65–92. nition of histone H4-K20 by 53BP1 and Crb2 in DNA repair. Cell 127:1361–1373. 9. Zou L, Elledge SJ (2003) Sensing DNA damage through ATRIP recognition of RPA- 22. Lukas C, et al. (2011) 53BP1 nuclear bodies form around DNA lesions generated by ssDNA complexes. Science 300:1542–1548. mitotic transmission of chromosomes under replication stress. Nat Cell Biol 13: 10. Biton S, Barzilai A, Shiloh Y (2008) The neurological phenotype of ataxia-telangiectasia: 243–253. Solving a persistent puzzle. DNA Repair (Amst) 7:1028–1038. 23. Pei H, et al. (2011) MMSET regulates histone H4K20 methylation and 53BP1 accu- 11. Katyal S, McKinnon PJ (2008) DNA strand breaks, neurodegeneration and aging in the mulation at DNA damage sites. Nature 470:124–128. brain. Mech Ageing Dev 129:483–491. 24. Tjeertes JV, Miller KM, Jackson SP (2009) Screen for DNA-damage-responsive histone 12. Kerzendorfer C, O’Driscoll M (2009) Human DNA damage response and repair de- modifications identifies H3K9Ac and H3K56Ac in human cells. EMBO J 28:1878–1889. ficiency syndromes: Linking genomic instability and cell cycle checkpoint proficiency. 25. Bekker-Jensen S, et al. (2006) Spatial organization of the mammalian genome sur- DNA Repair (Amst) 8:1139–1152. veillance machinery in response to DNA strand breaks. J Cell Biol 173:195–206. 13. Battaglia A, Carey JC (2008) Wolf–Hirschhorn syndrome and the 4p-related syn- 26. Smogorzewska A, et al. (2007) Identification of the FANCI protein, a mono- dromes. Am J Med Genet C Semin Med Genet 148C:241–243. ubiquitinated FANCD2 paralog required for DNA repair. Cell 129:289–301.

Hajdu et al. PNAS Early Edition | 5of5 Downloaded by guest on October 1, 2021