DOCSLIB.ORG

RNA Double-Stranded Monocytes

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
RNA Double-Stranded Monocytes IL-10-Dependent S100A8 Gene Induction in Monocytes/Macrophages by Double-Stranded RNA This information is current as Yasumi Endoh, Yuen Ming Chung, Ian A. Clark, Carolyn L. of September 27, 2021. Geczy and Kenneth Hsu J Immunol 2009; 182:2258-2268; ; doi: 10.4049/jimmunol.0802683 http://www.jimmunol.org/content/182/4/2258 Downloaded from References This article cites 73 articles, 26 of which you can access for free at: http://www.jimmunol.org/content/182/4/2258.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 27, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2009 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology IL-10-Dependent S100A8 Gene Induction in Monocytes/Macrophages by Double-Stranded RNA1 Yasumi Endoh,* Yuen Ming Chung,* Ian A. Clark,† Carolyn L. Geczy,* and Kenneth Hsu2* The S100 calcium-binding proteins S100A8 and S100A9 are elevated systemically in patients with viral infections. The S100A8- S100A9 complex facilitated viral replication in human CD4؉ T lymphocytes latently infected with HIV-1- and S100A8-induced HIV-1 transcriptional activity. Mechanisms inducing the S100 genes and the potential source of these proteins following viral activation are unknown. In this study, we show that S100A8 was induced in murine macrophages, and S100A8 and S100A9 in human monocytes and macrophages, by polyinosinic:polycytidylic acid, a dsRNA mimetic. Induction was at the transcriptional level and was IL-10 dependent. Similar to LPS-induced S100A8, induction by dsRNA was dependent on p38 and ERK MAPK. Protein kinase R (PKR) mediates antiviral defense and participates in MyD88-dependent/independent signaling triggered by TLR4 or TLR3. Like IL-10, S100 induction by polyinosinic:polycytidylic acid and by LPS was inhibited by the specific PKR Downloaded from inhibitor 2-aminopurine, indicating a novel IL-10, PKR-dependent pathway. Other mediators such as IFN-␤, which synergized with dsRNA, may also be involved. C/EBP␤ bound the defined promoter region in response to dsRNA. S100A8 was expressed in lungs of mice infected with influenza virus and was maximal at day 8 with strong immunoreactivity in epithelial cells lining the airways and in mononuclear cells and declined early in the recovery phase, implying down-regulation by mediator(s) up-regulated during resolution of the infection. IL-10 is implicated in viral persistence. Since S100A8/S100A9 levels are likely to be maintained in conditions where IL-10 is raised, these proteins may contribute to viral persistence in patients infected by some RNA http://www.jimmunol.org/ viruses. The Journal of Immunology, 2009, 182: 2258–2268. alcium-binding proteins S100A8 and S100A9 are ex- S100A9 negated this activity and S100A9-null mice are protected pressed constitutively in large amounts in neutrophils from endotoxic shock (9). S100A8 and S100A8/S100A9 were re- C and are inducible in monocytes and macrophages. cently shown to induce MMP-2, 3, 9, and particularly 13, in mu- S100A8/S100A9-positive macrophages are found in numerous au- rine bone marrow-derived macrophages (10), suggesting that the toimmune diseases (1) and in atherosclerotic plaque (2). They are S100 proteins mediate macrophage migration and matrix degrada- also inducible in other cell types such as epithelial cells (3) and tion via MMP production. Intracellularly, the complex is impli- fibroblasts (4) by appropriate stimulants and their expression is cated in arachidonic acid transport (11) assembly of the NADPH by guest on September 27, 2021 associated with several tumors. S100A8 and S100A9 have intra- oxidase complex (12) and may regulate cytoskeletal rearrangement cellular and extracellular functions and although the S100A8- of phagocyte membranes during migration by integrating MAPK S100A9 complex is considered the major functional form, separate and calcium-dependent signals that influence tubulin polymeriza- functions for the individual proteins are reported (reviewed in tion (13, 14). Refs. 5 and 6). These proteins are proposed to function as novel Elevated systemic levels of S100A8/S100A9 are associated with damage-associated molecular pattern molecules (7). The complex viral infections such as human papillomavirus (15), and microarray is antimicrobial, apoptotic for some cells, and inhibits matrix met- of PBMC from patients with severe acute respiratory syndrome, alloproteinase (MMP)3 activities (8) by virtue of its ability to che- caused by a coronavirus, identified ϳ60-fold increase in the late zinc. Recently, S100A8 was reported to activate cytokine pro- S100A9 gene (16). S100A8/A9 levels in patients infected with a duction from murine bone marrow cells via TLR4 ligation; lentivirus, HIV-1, correlate with disease progression and low CD4ϩ counts (17), and in HIV-1-seropositive patients with ad- *Centre for Infection and Inflammation Research, School of Medical Sciences, Uni- vanced immunodeficiency (18, 19) correlate with the onset of and versity New South Wales, Sydney, Australia; and †School of Biochemistry and Mo- lecular Biology, Australian National University, Canberra, Australia with opportunistic infections (20–22). The 27E10 Ag, (detects the Received for publication August 14, 2008. Accepted for publication December S100A8/A9 heterocomplex) was suggested to be a potential 1, 2008. marker for different stages of HIV (19). S100A8 was isolated from The costs of publication of this article were defrayed in part by the payment of page cervico-vaginal secretions from women at high risk of HIV infec- charges. This article must therefore be hereby marked advertisement in accordance tion that contained HIV-inducing activity for an HIV-infected with 18 U.S.C. Section 1734 solely to indicate this fact. monocyte cell line, and recombinant S100A8 mimicked this ac- 1 This work was supported by grants from the National Health and Medical Research Council of Australia. Y.E. had an International Postgraduate Award. tivity (23). The source of this protein was suggested as being de- 2 Address correspondence and reprint requests to Dr. Kenneth Hsu, Centre for Infec- rived from granulocytes, macrophages, and epithelial cells present tion and Inflammation Research, School of Medical Sciences, University New South as a consequence of localized inflammation of the genital mucosa. Wales, Sydney, NSW 2052. E-mail address: [email protected] In another study, S100A8, S100A9, and S100A8/S100A9 facili- 3 Abbreviations used in this paper: MMP, matrix metalloproteinase; poly(I:C), tated viral replication in human CD4ϩ T lymphocytes latently in- polyinosinic:polycytidylic acid; PKR, protein kinase R; HPRT, hypoxanthine gua- nine phosphoribosyltransferase; COX-2, cyclooxygenase 2; 2-AP, 2-aminopurine; fected with HIV-1 and S100A8-induced HIV-1 transcriptional ac- siRNA, small interfering RNA; iNOS, inducible NO synthase; ChIP, chromatin tivity via an NF-␬B-dependent pathway (24). It was proposed that immunoprecipitation. these S100 proteins may particularly contribute to HIV-1 progres- Copyright © 2009 by The American Association of Immunologists, Inc. 0022-1767/09/$2.00 sion in seropositive patients with opportunistic infections and/or www.jimmunol.org/cgi/doi/10.4049/jimmunol.0802683 The Journal of Immunology 2259 Table I. Primers and conditions used for real-time RT-PCR amplification and ChIP Gene Forward Primer (5Ј33Ј) Reverse Primer (5Ј33Ј) Mouse COX-2 TGAGCAACTATTCCAAACCAGC GCACGTAGTCTTCGATCACTATC HPRT GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCAA IL-10 ACCTGCTCCACTGCCTTGCT GGTTGCCAAGCCTTATCGGA iNOS GTTCTCAGCCCAACAATACAAGA GTGGACGGGTCGATGTCAC S100A8 CCGTCTTCAAGACATCGTTTGA GTAGAGGGCATGGTGATTTCCT S100A9 ATACTCTAGGAAGGAAGGACACC TCCATGATGTCATTTATGAGGGC S100A8 PRO AGAGCGTTGTCTCCATAGCC CGGAGCTGACAAAGGATATGT S100A8 EXON2 CCTTGAGCAACCTCATTGATG CCTCCTCACCTGCACAAACT Human S100A8 GGGATGACCTGAAGAAATTGCTA TGTTGATATCCAACTCTTTGAACCA S100A9 GTGCGAAAAGATCTGCAAAATTT GGTCCTCCATGATGTGTTCTATGA S100A12 CTGCTTACAAAGGAGCTTGCAA GGCCTTGGAATATTTCATCAATG ␤-actin CATGTACGTTGCTATCCAGGC CTCCTTAATGTCACGCACGAT inflammatory conditions because such conditions would likely cells and promoted resolution of a chronic viral infection (re- Downloaded from have elevated systemic levels. viewed in Ref. 27). IL-10 inhibits adaptive T cell-mediated responses, primarily by Our earlier studies showed that S100A8 expression in murine mac- anti-inflammatory functions through effects on Ag-presenting den- rophages induced by LPS is a late-phase response that is neutralized dritic cells and in the generation of regulatory T cells. It down- by anti-IL-10 Abs, although IL-10 does not directly induce the gene regulates proinflammatory cytokine production in macrophages. (28). Moreover, corticosteroids potentiate S100A8 induction by LPS On the other hand, IL-10 can stimulate B lymphocyte proliferation in an
Load more

Recommended publications
  • Datasheet: VMA00595 Product Details
    Datasheet: VMA00595 Description: MOUSE ANTI S100A8 Specificity: S100A8 Format: Purified Product Type: PrecisionAb™ Monoclonal Isotype: IgG2b Quantity: 100 µl Product Details Applications This product has been reported to work in the following applications. This information is derived from testing within our laboratories, peer-reviewed publications or personal communications from the originators. Please refer to references indicated for further information. For general protocol recommendations, please visit www.bio-rad-antibodies.com/protocols. Yes No Not Determined Suggested Dilution Western Blotting 1/1000 PrecisionAb antibodies have been extensively validated for the western blot application. The antibody has been validated at the suggested dilution. Where this product has not been tested for use in a particular technique this does not necessarily exclude its use in such procedures. Further optimization may be required dependant on sample type. Target Species Human Species Cross Reacts with: Mouse Reactivity N.B. Antibody reactivity and working conditions may vary between species. Product Form Purified IgG - liquid Preparation Mouse monoclonal antibody affinity purified on immunogen from tissue culture supernatant Buffer Solution Phosphate buffered saline Preservative 0.09% Sodium Azide (NaN3) Stabilisers 1% Bovine Serum Albumin Immunogen Full length recombinant human S100A8 External Database Links UniProt: P05109 Related reagents Entrez Gene: 6279 S100A8 Related reagents Synonyms CAGA, CFAG, MRP8 Page 1 of 2 Specificity Mouse anti Human S100A8 antibody recognizes S100A8, also known as MRP-8, S100 calcium- binding protein A8 (calgranulin A), calprotectin L1L subunit, leukocyte L1 complex light chain or migration inhibitory factor-related protein 8. The protein encoded by S100A8 is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs.
    [Show full text]
  • A Novel Computational Algorithm for Predicting Immune Cell Types Using Single-Cell RNA Sequencing Data
    A novel computational algorithm for predicting immune cell types using single-cell RNA sequencing data By Shuo Jia A hesis submitted to the Faculty of Graduate Studies of The University of Manitoba n partial fulfillment of the requirements of the degree of MASTER OF SCIENCE Department of Biochemistry and Medical Genetics University of Manitoba Winnipeg, Manitoba, Canada Copyright © 2020 by Shuo Jia Abstract Background: Cells from our immune system detect and kill pathogens to protect our body against many diseases. However, current methods for determining cell types have some major limitations, such as being time-consuming and with low throughput rate, etc. These problems stack up and hinder the deep exploration of cellular heterogeneity. Immune cells that are associated with cancer tissues play a critical role in revealing the stages of tumor development. Identifying the immune composition within tumor microenvironments in a timely manner will be helpful to improve clinical prognosis and therapeutic management for cancer. Single-cell RNA sequencing (scRNA-seq), an RNA sequencing (RNA-seq) technique that focuses on a single cell level, has provided us with the ability to conduct cell type classification. Although unsupervised clustering approaches are the major methods for analyzing scRNA-seq datasets, their results vary among studies with different input parameters and sizes. However, in supervised machine learning methods, information loss and low prediction accuracy are the key limitations. Methods and Results: Genes in the human genome align to chromosomes in a particular order. Hence, we hypothesize incorporating this information into our model will potentially improve the cell type classification performance. In order to utilize gene positional information, we introduce chromosome-based neural network, namely ChrNet, a novel chromosome-specific re-trainable supervised learning method based on a one-dimensional 1 convolutional neural network (1D-CNN).
    [Show full text]
  • Tumor-Infiltrating Monocytes/Macrophages Promote Tumor Invasion and Migration by Upregulating S100A8 and S100A9 Expression in Ca
    OPEN Oncogene (2016) 35, 5735–5745 © 2016 Macmillan Publishers Limited, part of Springer Nature. All rights reserved 0950-9232/16 www.nature.com/onc ORIGINAL ARTICLE Tumor-infiltrating monocytes/macrophages promote tumor invasion and migration by upregulating S100A8 and S100A9 expression in cancer cells SY Lim, AE Yuzhalin, AN Gordon-Weeks and RJ Muschel Myeloid cells promote the development of distant metastases, but little is known about the molecular mechanisms underlying this process. Here we have begun to uncover the effects of myeloid cells on cancer cells in a mouse model of liver metastasis. Monocytes/macrophages, but not granulocytes, isolated from experimental liver metastases stimulated migration and invasion of MC38 colon and Lewis lung carcinoma cells. In response to conditioned media from tumor-infiltrating monocytes/macrophages, cancer cells upregulated S100a8 and S100a9 messenger RNA expression through an extracellular signal-related kinase-dependent mechanism. Suppression of S100A8 and S100A9 in cancer cells using short hairpin RNA significantly diminished migration and invasion in culture. Downregulation of S100A8 and S100A9 had no effect on subcutaneous tumor growth. However, colony size was greatly reduced in liver metastases with decreased invasion into adjacent tissue. In tissue culture and in the liver colonies derived from cancer cells with knockdown of S100A8 and S100A9, MMP2 and MMP9 expression was decreased, consistent with the reduction in migration and invasion. Our findings demonstrate that monocytes/macrophages in the metastatic liver microenvironment induce S100A8 and S100A9 in cancer cells, and that these proteins are essential for tumor cell migration and invasion. S100A8 and S100A9, however, are not responsible for stimulation of proliferation.
    [Show full text]
  • Integrated DNA Methylation and Gene Expression Analysis Identi Ed
    Integrated DNA methylation and gene expression analysis identied S100A8 and S100A9 in the pathogenesis of obesity Ningyuan Chen ( [email protected] ) Guangxi Medical University https://orcid.org/0000-0001-5004-6603 Liu Miao Liu Zhou People's Hospital Wei Lin Jiangbin Hospital Dong-Hua Zhou Fifth Aliated Hospital of Guangxi Medical University Ling Huang Guangxi Medical University Jia Huang Guangxi Medical University Wan-Xin Shi Guangxi Medical University Li-Lin Li Guangxi Medical University Yu-Xing Luo Guangxi Medical University Hao Liang Guangxi Medical University Shang-Ling Pan Guangxi Medical University Jun-Hua Peng Guangxi Medical University Research article Keywords: Obesity, DNA methylation-mRNA expression-CAD interaction network, Function enrichment, Correlation analyses Posted Date: November 2nd, 2020 Page 1/21 DOI: https://doi.org/10.21203/rs.3.rs-68833/v2 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 2/21 Abstract Background: To explore the association of DNA methylation and gene expression in the pathology of obesity. Methods: (1) Genomic DNA methylation and mRNA expression prole of visceral adipose tissue (VAT) were performed in a comprehensive database of gene expression in obese and normal subjects; (2) functional enrichment analysis and construction of differential methylation gene regulatory network were performed; (3) Validation of the two different methylation sites and corresponding gene expression was done in a separate microarray data set; and (4) correlation analysis was performed on DNA methylation and mRNA expression data. Results: A total of 77 differentially expressed mRNA matched with differentially methylated genes. Analysis revealed two different methylation sites corresponding to two unique genes-s100a8- cg09174555 and s100a9-cg03165378.
    [Show full text]
  • Mouse Embryo S100A8 Causes Early Resorption of the Inflammation
    A Null Mutation in the Inflammation-Associated S100 Protein S100A8 Causes Early Resorption of the Mouse Embryo This information is current as of September 25, 2021. Robert J. Passey, Elizabeth Williams, Agnieszka M. Lichanska, Christine Wells, Shengping Hu, Carolyn L. Geczy, Melissa H. Little and David A. Hume J Immunol 1999; 163:2209-2216; ; http://www.jimmunol.org/content/163/4/2209 Downloaded from Why The JI? Submit online. http://www.jimmunol.org/ • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average by guest on September 25, 2021 Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 1999 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. A Null Mutation in the Inflammation-Associated S100 Protein S100A8 Causes Early Resorption of the Mouse Embryo1 Robert J. Passey,* Elizabeth Williams,† Agnieszka M. Lichanska,† Christine Wells,† Shengping Hu,* Carolyn L. Geczy,* Melissa H. Little,† and David A. Hume2† S100A8 (also known as CP10 or MRP8) was the first member of the S100 family of calcium-binding proteins shown to be chemotactic for myeloid cells.
    [Show full text]
  • Zinc Deficiency Activates S100A8 Inflammation in the Absence Of
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by PubMed Central IJC International Journal of Cancer Zinc deficiency activates S100A8 inflammation in the absence of COX-2 and promotes murine oral-esophageal tumor progression Shao-Gui Wan1*, Cristian Taccioli2*, Yubao Jiang1, Hongping Chen1, Karl J. Smalley3, Kun Huang4, Xiu-Ping Liu2, John L. Farber5, Carlo M. Croce2 and Louise Y. Y. Fong1 1 Department of Pharmacology and Experimental Therapeutics, Thomas Jefferson University, Philadelphia, PA 2 Department of Molecular Virology, Immunology, and Medical Genetics, The Ohio State University, OH 3 Kimmel Cancer Center, Thomas Jefferson University, Philadelphia, Pennsylvania, PA 4 Department of Biomedical Informatics, The Ohio State University, Columbus, OH 5 Department of Pathology, Anatomy, and Cell Biology, Thomas Jefferson University, Philadelphia, PA Zinc (Zn)-deficiency (ZD) is implicated in the pathogenesis of human oral-esophageal cancers. Previously, we showed that in ZD mice genetic deletion of cyclooxygenase-2 (Cox-2) enhances N-nitrosomethylbenzylamine-induced forestomach carcinogenesis. By contrast, Cox-2 deletion offers protection in Zn-sufficient (ZS) mice. We hypothesize that ZD activates pathways insensitive to COX-2 inhibition, thereby promoting carcinogenesis. This hypothesis is tested in a Cox-22/2 mouse tongue cancer model that mimics pharmacologic blockade of COX-2 by firstly examining transcriptome profiles of forestomach mucosa from Cox-22/2 and wild-type mice on a ZD vs. ZS diet, and secondly investigating the roles of identified markers in mouse forestomach/tongue preneoplasia and carcinomas. In Cox-22/2 mice exposed to the tongue carcinogen 4-nitroquinoline 1-oxide, dietary ZD elicited tongue/esophagus/forestomach carcinomas that were prevented by ZS.
    [Show full text]
  • Integrated Bioinformatics Approach to Understand Immune-Related Key
    Integrated bioinformatics approach to understand immune-related key genes and pathways in chronic spontaneous urticaria wenxing su Second Aliated Hospital of Soochow University biao huang First Aliated Hospital of Soochow University ying zhao Second Aliated Hospital of Soochow University xiaoyan zhang Second Aliated Hospital of Soochow University lu chen second aliated hospital of soochow university jiang ji ( [email protected] ) Second Aliated Hospital of Soochow University qingqing Jiao rst aliated hospital of soochow university Research Keywords: Chronic spontaneous urticaria, bioinformatical analysis, differentially expressed genes, immune inltration Posted Date: December 31st, 2020 DOI: https://doi.org/10.21203/rs.3.rs-137346/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/29 Abstract Background Chronic spontaneous urticaria (CSU) refers to recurrent urticaria that lasts for more than 6 weeks in the absence of an identiable trigger. Due to its recurrent wheal and severe itching, CSU seriously affects patients' life quality. There is currently no radical cure for it and its vague pathogenesis limits the development of targeted therapy. With the goal of revealing the underlying mechanism, two data sets with accession numbers GSE57178 and GSE72540 were downloaded from the Gene Expression Omnibus (GEO) database. After identifying the differentially expressed genes (DEGs) of CSU skin lesion samples and healthy controls, four kinds of analyses were performed, namely functional annotation, protein- protein interaction (PPI) network and module construction, co-expression and drug-gene interaction prediction analysis, and immune and stromal cells deconvolution analyses. Results 92 up-regulated genes and 7 down-regulated genes were selected for subsequent analyses.
    [Show full text]
  • Human S100A8 and S100A9 Scavenge Pro-Inflammatory Hypohalous Acids in Disease
    Human S100A8 and S100A9 Scavenge Pro-inflammatory Hypohalous Acids in Disease by Lincoln Henry Gomes A thesis submitted in fulfillment of the requirements for the degree of Doctor of Philosophy Faculty of Medicine The University of New South Wales 2012 THE UNIVERSITY OF NEW SOUTH WALES Thesis/Dissertation Sheet Surname or Family name: Gomes First name: Lincoln Other name/s: Henry Abbreviation for degree as given in the University calendar: PhD School: Medical Sciences Faculty: Medicine Title: S100A8 and S100A9 scavenge pro-inflammatory hypohalous acids in disease Abstract 350 words maximum: (PLEASE TYPE) S100A8, S100A9 and S100A12 are generally considered pro-inflammatory proteins because their expression is elevated in chronic inflammatory disorders. Hypohalous acids generated by activated phagocytes are scavenged by murine S100A8 and S100A9, suggesting a protective role in oxidative stress, but effects on human recombinant S100A8 and S100A9 are undefined. Hypohalous acids at low molar ratios (1:1) promoted structural changes in human S100A8 and S100A9 in vitro, generating two novel post- translational modifications on Cys42 in S100A8, defined as oxathiazolidine-oxide and dioxide. Particular methionine residues in S100A9 were also modified. S100A8 and S100A9 are increased in respiratory diseases in which reactive oxygen species are implicated and anti-oxidant mechanisms compromised. Oxidized S100A8 (oxS100A8) was prominent in asthmatic lung and significantly elevated in sputum, compared to controls, whereas S100A8 or S100A9 levels were not. Monomeric oxS100A8 was the major component in asthmatic sputum; modifications were similar to those generated by hypochlorous acid (HOCl) in vitro. Oxidized Met63/81/94 were variously present in S100A9 from asthmatic sputum, only oxidized Met63 was seen in control sputum.
    [Show full text]
  • LJELSR: a Strengthened Version of JELSR for Feature Selection and Clustering
    Article LJELSR: A Strengthened Version of JELSR for Feature Selection and Clustering Sha-Sha Wu 1, Mi-Xiao Hou 1, Chun-Mei Feng 1,2 and Jin-Xing Liu 1,* 1 School of Information Science and Engineering, Qufu Normal University, Rizhao 276826, China; [email protected] (S.-S.W.); [email protected] (M.-X.H.); [email protected] (C.-M.F.) 2 Bio-Computing Research Center, Harbin Institute of Technology, Shenzhen 518055, China * Correspondence: [email protected]; Tel.: +086-633-3981-241 Received: 4 December 2018; Accepted: 7 February 2019; Published: 18 February 2019 Abstract: Feature selection and sample clustering play an important role in bioinformatics. Traditional feature selection methods separate sparse regression and embedding learning. Later, to effectively identify the significant features of the genomic data, Joint Embedding Learning and Sparse Regression (JELSR) is proposed. However, since there are many redundancy and noise values in genomic data, the sparseness of this method is far from enough. In this paper, we propose a strengthened version of JELSR by adding the L1-norm constraint on the regularization term based on a previous model, and call it LJELSR, to further improve the sparseness of the method. Then, we provide a new iterative algorithm to obtain the convergence solution. The experimental results show that our method achieves a state-of-the-art level both in identifying differentially expressed genes and sample clustering on different genomic data compared to previous methods. Additionally, the selected differentially expressed genes may be of great value in medical research. Keywords: differentially expressed genes; feature selection; L1-norm; sample clustering; sparse constraint 1.
    [Show full text]
  • Vildagliptin and Its Metabolite M20.7 Induce the Expression of S100A8
    www.nature.com/scientificreports OPEN Vildagliptin and its metabolite M20.7 induce the expression of S100A8 and S100A9 in human Received: 28 January 2016 Accepted: 03 October 2016 hepatoma HepG2 and leukemia Published: 19 October 2016 HL-60 cells Mitsutoshi Asakura, Fumika Karaki, Hideaki Fujii, Koichiro Atsuda, Tomoo Itoh & Ryoichi Fujiwara Vildagliptin is a potent, orally active inhibitor of dipeptidyl peptidase-4 (DPP-4) for the treatment of type 2 diabetes mellitus. It has been reported that vildagliptin can cause hepatic dysfunction in patients. However, the molecular-mechanism of vildagliptin-induced liver dysfunction has not been elucidated. In this study, we employed an expression microarray to determine hepatic genes that were highly regulated by vildagliptin in mice. We found that pro-inflammatory S100 calcium-binding protein (S100) a8 and S100a9 were induced more than 5-fold by vildagliptin in the mouse liver. We further examined the effects of vildagliptin and its major metabolite M20.7 on the mRNA expression levels of S100A8 and S100A9 in human hepatoma HepG2 and leukemia HL-60 cells. In HepG2 cells, vildagliptin, M20.7, and sitagliptin – another DPP-4 inhibitor – induced S100A9 mRNA. In HL-60 cells, in contrast, S100A8 and S100A9 mRNAs were significantly induced by vildagliptin and M20.7, but not by sitagliptin. The release of S100A8/A9 complex in the cell culturing medium was observed in the HL-60 cells treated with vildagliptin and M20.7. Therefore, the parental vildagliptin- and M20.7-induced release of S100A8/ A9 complex from immune cells, such as neutrophils, might be a contributing factor of vildagliptin- associated liver dysfunction in humans.
    [Show full text]
  • Hacat Keratinocytes Overexpressing the S100 Proteins S100A8
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector ORIGINAL ARTICLE HaCaT Keratinocytes Overexpressing the S100 Proteins S100A8 and S100A9 Show Increased NADPH Oxidase and NF-jB Activities Malgorzata Benedyk1, Claudia Sopalla1,2, Wolfgang Nacken1,2,Gu¨nther Bode1,2, Harut Melkonyan1, Botond Banfi3,4 and Claus Kerkhoff1,2 The calcium- and arachidonic acid (AA)-binding proteins S100A8 and S100A9 are involved in nicotinamide adenine dinucleotide phosphate (NADPH) oxidase activation in phagocytes. They are specifically expressed in myeloid cells, and are also found in epithelial cells in various (patho)physiological conditions. We have investigated the consequences of S100A8/A9 overexpression in epithelial cell lines on reactive oxygen species (ROS) generation and downstream signaling. Epithelial carcinoma HeLa cells, which exclusively express Nox2, showed dramatically increased activation of NADPH oxidase by phorbol 12-myristate 13-acetate after S100A8/A9 gene transfection. HaCaT keratinocytes overexpressing S100A8/A9 showed enhanced, transient ROS generation in response to the calcium ionophore A23187 compared to mock-transfected cells. Polymerase chain reaction analysis revealed mRNA transcripts for Nox1, Nox2, and Nox5 in HaCaT keratinocytes. Detailed transfection studies confirmed that NADPH oxidase activities in Nox1- and Nox5-transfected HeLa cells were enhanced after S100A8/A9 gene complementation. Furthermore, mutational analysis revealed that AA binding and Thr113 phosphorylation are important for S100A8/A9-enhanced activation of NADPH oxidase. Nuclear factor-kB(NF-kB) activation and interleukin-8 mRNA levels were increased in S100A8/A9-HaCaT keratinocytes, consistent with the view that NF-kB is a redox-sensitive transcription factor.
    [Show full text]
  • S100A8 Promotes Chemoresistance Via Augmenting Autophagy in B‑Cell Lymphoma Cells
    ONCOLOGY REPORTS 45: 151-158, 2021 S100A8 promotes chemoresistance via augmenting autophagy in B‑cell lymphoma cells LI ZHANG1,2, SHIXIA ZHOU3, TIEJUN ZHOU4, KAIFENG YUAN3, XIAOMING LI3 and JUNLING TANG3 1Hospital of Stomatology, Southwest Medical University; Departments of 2Oral and Maxillofacial Surgery, 3Haematology and 4Pathology, The Affiliated Hospital of Southwest Medical University, Luzhou, Sichuan 646000, P.R. China Received June 15, 2020; Accepted October 9, 2020 DOI: 10.3892/or.2020.7841 Abstract. B-cell lymphomas (BCLs) are malignant lymphoid self-replicating abilities (1-4). Despite advances in treatment, tumours originating from the malignant proliferation and the quality of life of the patients following treatment is highly transformation of mature lymphocytes at various stages of affected by chemotherapy resistance, which severely impedes differentiation and clonal expansion of the lymphatic and circu- the clinical treatment of B-cell lymphomas (BCLs) (5-7). latory systems. Efforts to control or even eradicate BCLs are BCLs comprise a heterogenous group of mature lymphopro- frequently hampered by the development of drug resistance. liferative malignancies that are among the top 10 causes of Autophagy is an evolutionarily conserved biological process cancer-related mortality, mainly occurring in the lymph nodes, of the energy metabolism. By degrading intracellular organ- spleen, thymus and other lymphoid organs (4,8,9). Almost all elles and proteins, autophagy provides cells with biochemical anti-lymphoma treatments are accompanied by chemotherapy reaction substrates for the maintenance of homeostasis under resistance, including resistance to genotoxic agents, mono- nutrient deprivation or other stressful conditions. Accumulating clonal antibodies, antibody-drug conjugates, targeted agents evidence indicates that autophagy plays an important role in or multidrug combinations (5,10-12).
    [Show full text]