Detection, Occurrence, and Survey of Rice Stripe and Black-Streaked Dwarf Diseases in Zhejiang Province, China

Detection, Occurrence, and Survey of Rice Stripe and Black- Streaked Dwarf Diseases in Zhejiang Province, China

1 2 1 3 1 ZHANG Heng-mu , WANG Hua-di , YANG Jian , Michael J ADAMS , CHEN Jian-ping (1State Key Laboratory Breeding Base for Zhejiang Sustainable Pest and Disease Control; Key Laboratory of Plant Protection and Biotechnology, Ministry of Agriculture, China; Zhejiang Provincial Key Laboratory of Plant Virology, Institute of Virology and Biotechnology, Zhejiang Academy of Agricultural Sciences, Hangzhou 310021, China; 2Zhejiang Provincial Station of Plant Protection and Quarantine, Hangzhou 310020, China; 3Rothamsted Research, Harpenden, Herts AL5 2JQ, UK)

Abstract: The major viral diseases that occur on rice plants in Zhejiang Province, eastern China, are stripe and rice black-streaked dwarf diseases. Rice stripe disease is only caused by rice stripe tenuivirus (RSV), while rice black-streaked dwarf disease can be caused by rice black-streaked dwarf fijivirus (RBSDV) and/or southern rice black-streaked dwarf fijivirus (SRBSDV). Here we review the characterization of these viruses, methods for their detection, and extensive surveys showing their occurrence and spread in the province. Key words: viral diseases; rice stripe tenuivirus; rice black-streaked dwarf fijivirus; southern rice black- streaked dwarf fijivirus; surveys

Zhejiang Province, located in eastern China, is known caused more than 50% losses in rice production in as a fertile land of fish and rice, and has a long history some fields (Kuribayashi, 1931; Amano, 1933). It also of rice cultivation going back as many as 7 000 years. occurred in rice-growing areas of Korea and the Rice accounts for more than 80% of the total production former Union of Soviet Socialist Republics (USSR) of grain food crops in the province. However, many resulting in significant yield loss in epidemic years viral or virus-like diseases, including rice black- (Hibino, 1996). Diseased rice plants often display streaked dwarf, rice dwarf, rice gall dwarf, rice grassy chlorotic stripes, chlorosis, moderate stunting and loss stunt, rice ragged stunt (Lin et al, 1984; Shen et al, of vigor. In China, rice stripe disease occurred for the 1989), rice stripe (Zhang et al, 2007a), rice transitory first time in the Yangtze River Delta, eastern China, in yellowing (or rice yellow stunt) (Wu et al, 1980), and the early 1960s (Zhu et al, 1964), then spread to rice tungro diseases (Zhou et al, 1992), have posed eastern and southern China. Eventually, the epidemic serious threats to rice cultivation. These rice virus affected about 2 660 000 hm2 of rice fields in over 20 diseases emerge quickly, spread rapidly, and can be provinces, with a disease incidence of 10% to 20% in very destructive. They are also difficult to be cured general and 50% to 80% in serious cases, and resulted once they have occurred. During the past century, the in great loss of rice yield (Lin et al, 1990; Zhang et al, different virus diseases have emerged and disappeared 2007a). In Zhejiang Province, where the first outbreak in succession. Outbreaks of some diseases, especially had occurred and the disease had been a major rice stripe and black-streaked dwarf, have caused constraint on rice production, the disease suddenly destructive losses more than once in Zhejiang Province, and completely disappeared for a decade in the 1990s. China. Rice plants with stripe or black-streaked dwarf However, since the beginning of this century, it has disease often produce poor panicles or none at all, re-emerged in this region and has spread very rapidly leading to significant loss of yield. to become the most economically destructive disease Rice stripe disease was first discovered in the central on rice. In some regions where the epidemic was part of Japan at the end of the 19th century, where it severe, both disease incidence and yield loss exceeded 50%. In some of the fields, there was even no harvest. In recent years, the disease has also become of Received: 26 March 2013; Accepted: 17 April 2013 increasing importance on japonica rice in the province. Corresponding author: ZHANG Heng-mu ([email protected]); In the northern part of the province where the disease CHEN Jian-ping ([email protected]) has mostly occurred, japonica rice is generally grown 384 Rice Science, Vol. 20, No. 6, 2013 as a single summer crop (May to October), alternating is reported to infect as many as 80 species of the with winter crops that may include other cereals (such as family Gramineae (Shinkai, 1962; Ruan et al, 1984b). wheat or barley) or oilseed rape. It is transmitted by the small brown planthopper Black-streaked dwarf disease was also first reported (SBPH), Laodelphax striatellus Fallen, in a persistent in Japan (Kuribayshi and Shinkai, 1952). There have manner and can be passed through the eggs to about been sporadic, but serious outbreaks of rice black- 90% of progeny insects for as many as 40 generations streaked dwarf disease in Japan and Korea. Infected (Falk and Tsai, 1998; Toriyama, 2000). The complete plants are severely stunted with darkened leaves and genome sequence of rice stripe virus Zhejiang isolate white waxy or black-streaked swellings along the was reported in 2007. Its genome was similar in veins on the underside of the leaf blades, sheaths and organization and size to that of the Japanese and other culms. Huge losses in rice production have been Chinese isolates, totalling 17 114 nucleotide (nt) (Zhang reported in epidemic years (Lee et al, 1977; Ruan et al, et al, 2007b). The segments shared 92%–97% nt and 1984a; Chen, 1996; Hibino, 1996). In China, the disease 93%–100% amino acid (aa) identities with the was first reported on rice in Linhai County, Zhejiang corresponding segments of the other RSV isolates. Its Province in 1963, and the first major outbreak occurred genome comprises four single-stranded RNAs; the in Linhai, Xianju and Tiantai Counties of the province largest (RNA1) has a single large open reading frame in 1965–1966 (Ruan et al, 1984a). In the following 30 (ORF) on the viral complementary strand, while all other years, the disease declined greatly and the infected segments are bicistronic and have an ambisense coding plants became very difficult to be found. The reasons strategy. The functions of the proteins encoded on viral are probably complex, but include insecticidal sprays (v) and complementary (vc) strands are thought to against the vector and farming practices that remove include an RNA-dependent RNA polymerase (vcRNA1), the weeds on which both virus and vector overwinter. a membrane glycoprotein precursor (vcRNA2), an In addition, cultivars grown during this period appear to inclusion-body-associated protein (vRNA3), a be relatively resistant to the virus (Chen, 1996). In nucleocapsid protein (vcRNA3) and a major nonstructural, consequence, there was little research on the disease disease-related protein (vRNA4). In addition to for many years. However, since 1996, the disease has polymerase modules, the pc1 protein encoded on re-emerged and expanded very rapidly to become an RNA1 harbors an ovarian tumour (OTU)-like cysteine economically destructive disease in the central and protease signature near its N-terminus, suggesting that southern parts of Zhejiang Province, where there are the protein might yield the viral polymerase and one usually two seasons of rice a year. Early rice is sown or more additional proteins by autoproteolytic cleavage in nursery beds in mid-April and transplanted to the and/or have deubiquitination activity. A novel inverted fields in May for harvesting by the end of July. Late rice repeat sequence motif was found to be universal is sown in late June, transplanted in late July and within the intergenic regions of ambisense genome harvested by October. Wheat, barley or sometimes segments of Tenuivirus, supporting the possibility that it oilseed rape are then commonly grown during the may be functionally important, perhaps in regulating winter. The disease affects all cereal crops, but is transcription termination. usually most severe in the late rice. In some areas, Rice black-streaked dwarf disease (RBSDD) in disease incidence exceeded 90%. Zhejiang Province is caused by single or mixed infection Both diseases remain two of the most important of two different fijiviruses. Rice black-streaked dwarf viral diseases in Zhejiang Province today. In response virus (RBSDV), a recognized species in the genus to the serious and growing viral disease problems, the Fijivirus (family Reoviridae), that is also mostly Zhejiang Provincial Department of Science and transmitted by the SBPH (L. striatellus) in a persistent Technology, China launched a series of research projects (propagative) manner, but not via its eggs (Shinkai, during the period of 1996 to 2013, involving dozens of 1962, 1967; Shikata, 1974). The second virus is agricultural research and extension organizations to southern rice black-streaked dwarf virus (SRBSDV) monitor the diseases, investigate their epidemiology (also named rice black-streaked dwarf virus 2, RBSDV- and establish disease control strategies. 2), a novel tentative member of the genus Fijivirus (family Reoviridae) (Zhang H M et al, 2008; Zhou et al, Characteristics of viral pathogens 2008). This virus is mainly transmitted by the white- Rice stripe disease (RSD) is caused by rice stripe virus backed planthopper (WBPH), Sogatella furcifera Horvath, (RSV), the typical member of the genus Tenuivirus, and which is a widespread migratory pest throughout the

ZHANG Heng-mu, et al. Rice Stripe and Black-Streaked Dwarf Diseases in Zhejiang Province 385 main rice-growing areas in eastern Asia (Shen et al, late rice suffered a slightly higher yield penalty 2003; He et al, 2012). In Zhejiang Province, SRBSDV (0.92% for every 1% increase in disease incidence) was first reported in Wuyi County, in the central than the early one (0.80%). region of the province, in 2009. Trajectory analysis In experiments in northern Zhejiang where rice was suggested that WBPH and the virus it carried probably sown at different dates between 25 May and 20 June came from Guangdong, Guangxi, southern Fujian and (Wang et al, 2008), the earliest sown crops had the southern Jiangxi of China (Zhao et al, 2011). The two largest RSV incidence and suffered the most yield loss. viruses have similar particle morphology, serology, Yields of treated plots were similar from the first four cytopathology and typical symptoms. For this reason, sowing dates showing that sowing could be delayed SRBSDV was initially considered as an isolate of until mid-June without yield loss. Sowing date also RBSDV when it was first found in Yangjiang City, had a large effect on RBSDV incidence and subsequent Guangdong Province, China (Zhou et al, 2004), but grain yields in both early indica and late japonica rice the two viruses are now considered distinct on the in central Zhejiang (Wang et al, 2009). The earliest basis of sequence analysis and differences in vector sown plots always had the most serious diseases and specificity (Zhang H M et al, 2008; Zhou et al, 2008). the diseases (and subsequent yield loss) could largely The genomes of RBSDV and SRBSDV both have ten be avoided by later sowing (end of April for the early linear genomic segments of double-stranded RNA indica rice and early August for the late japonica rice) (dsRNA), ranging in size from approximately 4.5 to (Wang et al, 2008, 2009; Zhu et al, 2009). The diseases 1.8 kb and named S1 to S10 according to their may also be managed by timely insecticide sprays and mobility in gel electrophoresis. S1, S2 and S10 are the use of some hybrid rice cultivars (e.g. Xieyou 963) most conserved with identities of 78.5%–79.2% nt and which have useful levels of resistance to RBSDV 83.4%–89.0% aa, while S5 and S6 are the least (Wang et al, 2009). conserved with 70.6%–71.6% nt and 63.1%–69.9% aa The epidemiology of these diseases is closely identities (Zhang et al, 2001a, b, 2008; Zhou et al, linked to the life-cycle of their planthopper vectors. 2008; Wang et al, 2010, Ta et al, 2011). Sequence Studies on RBSDV (Wang et al, 2009) showed how analysis also showed that SRBSDV Zhejiang isolate the small brown planthopper numbers on the winter shared high homologies with isolates from Guangdong cereal crop increased as temperatures rose in spring, and Hainan of China, and Vietnam, suggesting that mainly because of overwintering insects that migrated these viral isolates were derived from the same ancestor. from weed hosts. Eggs were laid in early-mid April and this resulted in a peak of nymphs in early May at Damage and epidemiology a time when the early indica rice was at a young The damage from these viruses was measured in seedling stage in nurseries or fields. The adult peak of several experiments. For RSV (Wang et al, 2008), the first generation was consistently around 20 May, there was a strong correlation between yield loss and and RBSDV transmission at this time was responsible disease incidence (r2 = 0.949). The relationship was for the symptoms that appeared on the rice after similar across different experimental sites and every transplanting. The second generation of planthoppers 1% increase in disease incidence indicated an average at the end of June (peaking in mid-July) spread virus yield loss of 0.8%. In experiments for RBSDV (Wang within the early rice and into the seedling nurseries of et al, 2009), different disease levels were established late japonica rice. Seedlings of late japonica rice are by introducing different numbers of vectors at the usually sown on about 18 June and transplanted in late seedling stage or by sowing rice on different dates. July to early August in Zhejiang Province. This provides The yield loss percentages (y) were strongly correlated many opportunities for large numbers of planthoppers with disease incidence (x) in both early indica and late to migrate from the early indica rice at heading stage japonica rice: to the nurseries before transplanting and symptoms (a) early indica rice: may appear at this stage. The numbers of planthoppers y = 0.80 (± 0.014) x - 0.03 (± 0.147); r2 = 0.949 declines in the hot weather of July-August but the (b) late japonica rice: insects become more active and numbers increase as y = 0.92 (± 0.087) x - 0.65 (± 0.269); r2 = 0.990 temperatures decrease in late September to October. The slopes of these lines differ significantly (P < After harvesting of the late japonica rice, the vectors 0.001), suggesting that at similar disease levels, the migrate first to grass weeds and volunteer rice plants

386 Rice Science, Vol. 20, No. 6, 2013 and then to barley and wheat in November. Enzyme-linked immunosorbent assay (ELISA) is a This expanding epidemic and increasing inoculum useful method for high-throughput detection of viruses of RSV is also associated with increasing populations due to its low cost but there is a close serological of viruliferous vectors early in the season and these relationship between RBSDV and SRBSDV and an are clearly the primary sources of the epidemic (Wang antiserum that can discriminate between the two has et al, 2008). Experiments confirmed that rice was the not yet been prepared. This has highlighted the need most susceptible at the seedling stage (three to five for a rapid and simple method for simultaneous leaves) and, in the fields, plants are often at this stage detection of the three viruses. With their genomic in northern Zhejiang in mid-June to early July, coinciding sequences determined, molecular methods were therefore with the emergence of the first generation for L. established for detection of these viruses. A nested or striatellus vectors. Epidemics in Japan were triggered one step RT-PCR was developed to distinguish SRBSDV by earlier transplanting of rice seedlings at a time from RBSDV (Zhou et al, 2008; Zhou et al, 2010; Ji et al, which coincided with the peak migration of the vector 2011). A recent report describes a reverse-transcription (Kiritani, 1983; Toriyama, 2000), and experiments in loop-mediated isothermal amplification (RT-LAMP) Japan and Korea showed that disease incidence was assay for detection of nine rice viruses (Le et al, 2010), much reduced if sowing was delayed from early-mid but this assay does not include SRBSDV. RT-PCR-based May until mid-June (Kiritani et al, 1987; Bae and Kim, assay remains one of the best options for the early 1994). Our experiments have also shown that disease detection and accurate diagnosis of plant RNA viruses incidence and therefore yield loss were much less due to its rapidity, sensitivity and reproducibility (Cai when the rice was sown later, thus avoiding exposure et al, 2003; Zhang X et al, 2008). In view of the current to these vectors (Wang et al, 2008). There are unknown epidemiological situation of viral diseases on rice disadvantages to this delay in sowing, which also plants in Zhejiang Province, we also developed a reduces the risk of damage from the stem borer Chilo multiple RT-PCR method for simultaneous detection suppressalis that results from eggs laid on rice plants of RSV, RBSDV and SRBSDV. Our protocol was by the over-wintering generation (Zhu et al, 2011). designed from a large number of sequences to detect all isolates of these viruses. The sizes of the Method for simultaneous detection of the three amplification products are specific for each virus and viral pathogens easy to distinguish from one another. We therefore aligned Because of their host range and epidemiological all the known (published and unpublished) nucleotide properties, the three viruses often overlap epidemically sequences of the capsid protein genes of the three to some degree. During 2009–2011, studies in Zhejiang viruses, and then designed three pairs of primers Province showed that all the three viruses and both (Table 1), in which DRS-1/2, DRB-1/2 and DRZ-1/2 planthoppers (SBPH and WBPH) occurred in the were specific for detection of RSV, RBSDV and same county and even in the same paddy fields and on SRBSDV, respectively. To eliminate false negatives, the same rice plants. The similarity of symptoms and we selected the Actin gene as an internal reference and complex patterns of infection in fields make diagnosis designed a pair of universal degenerate primers for difficult, but accurate measurement of the viruliferous amplification of Actin genes from SBPH, WBPH, rice ratio of planthoppers and the incidence of diseased and maize plants (Wu et al, 2013). plants are pivotal for predicting and monitoring The conditions for the multiple reverse transcription- epidemics and for control of these viral diseases. polymerase chain reactions (mRT-PCRs) were optimized

Table 1. Primers designed for detection of rice stripe tenuivirus (RSV), rice black-streaked dwarf fijivirus (RBSDV) and southern rice black- streaked dwarf fijivirus (SRBSDV). Primer name Sequence (5′–3′) Target Size of target fragment (bp) DRS-1 CACTCTAGCTGATTTGCAGAAGGCA RSV 757 DRS-2 GGTCTTCACTTTCCCATTGGTGATG DRB-1 ACTAAGCTTATTTGCTACCTCCAAAC RBSDV 592 DRB-2 ATTAGTRCGCAAMGTGGACAAACTG DRZ-1 CGCTTTAGATGCTGACAAATCACTTTTA SRBSDV 142 DRZ-2 CTCCTTTTCTAAGTGCAGACAGTCC ACT-1 CCYGAYGGYCARGTRATCACMATTGG Actin 347 ACT-2 GAKATCCACATCTGYTGGAARGTG K = G, T; M =A, C; R = A, G; Y = C, T.

ZHANG Heng-mu, et al. Rice Stripe and Black-Streaked Dwarf Diseases in Zhejiang Province 387 by a series of preliminary experiments. This resulted the disease affected 55 000 hm2 (66% of the total rice- in an efficient protocol as follows: a reverse transcription growing area). Most crops had 10%–30% incidence, at 50 °C for 30 min; a pre-denaturation step at 94 °C with up to 80% in the worst cases, sometimes leading for 2 min; 30 cycles of 30 s at 94 °C, 30 s at 63 °C, to complete yield loss. Linhai, Wenling, Xianju, Tiantai, and 60 s at 72 °C; and a final extension at 72 °C for 10 Taizhou, Yueqing, Cangnan, Longyou, Lanxi and Yiwu min. In the RT-PCR optimization results, there were were the most seriously affected counties. The data no obvious differences between the four types of show evidence of a decline in 2006 and 2007, believed samples (rice, maize, SBPH and WBPH). The analysis to result from the adoption of improved control measures. results consistently indicated that the primer pairs were Rice stripe disease re-emerged first in Changxing, specific for the three viruses and that the mRT-PCR Wuxing and Haiyan Counties in 2003 and spread method could be efficiently used to detect them rapidly from the north of the province to the central simultaneously and that the method was highly sensitive and eastern parts with increasing incidence each year. (up to 1/10 000 dilution of samples). The mRT-PCR It reached the Hang-Jia-Hu Plain, covering an area of 2 method has been successfully used to detect viruses in approximately 66 000 hm in 2004, and, by 2005, 18 rice and maize plant samples and in single SBPH and counties in all had reported the disease, while, in the WBPH vector insects (Wu et al, 2013). two northern cities of Huzhou and Jiaxing, it was estimated that about 23 000 hm2 (14% of fields) of the Intensive surveys of these viral diseases in Zhejiang japonica rice growing region was affected. Tiantai and Province Qingtian Counties, in the middle and southern regions Survey during 1989–2007 of the province, also reported the disease in 2006, Before SRBSDV was characterized (Zhang H M et al, while the average disease incidence in Huzhou and 2008; Zhou et al, 2008), these viral diseases were Jiaxing increased further. In the whole province, an intensively monitored in the affected counties of estimated 100 000 hm2 of the rice crop was infected, Zhejiang Province by ELISA (Wang et al, 2008, 2009). of which one-third in the north was severe (Changxing, Rice black-streaked dwarf disease re-emerged on Wuxing, and Haiyan, where average incidence exceeded late japonica rice Shanyou 10 in Shuanggong Town, 10%). In Changxing alone the disease affected 23 300 Linhai, in 1989, and during the 1990s the affected area hm2 and 21 500 hm2 in 2005 and 2006, respectively, expanded, with four major outbreaks in 1992, 1996, representing 57% to 58% of the total rice-growing 1997 and 1998. In Linhai City, the disease spread area in the county and causing substantial loss of rice from two towns to 23 towns (and from circa (c.) 1 200 production. Moderate levels of disease (average of 1% 2 to c. 8 600 hm ) in 1992 and 1998, respectively. Similarly, to 5% plants infected) occurred in Nanhu and Xiuzhou the diseased area in Xianju County expanded from c. Districts, Tongxiang, Pinghu, Haining and Jiashan 2 2 330 hm in 1996 to c. 4 000 hm in 1998, and in Counties in Jiaxing City, Zhejiang Province. Elsewhere 2 Tiantai County, from c. 1 800 hm in 1996 to c. 6 000 the disease was mild, with average incidence lower 2 hm in 1998. In addition to late japonica rice, the than 0.1%. disease also infected early indica rice, barley, wheat and maize. Thus, in 1998 in Linhai, c. 530 hm2 of Survey from 2008 onwards barley and wheat were infected with an average The mRT-PCR method described above enabled us to incidence of 30% ranging from 4%–80% and c. 800 simultaneously detect three viruses and was routinely hm2 of early indica rice were infected with an average used to further investigate the distribution of the three incidence of 24% (12%–58%). In Tiantai County in viruses in plants (maize and rice) and planthoppers the same year, c. 667 hm2 of barley and wheat and c. 1 (SBPH and WBPH) sampled from 57 of the 70 800 hm2 of early indica rice were infected (average counties or cities throughout Zhejiang Province during incidence 10%). The disease became a serious threat 2008–2011. Most plant samples contained only a to rice production in these counties. During 2000 to single virus and none contained all three, but two of 2005, the disease spread rapidly from the east part of the viruses were sometimes found in the same plant the province (Linhai, Xianju and Tiantai Counties) to samples. In particular, mixed infections of SRBSDV the central and southern parts. The total area of rice and RSV were detected in plant samples from a paddy affected throughout Zhejiang Province rose from field in Taizhou City, mixed infections of RBSDV and about 26 000 hm2 to a maximum of 64 640 hm2 in RSV were detected in plant samples from a paddy 2005. In one of severely affected areas, Taizhou City, field in Lin’an County and mixed infections of

388 Rice Science, Vol. 20, No. 6, 2013

RBSDV and SRBSDV were detected in plant samples positively or negatively) with that of RBSDV even from paddy fields in Taizhou and Linhai Cities, and though both viruses are transmitted by the same vector. Pujiang County. The few maize samples tested had Compared with previous survey of RBSDV and RSV only RBSDV, suggesting that maize rough dwarf (Wang et al, 2008, 2009), the current results show that disease in the province was still mainly caused by both viruses have continued to spread and are now RBSDV. In addition, RBSDV was detectable in some present in a further 12 (RBSDV) or 5 (RSV) counties WBPH samples and SRBSDV was detectable in some or cities although measures of disease incidence SBPH samples although these are not the principal (mostly less than 10%) have been decreasing, indicating vectors of the respective viruses. that control measures are effective and are still The general distribution of the three viruses in required to stop the spread of disease and minimize Zhejiang Province based on these latest detection yield loss (Wu et al, 2013). SRBSDV was first discovered results using mRT-PCR is shown in Fig. 1. RSV was in 2009 in Wuyi County, the central part of Zhejiang mostly found in the northern part of the province and Province and reach an epidemic peak in 2010. In Taizhou its distribution did not appear to be correlated (either City in 2010, the affected areas totaled 8 100 hm2 and

Fig. 1. Distributions of rice stripe tenuivirus (RSV), rice black-streaked dwarf fijivirus (RBSDV) and southern rice black-streaked dwarf fijivirus (SRBSDV) in Zhejiang Province, eastern China. Huzhou includes Wuxing and Nanxun districts; Jiaxing includes Nanhu and Xiuzhou districts; Hangzhou includes Yuhang, Xiaoshan, Jianggan, Bingjiang, Shangcheng, Xiacheng, Gongshu and Xihu districts; Shaoxing includes Yuecheng district; Ningbo includes Haishu, Jiangdong, Beilun, Jiangbei, Zhenhai and Yinzhou districts; Jinhua includes Jindong and Wucheng districts; Taizhou includes Jiaojiang, Huangyan and Luqiao districts; Lishui includes Liandu district; Quzhou includes Kecheng and Qujiang districts; Wenzhou includes Ouhai, Longwan and Lucheng districts.

ZHANG Heng-mu, et al. Rice Stripe and Black-Streaked Dwarf Diseases in Zhejiang Province 389 the average disease incidence was about 8%. The area (Laodelphax stiatellus Fallen) and incidence of rice virus disease by with more than 20% incidence was about 220 hm2 different seeding dates in dry seeded rice. Kor J App Ent, 33: 173–177. (Zhong et al, 2011). There were some seriously diseased Cai L J, Ma X Z, Kang L, Deng K J, Zhao S Y, Li C B. 2003. fields where the disease incidence exceeded 90% and Detecting rice stripe virus (RSV) in the small brown planthopper some where there was no harvest. In Quzhou City, the (Laodelphax striatellus) with high specificity by RT-PCR. J affected areas totaled about 6 200 hm2 and there was Virol Methods, 112(1/2): 115–120. Chen S X. 1996. Occurrence and research progress on rice viral no harvest from about 13 hm2 (Jiang et al, 2011). The diseases. Zhejiang Agric Sci, 1: 41–42. (in Chinese) latest results show that SRBSDV has been detected in Falk B W, Tsai J H. 1998. Biology and molecular biology of viruses at least 27 counties or cities (Fig. 1), showing that this in the genus Tenuivirus. Annu Rev Phytopathol, 36: 139–163. newly-emerging disease has also spread substantially He X C, Xu H X, Zheng X S, Yang Y J, Gao G C, Pan J H, Lu Z X. since its discovery (Wu et al, 2013). More effort is 2011. Ecological fitness of non-vector planthopper Sogatella needed to monitor and control the threat from this furcifera on rice plants infected with rice black-streaked dwarf novel viral disease. virus. Chin J Rice Sci, 25(6): 654–658. Hibino H. 1996. Biology and epidemiology of rice viruses. Annu CONCLUSIONS AND PROSPECTS Rev Phytopathol, 34: 249–274. Ji Y H, Gao R Z, Zhang Y, Chen Z B, Zhou T, Fan Y J, Zhou Y J. The studies summarized above have helped demonstrate 2011. A simplified method for quick detection of rice black-streaked how widespread are the three viruses in Zhejiang Province dwarf virus and southern rice black-streaked dwarf virus. Chin J and how damaging they can be. The increased Rice Sci, 25(1): 91–94. (in Chinese with English abstract) understanding of their epidemiology has already Jiang X L, Yan S M, Yang M H. 2011. Occurrence and control of helped develop some effective control strategies from a Southern rice black-streaked dwarf disease in Quzhou city. Modern Agric Sci Technol, 4: 171–173. (in Chinese) combination of management of sowing date, deployment Kiritani K. 1983. Changes in cropping practices and the incidence of resistant cultivars, habitat management, and necessary of hopperborne diseases of rice in Japan. In: Plumb R T, Thresh targeted insecticide use. In addition, important tools J M. Plant Virus Epidemiology: The Spread and Control of have been developed, which enable us to detect and Insect-Borne Viruses. Oxford: Blackwells: 239–247. discriminate between the viruses quickly and sensitively. Kiritani K, Nakasuji F, Miyai S. 1987. Systems approaches for Nevertheless, many challenges and threats remain, not management of insect-borne rice disease. Curr Topics Vector least from the recent emergence of SRBSDV. Because Res, 3: 57–80. SRBSDV has a different vector, its epidemiology is Kuribayashi K. 1931. On the relationship between rice stripe disease unlikely to be the same as that of RBSDV, and there is and Delphacodes striatella Fallen. J Plant Prot Tokyo, 18: 565–571. a need to continue monitoring and experimentation to Kuribayshi K, Shinkai A. 1952. On the new disease of rice, black- develop efficient management strategies. streaked dwarf. Ann Phytopath Soc Jpn, 16: 41. Le D T, Netsua O, Uehara-Ichiki T, Shimizua T, Choi I R, Omura ACKNOWLEDGEMENTS T, Sasaya T. 2010. Molecular detection of nine rice viruses by a reverse-transcription loop-mediated isothermal amplification This work was funded by the National Science and assay. J Virol Methods, 170: 90–93. Technology Support Program of China (Grant No. Lee J, Lee S, Chung B. 1977. Studies on the occurrence of rice black-streaked dwarf virus in Korea. Kor J Plant Prot, 16: 121–125. 2012BAD19B03), the China 863 and 973 Program Lin Q Y, Xie L H, Chen Y H, Xie L Y, Cai J R. 1984. On the host (Grant Nos. 2007AA10Z414 and 2010CB126203), the range of rice ragged stunt virus. Acta Phytopathol Sin, 14(4): International Science and Technology Cooperation 247–248. (in Chinese) Project (Grant No. 2007DFB30350), the Special Fund Lin Q Y, Xie L H, Zhou Z J, Xie L Y, Wu Z J. 1990. Studies on for Agro-Scientific Research in the Public Interest of rice stripe: I. Distribution of and losses caused by the disease. J China (Grant No. 201003031), the Zhejiang Provincial Fujian Agric Coll, 19: 421–425. (in Chinese) Science and Technology Project (Grant No. 2010C12027) Ruan Y L, Chen S X, Lin R F, Jiang W L, Jin D D. 1984a. Studies and the Zhejiang Provincial Foundation for Natural on rice black-streaked dwarf disease. J Zhejiang Agric Sci, 4: Science (Grant Nos. Z305165 and Y3090657). 185–187. (in Chinese) Ruan Y L, Jin D D, Xu R Y. 1984b. Studies on the host range of REFERENCES rice stripe virus. Plant Prot, 10: 22–23. (in Chinese) Shen J Y, Peng B Z, Gong Z X, Lin R F, Jin D D. 1989. Rice Amano E. 1933. On the rice stripe disease. J Plant Prot Jpn, 20: ragged stunt virus in the phloem cells of diseased rice and in the 634–638. salivary gland cells of infected vectors. Acta Agric Shanghai, 2: Bae S D, Kim D K. 1994. Occurrence of small brown planthopper 15–18. (in Chinese)

390 Rice Science, Vol. 20, No. 6, 2013

Shen J H, Shang J M, Liu G J. 2003. Management of the whitebacked Adams M J. 2007b. Genomic analysis of rice stripe virus planthopper, Sogatella furcifera in China: A mini-review. Chin J Zhejiang isolate shows the presence of an OTU-like domain in Rice Sci, 17(suppl): 7-22. (in Chinese with English abstract) the RNA1 protein and a novel sequence motif conserved within Shikata E. 1974. Rice black-streaked dwarf virus. Wellesbourne, the intergenic regions of ambisense segments of tenuiviruses. UK: Association of Applied Biologists: CMI/AAB. Descriptions Arch Virol, 152: 1917–1923. of Plant Viruses No. 135. Zhang H M, Yang J, Chen J P, Adams M J. 2008. A black-streaked Shinkai A. 1962. Studies on insect transmission of rice virus dwarf disease on rice in China is caused by a novel fijivirus. diseases in Japan. Bull Nat Inst Agric Sci C, 14: 1–112. Arch Virol, 153: 1893–1898. Shinkai A. 1967. Transmission of stripe and black-streaked dwarf Zhang X, Wang X F, Zhou G H. 2008. A one-step real time RT- viruses by a new planthopper. Ann Phytopathol Soc Jpn, 33: 318. PCR assay for quantifying rice stripe virus in rice and in the Ta H A, Zhang H M, Yang J, Chen J P, Hébrard E, Zhou G H, small brown planthopper (Laodelphax striatellus Fallen). J Virol Vien N V, Cheng J A. 2011. Identification, characterization and Methods, 151(2): 181–187. distribution of southern rice black-streaked dwarf virus in Zhao Y, Wu C X, Zhu X D, Jiang X H, Zhang X X, Zhai B P. 2011. Vietnam. Plant Dis, 95: 1063–1069. Tracking the source regions of southern rice black-streaked dwarf Toriyama S. 2000. Rice stripe virus. In: Descriptions of Plant virus (SRBSDV) occurred in Wuyi County, Zhejiang Province, Viruses. Wellesbourne, UK: Association of Applied Biologists: China in 2009, transmitted by Sogatella furcifera (Horváth) 375. (http://www.dpvweb.net/dpv/showdpv.php?dpvno=375). (Homoptera: Delphacidae). Acta Entomol Sin, 54: 949–959. (in Wang H D, Chen J P, Zhang H M, Sun X L, Zhu J L, Wang A G, Chinese) Sheng W X, Adams M J. 2008. Recent rice stripe virus epidemics Zhong L Q, Wang E G, Xie B Y. 2011. Occurrence and control of in Zhejiang Province, China, and experiments on sowing date, southern rice black-streaked dwarf disease on single-season rice disease-yield loss relationships, and seedling susceptibility. plants in Taizhou City. Modern Agric Sci Technol, 15: 185–187. Plant Dis, 92: 1190–1196. (in Chinese) Wang H D, Chen J P, Wang A G, Jiang X H, Adams M J. 2009. Zhou G H, Xu D L, Li H P. 2004. Identification of rice Studies on the epidemiology and yield losses from rice black- blackstreaked dwarf virus infecting rice in Guangdong. In: Peng streaked dwarf disease in a recent epidemic in Zhejiang Province, Y L. Proceedings of the Conference on Chinese Plant Pathology. China. Plant Pathol, 58: 815–825. Beijing: China Agricultural Scientech Press: 210–212. (in Chinese) Wang Q, Yang J, Zhou G H, Zhang H M, Chen J P, Adams M J. Zhou G H, Wen J J, Cai D J, Li P, Xu D L, Zhang S G. 2008. 2010. The complete genome sequence of two isolates of a new Southern rice black-streaked dwarf virus: A new proposed Fijivirus rice-infecting fijivirus from China. J Phytopathol, 158: 733–737. species in the family Reoviridae. Chin Sci Bull, 53: 3677–3685. Wu Y L, Wang M Q, Huang F Y. 1980. Preliminary analyses of Zhou Q, Zhu J Z, Liang J G, Chen X Y, Gao B D. 2010. Rapid the relationships between rice yellow stunt virus and epidemic detection of southern rice black-streaked dwarf virus. Genom factors of the hybrid rice yellow stunt disease. J Fudan Univ Appl Biol, 29: 1009–1012. (in Chinese with English abstract) (Nat Sci), 19: 380–389. (in Chinese) Zhou Z J, Lin Q Y, Xie L H. 1992. Occurrence of rice tungro Wu W Q, Guo X G, Zhang H M, Yang J, Lu M F, Chen J P. 2013. bacilliform virus in China. Acta Phytopathol Sin, 22: 15–18. (in Simultaneous detection and survey of three rice viruses in China. Chinese) Plant Dis, 97: 1181–1186. Zhu F M, Xiao Q P, Wang F M. 1964. Several new diseases occurring Zhang H M, Chen J P, Adams M J. 2001a. Molecular characterization in rice south of the Yangtze River. Plant Prot, 2: 100–102. (in Chinese) of segments 1 to 6 of rice black-streaked dwarf virus from China Zhu J L, Zhu Z R, Zhou Y, Lu Q, Sun X L, Tao X G, Chen Y, provides the complete genome. Arch Virol, 146: 2331–2339. Wang H D, Cheng J A. 2009. Effect of rice sowing date on Zhang H M, Chen J P, Lei J L, Adams M J. 2001b. Sequence occurrence of small brown planthopper and epidemics of analysis shows that a dwarfing disease on rice, wheat and maize planthopper-transmitted rice stripe viral Disease. Agric Sci Chin, in China is caused by rice black-streaked dwarf virus. Eur J 8(3): 332–341. (in Chinese with English abstract) Plant Pathol, 107: 563–567. Zhu J L, Zhu Z R, Feng J X, Cai X T, Zhong X M. Cheng J A. Zhang H M, Sun H R, Wang H D, Chen J P. 2007a. Advances in 2011. Effect of sowing/transplanting time on occurrence of main the studies of molecular biology of rice stripe virus. Acta locally-overwintering insect pests and diseases. Acta Agric Phytophyl Sin, 34: 436–450. (in Chinese) Zhejiangensis, 23(2): 329–334. (in Chinese) Zhang H M, Yang J, Sun H R, Xin X, Wang H D, Chen J P,