ALLOSTERIC REGULATION of PROTHROMBIN ACTIVATION by FACTOR Va

ALLOSTERIC REGULATION OF PROTHROMBIN ACTIVATION BY FACTOR Va

MAHESHEEMA ALI

Bachelor of Science in Botany, Microbiology, Chemistry Osmania University, India April 2000

Master of Science in Organic Chemistry Osmania University, India April 2002

Submitted in partial fulfillment of requirements for the degree

DOCTOR OF PHILOSOPHY IN CLINICAL AND BIOANALYTICALCHEMISTRY

at the

CLEVELAND STATE UNIVERITY

May 2016

We hereby approve this dissertation for

Mahesheema Ali Candidate for the Doctor of Philosophy in Clinical-Bioanalytical Chemistry Degree for the Department of Chemistry

and the CLEVELAND STATE UNIVERSITY

College of Graduate Studies

______Dissertation Chairperson, Dr. Michael Kalafatis Department of CHEMISTRY ______Date ______Dissertation Committee Member, Dr. Edward F. Plow Department of MOLECULAR CARDIOLOGY Cleveland Clinic Foundation ______Date ______Dr. Anton A. Komar Department of BIOLOGY ______Date ______Dr. David J. Anderson Department of CHEMISTRY ______Date ______Dr. Crystal M. Weyman Department of BIOLOGY

______Date

Date of Defense: April 22nd, 2016

DEDICATION

I dedicate this thesis to my loving family. My beloved husband, Mir Ali, has shown unwavering support and encouragement during past five years of my doctoral journey. I am grateful for his love and continuous support, which gave me the strength and courage to pursue my dream and to make it come true. I would like to give special thanks to my wonderful children--Maaz, Maryum, and Idris--for their support and patience throughout.

I would like to thank my parents, Mrs. Kaneez Fathima and Mr.Yousuf Ali for all that I have become today, for the constant support in my academic career and personal life.

They believed in me and encouraged me to strive in my life.

I would like to thank my mother-in-law, Mrs.Moida Bano, and father-in-law Mr. Masood

Ali, for all the encouragement of our family.

Special thanks also goes to my sisters Mahjabeen, Afreen Fathima, Arshia Fathima and my brothers Kamran Mahmood and Rizwan Mahmood. They were always there when I needed them.

The love of family is life’s greatest blessing. I love you all very much.

ACKNOWLEDGEMENTS

I would like to express my sincere gratitude and appreciation to my advisor, Dr. Michael

Kalafatis, a great educator and a wonderful mentor. His invaluable advice and insightful comments have shaped my career for the future. He is patient and kind, and I thank him for the rewarding experience in his research lab.

I wish to thank the members of my dissertation committee for their valuable time, collegial guidance and support to help improve my research. I thank Dr. Edward F. Plow,

Dr. David J. Anderson, Dr. Crystal M. Weyman, and Dr. Anton A. Komar.

I would like to thank Dr. Mary McDonald for reading this text for grammatical and syntactical issues.

I especially would like to thank, the department secretaries, Richelle Emery and Michele

Jones, for all their administrative help to make this achievement possible.

I would like to thank Dr. Jamila Hirbawi for being a wonderful mentor and friend throughout and providing me with great support to be able to accomplish my work.

I would like to thank Dr. Joseph Wiencek for his tremendous support. I appreciate his help and support.

I would like to greatly acknowledge, Gregory M. Guzzo, research technologist, who has helped me tremendously in my day-to-day activities. I thank you Greg, for being there for me and supporting me as a wonderful friend.

I also wish to acknowledge, Katie Turner and Jasmine Manouchehri for being wonderful friends and supporting me. They will never know how much their support meant to me.

I would like to thank all my colleagues from Cleveland State University, especially those who have helped me along the way.

I would like to thank the entire faculty who have taught and mentored me from

Chemistry Department at Cleveland State University.

Finally, I thank one and all. Thank you.

ALLOSTERIC REGULATION OF PROTHROMBIN ACTIVATION BY FACTOR Va

MAHESHEEMA ALI

ABSTRACT

Upon vascular injury, the proteolytic conversion of prothrombin to thrombin occurs in the presence of prothrombinase. Prothrombinase is an enzymatic complex between factor Va (fVa) and factor Xa (fXa) assembled on a membrane surface in the presence of divalent metal ions.

Blood coagulation factor V (FV) is a multi-domain protein (A1-A2-B-A3-C1-C2) with no procoagulant activity and circulates in blood as a procofactor. Our investigation demonstrates that fV is activated by thrombin in a kinetically preferred order, by a first cleavage at Arg709, followed by cleavage at Arg1545 to ultimately generate the active cofactor species, fVa. The cofactor binds to membrane surfaces and effectively serves as receptor for membrane-bound fXa. Although membrane-bound fXa alone is capable of activating prothrombin through initial cleavage at Arg271, followed by the cleavage at Arg320 (Prethrombin-2 Pathway); the rate of activation is not physiologically compatible with survival. However, incorporation of fVa into prothrombinase results in a 300,000-fold increase in the catalytic efficiency of fXa for thrombin generation with the order of cleavages reversed, with initial cleavage at Arg320 followed by

Arg271 (Meizothrombin Pathway), resulting in physiologically relevant rates of thrombin formation at the place of vascular injury. We have shown that fXa interacts with prothrombin through amino acid region 478-482 in a fVa-dependent manner. We further demonstrate that basic amino acids from exosite I of prothrombin are involved in recognizing fXa within prothrombinase also in a fVa-dependent manner. Finally, we characterized the allosteric

interactions of these amino acid residues within prothrombin required for optimum prothrombin activation rates and optimal thrombin function. Our data suggest that amino acids Leu480 and

Gln481 allosterically interact with basic amino acids from exosite I on prothrombin, thus modulating the enzymatic activity of fXa within prothrombinase. Our results also provide a logical explanation for the deleterious physiological consequences of natural mutations in proexosite I (Arg382→Cys) and (Arg388→Hys) and demonstrate that patients harboring these mutations are impaired in their ability to form a fibrin clot and, thus, are prone to severe bleeding. Overall our data underline the crucial physiological importance of fVa for thrombin generation and clot formation.

vii

TABLE OF CONTENTS

ABSTRACT……………………………………………………………………………………...vi LIST OF TABLES…………………………………………………………………………….....xi LIST OF FIGURES………………………………………………………………...... xii CHAPTER I INTRODUCTION………………………………………………………………….1

1.1 Cardiovascular Disease and Associated Risk………………………………………1

1.2 Hemostasis…………………………………………………………………………2

1.3 Primary Hemostasis………………………………………………………………..3

1.4 The Coagulation Cascade: Secondary Hemostasis………………………………...4

1.5 Blood coagulation fV……………………………………………………………....9

1.6 Activation of fV………………………………………………………………….11

1.7 fV Inactivation…………………………………………………………………...13

1.8 Formation of the Prothrombinase Complex……………………………………...13

1.9 Interaction of fVa with Phospholipid Membranes……………………………….16

1.10 Interaction of fVa with fXa………………………………………………………18

1.11 Interaction of fVa with Prothrombin……………………………………………..18

1.12 Thrombin…………………………………………………………………………18

1.13 Clinical Significance……………………………………………………………..20

1.14 References………………………………………………………………………..22

CHAPTER II THE MOLECULAR MECHANISM CORRELATING THROMBIN

CLEAVAGE AND ACTIVATION OF FACTOR V……………………………………………33

viii

2.1 Abstract………………………………………………………………………...33

2.2 Introduction…………………………………………………………………….35

2.3 Experimental Procedures……………………………………………………....37

2.4 Results…………………………………………………………………………44

2.5 Discussion……………………………………………………………………..62

2.6 References……………………………………………………………………..65

CHAPTER III ALLOSTERIC INTERACTIONS REGULATING PROTHROMBIN

ACTIVATION AND THROMBIN ACTIVITY………………………………………………..71

3.1 Abstract………………………………………………………………………71

3.2 Introduction………………………………………………………………….73

3.3 Experimental Procedures…………………………………………………….76

3.4 Results………………………………………………………………………..84

3.5 Discussion…………………………………………………………………...110

3.6 References……………………………………………………………………114

CHAPTER IV OVERALL CONCLUSION……………………………………………………122

4.1 Conclusion……………………………………………………………….122

4.2 References………………………………………………………………126

LIST OF TABLES

Table 2.1 Functional Properties of Recombinant fV Molecules……………………………………….57

Table 3.1 Molecular Weight of Prothrombin Fragments ………………………………………………91

Table 3.2 Kinetic Constants of Wild-Type and Selected rIIa Mutant Molecules toward

S-2238…………………………………………………………………………………………..101

Table 3.3 Kinetic Constants of Plasma FII and rFII Mutant Molecules Activation by

Prothrombinase…………………………………………………………………………………103

LIST OF FIGURES

Figure 1.1 The Coagulation Cascade……………………………………………………………...8 Figure 1.2 Schematic of fV………………………………………………………………………10 Figure 1.3 Schematic of Human fV……………………………………………………………...12 Figure 1.4 Prothrombin Activation………………………………………………………………15 Figure 1.5 Prothrombinase Complex…………………………………………………………….17 Figure 2.1 Recombinant Mutants Generated to Explicate the Role of Individual Cleavage

Site..……………………………………………………………………………………………...46 Figure 2.2 SDS-PAGE Analysis of Purified Recombinant Proteins (3µg/lane) before (0 min) and after Activation with Thrombin (10 min, 20 min)…………………………………………..50

Figure 2.3 Immunoblot Analysis of Recombinant fV Molecules………………………………..52 Figure 2.4 Kinetic Analysis Comparing Dissociation Constant of Recombinant fVa Molecules for fXa……………………………………………………………………………………………54

Figure 2.5 Functional Analysis of Feedback Activation with Prothrombinase Assembled……..60 Figure 2.6 SDS- PAGE Analysis of Purified Recombinant Proteins, before (0 min) and after activation with Thrombin (5sec, 10sec, 20sec, 1min, 5min, 15min, 25min, and 35 min)……….61 Figure 3.1 Schematic of FII……………………………………………………………………...86 Figure 3.2.Clotting Analysis of Recombinant FII Molecules……………………………………88 Figure 3.3 Prothrombin and its Activation Fragments…………………………………………...89 Figure 3.4 SDS-PAGE Analyses of FIIPLASMAand rFII Mutant Activation by Membrane-Bound fXa Alone………………………………………………………………………………………..93 Figure 3.5 SDS-PAGE Analyses of rFII Molecule Activation by Prothrombinase……………..96 Figure 3.6 Determination of Kinetic Parameters of Prothrombinase Catalyzing Cleavage and Activation of Various FII Molecules……………………………………………………………99

xii

Figure 3.7Activation of Plasma-Derived fV by rIIa…………………………………………..106 Figure 3.8 Activation of Recombinant fVIII by rIIa ………………………………………….109

xiii

CHAPTER I

INTRODUCTION

1.1 CARDIOVASCULAR DISEASE AND ASSOCIATED RISK

Cardiovascular disease (CVD) is one of the leading causes of death around the world, which includes coronary heart disease and stroke (1). A heart attack occurs when a blood clot (thrombus) blocks the coronary artery that supplies blood to heart muscles. A stroke occurs when a blood clot occludes an artery supplying blood to brain. Several risk factors are associated with CVD (being overweight, physical inactivity, smoking, hypertension, and diabetes mellitus) along with preventive measures (weight loss, smoking cessation).

CVD is the disturbance in the hemostatic and fibrinolytic systems (2). An observational epidemiological association exists between CVD and hemostasis (3).

Studies have shown a relationship between the hemostatic imbalance and CVD risk (4).

Males are at higher risk than females; however, menopausal females are at higher risk than males. At the same age span, family history of CVD predicts a patient’s risk.

Cardiovascular disease includes illnesses that involve blood vessels (arteries, veins or capillaries) or the heart or both. The cardiovascular system, also called the circulatory

system, is responsible for blood transportation throughout the human body. It is involved in transporting oxygenated blood from the lungs to the heart through the arteries.

Capillaries are the vessels that are responsible for transporting the blood among veins and arteries. The deoxygenated blood makes its way back from the heart and lungs through the veins.

The key facts provided by World Health Organization state that approximately 17.3 million died in 2008 from CVD; by 2030, 23.3 million will die. The American Heart

Association (AHA) created a new set of central organizational Impact Goals for the current decade:“By 2020, to improve the cardiovascular health of all Americans by 20%, while reducing deaths from CVDs and stroke by 20%” (Italics original)(AHA, 2013 p.1).

This thesis aligns with the AHA goal in researching how blood clots form. This introduction presents a broad overview of the blood clotting process. Subsequently, the chapter presents the regulatory effect of factor Va during thrombin generation.

1.2 HEMOSTASIS

Hemostasis refers to a physiological response that prevents significant blood loss after vascular injury (5, 12, 13). Hemostasis involves a complex, dexterously balanced system of factors that are involved in the formation and dissolution of clots.

Hemostasis is crucial for survival, but the pathological formation of a thrombus poses major health risks. Any abnormalities in hemostasis can result in bleeding (hemorrhage) or blood clots (thrombosis).The coagulation system leans on a delicate balance between natural coagulant and anticoagulant factors and the coagulation and fibrinolytic systems.

Any imbalance in these systems can result in severe pathological coagulation.

The thrombus can obstruct the blood flow resulting in a number of serious cardiovascular diseases including heart attack, stroke and venous thromboembolism

(VTE). Venous thromboembolism (VTE) can manifest as Deep Vein Thrombosis (DVT) and /or pulmoembolism.

DVT is the blood clot in one of the deep veins of the body, usually the leg (14).The heart pumps oxygenated blood through the aorta to smaller arteries. After the blood supplies nutrients to vital organs, it returns through veins for re-oxygenation in the lungs.

Blood clots (called deep vein thrombi) often develop in the deep leg veins. Pulmonary embolism (PE) occurs when clots break off from vein walls and travel through the heart to the pulmonary arteries.

To understand this major disease state, it is very important to understand the process of hemostasis. There are three mechanisms, that works together to stop the flow of blood.

They are vasoconstriction, plug formation, and clotting of blood. Vasoconstriction and plug formation deal with primary hemostasis. In contrast, clotting of blood deals with secondary hemostasis.

1.3 PRIMARY HEMOSTASIS

The very first response to vascular injury is triggered via a sequence of events and is known as primary hemostasis. Staunching of blood is achieved by two interrelated processes: first, a vascular spasm causes vasoconstriction of blood vessels which slows down the blood flow. Second, by the formation of soft hemostatic plug (9, 10, 11). The fluid state of blood is maintained by the endothelium in the blood vessels which maintains an anticoagulant surface. Damage to blood vessels exposes the sub-endothelial matrix, which causes platelets to adhere causing primary platelet plug formation. Platelets

are activated following their exposure to a sub-endothelial surface (9). The activation of platelets results in the enzymatic flipping of the inner leaflet phosphotidyl serine phospholipids to the outer leaflet, creating an “active” surface, which is negatively charged, that supports the formation of enzymatic complexes composed of coagulation factors (12, 15). Simultaneously, the activation of platelets also results in the release of factors within platelets required for the clot formation, including factor V, von

Willebrand factor (vWf), and fibrinogen (16).

vWf makes the surfaces of endothelial cells adhesive, which closes the small blood vessels. In large blood vessels, platelets adhere to the surface of endothelial cells, which is referred as platelet adhesion. Platelets that adhered to the vessel wall may secrete adenosine diphosphate (ADP), which causes aggregation. Aggregated platelets secrete factor XIII and also release a powerful vasoconstrictor, thromboxane, along with ADP

(15). Upon vascular injury, the exposed sub-endothelial surface results in the exposure of a membrane protein called tissue factor. The exposure of tissue factor in circulation marks the start of secondary hemostasis. The initial plug formation in the injury is temporarily blocked by the formation of insoluble protein fibrin from fibrinogen through the enzyme thrombin, which forms a trap for platelets and blood cells forming a clot.

Fibrin is cross-linked with the aid of factor XIIIa thereby wringing the clot and increasing its firmness by retraction.

1.4 THE COAGULATION CASCADE: SECONDARY HEMOSTASIS

The coagulation process that leads to hemostasis involves a complex set of serine proteases. These reactions convert fibrinogen, a soluble protein, to insoluble strands of

fibrin, which, together with the platelets, form a stable thrombus. Several coagulation cascade models have been proposed, including the intrinsic and extrinsic pathways which finally culminate into the common pathway.

The secondary hemostasis consists of a cascade of coagulation serine protease which forms essential building blocks of the host’s defense mechanism. Secondary hemostasis results in the formation of insoluble fibrin deposits, which occur through fibrinogen activation by thrombin as a result of the proteolytic coagulation cascade. This segment examines the formation of extrinsic and intrinsic pathways that lead to the formation of fibrin.

After the initiation of coagulation, thrombin generation is divided into three separate segments: the initiation phase where a minimal amount of thrombin is formed; the propagation phase where a sufficient amount of thrombin is formed resulting in the formation of a fibrin plug; and the termination phase where thrombin formation is inhibited by the inactivation of cofactors fVa and fVIIIa by the APC/protein S complex

(18).

This cascade is generally comprised of two upstream tributaries known as extrinsic

(tissue factor) and intrinsic (contact) pathways that feed into a final common pathway leading to the generation of thrombin and the production of fibrin plug (Fig.1.1).

The extrinsic pathway is the principal initiating event in coagulation, which consists of factor VII (fVII) and tissue factor. Immediately after vessel wall injury, a small amount of circulating fVIIa is activated upon exposure of tissue factor thus, forming a complex between fVIIa and tissue factor (5). The extrinsic Xase complex is formed when activated fVIIa comes in contact with tissue factors on the membrane surface in presence of

calcium ions. The extrinsic Xase complex recognizes and activates the substrates factor X and IX converting them to their active forms, factor Xa (fXa) and factor IXa (fIXa).

However, substrate fIXa is recognized with higher affinity than fXa. Further, fIXa production is very important for the formation of intrinsic Xase complex, which results in efficient production for fXa inducing the amplification of the coagulation response. fXa converts prothrombin to thrombin. Thrombin activates fVIII, fV, fXI, and platelets catalyzing the conversion of fibrinogen to fibrin. As a result, the clot is reinforced by the action of fXIII, a cross linking enzyme (5, 6) (Fig.1.1).

The intrinsic pathway is comprised of four proteins: fXII, fXI, prekallikrein (PK), and high molecular weight kininogen (HMWK). In the contact pathway, they come in ordered assembly on the negatively charged membrane. At first, the endothelial cell prolycarboxypeptidase activates PK to kallikrein. Kallikrein activates fXII, and kallikrein digests HMWK to liberate vasoactive, bradykinnin. The cooperative interaction among all the contact factors leads to increased generation of fXIIa levels, which activates fXI to fXIa. In turn, surface bound fXIa then activates fIX; and fIXa, in presence of the divalent calcium ions on the membrane surface, and fIXa will associate with cofactor fVIIIa to form intrinsic tenase complex (7) (Fig.1.1). Additional fIXa is formed through the extrinsic pathway that participates in the intrinsic Xase formation.

Once a sufficient amount of fXa is generated through the extrinsic and intrinsic pathways, the common pathway augments the generation of thrombin by activating prothrombin to thrombin by the prothrombinase complex. This enzymatic complex is composed of the enzyme fXa, with its non-enzymatic cofactor fVa, on the phospholipid membrane in the presence of divalent calcium ions. Formation of prothrombinase

complex is very essential for the robust generation of thrombin, which is essential for fibrin formation resulting in a fibrin clot. In the absences of the cofactor fVa, fXa converts prothrombin to thrombin at a rate which is not physiologically compatible with life, resulting in clinical complications.

Figure 1.1

Figure 1.1 The Coagulation Cascade

The coagulation cascade includes the extrinsic and intrinsic pathways that feed into a common pathway where the prothrombinase complex activates prothrombin to thrombin.

This process will eventually lead to the formation of the fibrin plug after vascular injury.

Source: (Coagulation cascade, www.studyblue.com)

1.5 BLOOD COAGULATION fV

Factor V (fV) is a labile protein in the coagulation system. Deficiency leads to hemorrhages, while some mutations lead to thrombosis. The gene for fV is localized to human chromosome 1q21-25(23). Human fV gene spans approximately 80 kilobase (kb) of DNA and consists of 25 exons. The exons range in size from 72-286 base pairs (bp) with the exception of the exon 13, which spans 2820bp and 24 introns (24). Human fV is approximately 7kb in size and encodes mature protein of 2,196 amino acids (25, 26, 27, and 36). fV circulates in plasma as a single chain glycoprotein with a molecular weight

330,000 kDa (27-29). Human plasma fV circulates at a concentration of 20 nM, with minimal cofactor activity (30). About 20% of total human fV found in whole blood is contained in the platelets α- granules (31). Coagulation fV is composed of multiple domains, A1-A2-B-A3-C1-C2. The sequence of fV is 40% identical to human fVIII, except in the B-domain where there is no similarity.

The three A-domains in fV share homology with fVIII and copper binding protein ceruloplasmin (32). Human fV also shares 56% amino acid sequence homology with snake venom protein pseutarin C, except in the B-domain which is largely truncated in the snake venom protein (33). The C-domain is homologous with the slim mold protein discoidin (25, 35). The B-domain in fV has been found to be conserved among several vertebrae species (34).

Figure 1.2

Figure 1.2 Schematic of fV fV is activated through three sequential thrombin mediated cleavages occuring at Arg709,

Arg1018 and Arg1545 resulting in active cofactor (fVa) composed of a heavy and light chain.

1.6 ACTIVATION OF fV

fV is activated by thrombin through proteolytic cleavage at Arg709, Arg1018, and

Arg1545 (30). Activated fV (fVa) is a calcium dependent heterodimer consisting of 105 kDa heavy chain (A1-A2 domains) and 73kDa light chain (A3-C1-C2), whereas the B- domain is released and is not required for procoagulant activity (37, 38). Cleavage at

Arg709 and Arg1018 results in a release of an amino-terminal portion of the B-domain resulting in partial activation of the cofactor. Cleavage at Arg1545 releases the carboxy- terminal portion of the cofactor, resulting in maximal activation of fV. Activated fV, further, is involved in prothrombinase complex formation and function (19). Both the heavy and light chain of fVa are capable of interacting with fXa. The carboxy-terminal of the heavy chain of fVa interacts with fVa and prothrombin, whereas the light chain of fVa associates with the negatively charged phospholipids (41). In addition to thrombin, fV is activated with various proteases. The procofactor is activated by snake venom protease RVV-V, which cleaves fV at Arg1018 and Arg1545 (39, 40). The procofactor is cleaved by monocyte-derived cathepsin G, which cleaves fV at sitesTyr696, Phe1031, and

Leu1518, resulting in 103-kDa heavy chain and 80-kDa light chain (43) (Fig.1.3). Human neutrophil elastase cleaves fV at sites Thr678, Ile708, Ile819, and Ile1484 resulting in heavy chain 102-kDa and light chain 90-kDa (43) (Fig.1.3). The procofactor can be cleaved and sometimes activated activated by other proteases: snake venom naja naja oxiana, fXa, and prothrombin intermediate, mezothrombin (42).

Figure 1.3

Figure 1.3 Schematic of Human fV

Modifications and activation/ deactivation of human fV molecule at various cleavage sites (87).

1.7 fV INACTIVATION

Activated Protein C (APC) is a vitamin-K dependent serine protease that has Mr 60- kDa, and it circulates in plasma at 60nM (46). The protein C molecule has a heavy and light chain, connected through a single disulphide bond (47). In the presence of calcium ions, the thrombin-thrombomodulin complex converts protein C to activated protein C when cleaved at Arg169 of the heavy chain (47). Activated Protein C (APC) leads to the inactivation of fVa and fVIIIa, and it down regulates the prothrombinase complex (48).

APC inactivates fVa/fV by limited proteolysis in the heavy chain (44, 45).

APC cleaves the heavy chain of fVa at Arg506, Arg306 and Arg679, destroying the cofactor’s ability to associate with fXa (49, 50, 51, 52, 53) (Fig.1.3). Efficient inactivation of fVa requires the cofactor protein S and a phospholipid membrane surface.

Rapid cleavage of fVa by APC at Arg306 is completely membrane dependent. However, cleavage at Arg506 occurs in the absence of the phospholipid membrane. In the presence of the membrane, the ability to inactivate the procofactor fV increases; however, phospholipid membranes do enhance the rate of this cleavage. In contrast, the slow cleavage at Arg679 is not enhanced by the membrane surface. Also, in the presence of a membrane, APC inactivates fV following sequential cleavages at Arg306, Arg506, Arg679 and Lys994.

1.8 FORMATION OF THE PROTHROMBINASE COMPLEX

The prothrombinase complex is an enzymatic complex comprised of enzyme fXa, cofactor fVa, and substrate prothrombin on a lipid membrane in the presence of divalent metal ions (54) (Fig.1.4). The procoagulant activity of fVa advents from its ability to augment prothrombin activation to thrombin by serine protease fXa in presence of both

calcium ions and the phospholipids membrane. fVa contributes to the activation of prothrombin mainly by stabilizing the enzymatic complex and altering the kinetic mechanism of the prothrombinase complex (54, 55).

Prothrombin activation results from a 100-fold decrease in Km for prothrombin. In addition, in the presence of the phospholipid membrane, fVa increases the Vmax for prothrombin activation by 3000-fold for prothrombin (56, 57). The increase in Vmax results when fVa acts as receptor for fXa, which increases the local concentration of fXa on a membrane surface. The main effect of fVa is to increase the catalytic efficiency (kcat) of prothrombin activation.

The complex activates prothrombin via two pathways, depending on the order of bond cleavage. In the absence of fVa, fXa slowly converts prothrombin to thrombin by cleaving first at Arg271 and then at Arg320, through the intermediates of fragment 1.2 and mandatory fragment prethrombin 2. This is the prethrombin-2 pathway (58). However, in the presence of fVa, fXa activates prothrombin to thrombin by reversing the cleavage order first at Arg320 and then at Arg271 through the obligate intermediate mezothrombin.

This is the meizothrombin-pathway (59, 60) (Fig.1.4).

Figure 1.4

Figure 1.4 Prothrombin Activation (88)

Pathway-1 Two fXa-catalyzed cleavages convert prothrombin to thrombin. Initial cleavage at Arg271 by membrane-bound fXa in the absence of fVa results in the generation of fragment 1·2 and prethrombin-2. Subsequent cleavage at Arg320 results in thrombin formation (Prothrombin-2 Pathway).

Pathway-II Initial cleavage at Arg320 by prothrombinase results in the production of an enzymatically active intermediate (meizothrombin). Cleavage of this intermediate at

Arg271 produces thrombin and fragment 1.2 (Meizothrombin Pathway) (88).

1.9 INTERACTION OF fVa WITH PHOSPHOLIPID MEMBRANES

The presence of the membrane surface is very important for the formation of the prothrombin complex. In vivo, this surface is provided by activated platelets, endothelial cells, platelet micro particles, and damaged vascular cells (61). These negatively charged phospholipids are sequestered in the inner leaflet of cellular membrane but are exposed after platelet activation and micro particle formation (61) (Fig.1.5). fVa binds to phospholipids containing 25% phosphatidylserine (PS) and 75% phosphatidylcholine

(PC) (62). Activation of fVa or Ca+2 is not required for phospholipid binding (62, 63).

The fVa and phospholipid interaction involves hydrophobic and electrostatic interaction

(64.65, 66). fV has membrane binding sites within the light chain fragment (A3-C1-C2)

(67, 68).

Figure 1.5

Figure 1.5 Prothrombinase Complex (Enzymatic Complex)

Prothrombinase is composed of four components that are essential for its function. The cofactor fVa binds and also interacts with the enzyme fXa and the substrate prothrombin in the presence of calcium ions, where phospholipids provide membrane surface.

1.10 INTERACTION OF fVa WITH fXa

fVa interacts with fXa in presence of Ca+2 ions on the phospholipid membrane to accelerate the prothrombin activation to thrombin. fXa binds to phospholipids with low affinity (Kd 0.1µM) (69), and the physiologic concentration of fXa does not exceed more than 0.15 nM (70). In the absence of membranes, fXa binds to fVa with less affinity (Kd 1

µM) (71). In contrast, when fVa is bound to the membrane surface, fXa binds to fVa with a Kd that is three orders of magnitude lower (~1nM) (62, 69). fXa interacts with fVa at discontinuous epitopes on the heavy chain of the cofactor. The amino acids of the heavy chain of fVa involved in fXa interaction are 323, 324, 330, and 331 (72, 73, 74).

1.11 INTERACTION OF fVa WITH PROTHROMBIN

fV does not bind to prothrombin. The activation of fV is very important for its interaction with prothrombin (76). The interaction of fVa and prothrombin is mediated by the heavy chain of the cofactor and is independent of Ca+2 ions (75). The carboxy- terminal of the heavy chain of fVa contains amino acid residues 697-709 (39, 77). These acidic residues are directly involved in the interaction of the cofactor with fXa, or prothrombin, through positively charged amino acids. The proexosite –I of the catalytic domain as well as the kringle I and kringle II domains of prothrombin are involved in binding prothrombin to fVa (78, 79).

1.12 THROMBIN

Thrombin originates from prothrombin, the circulating zymogen precursor protein.

Thrombin is a key enzyme, involved in myriad functions in blood coagulation as well as its recently defined roles in the tissue repair and development and pathogenic processes.

Thrombin up- regulates and down-regulates its own production. It up-regulates its own

production by activating the procofactors fV and fVIII, thus amplifying hemostasis. It also converts fibrinogen to fibrin and activates fXIII. It down-regulates its own production by proteolytic activation of protein C (APC). The active form of APC is involved in enzymatic degradation of the cofactor fVa and fVIIIa that are involved in the prothrombinase complex and intrinsic complex formation respectively. Thrombin forms a complex with thrombomodulin on the endothelial surface (85, 86). This complex is responsible for activation of protein C. Proteolytic degradation of fV is mediated by APC through cleavages Arg506, Arg306 and Arg679. Proteolytic degradation of fVIIIa occurs sequentially at Arg336, Arg562 and Arg720.

Prothrombin belongs to vitamin K-dependent blood clotting proteins characterized by an NH2- terminal Gla domain, which consists of several γ-carboxyglutamic acid residues.

Prothrombin is activated to thrombin in presence of phospholipids membrane and calcium ions. Thrombin possesses at least four distinct binding sites for substrates, inhibitors, cofactor, and sodium ions. The other three sites (exosite I, exosite II and the active sites) account for varied functions due to their ability to recognize different molecules. Thrombin recognizes its substrates through exosites. These regions are exposed to plasma in the active form of thrombin, which is composed of varied number of basic amino acids that facilitate substrate recognition (20). Thrombin contains two electro-positively charged binding regions: anion binding exosite I (ABE-I) and anion binding exosite II (ABE-II), which play crucial role in protein function. ABE-I involves binding proteins in the coagulation cascade including fV, fibrinogen, PAR-I (the platelet thrombin receptor), thrombomodulin and heparin cofactor II. ABE-II, which is located

above the active site of molecule, serves as heparin binding site, protease nexin and antithrombin (III) (84).

1.13 CLINICAL SIGNIFICANCE

Hemophilia

Hemophilia is an inherited clotting disorder that involves prolonged bleeding after injury (80). The two most common forms of hemophilia are due to an X- chromosome- linked recessive gene. Hemophilia A (classic hemophilia) leads to the production of a defective fVIII. Hemophilia B (Christmas disease) leads to the production of a defective fIX (81).

In addition, acquired hemophilia is an auto-immune disorder in which a person with normal hemostatic activity develops auto-antibodies against fVIII. This condition is a result of various medical issues such as pregnancy, auto-immune disorders, diabetes, respiratory disease, and other malignancies.

Inactivation of clotting factors fVa and fVIIIa occur when enzyme-activated protein C

(APC) is bound to its cofactor protein S. The cofactors fVa and fVIIIa are responsible for clot formation. Deficiency of protein C or protein S leads to a thrombus formation due to an insufficient amount of protein C that was produced to inactivate fVa and fVIIIa (82).

Mutation of fV

A mutation of fV (fV Leiden) causes a resistance to the action of activated protein C.

A mutation in the fV gene at nucleotide 1691, which replaces guanine with adenine, leads to the substitution of a glutamine for an arginine at amino acid 506 of the protein. The anticoagulant function requires preliminary cleavage of cofactor fVa by activated protein

C at Arg506, which is impaired in the fV Glu506. Also, fVLeiden (Glu506) acts as a cofactor

in the inactivation of fVIII. Patients with fVLieden (Glu506 variant) face an increased risk of peripheral venous thrombosis (83).

1.14 REFERENCES

1. Hahn, R.A., Heath, G.W., Chang, M.H. Cardiovascular disease risk factors and

preventive practices among adults--United States, 1994: a behavioral risk factor atlas.

Behavioral Risk Factor Surveillance System State Coordinators. MMW CDC Surveill

Summ. 1998 Dec 11; 47(5):35-69.

2. Mertens, I., Van Gaal, L.F. Obesity, heamostasis and the fibrinolytic system. Obes

Rev. 2002 May; 3(2):85-101.

3. Koenig, W. Haemostatic risk factors for cardiovascular diseases. Eur Heart J. 1998

Apr; 19 Suppl C: C39-43.

4. Lefevre, M., Kris-Etherton, P., R.D., Zhao, G., Tracy, R. Dietary Fatty Acids,

Hemostasis, and CVD Risk. Journal of the American Dietetic Association (2004;

104:410–419; quiz 492)

5. Baugh, R.J., Broze, Jr., G.J., Krishnaswamy, S.Regulation of extrinsic pathway factor

Xa formation by tissue factor pathway inhibitor J. Biol. Chem., 273 (1998), pp. 4378–

4386.

6. Nemerson, Y. The tissue factor pathway of blood coagulation. Semin Hematol. 1992

Jul; 29(3):170-6.

7. Yuan, Q.P., Walke, E.N., Sheehan, J.P. The factor IXa heparin-binding exosite is a

cofactor interactive site: mechanism for antithrombin-independent inhibition of

intrinsic tenase by heparin. Biochemistry. 2005 Mar 8; 44(9):3615-25.

8. Ichinohe, T., Takayama, H., Ezumi Y, Arai, M., Yamamoto, N., Takahashi, H.,

Okuma, M. Collagen-stimulated activation of Syk but not c-Src is severely

compromised in human platelets lacking membrane glycoprotein VI. J Biol Chem.

1997 Jan 3; 272(1):63-8.

9. Tripodi, A., Primignani, M., Mannucci, P.M. Abnormalities of hemostasis and

bleeding in chronic liver disease: the paradigm is challenged. Intern Emerg Med.

2010 Feb; 5(1):7-12.

10. Davie, E.W., Fujikawa, K., Kisiel, W. Biochemistry. The coagulation cascade:

initiation, maintenance, and regulation.1991 Oct 29; 30(43):10363-70.

11. Gale, A.J. Continuing education course #2: current understanding of hemostasis.

Toxicol Pathol. 2011 Jan; 39(1):273-80.

12. Kalafatis, M., Egan, J.O., Van’t Veer C., Cawthern, K.M., Mann, and K.G. The

regulation of clotting factors. Crit Rev Eukaryot Gene Expr. 1997; 7(3):241-80.

Review.

13. Rand, M.D., Lock, J.B., Van't Veer, C., Gaffney, D.P., Mann, and K.G. Blood

clotting in minimally altered whole blood. Blood. 1996 Nov 1; 88(9):3432-45.

14. Castoldi, E., Simioni, P., Kalafatis, M., Lunghi, B., Tormene, D., Girelli, D.,

Girolami, A., Bernardi, F. Combinations of 4 mutations (FV R506Q, FV H1299R,

FV Y1702C, PT 20210G/A) affecting the prothrombinase complex in a

thrombophilic family. Blood. 2000 Aug 15; 96(4):1443-8.

15. Heemskerk, J.W., Bevers, E.M., Lindhout, T. Platelet activation and blood

coagulation. Thromb Haemost. 2002 Aug; 88(2):186-93.

16. Lawson, J.H., Kalafatis, M., Stram, S., Mann, K.G. A model for the tissue factor

pathway to thrombin. I. An empirical study. J Biol Chem. 1994 Sep 16;

269(37):23357-66.

17. Feng, Z., Gollamudi, R., Dillingham, E.O., Bond, S.E., Lyman, B.A., Purcell, W.P.,

Hill, R.J., Korfmacher, W.A. Molecular determinants of the platelet aggregation

inhibitory activity of carbamoylpiperidines. J Med Chem. 1992 Aug 7; 35(16):2952-

18. Butenas, S., Van’t Veer, C., Cawthern, K., Brummel, K.E., Mann, K.G. Models of

blood coagulation. Blood Coagul Fibrinolysis. 2000 Apr; 11 Suppl 1:S9-13.

19. Kalafatis, M. Coagulation factor V: a plethora of anticoagulant molecules. Curr Opin

Hematol. 2005 Mar; 12(2):141-8. Review.

20. Krishnaswamy, S., Betz, A., Exosites determine macromolecular substrate

recognition by prothrombinase. Biochemistry. 1997 Oct 7; 36(40):12080-6.

21. Krishnaswamy, S., Nesheim, M.E., Pryzdial, E.L., Mann, K.G. Assembly of

prothrombinase complex. Methods Enzymol. 1993; 222:260-80.

22. Krishnaswamy, S. Prothrombinase complex assembly. Contributions of protein-

protein and protein-membrane interactions toward complex formation. J Biol Chem.

1990 Mar 5; 265(7):3708-18.

23. Wang, H., Riddell, D, C., Guinto, E.R., MacGillivray, R.T., Hamerton, J.L.

Localization of the gene encoding human factor V to chromosome 1q21-5.Genomics.

1988 May; 2(4):324-8.

24. Downing, M.R., Butkowski, R.J., Clark, M.M., Mann, K.G. Human prothrombin

activation.J Biol Chem. 1975 Dec 10; 250(23):8897-906.

25. Jenny, R.J., Pittman, D.D., Toole, J.J., Kriz, R.W., Aldape, R.A., Hewick, R.M.,

Kaufman, R.J., Mann, K.G. Complete cDNA and derived amino acid sequence of

human factor V. Proc Natl Acad Sci U S A. 1987 Jul; 84(14):4846-50.

26. Kane, W.H., Davie, E.W. Cloning of a cDNA coding for human factor V, a blood

coagulation factor homologous to factor VIII and ceruloplasmin. Proc Natl Acad Sci

U S A. 1986 Sep; 83(18):6800-4.

27. Kane, W.H., Majerus, P.W. Purification and characterization of human coagulation

factor V. Biol Chem. 1981 Jan 25; 256(2):1002-7.

28. Nesheim, M.E., Myrmel, K.H., Hibbard, L., Mann, K.G. Isolation and

characterization of single chain bovine factor V. J Biol Chem. 1979 Jan 25;

254(2):508-17.

29. Dahlbäck, B. Human coagluation factor V purification and thrombin-catalyzed

activation. J Clin Invest. 1980 Sep; 66(3):583-91.

30. Mann, K.G., Kalafatis, M.Factor V: a combination of Dr Jekyll and Mr Hyde.Blood.

2003 Jan 1; 101(1):20-30.

31. Tracy, P.B., Eide, L.L., Bowie, E.J.W., Mann, K.G. Radioimmunoassay of factor V

in human plasma and platelets. Blood. 1982; 60:59-63

32. Mann, K.G., Lawler, C.M., Vehar, G.A., Church, W. R. Coagulation Factor V

contains copper ion. J Biol Chem. 1984 Nov 10; 259(21):12949-51.

33. Rao, V.S., Swarup, S., Kini, R.M. The nonenzymatic subunit of pseutarin C, a

prothrombin activator from eastern brown snake (Pseudonaja textilis) venom, shows

Structural similarity to mammalian coagulation factor V. Blood. 2003 Aug 15;

102(4):1347-54. Epub 2003 May 1.

34. Camire, R.M., Bos, M.H. The molecular basis of factor V and VIII procofactor

activation. J Thromb Haemost. 2009 Dec; 7(12):1951-61.

35. Poole, S., Firtel, R.A., Lamar, E., Rowekamp, W. Sequence and expression of the

discoidin I gene family in Dictyostelium discoideum. J Mol Biol. 1981 Dec 5;

153(2):273-89.

36. Cripe, L.D, Moore, K.D, Kane, W.H. Structure of the gene for human coagulation

factor V. Biochemistry. 1992 Apr 21; 31(15):3777-85.

37. Esmon, C.T. The subunit structure of thrombin-activated factor V. Isolation of

activated factor V, separation of subunits, and reconstitution of biological activity. J

Biol Chem. 1979 Feb 10; 254(3):964-73.

38. Suzuki, K., Dahlbäck, B., Stenflo, J .Thrombin-catalyzed activation of human

coagulation factor V. J Biol Chem. 1982 Jun 10; 257(11):6556-64.

39. Kalafatis, M., Beck, D.O., Mann, K.G. Structural requirements for expression of

factor Va activity. J Biol Chem. 2003 Aug 29; 278(35):33550-61. Epub 2003 Jun 4.

40. Keller, F.G., Ortel, T.L., Quinn-Allen, M.A., Kane WH.Thrombin-

catalyzed activation of recombinant human factor V. Biochemistry. 1995 Mar 28;

34(12):4118-24.

41. Hirbawi, J., Bukys, M.A., Barhoover, M.A., Erdogan, E., Kalafatis, M. Role of the

acidic hirudin-like COOH-terminal amino acid region of factor Va heavy chain in the

enhanced function of prothrombinase. Biochemistry. 2008 Jul 29; 47(30):7963-74.

42. Thorelli, E., Kaufman, R.J., Dahlbäck, B. Cleavage requirements for activation of

factor V by factor Xa. Eur J Biochem. 1997 Jul 1; 247(1):12-20.

43. Camire, R.M., Kalafatis, M., Tracy, P.B. Proteolysis of factor V by cathepsin G and

elastase indicates that cleavage at Arg1545 optimizes cofactor function by facilitating

factor Xa binding. Biochemistry. 1998 Aug 25; 37(34):11896-906.

44. Bertina, R.M., Koeleman, B.P., Koster, T., Rosendaal, F.R., Dirven, R.J., de Ronde,

H., van der Velden, P.A., Reitsma, P.H. Mutation in blood coagulation factor V

associated with resistance to activated protein C. Nature. 1994 May 5; 369(6475):64-

45. Kalafatis, M, Bertina, R.M., Rand, M.D., Mann, K.G. Characterization of the

molecular defect in factor VR506Q. J Biol Chem. 1995 Feb 24; 270(8):4053-7.

46. Griffin, J.H., Mosher, D.F., Zimmerman, T.S., Kleiss, A.J. Protein C, an

antithrombotic protein, is reduced in hospitalized patients with intravascular

coagulation. Blood. 1982 Jul; 60(1):261-4.

47. Kisiel, W.Human plasmaprotein C: isolation, characterization, and mechanism of activation

by alpha-thrombin. J Clin Invest. 1979 Sep; 64(3):761

48. Esmon, C.T., Esmon, N.L., Le Bonniec, B.F., Johnson, A.E. Protein C activation.

Methods Enzymol. 1993;222:359-85.

49. Egan, J.O., Kalafatis, M., Mann, K.G. The effect of Arg306-->Ala and Arg506-->Gln

substitutions in the inactivation of recombinant human factor Va by activated protein

C and protein S. Protein Sci. 1997 Sep;6(9):2016-27.

50. Mann, K.G., Hockin, M.F., Begin, K.J., Kalafatis, M. Activated protein C cleavage of

factor Va leads to dissociation of the A2 domain. J Biol Chem. 1997 Aug 15;

272(33):20678-83.

51. Lu, D., Kalafatis, M., Mann, K.G., Long, G.L. Loss of membrane-dependent factor

Va cleavage: a mechanistic interpretation of the pathology of protein C Vermont.

Blood. 1994 Aug 1; 84(3):687-90.

52. Yang, L., Manithody, C., Rezaie, A. R. The functional significance of the autolysis

loop in protein C and activated protein C. Thromb Haemost. 2005 Jul; 94(1):60-8.

53. Kalafatis, M., Simioni, P., Bernardi, F. Phenotype and genotype expression in

pseudohomozygous R2 factor V. Blood. 2001 Sep 15; 98(6):1988-9.

54. Mann, K.G., Jenny, R.J., Krishnaswamy, S. Cofactor proteins in the assembly and

expression of blood clotting enzyme complexes. Annu Rev Biochem. 1988; 57:915-

56.

55. Mann, K.G., Nesheim, M.E., Church, W.R., Haley, P., Krishnaswamy, S. Surface-

dependent reactions of the vitamin K-dependent enzyme complexes. Blood. 1990 Jul

1; 76(1):1-16

56. Rosing, J., Tans, G., Govers-Riemslag, J.W., Zwaal, R.F., Hemker, H.C. The role of

phospholipids and factor Va in the prothrombinase complex.J Biol Chem. 1980 Jan

10; 255(1):274-83.

57. Van Rijn, J.L., Govers-Riemslag, J.W., Zwaal, R.F., Rosing, J. Kinetic studies of

prothrombin activation: effect of factor Va and phospholipids on the formation of the

enzyme-substrate complex. Biochemistry. 1984 Sep 2; 23(20):4557-64.

58. Krishnaswamy, S., Church, W.R., Nesheim, M.E., Mann, K.G. Activation of human

prothrombin by human prothrombinase. Influence of factor Va on the reaction

mechanism. J Biol Chem. 1987 Mar 5; 262(7):3291-9.

59. Tans, G., Janssen-Claessen, T., Hemker, H.C., Zwaal, R.F., Rosing, J. Meizothrombin

formation during factor Xa-catalyzed prothrombin activation. Formation in a purified

system and in plasma. J Biol Chem. 1991 Nov 15; 266(32):21864-73.

60. Krishnaswamy, S., Mann, K.G., Nesheim, M. E. The prothrombinase-catalyzed

activation of prothrombin proceeds through the intermediate meizothrombin in an

ordered, sequential reaction. J Biol Chem. 1986 Jul 5; 261(19):8977-84.

61. Zwaal, R. F., Comfurius, P., Bevers, E.M. Lipid-protein interactions in blood

coagulation. Biochim Biophys Acta. 1998 Nov 10; 1376(3):433-53. Review

62. Krishnaswamy, S., Mann, K.G. The binding of factor Va to phospholipid vesicles.J

Biol Chem. 1988 Apr 25; 263(12):5714-23.

63. Bloom, J.W., Nesheim, M.E., Mann, K.G. Phospholipid-binding properties of bovine

factor V and factor Va. Biochemistry. 1979 Oct 2; 18(20):4419-25.

64. Pusey, M.L., Nelsestuen, G. L. Membrane binding properties of blood coagulation

Factor V and derived peptides. Biochemistry. 1984 Dec 4; 23(25):6202-10.

65. Pusey, M.L., Mayer, L.D., Wei, G. J., Bloomfield, V.A. , Nelsestuen, G.L. Kinetic

and hydrodynamic analysis of blood clotting factor V-membrane binding.

Biochemistry. 1982 Oct 12; 21(21):5262-9.

66. Krieg, U.C., Isaacs, B.S., Yemul, S.S., Esmon, C.T., Bayley, H., Johnson, A.E.

Interaction of blood coagulation factor Va with phospholipid vesicles examined by

using lipophilic photoreagents. Biochemistry. 1987 Jan 13; 26(1):103-9.

67. Tracy, P.B., Mann, K.G. Prothrombinase complex assembly on the platelet surface is

mediated through the 74,000-dalton component of factor Va. Proc Natl Acad Sci U S

A. 1983 Apr;80(8):2380-4.

68. Saenko, E.L., Scandella, D., Yakhyaev, A.V., Greco, N.J. Activation of factor VIII by

thrombin increases its affinity for binding to synthetic phospholipid membranes and

activated platelets. J Biol Chem. 1998 Oct 23; 273(43):27918-26.

69. Krishnaswamy, S., Jones, K.C., Mann, K.G. Prothrombinase complex assembly.

Kinetic mechanism of enzyme assembly on phospholipid vesicles. J Biol Chem. 1988

Mar 15; 263(8):3823-34.

70. Rand, M.D., Lock, J.B., van't Veer C., Gaffney, D.P., Mann, K.G .Blood clotting in

minimally altered whole blood. Blood. 1996 Nov 1; 88(9):3432-45.

71. Pryzdial, E.L., Mann, K.G. The association of coagulation factor Xa and factor Va. J

Biol Chem. 1991 May 15; 266(14):8969-77.

72. Kalafatis, M., Beck, D.O .Identification of a binding site for blood coagulation factor

Xa on the heavy chain of factor Va. Amino acid residues 323-331 of factor V

represent an interactive site for activated factor X. Biochemistry. 2002 Oct 22;

41(42):12715-28.

73. Singh, L.S., Bukys, M.A., Beck, D.O., Kalafatis, M. Amino acids Glu323, Tyr324,

Glu330, and Val331 of factor Va heavy chain is essential for expression of cofactor

activity. J Biol Chem. 2003 Jul 25; 278(30):28335-45. Epub 2003 May 8.

74. Barhoover, M.A., Orban, T., Beck. D.O., Bukys, M.A., Kalafatis, M. Contribution of

amino acid region 334-335 from factor Va heavy chain to the catalytic efficiency of

prothrombinase. Biochemistry. 2008 Jul 1; 47(26):6840-50.

75. Luckow, E.A., Lyons, D.A., Ridgeway, T.M., Esmon, C.T., Laue, T .M. Interaction

of clotting factor V heavy chain with prothrombin and prethrombin 1 and role of

activated protein C in regulating this interaction: analysis by analytical

ultracentrifugation. Biochemistry. 1989 Mar 7; 28(5):2348-54.

76. Guinto, E.R., Esmon, C.T. Loss of prothrombin and of factor Xa-factor Va

interactions upon inactivation of factor Va by activated protein C. J Biol Chem. 1984

Nov 25;259(22):13986-92.

77. Beck, D.O., Bukys, M.A., Singh, L.S., Szabo, K.A., Kalafatis, M. The contribution of

amino acid region ASP695-TYR698 of factor V to procofactor activation and factor

Va function. J. Biol Chem. 2004 Jan 23; 279(4):3084-95. Epub 2003 Oct 14

78. Anderson, P.J., Nesset, A., Dharmawardana, K.R., Bock, P.E. Role of proexosite I in

factor Va-dependent substrate interactions of prothrombin activation. J Biol Chem.

2000 Jun 2; 275(22):16435-42.

79. Liu, L.W., Ye, J., Johnson, A.E., Esmon, C.T. Proteolytic formation of either of the

two prothrombin activation intermediates results in formation of a hirugen-binding

site.- Journal of Biological Chemistry, 1991. 266, 23633-23636.

80. Mannucci, P.M. Hemophilia and related bleeding disorders: a story of dismay and

success. Hematology Am Soc Hematol Educ Program. 2002:1-9.

81. Awidi, A., Ramahi, M., Alhattab, D., Mefleh, R., Dweiri, M., Bsoul, N., Magablah,

A., Arafat, E., Barqawi, M., Bishtawi, M., Haddadeen, E., Falah, M., Tarawneh, B.,

Swaidan, S., Fauori, S. Study of mutations in Jordanian patients with haemophilia A:

identification of five novel mutations. Haemophilia. 2010 Jan; 16(1):136-42.

82. Kalafatis, M., Simioni, P., Tormene, D., Beck, D.O., Luni, S., Girolami, A. Isolation

and characterization of an antifactor V antibody causing activated protein C

resistance from a patient with severe thrombotic manifestations. Blood. 2002 Jun 1;

99(11):3985-92.

83. Koster, T,Rosendaal, F.R, de Ronde, H., Briët, E., Vandenbroucke, J.P., Bertina,

R.M. Venous thrombosis due to poor anticoagulant response to activated protein C:

Leiden Thrombophilia Study. Lancet. 1993 Dec 18-25; 342(8886-8887):1503-6.

84. Bukys, M.A., Orban, T., Kim, P.Y., Beck, D.O., Nesheim, M.E., Kalafatis, M. The

structural integrity of anion binding exosite I of thrombin is required and sufficient

for timely cleavage and activation of factor V and factor VIII. J Biol Chem. 2006 Jul

7; 281(27):18569-80. Epub 2006 Apr 1

85. Xu, H., Bush, L.A., Pineda, A.O., Caccia, S., Di Cera, E. Thrombomodulin changes

the molecular surface of interaction and the rate of complex formation between

thrombin and protein C. J Biol Chem. 2005 Mar 4; 280(9):7956-61. Epub 2004 Dec 6.

86. Rezaie, A.R., Yang, L. Thrombomodulin allosterically modulates the activity of the

anticoagulant thrombin. Proc Natl Acad Sci U S A. 2003 Oct 14; 100(21):12051-6.

Epub 2003 Oct 1.

87. Kalafatis, M., Mann, K.G. The role of the membrane in the inactivation of factor Va

by plasmin. Amino acid region 307-348 of factor V plays a critical role in factor Va

cofactor function. J Biol Chem. 2001 May 25; 276(21):18614-23. Epub 2001 Feb 14.

88. Bukys, M.A., Kim, P.Y., Nesheim, M.E., Kalafatis, M. A control switch for

prothrombinase: characterization of a hirudin-like pentapeptide from the COOH

terminus of factor Va heavy chain that regulates the rate and pathway for prothrombin

activation. J Biol Chem. 2006 Dec 22; 281(51):39194-204. Epub 2006 Oct 4.

CHAPTER II

THE MOLECULAR MECHANISM CORRELATING THROMBIN CLEAVAGE

AND ACTIVATION OF FACTOR V

2.1 ABSTRACT

Blood clotting results in the proteolytic conversion of prothrombin (Pro) to thrombin catalyzed by the prothrombinase complex. Prothrombinase is composed of two subunits: the catalytic subunit, factor Xa (fXa), and the regulatory subunit, factor Va (fVa), assembled on a membrane surface in the presence of divalent metal ions. Factor V (fV), is a multidomain protein (A1-A2-B-A3-C1-C2) with no procoagulant activity and is activated by thrombin to fVa through three proteolytic cleavages at Arg709, Arg1018 and

Arg1545. To understand the significance of each cleavage for active cofactor formation and prothrombinase function, recombinant fV molecules were generated by site-directed mutagenesis with two (out of three) cleavage sites mutated simultaneously (to glutamine).

We have generated the fV molecule mutated at the cleavage sites Arg709/1018 (fVQQR), fV molecule mutated at the cleavage sites Arg709/1545 (fVQRQ), fV molecule Arg1018/1545

(fVRQQ), and a fV molecule that is mutated at all three cleavage sites Arg709/1018/1545

(fVQQQ). These recombinant fV molecules along with wild type fV (fVWT) were transiently expressed in COS-7L cells, purified to homogeneity, and assessed for their

capability to interact with fXa following activation by thrombin and to participate in the formation of prothrombinase. Pro activation by prothrombinase assembled with the mutant molecules was evaluated by SDS-PAGE, and the kinetic parameters of the reactions in the presence of saturating concentrations of fXa were determined. Two-stage clotting assays revealed that while fVQQQ was devoid of clotting activity following incubation with thrombin, fVaQQR, fVaQRQ and fVaRQQ all had impaired clotting activities compared to fVaWT and plasma-derived fVa (fVaPLASMA). Kinetic analyses demonstrated that fVaWT had a Kd of 0.25nM for fXa while all other mutant molecules had impaired binding capabilities for fXa. fVaQQQ was severely impaired in its ability to interact with

QQR fXa. The kcat value for prothrombinase assembled with fVa was approximately 40%

WT lower than the kcat obtained with prothrombinase assembled with fVa , while prothrombinase assembled with fVaQRQ and fVaRQQ had an approximately 3-fold reduced catalytic efficiency when compared to the values obtained with prothrombinase assembled with fVaWT. To determine the importance of the cleavage site at Arg1018 several other recombinant molecules were generated: fVRQR molecule with the mutation

Arg1018→Gln and fVΔB9 is a mutant fV molecule with region the 1000-1008 deleted. We have also generated fVRQR/ΔB9 and fVΔB9/QRQ. Two-stage clotting assays revealed that fVaRQR and fVaRQR/ΔB9 have similar clotting activities as fVaWT, whereas fVaQRQ and fVaQRQ/ΔB9 are impaired in their clotting activities. Kinetic analyses demonstrated that fVaRQR and fVaRQR/ΔB9 have a similar affinity for fXa as fVaWT while fVaQRQ and

ΔB9/QRQ fVa were impaired in their interaction with fXa. The kcat values for

RQR ΔB9/RQR prothrombinase assembled with fVa and fVa were similar to the kcat obtained with prothrombinase assembled with fVaWT, while prothrombinase assembled with

fVaQRQ and fVaQRQ/ ΔB9 had a 2-fold and 7-fold reduced catalytic efficiency respectively,

WT when compared to the kcat values obtained with prothrombinase assembled with fVa .

Overall, the data demonstrate that cleavage at both Arg709 and Arg1545 is a prerequisite for the expression of optimum cofactor activity. Our data also suggests that cleavage at

Arg1018 is dispensable for procofactor activation.

2.2 INTRODUCTION

The coagulation cascade begins with the slightest vascular injury that involves exposure of the tissue factor to the blood flow (1) and, subsequently, results in robust generation of thrombin.

Thrombin is the essential end product in the coagulation cascade (4). The proteolytic conversion of prothrombin to thrombin is catalyzed by the prothrombinase complex. This enzymatic complex is composed of cofactor fVa and enzyme fXa that exist in the presence of divalent calcium ions bound to the membrane surface (2). fXa alone can convert prothrombin to thrombin at a slower rate. However, the interaction of fVa with fXa converts prothrombin to thrombin at a rate that is compatible with survival, increasing the rate of activation 300,000 times compared to rates of activation by fXa alone (3).

Coagulation factors generally circulate in the blood as inactive precursors, and they change to active precursors following limited proteolysis consequent to injury (5). fV plays a quintessential role in the coagulation system. fV circulates at a concentration of

20 nМ. It is a large (Mr 330,000) heavily glycosylated single chain, multi-domain (A1-

A2-B-A3-C1-C2) procofactor with nominal activity (2). The procofactor fV is homologous to fVIII and shares the same domain organization as fVIII.

fV is essentially activated by thrombin. Proteolytic processing of fV by thrombin at cleavage sites Arg709, Arg1018, and Arg1545 results in the production of the active cofactor which consists of a heavy chain (Mr 105,000) and a light chain (Mr 74,000); and fVa is required for the interaction of the cofactor with the members of prothrombinase (6-8)

(Fig.2.1). The two chains are associated via a non-covalent bond in the presence of divalent calcium ions (9). The B-domain is heavily glycosylated, spanning amino acids

710-1545, and is released during activation (30).

It has been previously reported that cleavage site Arg1545 is sufficient for activation, and the release of the B-domain is not necessary for expression of cofactor activity (7, 32,

24). It has also been reported that cleavage sites Arg709 and Arg1018 are kinetically favored over Arg1545 (7, 31, 32), and cleavage at the Arg1545 site is the last one to occur during thrombin activation. The mechanism underlying each cleavage site of fV to convert procofactor into active cofactor is different (shown in our present studies). It has been well established that cleavages at Arg709 and Arg1545 are required for proper activation and optimum cofactor function. However, an enigma is posed regarding which activating cleavage site has a potential destabilizing effect on the procofactor and which region of the B-domain are required for proper thrombin cleavage at Arg709/Arg1545 and the subsequent generation of a heavy and light chain. In our study, one or more cleavage sites were eliminated by mutagenesis, and the effect of each cleavage site on the cofactor activity and formation of prothrombinase complex has been determined.

Activation of fV is a consequence of the removal of the B-domain and the exposure of fXa binding sites on fVa, which ensures the assembly of prothrombinase complex that, ultimately, generates thrombin. Limited information is present about the release of the B-

domain and the exposure of fXa binding sites and conformational change. The B-domain has short evolutionary conserved sites that serve an auto-inhibitory function. The basic region 963-1008 is highly conserved among the vertebrate lineage (34). Any kind of disorder of this region by mutagenesis would lead to cofactor-like properties resistant to activation by thrombin (35). In order to study the effect of this basic region, we deleted a small region 1000-1008 (ΔB9) by site-directed mutagenesis along with mutating one of the three cleavage sites and determined the cofactor activity and prothrombin activation

(Fig.2.1). Our results show a profound effect of recombinant fVa molecules on the cofactor activity and activation of prothrombinase complex. Our experimental results have ruled out that all the three cleavage sites are important for generation. In addition, we conclude that cleavage of fV by thrombin at Arg709 is dependent on the integrity of amino acid region 1000-1006 in the B-domain of the procofactor.

2.3 EXPERIMENTAL PROCEDURES

Materials Required. Phenyl methane sulfonyl fluoride (PMSF), O-phenylenediamine

(OPD)-dihydrochloride,N-[2-Hydroxyethyl] piperazine-N’-2-ethanesulfonoic acid

(Hepes), Trizma (Tris base),and Coomasie Blue R-250 were purchased from Sigma. fV- deficient plasma was from Research Protein Inc (Essex Junction, VT). Secondary anti- mouse and anti-sheep IgG coupled to peroxidase were purchased from southern

Biotechnology Associates Inc. (Birmingham, AL). L-α-phosphatidylserine (PS) and L-α- phosphatidylcholine (PC) were from Avanti Polar Lipids (Alabaster, AL).

Chemiluminescent reagent ECL+ and Heparin Sepharose were from Amersham

Pharmacia Biotech Inc. (Piscataway, NJ). Normal reference plasma and chromogenic substrate H-d-hexahydrotyrosyl-alanyl-arginyl-p-nitroanilide diacetate (Spectrozyme –

TH) were purchased from American Diagnostica Inc. (Greenwich, CT). RecombiPlasTin used in clotting assay was purchased from Instrumentation Laboratory Co. (Lexington,

MA). Polyethylene glycol Mr 8000 (PEG) was purchased from J.T. Baker (Danvers,MA).

The reversible fluorescent α-thrombin inhibitor Dansylarginine –N-(3-ethyl-1,5- pentanediyl) amide (DAPA) , Human fXa was purchased from Enzyme Research

Laboratories( South Bend, IN). Human α- Thrombin and human Prothrombin were purchased from Hematologic Technologies Inc. (Essex Junction, VT). Human fV c-DNA was from American Type Tissue Collection (ATCC# 40515 pMT2-V, Manassas, VA).

All restriction enzymes came from New England Bio Labs (Beverly, MA). All molecular biology and tissue culture reagents, specific primers, and media were purchased from

Gibco, Invitrogen Corp. (Grand Island, NY). Human fV monoclonal antibodies

(αHFVHC#17 and αHFVLC#9) used for immune blotting and monoclonal antibody

αHFV#1 coupled to Sepharose used to purify plasma and recombinant fV were provided by Dr. Kenneth G. Mann (Department of Biochemistry, University of Vermont,

Burlington, VT).

Recombinant fV Molecules. c-DNA clones encoding human fV have been isolated from an oligo (dT)-primed human fetal liver c-DNA library prepared with vector Charon

21A. The c-DNA sequence of fV from three overlapping clones includes a 6672 base pair

(bp) coding region, a 90-bp 5’ untranslated region, and a 163-bp 3’ untranslated region within which is a poly ( A) tail (10). Mutant fV molecules consisting of mutations at different cleavage sites and various deletions of the B-domain region of fVa were synthesized using the Quik-change site-directed mutagenesis kit (Stratagene, La Jolla,

CA) according to the manufacturer’s instructions. The mutagenic primers used for the

making mutations were primers on the sense and antisense strands of the recombinant fV molecule.

The mutagenic primers for R709Q were

5’GCATTAGGAATCCAGTCATTCCGAAAC 3’ (forward) and 5’

GTTTCGGAATGACTGGATTCCTAATGC 3’ (Reverse).

The mutagenic primers for R1018Q were

5’CCTTTATCTCCGCAGACCTTTCACCCTC 3’ (Forward) and 5’

GAGGGTGAAAGGTCTGCGGAGATAAAGG 3’ (Reverse).

The mutagenic Primers for R1545Q were 5’ GCATGGTACCTCCAAAGCAACAATGG

3’ (Forward) and 5’ CCATTGTTGCTTTGGAGGTACCATGC 3’ (Reverse).

The mutagenic primers for 7 amino acid deletion the fVΔB7 were constructed using the mutagenic primers 5′-CTG AAG AAA AGC CAG TTT CTC ATT CAC ACA CAC

CAT GCT CCT TTA -3′ ( Forward) and 5′- TAA AGG AGC ATG GTG TGT GTG AAT

GAG AAA CTG GCT TTT CTT CAG-3′ (Reverse) (corresponding to the

1000KTRKKKK1006 deletion).

The mutagenic primers for 9 amino acid deletion the fVΔB9 were constructed using the mutagenic primers 5′-CTG AAG AAA AGC CAG TTT CTC ATT CAC ACA CAC

CAT GCT CCT TTA TCT CCG-3′ ( Forward) and 5′-CGG AGA TAA AGG AGC ATG

GTG TGT GTG AAT GAG AAA CTG GCT TTT CTT CAG-3′ (Reverse)

(corresponding to the 1000KTRKKKKEK1008 deletion).

We generated all the mutants by changing arginine to glutamine, a single mutant with one of the cleavage site mutated fVRQR (Cleavage site 709/1545 available); and three double mutants with two of the three sites mutated were known as fVQQR (Cleavage site

1545 available), fVQRQ (Cleavage site 1018 available), fVRQQ (Cleavage site 709 available) and one of the triple mutant fVQQQ (All the three cleavage sites were mutated).

We also generated mutations by mutating at two positions along with 9 amino acids deleted with fVQRQ/∆B9, fVRQR/∆B9, and fVRRQ/∆B7. The wild type recombinant fV molecule contained all the arginine residues within all the three cleavage sites.

The mutagenized primers were transformed into competent Escherichia coli cells, and positive ampicillin-resistant clones were selected to screen for mutants. Wild type fV and mutant fV clones were cultured and isolated using pureLink Quik Plasmid miniprep kit

(Invitrogen, Carlsbad, CA). The incorporation of the mutations into the c-DNA was verified by DNA sequence analysis using fV specific primers.

All the deletions and mutations were confirmed by DNA sequencing (DNA Analysis

Facility, Department of Molecular Cardiology at The Lerner’s Research Institute.

Cleveland Clinic, Cleveland. OH).

Expression of Recombinant fV Molecules into COS-7L Cells and Purification. The transfection and harvesting of the media were performed as described by our lab (11, 12).

The COS-7L was maintained in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum and the antibiotics streptomycin (100µg/ml) and penicillin (100IU/Ml) in an atmosphere of 5% CO2 and 95% air at 37ºC. The purified wild type and the recombinant mutated fV plasmids were transfected using

Fugene 6 (Promega) into COS-7 cells. The cells were washed after 48 hours of incubation and treated with VP-SFM (Virus production-Serum free Media), which was collected for 4 consequent days. All media containing recombinant fV were concentrated using the Vivaflow 50 Complete System (Viva science AG, Hannover, Germany)

according to the manufacturer’s instructions. All recombinant fV molecules were purified according to the detailed protocol described previously by our laboratory (13) employing the monoclonal antibodies αhFV#1 coupled to sepharose (14). The concentration of recombinant fV molecules was determined by measuring the optical density (OD) at

280nm and by enzyme-linked immunosorbent assay (ELISA) as previously described

(11,12). The purity and integrity of the recombinant molecules were accessed before and after activation with thrombin by clotting assay, using fV-deficient plasma and by running sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) using

4-12% gradient gel followed by western blotting using both monoclonal and polyclonal antibodies. In some illustrations, recombinant fVa fragments were visualized using silver stain.

Clotting Assay. Clotting activities of recombinant fV and wild type fV molecules were obtained from two-stage clotting assay using START-4, Diagnostica Stago, (Parsippany,

NJ). Prior to assay, the fV molecule is incubated with α-thrombin at 1/50 enzyme-to- substrate ratio. An aliquote of the mixture was then assayed for the clotting activity using fV-deficient plasma and the amount of fVa was limited.

Gel Electrophoresis and Western Blotting. An SDS-PAGE analysis of recombinant fV molecules was performed using 4-12% gradient gels according to the method of Laemmli

(15). Proteins were then transferred to the polyvinylidene difluoride (PVDF) membrane according to methodology described by Towbin et al. (16). After transferring the proteins to PVDF, a fVa heavy and light chain were detected using appropriate monoclonal and polyclonal antibodies (17, 18). Immunoreactive fragments were visualized with chemiluminescence. In several instances, silver staining procedures were conducted to

visualize intact recombinant fV and activated fVa fragments as described previously in

(19).

Prothrombin Activation Pathway Using Gel Electrophoresis. Prothrombin (1.4μM) was incubated in a reaction mixture containing PCPS vesicles (20μM), DAPA (50μM), and recombinant fVa molecules at 20nM (activated with thrombin at a 1/50 enzyme/substrate ratio for 20min) in TBS, Ca2+.The addition of fXa (1nM) marked the start of the reaction. Aliquots (50μL) of the reaction mixture were removed at selected time points, and the reaction was quenched by the addition of 2 volumes of 0.2 M glacial acetic acid and treated as described previously (12). The dried samples were reconstituted in 0.1 M Tris base (pH 6.8), 1%SDS, and 1% β-mercaptoethanol; samples were heated for exactly 75s at 90ºC and vortexed and subjected to SDS-PAGE using 9.5% gels prepared according to the method of Laemmli (15). Six μg of protein per lane were loaded. Protein bands were visualized following staining with Coomassie Brilliant Blue

R-250 and destained by diffusion in a methanol/acetic acid/water solution.

Measuring the Rate of Thrombin Formation. The ability of all recombinant fV molecules to assemble in the prothrombinase complex was assessed in this assay as described in detail in our laboratory (12). All recombinant and wild type fV molecules were activated with human α-thrombin (1/50 enzyme/substrate ratio, 20min at 37ºC) as previously described (20). The reaction mixture contained PCPS vesicles (20µM), Dapa

(3µM), fXa (15pM) and recombinant fVa species in reaction buffer [HEPES, 0.15 M

NaCl, 50 nM CaCl2, and 0.01% Tween 20 (pH 7.40)]. Dapa (twice the concentration of prothrombin) was included in all mixtures to prevent the action of thrombin during the course of assay on fVa, prothrombin, and on itself (22). For the functional calculation of

apparent dissociation constants (KDapp) among the recombinant fVa molecules and fXa, experiments were performed in the presence of a limited concentration of fXa (15pM) and varying concentrations of fVa between 30pM and 10nM. The experiment was initiated with a constant amount of prothrombin (1.4µM) at selected time intervals of 20s,

40s, 60s, 1.30min and 2min. Aliquotes were separately quenched in 80μl of a quench buffer in a 96-well microtiter plate. The initial rate of thrombin formation (initial velocity in nM .IIa, min-1’=’) was calculated, and the data was analyzed and plotted using nonlinear regression analysis and prism (Graph pad) according to a one-binding site model. Dissociation constants were obtained directly from the fitted data (23). The assay verifying the activity of recombinant fV was conducted by measuring thrombin by the change in absorbance of chromogenic substrate at 405nm (Spectrozyme-TH, 0.4mM) monitored with a Theromax microplate reader (Molecular Device, Sunnyvale, CA) (11,

21). Absorbance at 405nm was compared with a standard curve prepared fresh using purified thrombin (0-50nM).

Using purified reagents and verifying the cofactor activity of the recombinant fV molecules for prothrombin activation, the assay was conducted under conditions where fXa was saturated with fVa, as described in (11). Knowing the KDapp of each fVa species for fXa, we calculated the amount necessary to saturate fXa using the quadratic equation described in the literature (22, 25, and 26) before each experiment. All fV molecules were activated with thrombin as described previously (21, 24) for the calculation of kinetic constants of prothrombinase assembled with various recombinant mutants fVa

WT molecules as well as with fVa (Km and kcat) .The absorbance was monitored with a

Thermomax microplate reader and compared to that of a thrombin standard prepared

using purified plasma-derived thrombin. The data has been analyzed and plotted using nonlinear regression analysis and prism according to the Henri Michaelis-Menten equation. Kinetic constants provided herein were extracted directly from the fitted data.

In addition, in the figure legends, we report the goodness of fit to the Henri

Michaelis−Menten equation (R2).

Functional Analysis of Feedback Activation of Recombinant fVa with Prothrombinase

Assembled. Activation of recombinant fV molecules prior to the addition of fXa by thrombin and after the addition of fXa can be scrutinized. In the present experimental procedure, cleavage of recombinant mutants was observed by using the western blot technique as described in the experimental procedures (17, 18).

A reaction mixture containing 1.4µM prothrombin, 20µM PCPS, 3µM DAPA, 20nM fVa and the reaction was initiated with 1nM fXa. Aliquots of the reaction mixture were pulled before the reaction was initiated and after the addition of fXa at 1-h time point.

The reaction mixture was quenched in 0.2 M glacial acetic acid and concentrated using a

Centrivap cold trap (Labconco, Kansas City, MO). The concentrated samples were dissolved in 0.1M Tris base (pH 6.8), 1% SDS and subjected to SDS-PAGE using 4-12% gels prepared according to the method of Laemmli (15). One µg of protein per lane was loaded. Proteolytic cleavage was observed using the western blot techniques with appropriate monoclonal and polyclonal antibodies (17, 18).

2.4 RESULTS

Expression and Activation of Recombinant fV Proteins. Significance of individual cleavage sites of fV for the cofactor activation is determined in the present work. The

single chain procofactor fV is activated by proteolytic cleavage at Arg709, Arg1018 and followed by Arg1545 in a kinetically preferred order resulting in an activated cofactor.

Figure 2.1

Figure 2.1 Recombinant Mutants Generated to Explicate the Role of Individual

Cleavage Site fV is composed of 2196 amino acids with three A domains, a connecting B region, and two C domains. The procofactor is activated following three cleavages by α-thrombin at

Arg709, Arg1018, and Arg1545. To elucidate the mechanism correlating each cleavage site, we generated recombinant fV variants by mutating two of the three cleavage sites and by mutating all the three cleavage sites. fVQQR (Cleavage site 1545 available), fVQRQ

(Cleavage site 1018 available), fVRQQ (Cleavage site 709 available) and one of the triple

mutant fVQQQ (All the three cleavage sites were mutated). Further we also generated point mutations, fVRQR (Cleavage site 709/1545 available). We also generated point mutations induced with deletions, mutating two sites along with 9 amino acids deletion, fVQRQ/∆B9

(Cleavage site 1018 available and nine amino acid 1000-1008 missing), fVRQR/∆B9

(Cleavage site 709/1545 available along with nine amino acid 1000-1008 missing), and fVRRQ/∆B7 (Cleavage site 709/1018 available along with seven amino acid 1000-1006 missing).

To determine the importance of individual cleavage sites for cofactor activity, we have generated a fV molecule mutated at the Arg709/1018 cleavage sites (fVQQR); a fV molecule mutated at the Arg709/1545 cleavage sites (fVQRQ); a fV molecule mutated at the Arg1018/1545 cleavage sites (fVRQQ); and a fV molecule that is mutated at all three cleavage sites

(fVQQQ) as a negative control (Fig.2.1).

Full length wild type fVWT and recombinant fV mutants were transiently expressed in

COS-7 cells and purified employing immunoaffinity chromatography. Then the recombinant molecules along with wild type fVa were subjected to full activation using thrombin as described in the experimental procedure (13). Recombinant fV variants were analyzed by silver stain before and after activation by thrombin. All the recombinant fV molecules along with fVWT were activated with α-thrombin at 37ºC for 20min. Activation is performed every time the experiments are conducted to ensure that appropriate reaction conditions are maintained. Fig.2.2 (in Panels A-E) shows the sub-unit configuration of recombinant fV molecules before and after activation by thrombin (0min, 10min, and 20 min) following silver staining. All fragments observed are consistent with our expectations (Fig.2.2).

All the unactivated fV variants have a single chain, which corresponds to intact fV.

Recombinant fV molecules provided the expected proteolytic pattern upon activation by thrombin. Consequently, the variant fVRQQ (Panel D), with cleavage sites Arg1545 and

Arg1018 mutated, resisted the action by thrombin and did not form a light chain. The variant fVQRQ (Panel E), with cleavage sites Arg709 and Arg1545 mutated, resisted the action of thrombin and has only Arg1018 open which resulted in the absence of both a

heavy and light chain. The variant with fVQQR (Lane C) with cleavage sites Arg709 and

Arg1018 mutated, resisted the action of

Figure 2.2

Figure 2.2 SDS- PAGE Analysis of Purified Recombinant Proteins (3µg/lane) before

(0min) and after Activation with Thrombin (10min, 20min)

In all cases, recombinant fV molecules were activated with the enzyme-to-substrate ratio

1/50, following analysis on 4–12% linear gradient SDS-PAGE electrophoresis and silver staining procedures. The results seen in Panel A-fVWT, Panel B- fVQQQ, Panel- C fVQQR,

Panel D- fVRQQ and Panel E-fVQRQ . The activated fragments of fV are shown below as

HC, Heavy Chain and LC, Light Chain.

thrombin and has Arg1545 open, which resulted in the formation of a light chain and the absence of a heavy chain. We used fVWT (Lane A) as the positive control upon incubation with thrombin, which resulted in a heavy and light chain; the negative control fVQQQ

(Lane B) where all the cleavage sites were mutated was devoid of a heavy or light chain.

To gauge the importance of amino acids in the B-domain region of fV in maintaining the procofactor state or the cofactor state, we have generated several other recombinant molecules: fVRQR recombinant mutant with the mutation Arg1018→Gln and we also generated fVRQR/ΔB9, a recombinant mutant fV with the mutation Arg1018→Gln that is also missing amino acids 1000-1008 and fVQRQ/ΔB9 a recombinant mutant fV with the mutations Arg709/1545→Gln that is also missing amino acids 1000-1008. Activation of the fV variants following incubation with thrombin was analyzed on western blot, using monoclonal antibodies (Fig.2.3).

Figure 2.3

Figure 2.3 Immunoblot Analysis of Recombinant fV Molecules

Purified recombinant fVWT; and purified recombinant molecules fVRQR, fVaRQR/∆B9 and fVQRQ/∆B9 were activated as described under the experimental procedures section, followed by analysis on 4–12% linear gradient SDS-PAGE electrophoresis. In all cases, the enzyme-to-substrate ratio was 1/50. After transfer to PVDF membranes, the heavy and light chain of the recombinant molecules were detected with monoclonal antibodies as indicated in each panel.

Kinetic Analysis of Recombinant fV Variants. In order to determine the relationship between the individual cleavage sites in recombinant fVa and cofactor activity within the prothrombinase complex, we used two of the three cleavage sites mutated or one of the cleavage sites mutated. Therefore, each recombinant fV molecule is cleaved by thrombin, and the ability of fVa mutants to bind to fXa on the surface of phospholipids was probed with a prothrombin activation assay.

The fVa-fXa interaction was probed with an assay performed under conditions of limiting fXa concentrations and varying concentrations of fVa variants. Table 2.1 shows the results of the kinetic studies. Under similar experimental conditions fVaWT and

PLASMA fVa have a similar affinity for the enzyme fXa, and, therefore, have similar Kd. The recombinant molecules fVaQQR, fVaRQQ, fVaRQR and fVaRQR/ΔB9 have a similar affinity towards the plasma-derived fXa, the same as fVaWT and fVaPLASMA, and, therefore, have

QRQ ∆B9/QRQ similar KD. Recombinant variant fVa has nearly ~6-fold increase in Kd and fVa

WT PLASMA has nearly ~4-fold increase in Kd than fVa and fVa . The above results demonstrate that cleavage at Arg1018 located on the B-domain is not required for optimum interaction of rfVa with plasma-derived fXa (Fig. 2.5).

Figure 2.4

Figure 2.4 Kinetic Analysis Comparing Dissociation Constant of Recombinant fVa

Molecules for fXa

Thrombin generation was accessed as described under the experimental procedures section. Prothrombinase assembled with varying concentrations of recombinant fVa mutants purified is shown here, fVaQQR is illustrated by open squares; prothrombinase assembled with purified recombinant fvaRQR by filled squares; and prothrombinase assembled with purified recombinant fVaQRQ/ΔB9 by filled triangles. Prothrombinase assembled with varying concentrations of recombinant purified fVaPLASMA is illustrated by filled circles, and prothrombinase assembled with purified recombinant fVaWT is

illustrated by open circles. Further, fVaRQQ with open triangles; fVaQRQ with open inverted triangles, and fVaRQR/ΔB9 closed inverted triangles. The solid lines represent a nonlinear regression fit of the data using Prism® GraphPad software. All reactions were replicated and errors bars are representative of standard deviation.

To elucidate which parameters of prothrombinase are affected by mutations in the regulatory subunit, we determined the kinetic parameters of the enzyme (Km and kcat) in the prothrombinase assay where all membrane-bound fXa is saturated with fVa. The kinetic constants for each set of titrations are provided in Table 2.1, and the kinetic data deriving from the prothrombinase assay is shown in Fig.2.4. Under the experimental conditions used, the recombinant mutants do not have a significant change in the Km of the reaction. Furthermore, the prothrombinase complex assembled with wild type fVa molecule has a similar kcat value as prothrombinase assembled with plasma fVa (Table

QQR 2.1); prothrombinase assembled with fVa has kcat ~1370nM. Almost similar results

RQR/ΔB9 were obtained for fVa that has kcat 1893nM, and prothrombinase assembled with

RQR fVa has kcat ~1663nM (Table 2.1).

Prothrombinase assembled with other recombinant fVa mutants was characterized by

RQQ QRQ QRQ/ΔB9 lower kcat values; fVa and fVa of about ~724 and 785nM. fVa has nominal~169nM IIa (Table 2.1) (Fig.2.4).

Table 2.1

Factor Va KDapp Km kcat kcat/Km

Species (nM)a (M)b (min-1)b,c (M-1•s-1) x 106

fVaPLASMA 0.5 ± 0.06 0.12 ± 0.02 2029 ± 75 --

fVaWT 0.28 ± 0.03 0.14 ± 0.01 1870 ± 120 222

fVQQR 0.44 ± 0.05 0.19 ± 0.05 1370 ± 87 120

(0.99)

fVRQQ 0.52 ± 0.15 0.14 ± 0.07 724 ± 78 86

(0.95)

fVQRQ 3.1 ± 0.74 (0.86) 0.15 ± 0.05 785 ± 65 87

fVRQR 0.49 ± 0.08 0.16 ± 0.05 1663 ± 109 173

(0.96)

fVQRQ/B9 2.1 ± 0.80 (0.8) 0.27 ± 0.01 169 ±9 10

fVRQR/B9 0.62 ± 0.17 (0.8) 0.10 ± 0.03 1893 ± 128 310

Table 2.1 Functional Properties of Recombinant fV Molecules

The apparent Vmax, Km and kcat values are determined using Prism® GraphPad software to analyze the prothrombin titrations presented in Fig.2.4.

aApparent dissociation constants of recombinant and plasma fVa molecules for plasma-derived fXa (KDapp) were determined as described in the experimental procedures section at limiting fXa concentrations (15pM) according to the binding model assuming one binding site and using the software Prizm. Apparent dissociation constants were derived directly from the fitted data. b The Km and kcat of prothrombinase assembled with saturating concentrations of recombinant fVa molecules were determined as described in the experimental procedures section according to the

Michaelis-Menten equation using the software Prizm. Kinetic constants were derived directly from the fitted data shown in Fig.2.4 c kcat = Vmax/[enzyme] (in the presence of fVa); the enzyme concentrations of prothrombinase (fXa- fVa complex on the membrane surface in the presence of Ca2+) were calculated based on the equations previously described in detail in the literature. Under the conditions employed herein, prothrombinase concentration was assumed to be ~10 pM (the fXa used was > 98% saturated with fVa).

Feedback Activation of Recombinant fVa Proteins before and after Addition of fXa. Our hypothesis thus far is that all recombinant mutant fVa molecules within each mixture remain intact for the duration of the experiments. However, during all the kinetic experiments shown above, we are assessed fVa interaction with fXa in an assay that measures thrombin formation. While we used an excess of a specific thrombin inhibitor, and while all fV activation cleavage sites were changed to glutamine, it was imperative to assess the integrity of the mutant recombinant fV molecules within the mixture containing all reagents prior to and at the end of the experiment in order to verify for any complementary cleavages. Fig.2.5 shows the appropriate control experiments. The data demonstrate that no proteolysis of the recombinant proteins was observed prior to the addition of fXa and after 1-h incubation with fXa. The cleavage pattern showed no change before the addition and after the addition of fXa in all the three cases (Fig.2.5).

Finally, we tested the effect of the deletion of seven amino acids from the B-region on the rate of cleavage of fV at Arg709. The data shown in Fig.2.6 demonstrate a small but significant effect of this region on the rate of cleavage at Arg709.

Figure 2.5

Figure 2.5.Functional Analysis of Feedback Activation with Prothrombinase

Assembled

Recombinant fVa mutants, (fVaWT, fVaQQR, fVaRQQ, fVaQRQ and fVaQRQ/ΔB7), were incubated in prothrombin activation assay before (Lane 1) and after (Lane 2) the addition of fXa as described under experimental procedures section followed by analysis on 4–

12% linear gradient SDS-PAGE electrophoresis. After transfer to PVDF membranes, the heavy and light chain of the recombinant molecules were detected with monoclonal antibodies as indicated in each panel.

Figure 2.6

Figure 2.6 SDS- PAGE Analysis of Purified Recombinant Proteins, before (0 min) and after Activation with Thrombin (5sec, 10sec, 20sec, 1min, 5min, 15min, 25min, and 35 min)

In all cases, recombinant fV molecules were activated with the enzyme-to-substrate ratio of 1/50. After SDS-PAGE analysis and silver staining procedures, the activated fragments of fV are shown above as HC, (Heavy Chain) and LC, (Light Chain) in Panel

A-fVWT, Panel B-fVRRQ, and Panel- C fVRRQ/B7.

2.5 DISCUSSION

The majority of the coagulation proteins are found as inactive proteins and are activated as a result of series of discrete proteolysis events that lead to conformational changes and ensure the assembly of the prothrombinase complex leading to the generation of thrombin (28).

Activation of plasma human-derived fV and plasma bovine-derived fV has been extensively studied by different investigators (7, 3, 30). Previous data has shown the significance of cleavage sites in fVa using in vitro mutagenesis and the expression of recombinant variants. It has been shown that cleavage at Arg709 alone resulted in little activity. However, cofactor activity was augmented following cleavage at Arg709 and

Arg1018. Cleavage at Arg709 and Arg1018 was shown to be very important for rapid cleavage at Arg1545 (31).

It has been demonstrated previously that human fV is 40% identical to human fVIII with the exception of the B-domain, where there is no similarity (36, 37, 38). However, human fV also shares about 56% amino acid identity with snake venom protein pseutarin

C, except in the B-domain, which is largely is truncated in the snake venom protein (39,

40). Our data demonstrate that Arg1018 is not required for fV activation.

In the present work, we mutated two of the three cleavage sites and generated the following recombinant fV mutant molecules: fVaQQR, fVaQRQ and fVaRQQ. We evaluated the cofactor activity of each mutant following incubation with thrombin, and the data showed that fVaQQR had cofactor activity comparable to fVaWT. The cofactor activity of fVaQRQ and fVaRQQ was significantly impaired compared to fVaWT.

QQR WT Our data show that that while fVa had Kd that is similar to fVa , in contrast,

QRQ RQQ fVa and fVa had a 4-fold and 6-fold decrease in the Kd values, respectively. We

QQR also determined that the kcat value for prothrombinase assembled fVa is 30% lower, and prothrombinase assembled fVaQRQ and fVaRRQ are 3-fold reduced whereas prothrombinase assembled for fVaQQQ has no activity.

Moreover, according to western blot analysis, we found that recombinant fV species were activated with α-thrombin in which fVaQQR has only a light chain; fVaRQQ has only a heavy chain; and fVaQRQ does not have any specific activity and does not show any heavy or light chain. fVaQQQ is devoid of specific activity and does not show a heavy or light chain.

Our data demonstrate that cleavage at Arg1018 is not required for expression of full cofactor activity. The fVaRQR recombinant mutant has full cofactor activity following incubation with thrombin. Our data supports previous studies suggesting that fV is activated by the removal of the B-domain; it is vital for procoagulant activity (41). It also supports the notion that cleavage at Arg1018 by thrombin or fXa did not lead to increased or full cofactor activity, which leads to the conclusion that this site may have some other function (32). However, it is noteworthy that earlier data shows that cleavage at Arg1018 facilitates further cleavage at position Arg1545, but our experimental data demonstrate that cleavage at Arg1018 is not required for full cofactor activity (32, 33). Western blot analysis demonstrated that recombinant fVaRQR has full cofactor activity and has both a heavy and light chain following activation with thrombin. Similar experiments demonstrated that fVaRQR/∆B9 also has full cofactor activity with both a heavy and light chain present, whereas fVaQRQ/ΔB9 is devoid of activity with no heavy or light chain present. We also

analyzed the recombinant fV variants for their capability to interact with fXa; fVaRQR and

RQR/∆B9 WT fVa have similar Kd values as fVa . In contrast, prothrombinase assembled with fVaQRQ/∆B9 is devoid of cofactor activity activity and is severely impaired in its interaction with fXa possibly due to intact B-domain fragments. Overall, these data demonstrate that cleavage at Arg1018 is not required for expression of full cofactor activity. Our data also demonstrate that amino acid 1000-1007 is most likely a secondary binding site for thrombin and is necessary for optimum rates of cleavage at Arg709 and

Arg1018. Any defect in this regulatory region from the B-domain will result in defective fV activation.

2.6 REFERENCES

1. Butenas, S., Mann, K.G. Blood Coagulation. Biochemistry (Mosc ). 2002 Jan;

67(1):3-12

2. Mann, K.G., Kalafatis, M. Factor V: a combination of Dr Jekyll and Mr Hyde. Blood

2003; 101: 20–302

3. Nesheim, M.E., Taswell, J.B., Mann, K.G. The contribution of bovine factor V and

factor Va to the activity of prothrombinase. J Biol Chem .1979; 254: 10952

4. Jenny, N.S., Mann, K.G. Coagulation cascade: an overview. In: Loscalzo J, Schafer

AI, eds. Thrombosis and Hemorrhage. Baltimore, Md: Williams and Wilkins;

1998:3–27.

5. Khan, A. M. and James, M. N. G. Molecular mechanisms for the conversion of

zymogens to active proteolytic enzymes. Prot. Sci. 1998. 7, 815-836

6. Nesheim, M. E., Foster, W. B., Hewick, R., and Mann, K. G. J. Biol. Chem.

1984.259, 3187–3196

7. Suzuki, K., Dahlbick, B. & Stenflo, J. Thrombin-catalyzed activation of human

coagulation factor V, 257, 6556 - 6564 (1982) J. Biol. Chem. 1982. 257, 6556–6564

8. Kane, W. H., and Majerus, P. W. Purification and Characterization of Human

Coagulation Factor V J. Biol. Chem.1981. 256, 1002–1007

9. Adams, Ty. E., Hockin Matthew, F., Mann, K. G., Stephen, J. Everse .The crystal

structure of activated protein C-inactivated bovine factor Va: Implications for

cofactor function. Proc Natl Acad Sci U S A. 2004 June 15.

10. Jenny, R.J., Pittman, D.D., Toole, J.J., Kriz, R.W., Aldape, R.A., Hewick,

R.M., Kaufman, R.J., Mann, K.G. Complete cDNA and derived amino acid sequence

of human factor V. Proc. Nati. Acad. Sci. USA. Vol. 84, pp. 4846-4850, July 1987

11. Singh, L.S., Bukys, M.A., Beck, D.O., and Kalafatis, M. Amino acids Glu323,

Tyr324, Glu330, and Val331 of factor Va heavy chain are essential for expression of

cofactor activity. J Biol Chem. 2003 Jul 25; 278 (30):28335-45.

12. Bukys, M.A., Blum, M.A., Kim, P.Y., Brufatto, N., Nesheim, M.E., and Kalafatis, M.

Incorporation of factor Va into prothrombinase is required for coordinated cleavage

of prothrombin by factor XaJ Biol Chem. 2005 Jul 22;280(29):27393-401. Epub 2005

May 16.

13. Erdogan, E., Bukys, M.A., Orfeo, T., Mann, K.G., and Kalafatis, M. Identification of

an inactivating cleavage site for alpha-thrombin on the heavy chain of factor Va.

Thromb Haemost. 2007 Nov; 98 (5):998-100615

14. Nesheim, M.E., Katzmann, J.A., Tracy, P.B., and Mann KG. Factor V.Methods

Enzymol 1980; 80: 243–75U.

15. K .Laemmli. Cleavage of Structural Proteins during the Assembly of the Head of

Bacteriophage T4. Nature 1970 .227, 680 - 685

16. Towbin, H., Staehlin, T., and Gordon, J. Electrophoretic transfer of proteins from

polyacrylamide gels to nitrocellulose sheets: Procedure and some applications .Proc.

Natl. Acad. Sci. U.S.A. 1979. 76, 4350– 43541.

17. Van’t Veer, C., Golden, N. J., Kalafatis, M., and Mann, K. G. Inhibitory mechanism

of the protein C pathway on tissue factor-induced thrombin generation. Synergistic

effect in combination with tissue factor pathway inhibitor. J. Biol.Chem. 1997. 272,

7983– 7994.

18. Kalafatis, M., Haley, P. E., Lu, D., Bertina, R. M., Long, G. L., and Mann, K. G.

Proteolytic events that regulate factor V activity in whole plasma from normal and

activated protein C (APC)-resistant individuals during clotting: An insight into the

APC-resistance assay. Blood 1996. 87, 4695– 4707

19. Merril, C. R., Dunau, M. L., and Goldman, D. A rapid sensitive silver stain for

polypeptide in polyacrylamide gels. Anal. Biochem. 1981 110, 201– 207

20. Erdogan, E., Bukys, M. A., and Kalafatis, M. The contribution of amino acid residues

1508−1515 of factor V to light chain generation. J. Thromb. Haemostasis. 2008 6,

118– 124

21. Beck, D. O., Bukys, M. A., Singh, L. S., Szabo, K. A., and Kalafatis, M. The

contribution of amino acid region ASP695-TYR698 of factor V to procofactor

activation and factor Va function J. Biol. Chem. 2004 279, 3084– 3095

22. Barhoover, M.A., Orban, T., Beck, D.O., Bukys, M.A., and Kalafatis, M.

Contribution of amino acid region 334-335 from factor Va heavy chain to the

catalytic efficiency of prothrombinase. Biochemistry.2008 Jul 1; 47(26):6840-50.

23. Hirbawi, J., Vaughn,J.L., Bukys, M.A., Vos, H.L., and Kalafatis, M. Contribution of

amino acid region 659-663 of Factor Va heavy chain to the activity of factor Xa

within prothrombinase. Biochemistry. 2010 Oct 5; 49(39):8520-34.

24. Kalafatis, M., Beck, D. O., and Mann, K. G. Structural requirements for expression of

factor Va activity. J. Biol. Chem. 2003. 278, 33550– 33561

25. Krishnaswamy, S., Williams, E. B., and Mann, K. G. The binding of activated protein

C to factors V and Va. J. Biol. Chem.

26. Krishnaswamy, S. The interaction of human factor VIIa with tissue factor. J. Biol.

Chem. 1992. 267, 23696– 23706

27. Thorelli, E., Kaufman, R.J., and Dahlbäck, B. Cleavage Requirements of Factor V in

Tissue-factor Induced Thrombin Generation. Thromb Haemost. 1998 Jul; 80(1):92-8.

28. Steen, M., and Dahlback,B .Thrombin-mediated Proteolysis of Factor V Resulting in

Gradual B-domain Release and Exposure of the Factor Xa-binding Site, October 11,

2002 The Journal of Biological Chemistry, 277, 38424-38430

29. Mann, K.G., Nesheim, M.E., Church, W.R., Haley, P.E., and Krishnaswamy, S.

Surface dependent reactions of the vitamin K-dependent enzyme complexes. Blood

.1990; 76:1-165.

30. Esmon, C. T. The subunit structure of thrombin-activated factor V. Isolation of

activated factor V, separation of subunits, and reconstitution of biological activity, J.

Biol. Chem. 1979 254,964- 973.

31. Keller, F. G., Ortel, T. L., and Kane, W. H. Thrombin-catalyzed activation of

recombinant human factor V, Biochemistry. 1995. 34, 41 1 8 -41 24.

32. Thorelli, E., Kaufman, R.J., and Dahlbäck, B. Cleavage requirements for activation of

factor V by factor Xa. Eur J Biochem. 1997 Jul 1; 247(1):12-20

33. Marquette, K. A., Pittman, D. D., and Kaufman, R. J. The factor V B-domain

provides two functions to facilitate thrombin cleavage and release of the light chain,

Blood. 1995 .86, 3026-3034.

34. Camire, R. M., and Bos, M. H. A. The molecular basis of factor V and VIII

procofactor activation. J. Thromb. Haemost. 2009 .7, 1951-1961

35. Zhu, H., Toso, R., and Camire, R. MInhibitory sequences within the B-domain

stabilize circulating factor V in an inactive state. J. Biol. Chem. 2007 282, 15033-

15039

36. Vehar GA, Keyt B, Eaton D, Rodriguez H, O'Brien DP, Rotblat F, Oppermann H,

Keck R, Wood WI, Harkins RN, Tuddenham EG, Lawn RM, Capon DJ.

Structure of human factor VIII.Nature. 1984 Nov 22-28; 312(5992):337-42.

37. Gitschier J, Wood WI, Goralka TM, Wion KL, Chen EY, Eaton DH, Vehar GA,

Capon DJ, Lawn RM. Characterization of the human factor VIII gene Nature. 1984

Nov 22-28; 312(5992):326-30.

38. Colman, Robert W. Hemostasis and Thrombosis: Basic Principles and Clinical

Practice. Philadelphia: Lippincott Williams & Wilkins, 2000. Print.

39. Rao, V .S. Kini, R.M Pseutarin C, a prothrombin activator from Pseudonaja textilis

venom: its structural and functional similarity to mammalian coagulation factor Xa-

Va complex. Thromb Haemost. 2002 Oct; 88(4):611-9.

40. Rao, V.S.,Swarup,S., Kini, R.M. The nonenzymatic subunit of pseutarin C, a

prothrombin activator from eastern brown snake (Pseudonaja textilis) venom, shows

structural similarity to mammalian coagulation factor V. Blood. 2003 Aug 15;

102(4):1347-54.

41 Wiencek, J.R., Na, M., Hirbawi, J., Kalafatis, M. Amino acid region 1000-1008 of

factor V is a dynamic regulator for the emergence of procoagulant activity. J Biol

Chem. 2013 Dec 27; 288(52):37026-38.

CHAPTER III ALLOSTERIC INTERACTIONS REGULATING PROTHROMBIN ACTIVATION AND THROMBIN ACTIVITY

3.1 ABSTRACT

Uncontrollable bleeding at the site of vascular injury is the inception of diseases like stroke, cardiac arrest and other cardiovascular diseases. Upon vascular injury, the proteolytic conversion of prothrombin (FII) to thrombin (IIa) occurs in the presence of the prothrombinase complex. Prothrombinase is an enzymatic complex between factor

Va (fVa) and factor Xa (fXa) assembled on a membrane surface in the presence of divalent metal ions. Although fXa is capable of activating FII through initial cleavage at

Arg271 followed by the cleavage at Arg320, physiologically it would take approximately six months to form a clot, which is not compatible with life. However, the incorporation of fVa into prothrombinase results in a 300,000-fold increase in the catalytic efficiency of fXa for thrombin generation, and the order of cleavages is reversed (initial cleavage at

Arg320 followed by Arg271, which is physiologically compatible with life. Recently, we have shown that the concentration of fVa locally at the place of vascular injury dictates the pathway of FII activation and that fXa has a fVa-dependent interactive site on FII within amino acid region 478-482 (chymotrypsinogen numbering153-157). In addition,

several specific basic residues within FII have been shown to interact with fXa in a fVa- dependent manner (proexosite I). Thus, in order to elucidate the contribution of amino acid residues from both proexosite I and the region 153-157 in FII during activation by fXa-alone or prothrombinase, we constructed several recombinant FII (rFII) molecules.

In this study, we generated several recombinant FII mutants in which basic residues from

(pro) exosite I Arg340, Lys341, Arg382, Lys385, Arg388, Arg390 and Arg393 (Chymotrpsinogen numbering Arg35, Lys36, Arg67, Lys70, Arg73, Arg75, and Arg77) along with fVa-dependent sites on FII (478-482) 153-157 were mutated and/or deleted. The first rFII was mutated with two point alanine mutations at 67A/70A known herein as rFIIW2, then we generated rFII with five point alanine mutations known herein as rFIIW5 (where

67A/70A/35A/36A/77A), followed by rFII with seven alanine mutations known herein as rFIIW7 (where 67A/70A/35A/36A/77A/73A/75A). Next, we generated rFII molecules missing amino acids 153-157 (rFIIΔNC) and having point mutations as rFIIW2/ΔNC, rFIIW7/ΔNC. Then we generated mutants rFIIΔW2 (by deleting 67/70) and we also generated rFIIΔW2/ΔLQ (by deleting 67/70 and deleting L155/Q156 from the five amino acid stretch

153-157). All the rFII molecules and wild type FII (rFIIWT) were stably transfected in

BHK-21 cells, purified to homogeneity according to a well-established protocol. The last step of the procedure utilized a Fast Performance Liquid-Chromatography instrument equipped with a strong anionic exchanger that employed the use of a step-wise calcium gradient to isolate fully carboxylated rFII. The rFII molecules were analyzed for their ability to be activated by both fXa alone or the prothrombinase complex by SDS-PAGE.

Gel electrophoresis revealed that activation of all recombinant molecules by membrane - bound fXa alone did not show any detectable change when comparing to the activation of

rFIIWT under similar conditions. In contrast, prothrombinase activity of several rFII molecules was severely impaired. Subsequently, a clotting assay using prothrombin deficient plasma revealed that rFIIW2, rFIIW5, rFIIW2 /ΔNC, rFIIW7/ΔNC and rFIIΔ67/70/ΔLQ had prolonged clotting times. In contrast, rFIIΔ67/70 and rFIIW7 were devoid of clotting activity. All mutants had impaired capability in activating fV and fVIII. In conclusion, our data suggest that basic residues from anion basic exosite I of prothrombin provide a fVa-dependent binding of fXa on FII within prothrombinase and are also required for procofactor activation. Our data suggest that amino acids Leu480 (Chymotrpsinogen numbering Leu155) and Gln481 (Chymotrpsinogen numbering Gln156) allosterically interact with basic exosites on FII, thus modulating the enzymatic activity of fXa within the prothrombinase complex. Our results also provide further explanation for a natural mutation in proexosite I (Arg67→Cys, Arg78→Hys). Patients harboring this natural mutation have dysfunctional abilities to form a fibrin clot and, thus are prone to be severe bleeders.

3.2 INTRODUCTION

FII is a vitamin K-dependent serine protease that is proteolytically converted to thrombin by a catalytic complex (fXa, cofactor fVa on a negatively charged phospholipid membrane in presence the of divalent calcium ions) in the penultimate step of blood coagulation. FII is activated to thrombin by fXa as a result of two peptide bond cleavages: Arg271 and Arg320. The catalytic domain of FII bears strong homology with other serine protease enzymes, such as trypsin and chymotrypsin. Different numbering has been developed based on α-thrombin, prethrombin-2 sequences in bovine, human, and chymotrypsinogen (45). Previously, different numbering has triggered confusion. In

the present study we make use of chymotrypsinogen; numbering, this approach is very important in making a direct comparison among serine protease members.

Conventionally, fXa alone can activate FII to IIa where initial cleavage at Arg271 of

FII results in the generation of an inactive intermediate prethrombin-2. Further cleavage of prethrombin-2 at Arg320 generates thrombin (Prethrombin-2 Pathway) (27-30).

However, when fXa interacts with the members of prothrombinase complex, in the presence of fVa, the order of cleavages reverses, where the initial cleavage at Arg320 generates an obligatory, active intermediate mezothrombin. Further cleavage of Arg271 results in the generation of IIa (Meizothrombin Pathway) (26). The enzymatic aspects of the prothrombinase complex, where the molecular interactions take place between the members of prothrombinase in relation to fXa alone, have shown a greater than 1000-fold increase in kcat and 100-fold decrease in Km. The 100-fold decrease in Km is due to the tight assembly of the prothrombinase complex on the membrane surface (31).

Factor V (fV) is a single chain procofactor with minimal cofactor activity. It is a multidomain protein (A1-A2-B-A3-C1-C2) which circulates in blood at a concentration of 20µM (32-35). fV is activated sequentially following cleavage at Arg709, Arg1018 and

Arg1545 (36-39) by either thrombin or by fXa (40,41) so that fV forms an active cofactor, fVa (fVa). fVa takes part in the formation of the prothrombinase complex. FII circulates in blood as single chain glycoprotein at a concentration of 1.4µM (42, 43). Mature FII protein is composed of four distinct domains: a domain containing several post- translationally modified γ-carboxyglutamic acid residues (described as the Gla domain, residues 1–46), followed by two Kringle domains (residues 65–143 and 170–248, respectively), and a serine protease domain (residues 272–579, see Fig. 3.1). FII contains

three linkers as follows: linker 1 (residues 47–64) connects the Gla domain to kringle-1; linker 2 (residues 144–169) connects the two kringles; and linker 3 (residues 249–284) connects kringle-2 to the A-chain portion of IIa (42, 44) (Fig.3.1).

IIa plays a key regulatory role in hemostasis. FII has a lower affinity sites proexosite I and proexosite II. The activation of FII results in the expression of higher affinity sites, exosite I and exosite II on IIa. Basic exosite I is in the low affinity precursor proexosite I that is a fVa dependent site for fXa binding. Proexosite I is well characterized and has electropositive sites that functionally bind to thrombomodulin, fibrinogen, fV & fVIII, heparin, and hirudin peptides (1). Studies also show that interaction between fVa and fXa exposes secondary binding sites on the serine protease domain of FII (Kringle I and II)

(2).

An earlier investigation and recent data from our lab have shown binding sites on FII for fVa in each of the kringle domains (3-5) and within Gla domain (6). Additional investigation with anion binding exosites or acidic peptides from the carboxy terminal region of the heavy chain of fVa led to a region rich in basic amino acids from FII; these amino acids are necessary for protein-protein interactions between fVa and prothrombin.

Site directed mutagenesis of these basic residues generated rFII molecules that were severely impaired in their ability to be activated by prothrombinase. It was earlier suggested by Yegneswaran et al. that there are fXa binding sites (fVa-dependent sites close to anion binding exosites I) within the amino acid region 473–487, (homologous to chymotrypsin residues 149D-163) (7) and fVa-independent sites for fXa 557–571,

(homologous to chymotrypsin residues 225–239) (8). These investigations revealed limited information about the FII activation pathways by prothrombinase and fXa alone.

Despite the extensive work on these proexosites, the lack of information on which basic amino acids among Arg35, Lys36, Arg67, Lys70, Arg73, Arg75, and Arg77

(chymotrypsinogen numbering (9)) in FII play a vital role in the interaction of prothrombin and fVa. rFII mutants were analyzed for their ability to function as zymogen for fXa in the presence and absence of fVa in a prothrombinase complex. Our findings identified the allosteric interactions of these basic residues within FII required for optimum FII activation rates and optimum IIa function. Our data suggest that amino acids

Leu480 and Gln481 allosterically interact with basic exosites on FII, thus modulating the enzymatic activity of fXa within the prothrombinase complex.

3.3 EXPERIMENTAL PROCEDURES

Materials Reagents and Protein. Phenylmethanesulfonylfluoride or phenylmethyl- sulfonyl fluoride (PMSF), O-phenylenediamine (OPD)-dihydrochloride, N-[2-

Hydroxyethyl] piperazine-N’-2-ethanesulfonoic acid (Hepes), Trizma (Tris base), and

Coomasie Blue R-250 were purchased from Sigma (St.Louis, MO). Factor V-deficient plasma was from Research Protein Inc. (Essex Junction, VT). Secondary anti-mouse and anti-sheep IgG coupled to peroxidase were purchased from Southern Biotechnology

Associates Inc. (Birmingham, AL). L-α-phosphatidylserine (PS) and L-α- phosphatidylcholine (PC) were purchased from Avanti Polar Lipids (Alabaster,

AL).Chemiluminescent reagent ECL+ and Heparin Sepharose were purchased from

Amersham Pharmacia Biotech Inc. (Piscataway, NJ). Normal reference plasma and chromogenic substrate H-d-hexahydrotyrosyl-alanyl-arginyl-p-nitroanilide diacetate

(Spectrozyme -TH) were purchased from American Diagnostica Inc. (Greenwich, CT).

RecombiPlasTin used in clotting assay was purchased from Instrumentation Laboratory

Co.(Lexington, MA). Polyethylene glycol Mr 8000 (PEG) was from J.T. Baker (Danvers,

MA). The reversible fluorescent α-thrombin inhibitor Dansylarginine –N-(3-ethyl-1,5- pentanediyl) amide (DAPA) were purchased from Haematologic Technologies Inc.

(Essex Junction, VT).Human factor Xa was purchased from Enzyme Research

Laboratories( South Bend, IN) , human α- Thrombin and human Prothrombin were purchased from Haematologic Technologies Inc. (Essex Junction, VT). Human Factor V c-DNA was from American Type Tissue Collection (ATCC# 40515 pMT2-V, Manassas,

VA). The plasmid Pzem229R-lite annot encoding human prothrombin was a generous gift from Dr.Kathleen Berkner (Cleveland Clinic Foundation,

Cleveland,OH).QuickChange® II XL Site Directed Mutagenesis Kit was purchased from

Agilent Technologies Genomics (Santa Clara, CA). All molecular biology and tissue culture reagents, specific primers, and media were purchased from Gibco, Invitrogen

Corp. (Grand Island, NY) or as indicated. Human factor V monoclonal antibodies

(αHFVHC#17 and αHFVLC#9)used for immune blotting and monoclonal antibody

αHFV#1 coupled to Sepharose used to purify plasma and recombinant fV were provided by Dr. Kenneth G. Mann (Department of Biochemistry, University of Vermont,

Burlington, VT). Plasma factor V (fVPLASMA) was purified as previously described (19).

In some experiments, fVa was purified as previously described following activation by α- thrombin by FPLC using Mono Q (GE Healthcare Bio-Sciences AB,Uppsala

Sweden)(20).

Construction of rFII Molecules. To investigate the importance of proexosite I region of FII, we generated point mutations and deletions in basic region Arg35, Lys36, Arg67,

Lys70, Arg73, Arg75, and Arg77 (chymotrypsinogen numbering (9)).We first constructed rFII molecules rFIIW2 by mutating rPro67R/70K → AA, using the mutagenesis primers 5’-

GACCTTCTGGTGGCCATTGGCGCGCACTCCCGCACCAGG-3’ (sense) and 5’-

CCTGGTGCG GGA GTG CGCGCCAATGGCCACCAGAAGGTC-3’ (antisense). To further determine the sequence of amino acid required for the fVa-dependent fXa binding on pro within the region 478-482 (153-157 chymotrypsinogen numbering) of serine protease domain, we deleted five amino acids and generated a rFII mutant rFII153-

157→ΔNC using mutagenic primers5’-

GGTAAGGGGCAGCCCGTGAACCTGCCCATT -3’( sense) and 5’-

AATGGGCAGGTTCACGGGCTGCCCCTTACC -3’( antisense) ( corresponding to

153SVLQV157 Deletion). Similarly, as a control we constructed rFIIW2/ΔNC, by using same primers as rFII67R/70K → AA and ΔNC.

We also generated another mutant by making five point mutations within the proexosites region I by mutating 67A/70A/35A/36A/77A as rFIIW5, using mutagenic primers 5’ -CAGGTGATGCTTTTCGCGGCGAGTCCCCAGGAGCTGCGT -3’ (sense) and 5’- CAGCAGCTCCTGGGGACTCGCCGCGAAAAGCATCACCTG -

3’(antisense)(corresponding to RK35/36→AA) and 5’-

AAGCACTCCCGCACCAGGTACGAGGCTAACATTGAA-3’(sense) and 5’-

TTCAATGTTAGCCTCGTACCTGGTGCGGGAGTGCTT-3’(antisense)

(corresponding to E77→A)

We also generated another set of mutants by making seven point mutations within the proexosites region I. We generated rFIIW7 by mutating 67A/70A/35A/36A/77A/73A/75A using mutagenic primers. We generated rFII67R/K70→AA using the mutagenesis primers

5’-GACCTTCTGGTGGCCATTGGCGCGCACTCCCGCACCAGG-3’ (sense) and 5’-

CCTGGTGCG GGA GTG CGCGCCAATGGCCACCAGAAGGTC-3’ (antisense) and same primers used in constructing rFIIW5. On the other hand, as a control we generated rFIIW7/ΔNC using and mutagenic primers same as as rFIIW7 and ΔNC.

Finally, we constructed rFIIΔ67/70 by deleting amino acids Arg67/Lys70, using mutagenic primers 5’ GAC CTTCTGGTGATTGGCCACTCCCGCACC-3’ (sense) and 5’-

GGTGCGGGAGTGGCCAATCACCAGCAGAAGGTC-3’ (antisense). We also generated rFIIΔ67/70/ΔLQ by deleting Arg67/ Lys70 and deleting 155Leu/Gln156. We used same mutagenic primers for rFIIΔ67/70 and 155Leu/Gln156 we used 5’ -

CAGCCCAGTGTCGTGGTGAACCTGCCCATT -3’ (sense) and 5’-

ATTGGGCAGGTTCACCACGACACTGGGCTG-3’ (antisense).

All the deletions and mutations were confirmed by DNA sequencing (DNA Analysis

Facility, Department of Molecular Cardiology at The Lerner’s Research Institute.

Cleveland Clinic, Cleveland. OH).

Expression of rFII Wild Type and rFII in Mammalian Cells.The expression of wild type FII by PZEM229R expression vector system in baby hamster kidney cells (BHK-21) has previously been described in detail (10). BHK cells were maintained in Dulbecco’s modified Eagle’s medium supplemented with fetal bovine serum (10%) and streptomycin

/ penicillin (1%) mixture. The BHK-21 cells were grown in the environment of 5%CO2 humidified atmosphere at a temperature of 37°C. The wild type FII and mutant FII plasmids (4-6µg) were transfected in BHK-21 cells using a lipid based transfection reagent, lipofectamine (Invitrogen Corp), according to the manufacturer’s instructions.

After 48-h of transfection, the cells were treated with selection media which is

Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with fetal bovine serum

(10%) and streptomycin / penicillin (1%) mixture and methotrexate (1µM) (10). The cells were treated with selection media for about a month and more, until approximately 1cm round colonies were formed. Once the colonies were formed methotextrate resistant colonies were isolated, grown and screened. Different clones have variable expression levels. The highest secreting clones were picked, cultured with expression media, and further analyzed by western blotting using a monoclonal antibodies and plasma derived

FII as a standard (one µg/ml). For large scale protein expression, the clones are maintained in serum-free OptiMEM supplemented with ZnCl2 (50µM), vitamin K

(10µg/ml) and penicillin/ streptomycin/Fungizone (1%v/v) mixture, and the media were collected every 2 days for 2-3 weeks. Following protein collection, clotting assay was performed using FII deficient plasma to analyze resistant colonies for their level of secretion of recombinant protein and compared to plasma-derived FII as a standard

(1µg/ml). Considerable variation was observed between individual clones for both rFIIWT and other recombinant FII proteins.

rFII Molecules Purification. rFII purification molecules were purified according to a well established protocol previously described in detail (10). In short, the collected rFII media is thawed, filtered (0.4µM), and loaded on tandem column set up of amberlite

XAD2 and Q-Sephrose. The media (4L) is loaded overnight on a tandem column followed by washing the Q-Sepharose column with TBS (0.02M Tris, 150mM NaCl, pH7.4). The

FII molecules were then eluted off the column using 0.02M Tris, 0.5 M NaCl and pH7.4.

Eluted fractions were collected and pooled; barium citrate precipitation was used to

isolate FII molecules according to a well established method as described (10). The barium citrate precipitate was further centrifuged for 20 minutes at 8,000 ×g, and the supernatant was discarded. The pellet was dissolved in minimal volume of EDTA (0.5M, pH 7.4). The suspended mixture was dialyzed overnight in TBS (4L) followed by dialysis for 4hrs in fresh TBS (4L). The solution containing FII was then filtered (0.22µM) and loaded on Fast Performance Liquid-Chromatography (FPLC), equipped with MonoQ

5/50 column, equilibrated in TBS, and a step-wise gradient of calcium (0-50mM) was used to isolate fully carboxylated prothrombin. Collected tubes of fully carboxylated FII were concentrated using Millipore centricon (Bellerica, MA) and aliquots were frozen at

-80°C to avoid freeze-thaw cycles.

Analysis of FII Molecules by Gel Electrophoresis and Western Blotting. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was carried out using

9.5% gel according to Laemmli (11). A method modification was described by Towbin et al. in several experiments where proteins were transferred to polyvinylidene difluoride

(PVDF) (11). The PVDF membrane with proteins were then incubated with monoclonal and polyclonal antibodies specific to FII, and protein bands were visualized by chemiluminescence using ECL plus reagents as described in (13).

FII Activation Pathway Using Gel Electrophoresis. FII activation with membrane- bound fXa alone was as described in detail in our laboratory; FII (1.4 μM) was incubated in a reaction mixture containing PCPS vesicles (20 μM), DAPA (3μM). In TBS, Ca2+ were incubated for 5min .The addition of fXa (1nM) marked the start of the reaction (14,

15, 16). Aliquots (50μL) of the reaction mixture were removed at selected time points and the reaction was quenched when added to 2 volumes of 0.2 M glacial acetic acid and

treated as described previously (14). The dried samples were reconstituted in 0.1M Tris base (pH 6.8), 1% (pH 6.8), 1%SDS, and 1% β-mercaptoethanol, heated for exactly 75s at 90ºC, vortex, and subjected to SDS-PAGE using 9.5% gels prepared according to the method of Laemmli (11); six μg of protein per lane were applied. Protein bands were visualized following staining with Coomassie Brilliant Blue R-250 and destained by diffusion in a methanol/acetic Acid/water solution. Similarly, to investigate FII cleavage and activation by prothrombinase complex, the reaction mixture was incubated with

1.4µМ recombinant and human FII, 50µМ lipids, DAPA (3μM), and 20nМ purified fVaPLASMA in TBS Ca+2. Aliquots (50μL) of the reaction mixture were removed at selected time points, and the reaction was quenched when added to 2 volumes of 0.2 M glacial acetic acid and treated as described previously (14,15,16,17). Gel electrophoresis and scanning densitometry was used to visualize the FII fragment and quantify the FII consumption as previously described in detail (5, 14, 15).

Kinetic Studies for Determination of IIa Production.The ability of all recombinant FII molecules to assemble in the prothrombinase complex was assessed in this assay as described in detail in our laboratory (16). A determination of kinetic constants of

prothrombinase assembled (Km and kcat) was performed; the reaction mixture contained

PCPS vesicles (20µM), Dapa (3µM), factor Xa (15pM), recombinant fVPLASMA (20 µM) and varying concentrations of FII in a reaction buffer (HEPES, 0.15 M NaCl, 50 nM

CaCl2, and 0.01% Tween 20 (pH 7.40)). Dapa (twice the concentration of FII) was included in all mixtures to prevent the action of thrombin during the course of assay on fVa, FII, and on itself (18). Aliquots are taken and quenched in 80µl of quench buffer in a

96-well microtiter plate at selected intervals of time from each reaction tube. The initial

rate of IIa (initial velocity in nM .IIa, min-1) formation was calculated, and the data was analyzed and plotted using nonlinear regression analysis and prism (Graph pad) according to a one-binding site model (15). The data has been analyzed and plotted using nonlinear regression analysis and Prism, according to the Henri Michaelis-Menten equation. All kinetic constants provided here were extracted directly from the fitted data.

In addition, all the experiments were conducted in duplicate and we reported the goodness of fit (R2) to the Henri Michaelis-Menten equation. In order to avoid any artifact or inter-experiment variation, all recombinant mutant FII molecules were assayed at same time and with the same reagents.

rIIa Activity. Prothrombinase (1nM) is used to convert rFII molecules rIIa. The gel electrophoresis technique was used to access full conversion of rFII to rIIa as described.

The chromogenic substrate S-2238 was used to access rIIa activity by employing serial dilutions of the substrate in the Tris-NaCl buffer in the presence of 0.1% PEG8000. The final concentrations of S-2238 used in the reactions were 0.94, 1.87, 3.75, 7.50, 15, and

60µM. The reaction was initiated by the addition of 1nM rIIa. The data were obtained at

1min using a Spectra Max M2 plate reader (Molecular Devices). The optical density was automatically adjusted for a 1-cm path length, and the Vmax was calculated from the optical density using an established extinction coefficient of S-2238 at room temperature

(52) following plotting of the data to the Michaelis-Menten equation using the software

Prizm (Graph Pad).

Activation of fV and fVIII by rIIa. Prothrombinase (1nM) is used to convert rFII molecules to rIIa. The gel electrophoresis technique was used to access full conversion of rFII to rIIa as described. rIIaWT and rIIa mutants were accessed for their aptitude to cleave

and activate the cofactors over time by SDS-PAGE. Reaction mixtures were diluted in a

Tris-NaCl buffer in the presence of Ca+2 ions with either 500nM plasma-derived human fV or recombinant human fVIII. The reaction was initiated with 4nm rIIa.

FII Clotting Assay. Clotting assay using FII-deficient plasma was employed in order to access the function of all FII molecules in the whole plasma. The clotting assay was performed as described in the literature (17), and the time needed to form a fibrin plug was monitored at 37°C using a Diagnostica StagoSTart® 4 hemostasis analyzer as described in (17); the analyzer was set up to automatically measure the time of clot up to

240s.

3.4 RESULTS

Expression of rFII. To investigate the role of basic residues (Arg35, Lys36, Arg67, Lys70,

Arg73, Arg75, and Arg77) in the proexosite region of FII and their potential interaction with fVa, we stably transfected, rFIIWT and several recombinant mutants in BHK-21 cell lines according to a well-defined protocol as previously described in (10). Mutant recombinant molecules prepared were as follows: rFIIW2 (where 67A/70A), rFIIW5 (where

67A/70A/35A/36A/77A), rFIIW7 (where 67A/70A/35A/36A/77A/73A/75A), rFIIW2/ΔNC

(where 67A/70A with missing amino acids 153SVLQ157), rFIIΔW2/ΔLQ (missing amino acids 67/70 and missing157 LQ158), rFIIW7/ΔNC (67A/70A/35A/36A/73A/75A/77A and missing amino acids 153SVLQV157 ) and rFIIΔW2 (missing amino acids 67/70). We also generated another recombinant mutant rFIIΔNC (missing amino acids 153SVLQV157) and rFIIΔLQ (missing 157LQ158), as negative controls (Fig.3.1). All the recombinant proteins were expressed and purified to homogeneity. The recombinant mutants provide the best

way to probe the role of these basic amino acid residues. In all experiments, the results obtained with recombinant mutants were compared to control rFIIWT and rFIIPLASMA.

Figure 3.1

Figure 3.1 Schematic of FII

IIa is generated from FII through two fXa catalyzed cleavages at Arg271 and at Arg320 resulting in the IIa formation. The orange rectangle denotes the fVa-independent site for fXa on FII, and the yellow rectangle represents the fVa-dependent site for fXa on FII studied in here. The dark blue rectangle displays amino acids composing the proexosite

(I) of FII. All the recombinant mutants generated were stably transfected, purified to homogeneity, and were used in the following study.

Prothrombin Times. The aptitude of FII and all rFII molecules to be activated and promote a fibrin clot, under physiological conditions, was initially assessed using prothrombin times (PTs) (Fig.3.2). The results shown demonstrate that rFIIWT and rFII

PLASMA have comparable clotting times 12.1, 12.0 respectively; however, all recombinant pro molecules were severely impaired in their clotting activity: rFIIW2 had PT around

~102 s; rFIIW5 had PT times ~95s; rFIIW2/ΔNC~93s; rFIIW7/ΔNC~108 s; and rFIIΔW2/ΔLQ had

PT times ~60s. In contrast, rFIIΔW2, rFIIW7, rFIIΔLQ, and rFIIΔNC were devoid of clotting activity. Overall, these results demonstrate the basic residues within the proexosite region of FII profoundly affect fibrin plug formation, severely affecting thrombin activity.

Figure 3.2

Figure 3.2 Clotting Analysis of Recombinant FII Molecules

The average clotting time found in four different measurements using plasma deficient

FII is shown for all FII/rFII molecules identified at the bottom of the graph.

Figure 3.3

Figure 3.3 Prothrombin and its Activation Fragments

Prothrombin and different activation fragments derived from prothrombin. Prothrombin fragment 1 and fragment 2 along with the A and Bchains of α-thrombin are identified.

There are two autocatalytic sites Arg155 and Arg284 are catalyzed by thrombin, whereas

Arg271 and Arg320 are catalyzed fXa. The other fragments identified as a consequence of cleavage sites are α-, β-, and γ- thrombin (Adapted from 50).

Table 3.1

Table 3.1 Molecular Weight of Prothrombin Fragments

In the current table we have the individual prothrombin fragments and their molecular weight.

Activation of rFII Molecules. To ascertain the effect of basic residues within the proexosite region of FII for their ability to be activated by membrane-bound fXa alone in absence of fVa, we assessed the pattern of activation by gel electrophoresis over a 2-h time period (Fig.3.4). Fig.3.5A shows a control experiment and demonstrates that FIIWT activation by membrane-bound fXa alone proceeds following initial cleavage at Arg271 through the intermediate prethrombin-2 with a very slow and gradual appearance of the

B-chain of thrombin because of inept rate of cleavage at Arg320. rFIIΔNC (deletion of 153-

157) was used as negative control (Fig.3.4). There is an acceleration of rFIIΔNC consumption by fXa alone through the initial cleavage Arg271 that is evident by the robust generation of prethrombin-2 intermediate. This is accompanied by minimal amounts of the B-chain due to slow and restricted cleavage at Arg320 resulting in delayed rate of of rFIIΔNC activation compared to rFIIWT.

We further investigated the role of the basic residues 35/36/67/70/73/75/77 during FII activation by membrane-bound fXa alone. rFIIW2 is activated by membrane-bound fXa through initial cleavage at Arg271 similar to rFIIWT, which is evident by the expeditious formation of prethrombin-2. Furthermore, the intensity of the B-chain of thrombin revealed a substantial impediment to cleavage at Arg320 of rFIIW2. In addition, rFIIΔW2, rFIIW5 and rFIIW7 in presence of membrane-bound fXa show rates of cleavage similar to rFIIW2. These data demonstrate that FII activation by fXa alone is not dependent on amino acids from ABE-I.

Figure 3.4

Figure 3.4 SDS-PAGE Analyses of FIIplasmaand rFII Mutant Activation by

Membrane-Bound fXa Alone

Represented here Panel A: rFIIplasma; Panel B: rFIIΔW2; Panel C: rFIIW2/ΔNC; Panel D: rFIIW5 ; Panel E: rFIIW7; Panel F: FIIW7/ΔNC; Panel G: rFIIΔ67/70; Panel H: FIIΔ67/70/ΔLQ and

Panel I: rFIIΔNC .With the set experimental conditions (1.4 μM) in the presence of PCPS vesicles, DAPA, and membrane-bound fXa alone (5 nM).M represents the lane with molecular weight markers (from top to bottom): 98,000, 64,000, 50,000, and 36,000, respectively. Lanes 1–19 show samples from the reaction mixture before (0 min) the addition of fXa and 20, 40, 60, 80, 100, 120, 150, 180, 210, and 240 s and 5, 6, 10, 20,

30, 60, 90, and 120 min, respectively, after the addition of fXa. FII-derived fragments are identified to the right of A–D as follows: FII, prothrombin (amino acid residues 1–

579); P1, prethrombin-1 (amino acid residues 156–579); F1·2-A, fragment 1·2-A chain

(amino acid residues 1–320); F1·2, fragment 1·2 (amino acid residues 1–271); P2, prethrombin-2 (amino acid residues 272–579); B, B-chain of IIa (amino acid residues

321–579); F1, fragment 1 (amino acid residues 1–155). (Fig.3.3 and Table 3.1)

To further advance our understanding of FII activation by prothrombinase, we studied the pattern of FII activation by fully assembled prothrombinase by gel electrophoresis over a 2-h time period. A control experiment (Fig.3.5A) demonstrated that under conditions used to activate FIIWT, the reaction proceeds efficiently following initial cleavage at Arg320, through the obligate intermediate, mezothrombin, which is enzymatically active, as confirmed by the appearance of fragment 1.2-A (Fig.3.3). Rapid cleavage of this fragment at Arg271 leads to the formation of IIa. rFIIΔNC (Deletion of153-

157) is used as a negative control in Fig.3.5I, where the slow consumption of rFIIΔNC is evident by the delayed formation of fragment 1.2, followed by the delayed and slow formation of IIa .

We next assessed the essential role of basic residues from ABE-I (67/70/35/36/73/77) for FII activation by fully assembled prothrombinase. Under the conditions employed rFIIW2 shows robust generation of IIa similar to rFIIWT (Fig.3.5A-B). In addition, rFIIW5 and rFIIW7 show a similar cleavage pattern of activation as rFIIW2 and rFIIWT. These data demonstrate that the simple amino acid substitution within ABE-I is of no consequence for prothrombin activation.

We next tested the recombinant mutant rFIIW2/ΔNC, (which has recombinant mutant rFIIW2 along with a five amino acid deletion 153-157 (ΔNC)) for the fXa membrane- bound activation pattern by gel electrophoresis (Fig.3.4D). There is acceleration of rFIIW2/ΔNC consumption by fXa alone through initial cleavage at Arg271 that is evident by robust generation of prethrombin-2. However, there is no trace of the B-chain of IIa evident under the conditions employed, suggesting a delay in cleavage at Arg320 of the mutant as compared with the cleavage of rFIIWT.

Figure 3.5

Figure 3.5 SDS-PAGE Analyses of rFII Molecule Activation by Prothrombinase.

Represented here Panel A: rFIIplasma; Panel B: rFIIΔW2; Panel C: rFIIW2/ΔNC Panel D: rFIIW5; Panel E: rFIIW7; Panel F: FIIW7/ΔNC; Panel G: rFIIΔ67/70; Panel H: FIIΔ67/70/ΔLQ and

Panel I: rFIIΔNC.With the set experimental conditions (1.4 μM) in the presence of PCPS vesicles, DAPA, and prothrombinase (1 nM fXa and 20 nM fVa), the same timepoints are as described in the legend to Fig.3.4.

Similarly, we tested the activation pattern of FII activation by membrane-bound fXa alone for mutant rFIIW7/ΔNC , which showed a similar pattern of activation as rFIIW2/ΔNC and FIIΔNC, where there is an accumulation of prethrombin-2 and an impediment in cleavage Arg320 resulting in no trace of the B-chain of IIa. Fig.3.4 C shows activation of rFIIΔW2/ΔLQ, where there is a significant amount of prethrombin-2 accumulated with no trace of the B-chain of IIa generated also, which suggests impaired cleavage at Arg320 by membrane-bound fXa alone.

To further improve our understanding of the crucial role of basic residues

(35/36/67/70/73/75/77) for FII activation, we studied the gel electrophoresis pattern of all mutants by fully assembled prothrombinase. We ran a time course for a 2-h time period

(Fig.3.5). rFIIW2/ΔNC (Fig.3.5C), shows a slow activation of the mutant, which is evident by the lingering of fragment 1.2. At the later time points there is appearance of the B- chain of IIa. Similarly, we studied the recombinant mutant rFIIW7/ΔNC, which shows trace amounts of fragment 1.2 and very slow B-chain formation (Fig.3.5F)

Surprisingly, when studying rFIIΔW2 (Fig.3.5G), we noted that there is a late appearance of the B-chain of IIa. These data demonstrated that these basic amino acids

(67/70 of proexosite-1 and the amino acids 478-482) are very important for the initial cleavage of FII at Arg320 by prothrombinase. Similar results were found with rFIIΔW2/ΔLQ

(Fig.3.5H). Our data clearly demonstrate delayed cleavage at Arg320 in the recombinant mutants with amino acids 67/70 and 153-157 obviated. Similarly, a combination of

Lys/ArgAla together with a 153-157 deletion result in severely impaired FII activation.

In conclusion, amino acids L155Q156 of FII obviate the fVa interaction with basic amino acids from the proexosite region. We hypothesize that there must be an allosteric

transition taking place, which results in the interaction of fVa with specific exosites on

FII.

Kinetic Analyses of rFII Activation. To understand the effect of the mutations on the activity of prothrombinase in activating the rFII molecules, we initially examined the rates of rIIa formation from all the rFII molecules under similar experimental conditions.

Conventionally, this method was implemented to identify any disorder in the fVa and fXa interaction with the prothrombinase complex. IIa generation is measured with a chromogenic substrate. The overall kinetic data with several mutants are shown in Fig.

3.6 with kinetic constants derived directly from the fitted data reported in Table 3.2. Our findings demonstrate that the point mutations in the proexosite-I region of FII are not always detrimental to to prothrombin activation. Kinetic analysis of prothrombinase

W2 activation of FII demonstrate no significant increase in kcat and Km. In contrast, similar

W7 experiments studying rFII revealed a six-fold increase in Km and a two-fold decrease in

N2 kcat. Finally rFII was severely impaired in its activation rate with a 66-fold in second order rate constant.

Figure 3.6

Figure 3.6 Determination of Kinetic Parameters of Prothrombinase Catalyzing

Cleavage and Activation of Various FII Molecules.

IIa generation experiments were conducted as described under the experimental procedures by varying the substrate concentration and using a chromogenic substrate.

Prothrombinase activity with various rFII molecules is shown as follows: rFIIWT open

circles; FIIPLASMA filled circles, rFIIW2/ΔNC filled squares; rFIIΔW2/ΔLQ filled diamonds; rFIIΔW2/ΔLQ open diamonds, rFIIW5 open triangles; rFIIN7asterick; rFIIW7closed triangles.

Kinetic constants reported in the text and in Table 3.3 were extracted directly from the fitted data shown herein. The solid lines represent the nonlinear regression fit of the data using Prizm GraphPad software according to the Henri Michaelis-Menten equation

(Vo = Vmax·[FII]/Km + [FII]) to yield the Km and kcat (kcat = Vmax/Etot, where Etot is the concentration of fully assembled prothrombinase, in this case is 10 pM, Table 3.3).

100

Table 3. 2

a b 2c α-Thrombin Km kcat R kcat/Km

species (µM) (s-1) (M-1  s-1) 

106

IIaPLASMA 5.0 ± 2.5 18.7 ± 2.5 0.93 3.74

rIIaWT 5.9 ± 2.6 17.2 ± 2.2 0.88 2.9

rIIaW2 15.7 ± 5.7 43 ± 6 0.86 2.7

rIIaW5 5.2 ± 1.7 27.6 ± 3.5 0.89 5.3

rIIaW7 29.3 ± 14 38.7 ± 5.7 0.86 1.9

rIIaΔ67/70 33.6 ± 20 27.3 ± 8.2 0.9 0.8

rIIaΔLQ 31.7 ± 33 1.5 ± 0.72 0.61 0.05

rIIaΔ67/70/ΔLQ 12.7 ± 3.3 0.93 ± 0.01 0.96 0.07

Table 3.2 Kinetic Constants of Wild-Type and Selected rIIa Mutant Molecules toward S-2238 a The Km for S-2238 for all IIa species and selected rIIa mutants was determined as described under experimental procedures section according to the Michaelis-Menten equation using the software Prizm. Kinetic constants reported were derived directly from the fitted data. b kcat = Vmax/[enzyme]; the kcat was calculated as described in experimental procedures section.

101

cR2 is the goodness of fit of the data points to the Michaelis-Menten equation using the software Prizm.

102

Table 3.3

a b 2 f FI1 species Km kcat R /points kcat/Km Decrease

(µM) (min-1) /titrations (M-1  s-1) (-fold)

d  108

FIIPLASMA 0.17 ± 2304 ± 89 0.91/40/4 2.3 --

0.03

rFIIWT 0.12 ± 2533 ± 89 0.90/40/4 3.5 --

0.02

arFIIW2 0.23 ± 2652 ± 0.93/30/3 1.9 1.8

0.04 140

rFIIW5 0.44 ± 2574 ± 0.97/10/1 0.98 3.6

0.10 176

rFIIW7 0.72 ± 1382 ± 0.98/10/1 0.32 11

0.14 100

rFIIN2 0.37 ± 117 ± 46 0.32/29/4 0.053 66

0.44

rFIIN7 NPc ------

rFIIΔ67/70 NP ------

rFIIΔLQ NP ------

rFIIΔ67/70/ΔLQ NP ------

103

Table 3.3 Kinetic Constants of Plasma FII and rFII Mutant Molecules Activation by

Prothrombinase a The Km and kcat of prothrombinase assembled with saturating concentrations of recombinant fVa molecules were determined as described in the experimental procedures section according to the Michaelis-Menten equation using the software Prizm from several different preparations of rFII molecules (representative experiments are shown in fig.3.6). Kinetic constants were derived directly from the fitted data. b kcat = Vmax/[enzyme]; the enzyme concentrations of prothrombinase (fXa-fVa complex on the membrane surface in the presence of Ca2+) under the conditions employed herein was 10 pM. cNP is no plot; no kinetic constants could be obtained when the data was plotted according to the Michaelis-Menten equation using the software Prizm. dR2 is the goodness of fit of the data points to the Michaelis-Menten equation using the software Prizm. Points and titrations studied are also indicated. f The -fold decrease is the ratio of the second order rate constant (kcat/Km) of prothrombinase catalyzing rFIIWT activation compared to the second order rate constant of prothrombinase catalyzing activation of all other rFII molecules.

104

Analysis of the Activity of rIIa Molecule. The substrate (S-2238) is used to measure the correlation between thrombin potency, its specificity, and amidolytic activity. The formation of a stable fibrin plug also depends on the aptitude of IIa to stimulate its own generation through feedback activation of the protein cofactors V and VIII (46). To understand the role of the deletions/mutations on IIa activity, we further assessed both the amidolytic and biological activity of recombinant IIa mutants towards the chromogenic substrate S-2238 and towards IIa natural substrates fV and fVIII. We ascertained the kinetic constants for the hydrolysis of S-2238 by the rIIa molecules under steady state conditions. The data shown in Table 3.2 revealed the following information. rIIaW2 and

W5 WT rIIa have similar catalytic efficiency (kcat/Km) as rIIa , as described previously in (47,

48). In contrast, rIIaΔW2, rIIaΔLQ, rIIaΔ67/70/ΔLQ and rIIaW7 are most impaired in S-2238 hydrolysis, when compared to control rIIaWT and rFIIaPLASMA. In addition, we found that rIIaW2/ΔNC and rIIaW7/ΔNC were devoid of activity. Our data clearly indicates that basic residues from the proexosite region of FII and amino acids 155LQ156 play a significant role in the expression of IIa amidolytic activity. However, on the other hand, amino acids

Arg73, Arg75 in rFIIW7, profoundly affected the amidolytic activity, thus these amino acids maybe part of a putative groove among anion binding exosite I.

105

Figure 3.7

Figure 3.7 Activation of Plasma-Derived fV by rIIa Plasma-derived fV (500 nM) was incubated with rIIa (4 nM) as described under experimental procedures section At selected time intervals, aliquots of the mixtures were removed, mixed with 2% SDS, heated for 5 min at 90 °C, and analyzed on a 4–12% SDS-PAGE followed by staining with Coomassie Blue. Lane 1 in all panels depicts aliquots of the mixture withdrawn from the reaction before the addition of rIIa. Lanes 2–8 represent aliquots of the reaction mixture withdrawn at 10, 20, 30, 45, 60, 120, and 180 min. The positions of all fV

106

fragments and of the heavy (HC) and light chain (LC) of the active cofactor are indicated on the right. Fragments a and b of fV are identified as previously described (17).

107

The coagulation fV and fVIII are essential at the sites of vascular injury for the amplification of the coagulation cascade (48). To investigate residues important for activation of procofactors, we used rIIa. The data shown in Fig.3.7 and Fig.3.8 demonstrate that rIIaWT cleaves and efficiently activates fV and fVIII generating the expected fragments (Fig.3.7A and 3.8A). rFIIaW2 (Fig.3.7B) shows partial activation of fVa with slow cleavage at Arg709, which is evident by the late appearance of the heavy chain and impaired cleavage at Arg1545. We also see other intermediates, Mr 280,000 and

Mr 220,000 intermediates, in addition to heavy and light chains. In contrast, rFIIW2

(Fig.3.7B) activates fVIII efficiently. In contrast, rIIaW7, rIIaW7/ΔNC, rIIaΔW2, rFIIaΔ67/70/ΔLQ, rFIIaW2/ΔNC, and rFIIaΔLQ are apparently devoid of activity towards fV over a 3-h time period (Fig.3.7C, D, E, F G, H). These data are in complete agreement with the clotting activity of the recombinant proteins. However, while rIIaW7 (Fig.3.8C) cleaves fVIII at Arg372 and Arg1689, rIIaW7/ΔNC, rIIaW2/ΔNC and rIIaΔW2/ΔLQ (Fig.3.8D, H and G) have impaired capability to cleave at Arg740 and rIIaΔW2 (Fig.3.8E) is efficient in cleaving fVIII at Arg740. In conclusion, our data demonstrate that all recombinant mutants with mutations within ABE-I of FII fail to activate fV with the exception of rFIIW2 (Fig.3.8B).

Perhaps the most surprising result is that all the rIIa mutants show partial activity towards fVIII. Finally, rIIaΔLQ (Fig.3.7F and Fig.3.8F) is devoid of activity towards both fV and fVIII over a 3-h time period.

108

Figure 3.8

Figure 3.8 Activation of Recombinant fVIII by rIIa

rfVIII (500 nM) was incubated with rIIa (4 nM) as described under the experimental procedures section .At selected time intervals, aliquots of the mixtures were removed, mixed with 2% SDS, heated for 5 min at 90°C, and analyzed on a 4–12% SDS-PAGE followed by staining with Coomassie Blue. Lane 1 in all panels depicts aliquots of the mixture withdrawn from the reaction before the addition of rIIa. Lanes 2–8 represent aliquots of the reaction mixture withdrawn at 10, 20, 30, 45, 60, 120, and 180 min. The positions of all rfVIII fragments are indicated on the right. Fragments from rfVIII are identified as previously demonstrated (17).

109

3.5 DISCUSSION

Our data demonstrates that the sequences within the proexosite-I region of FII containing basic residues are required for optimum FII activation rates and optimum IIa function. Recent findings from our lab indicate (25) that amino acids sequences Leu155-

Gln156 play a crucial role in the tethering of fV, fVIII and protein C to IIa. The data presented herein provide for the first time a mechanistic interpretation regarding the allosteric interactions between basic residues and the amino acid region 153-157 of FII.

Further, this model allows us to understand the modulation of FII and IIa activity. We hypothesize the binding of fXa to fVa allosterically alters the active site of fXa and repositions the enzyme for FII activation (2).

To understand the ability of basic amino acids from ABE-I to interact with the sequences 153-157 we constructed, expressed, purified to homogeneity, and studied several rFII molecules with deletions and point mutations. We first investigated the effect of five amino acid deletion, rFIIΔ153-157 (rFIIΔNC) followed by rFII molecules containing point mutations and deletions within ABE-I: rFIIW2 (where 67A/70A), rFIIW5 (where

67A/70A/35A/36A/77A), rFIIW7 (where 67A/70A/35A/36A/77A/73A/75A). Several other rFII mutants bearing point mutations and deletions in the basic region along with the deletion of amino acid region 153-157 were generated: rFIIW2/ΔNC, rFIIΔW2, rFIIW7/ΔNC and rFIIΔW2/ΔLQ. Membrane-bound fXa cleaves FII sequentially at Arg271 followed by

Arg320, forming small amounts of IIa. Under these conditions the activation of rFIIW2, rFIIW5 rFIIW7 and rFIIΔW2 shows similar activation to rFIIWT. In addition, rFIIW2/NC, rFIIW7/NC, rFIIW2/ΔLQ, and, rFIIΔ67/70/ΔLQ molecules resulted in the accumulation of prethrombin-2, with very little IIa formed. In contrast, activation by fully assembled

110

prothrombinase of of recombinant mutants rFIIW2, rFIIW5, rFIIW7 show a similar pattern of activation as rFIIWT. On other hand, fully assembled prothrombinase is deficient in cleaving and activating rFIIW2/NC, rFIIW7/NC, rFIIΔW2/ΔLQ, rFIIΔW2 and, rFIIΔW2/ΔLQ. The combined data suggest that amino acids Leu155 and Gln156 allosterically interact with basic exosites from ABE-I on FII, thus modulating the enzymatic activity of fXa within the prothrombinase complex.

The anion binding exosites of IIa are involved in binding of thormbomodulin, hirudin, and fibrinogen. Anion binding exosite I spans residues 67-82 (382-393) and is characterized by strong electropositive charges (49, 53). This region is identical in human, bovine, rat and mouse FII (49). Chen et al. (2) identified a sequence within proexosite I of FII containing basic residues Arg35, Lys36, Arg67, Lys70, Arg73, Arg75, and

Arg77, that is in close spatial proximity to region 153-157of FII. These investigations revealed that following the replacement of all basic residues from proexosite I with Glu, there was a significant effect on fXa within prothrombinase when compared with fXa alone in cleaving and activating FII, suggesting that these amino acids are specific fVa- dependent recognition sites for fXa on FII. The combined studies of Chen et al. (2) and

Yegneswaran et al. (7) suggested the requirement of both sites for optimum productive interaction of prothrombinase with FII and timely IIa formation. Research with discontinuous assays using a chromogenic substrate for IIa revealed that when fVa is incorporated into the prothrombinase complex, the resulting Km value of the reaction decreased 100-fold (corresponding to a 100-fold increase in affinity of prothrombinase for FII as compared with the affinity of fXa alone for the substrate), whereas the catalytic efficiency (kcat) of fXa increased 3,000-fold resulting in a 300,000-fold overall increase in

111

the activity of prothrombinase for FII compared with the activity of fXa alone toward FII

(21).

The kinetic findings presented herein revealed comparable Km and kcat constants for prothrombinase when rFII molecules bearing the point mutations were used as a substrate. rFIIW2 and rFIIW5 had comparable kinetic constants as rFIIWT. On other hand,

W7 rFII has higher Km and two-fold fold decrease in kcat.

Arg67 is associated with a prominent grove extending from the active site. Any modification of this residue probably interferes with the binding of fibrinogen to its secondary binding site. Earlier work in where basic amino residues 52, 73, 75

(chymotrypsinogen numbering) were replaced with glutamic acid in a putative substrate binding groove of ABE-I reported that Arg73 is required for all the three IIa activities: fibrinogen binding, protein C activation and platelet activation (49, 21). However, Arg75 is only required for protein C activation (21). These detailed insights into basic residues of FII can provide significant understanding of structural and/ or functional properties of the molecule.

Congenital abnormalities associated with this basic region of FII are rare. However, a genetic defect Arg67 (Quick I) where Arg was substituted with Cys, resulted in the impaired fibrinogen binding and platelet aggregation (49). It has been reported that this mutant molecule has near normal activity with specific low molecular weight substrates, but its activity with fibrinogen is about 100-fold decreased. A similar mutation (Arg67 to

Cys) was also observed in Corpus Christi (22, 49). Another variant having the Arg67 to

His mutation was also reported (23).

112

Prothrombin Himi II was found in heterozygous patients. The dysfunctional prothrombin molecules are defective in thrombin generation. The sequence analysis of the genomic DNA from the patient revealed the substitution of Arg to His for Arg73, which results in the impairment of the fibrinogen binding site. This amino acid substitution is responsible for bleeding disorders and is conserved (24).

In conclusion, we characterized the allosteric interactions of basic residues within

ABE-I of FII required for optimum FII activation rates and optimum IIa function. Our data suggest that amino acids Leu480 and Gln481 allosterically interact with basic amino acids from ABE-I on FII, thus modulating the enzymatic activity of fXa within the prothrombinase complex.

113

3.6 REFERENCES

1. Patricia, J. Anderson, Anna Nesset, Kumudini, R. Dharmawardana, and Paul, E.

Bock. Characterization of Proexosite I on Prothrombin. The Journal Of Biological

Chemistry, Vol. 275, No. 22, Issue of June 2, pp. 16428–16434, 2000

2. Lin Chen, Likui Yang, and Alireza, R. Rezaie.Proexosite-1 on Prothrombin Is a

Factor Va-dependent Recognition Site for the Prothrombinase Complex. The Journal

of Biological Chemistry Vol. 278, No. 30, Issue of July 25, pp. 27564–27569, 2003

3. Kotkow, K.J, Deitcher SR, Furie B, Furie BC. The second kringle domain of

prothrombin promotes factor Va-mediated prothrombin activation by prothrombinase.

J Biol Chem. 1995 Mar 3; 270(9):4551-7

4. Deguchi H1, Takeya H, Gabazza EC, Nishioka J, Suzuki K. Prothrombin kringle 1

domain interacts with factor Va during the assembly of prothrombinase complex.

Biochem J. 1997 Feb 1; 321 (Pt 3):729-35

5. Bukys, M.A., Orban, T., Kim, P.Y., Nesheim ME, Kalafatis M.The interaction of

fragment 1 of prothrombin with the membrane surface is a prerequisite for optimum

expression of factor Va cofactor activity within prothrombinase. Thromb Haemost.

2008 Mar; 99(3):511-22.

6. Blostein, M.D., Rigby, A.C., Jacobs, M., Furie, B., Furie, B.C. The Gla domain of

human prothrombin has a binding site for factor Va. J Biol Chem. 2000 Dec 1;

275(48):38120-6.

114

7. Yegneswaran S1, Mesters RM, Fernández JA, Griffin JH. Prothrombin residues 473-

487 contribute to factor Va binding in the prothrombinase complex. J Biol Chem.

2004 Nov 19; 279(47):49019-25.

8. Yegneswaran, S., Mesters, R.M., Griffin, J.H. Identification of distinct sequences in

human blood coagulation factor Xa and prothrombin essential for substrate and

cofactor recognition in the prothrombinase complex. J Biol Chem. 2003 Aug 29;

278(35):33312-8.

9. Susannah J. Rogers, Charlotte W. Pratt, Herbert C. Whinna, and Frank C. Church.

Role of Thrombin Exosites in Inhibition by Heparin Cofactor 11. The Journal of

Biological Chemistry. Vol. 267, NO. 6. Issue of February 25, pp. 3613-3617, 1992

10. Cote H.C., Stevens WK, Bajzar L, Banfield DK, Nesheim ME, MacGillivray RT.

Characterization of a stable form of human meizothrombin derived from recombinant

prothrombin (R155A, R271A, and R284A). J Biol Chem. 1994 Apr 15;

269(15):11374-80.

11. Laemmli UK. Cleavage of structural proteins during the assembly of the head of

bacteriophage T4. Nature. 1970 Aug 15; 227(5259):680-5.

12. Towbin H, Staehelin T, Gordon J.Electrophoretic transfer of proteins from

polyacrylamide gels to nitrocellulose sheets: procedure and some applications. 1979.

Biotechnology. 1992; 24:145-9.

13. Kalafatis M1, Rand MD, Mann KG. The mechanism of inactivation of human factor

V and human factor Va by activated protein C. J Biol Chem. 1994 Dec

16;269(50):31869-80.

115

14. Bukys MA, Kim PY, Nesheim ME, Kalafatis M.A control switch for prothrombinase:

characterization of a hirudin-like pentapeptide from the COOH terminus of factor Va

heavy chain that regulates the rate and pathway for prothrombin activation.J Biol

Chem. 2006 Dec 22; 281(51):39194-204. Epub 2006 Oct 4.

15. Hirbawi J, Vaughn JL, Bukys MA, Vos HL, Kalafatis M.Contribution of amino acid

region 659-663 of Factor Va heavy chain to the activity of factor Xa within

prothrombinase.Biochemistry. 2010 Oct 5; 49(39):8520-34.

16. Bukys M.A., Blum M.A., Kim P.Y., Brufatto N, Nesheim ME, Kalafatis ,M.

Incorporation of factor Va into prothrombinase is required for coordinated cleavage

of prothrombin by factor Xa. J Biol Chem. 2005 Jul 22; 280(29):27393-401. Epub

2005 May 16.

17. Bukys, M.A., Orban, T., Kim, P.Y, Beck DO, Nesheim, M.E., Kalafatis, M.The

structural integrity of anion binding exosite I of thrombin is required and sufficient

for timely cleavage and activation of factor V and factor VIII. J Biol Chem. 2006 Jul

7; 281(27):18569-80.

18. Barhoover MA, Orban T, Beck DO, Bukys MA, Kalafatis M.Contribution of amino

acid region 334-335 from factor Va heavy chain to the catalytic efficiency of

prothrombinase. Biochemistry. 2008 Jul1; 47(26):6840-50. Epub 2008 Jun 7

19. Kalafatis M, Krishnaswamy S, Rand MD, Mann KG.Factor V.Methods Enzymol.

1993; 222:224-36

20. Kalafatis M, Beck DO.Identification of a binding site for blood coagulation factor Xa

on the heavy chain of factor Va. Amino acid residues 323-331 of factor V represent

116

an interactive site for activated factor X. Biochemistry. 2002 Oct 22; 41(42):12715-

28.

21. Wu, Q.Y., Sheehan, J.P., Tsiang, M., Lentz, S.R., Birktoft, J.J., Sadler, J.E. Single

amino acid substitutions dissociate fibrinogen-clotting and thrombomodulin-binding

activities of human thrombin.Proc Natl Acad Sci U S A. 1991 Aug 1; 88(15):6775-9.

22. O'Marcaigh AS1, Nichols WL, Hassinger NL, Mullins JD, Mallouh AA, Gilchrist

GS, Owen WG.Genetic analysis and functional characterization of prothrombins

Corpus Christi (Arg382-Cys), Dhahran (Arg271-His), and hypoprothrombinemia.

Blood. 1996 Oct 1; 88(7):2611-8.

23. Akhavan S1, Mannucci PM, Lak M, Mancuso G, Mazzucconi MG, Rocino A,

Jenkins PV, Perkins SJ.Identification and three-dimensional structural analysis of

nine novel mutations in patients with prothrombin deficiency. Thromb Haemost.

2000, Dec; 84(6):989-97.

24. Morishita E1, Saito M, Kumabashiri I, Asakura H, Matsuda T, Yamaguchi

K.Prothrombin Himi: a compound heterozygote for two dysfunctional prothrombin

molecules (Met-337-->Thr and Arg-388-->His). Blood. 1992 Nov 1; 80(9):2275-80

25. Wiencek, J. R., Hirbawi, J., Yee, V.C., Kalafatis, M. The Dual Regulatory Role of

Amino Acids Leu480 and Gln481 of Prothrombin.J Biol Chem. 2016, Jan 22;

291(4):1565-81.

26. Krishnaswamy, S., Church, W. R., Nesheim, M. E., and Mann, K. GActivation of

human prothrombin by human prothrombinase. Influence of factor Va on the reaction

mechanism. J. Biol. Chem. 1987 262, 3291–3299

27. Mann, K. G., Bajaj, S. P., Heldebrant, C. M., Butkowski, R. J., and Fass, D. N.

117

Intermediates of prothrombin activation. Semin. Haematol. 1973 ,6, 479–493

28. Heldebrant, C. M., Butkowski, R. J., Bajaj, S. P., and Mann, K. G.The activation of

prothrombin. II. Partial reactions, physical and chemical characterization of the

intermediates of activation. J. Biol. Chem.1993, 248,7149–7163

29. Esmon, C. T., Owen, W. G., and Jackson, C. M.The conversion of prothrombin to

thrombin. II. Differentiation between thrombin- and factor Xa-catalyzed

proteolyses. J. Biol. Chem. 1974,249, 606–611

30. Esmon, C. T., and Jackson, C. M.The conversion of prothrombin to thrombin. III. The

factor Xa-catalyzed activation of prothrombin. J. Biol. Chem.1974,249, 7782–7790

31. Shim, J. Y., Lee, C. J., Wu, S., and Pedersen, L. G.A model for the unique role of

factor Va A2 domain extension in the human ternary thrombin-generating

complex. Biophys. Chem. 2015,199, 46–50

32. Mann, K. G., Nesheim, M. E., and Tracy, P. B. Molecular weight of undegraded

plasma factor V. Biochemistry .1981, 20, 28–33

33. Nesheim, M. E., Foster, W. B., Hewick, R., and Mann, K. G.Characterization of

factor V activation intermediates. J. Biol. Chem. 1984, 259,3187–3196

34. Esmon, C. T., Owen, W. G., Duiguid, D. L., and Jackson, C. M.The action of

thrombin on blood clotting factor V: conversion of factor V to a prothrombin-binding

protein. Biochim. Biophys. Acta. 1973,310, 289–294

35. Tracy, P. B., Eide, L. L., Bowie, E. J., and Mann, K. G.Radioimmunoassay of factor

V in human plasma and platelets. 1982, Blood 60, 59–63

36. Nesheim, M. E., Foster, W. B., Hewick, R., and Mann, K. G.Characterization of

factor V activation intermediates. J. Biol. Chem. 1984, 259, 3187–3196

118

37. Suzuki, K., Dahlbäck, B., and Stenflo, J. Thrombin-catalyzed activation of human

coagulation factor V. J. Biol. Chem.1982,. 257, 6556–6564

38. Kane, W. H., and Majerus, P. W.Purification and characterization of human

coagulation factor V. J. Biol. Chem. 1981, 256, 1002–1007

39. Keller, F. G., Ortel, T. L., Quinn-Allen, M. A., and Kane, W. H.Thrombin-catalyzed

activation of recombinant human factor V. Biochemistry, 1995,34, 4118–4124

40. Orfeo, T., Brufatto, N., Nesheim, M. E., Xu, H., Butenas, S., and Mann, K. G. The

factor V activation paradox. J. Biol. Chem. 2004, 279, 19580–19591

41. Schuijt,T.J.,Bakhtiari, K., Daffre, S., Deponte, K., Wielders, S.J., Marquart,

J.A.Hovius, J.W., van der Poll, T., Fikrig, E., Bunce, M. W., Camire, R. M., Nicolaes,

G. A.,Meijers, J. C.and van't Veer, C.Factor Xa activation of factor V is of paramount

importance in initiating the coagulation system. Lessons from a tick salivary protein.

Circulation.2013, 128, 254–266

42. Butenas, S., van't Veer, C., and Mann, K. G.“Normal” thrombin generation. Blood.

999, 94, 2169–2178

43. Degen, S. J., and Davie, E. W.Nucleotide sequence of the gene for human

prothrombin. Biochemistry.1987, 26, 6165–6177

44. Pozzi, N., Chen, Z., Pelc, L. A., Shropshire, D. B., and Di Cera, E.The linker

connecting the two kringles plays a key role in prothrombin activation.Proc. Natl.

Acad. Sci. U.S.A. 2014, 111, 7630–763.

45. Bode, W., Mayr, I., Baumann, U., Huber, R., Stone, S. R., and Hofsteenge, J.The

refined 1.9 A crystal structure of human α-thrombin: interaction with d-Phe-Pro-Arg

119

chloromethylketone and significance of the Tyr-Pro-Pro-Trp insertion segment.

EMBO J. 1989, 8, 3467–347546.

46. Ann Lövgren,a Johanna Deinum,a Steffen Rosén,b Pia Bryngelhed,b Per Rosén,b and

Kenny M. Hanssona. Characterization of thrombin derived from human recombinant

prothrombin. Blood Coagul Fibrinolysis. 2015 Jul; 26(5): 545–555.

47. Myles, T., Yun, T.H., Leung, L.L. Structural requirements for the activation of human

factor VIII by thrombin. Blood. 2002 Oct 15; 100(8):2820-6.

48. Rezaie, A.R.Reactivities of the S2 and S3 subsite residues of thrombin with the native

and heparin-induced conformers of antithrombin. Protein Sci. 1998 Feb; 7(2):349-57.

49. High, Katherine A., and H. R. Roberts. Molecular Basis of Thrombosis and

Hemostasis. New York: M. Dekker, 1995. Print.

50. Colman, Robert W. Hemostasis and Thrombosis: Basic Principles and Clinical

Practice. Philadelphia: Lippincott Williams & Wilkins, 2000. Print.

51. Koike, H., Okuda, D., and Morita, T. (2003) Mutations in the autolytic loop-2 and at

Asp554 of human prothrombin that enhance protein C activation by

meizothrombin. J. Biol. Chem. 278, 15015–15022

52. Witting, J. I., Miller, T. M., and Fenton, J. W., 2nd. (1987). Human α and γ thrombin

specificity with tripeptide p-nitroanilide substrates under physiologically relevant

conditions. Thromb. Res. 46, 567–574

53. Noe G, Hofsteenge J, Rovelli G, Stone SR. The use of sequence specific antibodies to

identify a secondary binding site in thrombin. J Biol Chem. 1988 Aug 25;

263(24):11729-35.

120

54. Owen, W. G., Esmon, C. T., and Jackson, C. M.The conversion of prothrombin to

thrombin. I. Characterization of the reaction products formed during the activation of

bovine prothrombin. J. Biol. Chem. 1974,249, 594–605

121

CHAPTER IV

OVERALL CONCLUSION

4.1 CONCLUSION

The coagulation system involves various clotting factors that maintain a balanced response to vascular injury under any normal circumstances. Any imbalance in the coagulation (as a result of weight gain, smoking, surgery or traumatic injury) may have deleterious effects, leading to the formation of a clot. However, a consequence of mutation in one or more genes causes a dysfunction of the coagulation system (3). The most common causes of blood clots include stroke, complications during pregnancy, and venous thromboembolism (VTE) leading to cardiovascular diseases and a pulmonary embolism (4). Thus, understanding the mechanism that causes blood clot to form can help individuals identify and treat a major disease state (as CVD) in patients with vascular injury (defects in coagulation) as well as help prevent potentially devastating complications.

122

Upon vascular injury, the proteolytic conversion of prothrombin (FII) to thrombin occurs in the presence of the prothrombinase complex. Prothrombinase is an enzymatic complex between the protein cofactor, factor Va (fVa), and serine protease, factor Xa

(fXa), assembled on a membrane surface in the presence of divalent metal ions. Proper assembly of the prothrombinase complex is crucial for physiological functioning of the complex where zymogen, FII, is converted to enzyme IIa (4). The cofactor, fVa is present in plasma as factor V (fV).

fV is a single chain procofactor. It circulates in blood as a multi-domain protein (A1-

A2-B-A3-C1-C2). Thrombin activates factor V by limited proteolysis firstly at Arg709,

Arg1018, and Arg1545. The B-domain preserves the procofactor from promoting the coagulation response. Previously, it was demonstrated that cleavage at Arg709 and Arg1018 is necessary for maximal rate of activation (5, 6). We demonstrated that amino acid region 1000-1008 of fV is a regulatory sequence (7). Recombinant technologies were used to show the effect of cleavage site Arg1018 during the activation of factor V. When the same mutation Arg1018 (fVaRQR) was introduced in the B-domain missing amino acids

1000-1008, the mutant fVaRQR/ΔB9 molecule showed similar results comparable to fVaWT.

The data demonstrated that Arg1018 is not required for fVa activation, and the effect of B- domain on this cleavage site is minimal.

We have previously demonstrated (8) that fVa serves to promote prothrombinase function during hemostasis and may be a good target strategy to streamline better anti-coagulant therapy. We next tested fVa function within the prothrombinase complex and the aptitude of fVa to interact with the fXa and efficiently cleave FII. There are two different pathways by which FII activation can be channeled. Pathway I involves factor Xa alone that will cleave

123

271 320 FII initially at Arg followed by cleavage at Arg to produce thrombin. Pathway II involves the incorporation of factor Va and results in a reversal of cleavages with initial

320 cleavage of prothrombin at Arg (9). This pathway is characterized by the formation of an intermediate, meizothrombin, that has been shown to have catalytic properties and is considered to be useful for in vivo diagnosis of thrombosis (2) Recent data suggested that fVa promotes and directs the interaction between fXa and anion binding exosites –I (10). In addition, Yegneswaran et al. (12 identified a fVa-dependent fXa site on FII to be within amino acids 473-487(chymotrypsin numbering149D-163). The most recent data from our laboratory (11) indicate a novel exosite to be provided by amino acid region L480 and

Q481.

We have explored the contribution of amino acid residues from both proexosite-I and the region 478-482 (chymotrypsin numbering 153-157) to proper FI activation and IIa function. Several recombinant mutants were generated by deleting and making point mutations in the region of ABE-I and the 153-157 region. The first rFII molecule constructed was a molecule with two point mutations at 67A/70A known herein as rFIIW2. Then we generated rFII with five point alanine mutations known herein as rFIIW5

(where 67A/70A/35A/36A/77A), followed by rFII with seven point alanine mutations known herein as rFIIW7 (where 67A/70A/35A/36A/77A/73A/75A). Next, we generated rFII molecules missing amino acids 153-157 (rFIIΔNC) and having point mutations as rFIIW2 /ΔNC, rFIIW7/ΔNC. Then we generated mutants rFIIΔW2 (by deleting 67/70) and we also generated rFIIΔW2/ΔLQ (by deleting 67/70 and deleting L155/Q156 from the five amino acid stretch153-157). Most mutants were severely impaired in the clotting capabilities and their ability to activate fV and fVIII. We have seen a cross-sectional association

124

between the prothrombin time and individuals associated with increased risk of cardiovascular disease (1).

The recombinant mutants within proexosite I region of FII profoundly affect the activation of natural substrate fV, and, on the other hand, all the recombinant mutants partially activate fVIII. Finally, we characterized the allosteric interactions of these basic residues within FII required for optimum FII activation rates and optimum thrombin function. Our data suggest that amino acids Leu480 and Gln481 allosterically interact with basic amino acids from ABE-I of FII, thus modulating the enzymatic activity of fXa within the prothrombinase complex.

Overall, the ultimate goal of our research is to understand the regulatory effect of fVa during thrombin generation. Our investigation demonstrates that fV is activated by thrombin in a kinetically preferred order, by a first cleavage at Arg709and followed by a cleavage at Arg1545 to ultimately generate the active cofactor species, fVa. Further the interaction of fVa with fXa and FII exposes cryptic exosites on FII that play a crucial role and are required for the timely generation of thrombin. Our research can be used to streamline therapeutic targets that will impair fibrin formation in patients with thrombotic tendencies (thrombophilia) by preventing the activity of prothrombinase.

125

4.2 REFERENCES

1. Freedman, D.S., Byers, T., Barboriak, J, J., Flanders, W.D., Duncan, A., Yip, R., Meilahn, E.N.Am J Epidemiol. 1992 Sep 1;136(5):513-24.The relation of prothrombin times to coronary heart disease risk factors among men aged 31-45 years. 2. Páramo, J.A. Prothrombin fragments in cardiovascular disease Adv Clin Chem. 2010; 51:1-23. 3. Yokus, O., Albayrak, M., Balcik, O.S., Ceran, F., Dagdas, S., Yilmaz, M., Ozet, G. Risk factors for thrombophilia in young adults presenting with thrombosis. Int. J. Hematol. 2009;90(5):583–59 4. Mann, K. G., Nesheim, M. E., Tracy, P. B.,Hibbard, L. S., Bloom, J. W. Assembly of the Prothrombinase Complex. Biophys J. 1982 Jan; 37(1): 106–107

5. Keller, F.G, Ortel, T.L, Quinn-Allen, M.A, Kane, W.H. Thrombin-catalyzed activation of recombinant human factor V. Biochemistry. 1995 Mar 28; 34(12):4118- 24.

6. Thorelli, E., Kaufman, R.J, Dahlbäck, B. Cleavage requirements for activation of factor V by factor Xa. Eur J Biochem. 1997 Jul 1; 247(1):12-20. 7. Wiencek, J.R, Na, M., Hirbawi, J., Kalafatis, M.Amino acid region 1000-1008 of factor V is a dynamic regulator for the emergence of procoagulant activity. J Biol Chem. 2013 Dec 27; 288(52):37026-38. 8. Michael, A. Bukys., Paul, Y. Kim., Michael, E. Nesheim., Kalafatis, M. A control switch for prothrombinase characterization of a hirudin-like pentapeptide from the cooh terminus of factor Va heavy chain that regulates the rate and pathway for prothrombin activation The Journal of Biological Chemistry, 2006. 281, 39194- 39204. 9. Mann, K.G. M, Kalafatis. Factor V: A Combination of Dr. Jekyll and Mr. Hyde. Blood, 2003. 101 (1): p. 21-30.

126

10. Chen, L., Yang, L., Rezaie, A.R. Proexosite-1 on prothrombin is a factor Va- dependent recognition site for the prothrombinase complex. J Biol Chem. 2003 Jul 25; 278(30):27564-9. Epub 2003 May 14.

11. Wiencek, J.R., Hirbawi, J., Yee, V.C., Kalafatis, M. The Dual Regulatory Role of Amino Acids Leu480 and Gln481 of Prothrombin.J Biol Chem. 2016, Jan 22; 291(4):1565-81. 12. Yegneswaran S1, Mesters RM, Fernández JA, Griffin JH. Prothrombin residues 473- 487 contribute to factor Va binding in the prothrombinase complex. J Biol Chem. 2004 Nov 19; 279(47):49019-25. 1986. 261, 9684– 9693

127