Characterization and Expression of Xiphophorus Maculatus Microsatellite Msb069 Full Sequence in Subgenus Poecilia

Home , Xiphophorus

Journal of Genetics, Vol. 97, No. 4, September 2018, pp. 817–824 © Indian Academy of Sciences https://doi.org/10.1007/s12041-018-0968-y

RESEARCH ARTICLE

Characterization and expression of Xiphophorus maculatus microsatellite Msb069 full sequence in subgenus Poecilia

KEONG BUN POH∗ , ZARIF MUAZ ROSLAN, ROSMILAH MISNAN and SOM CIT SINANG

Faculty of Science and Mathematics, Department of Biology, Universiti Pendidikan Sultan Idris, 35900, Tanjong Malim, Perak, Malaysia *For correspondence. E-mail: [email protected].

Received 21 April 2017; revised 26 October 2017; accepted 21 November 2017; published online 3 August 2018

Abstract. Msb069 primer pairs encompassed region is believed to be associated with a quantitative trait loci (QTL) of dorsal fin length in subgenus Poecilia. However, detailed investigation on Msb069 which originated from Xiphophorus on subgenus Poecilia remains unexplored. In this study, full sequence of Msb069 was characterized by sequencing bioinformatics analysis and gene expression. The sequence analysis of Msb069 primer pairs encompassed region on three species of Poecilia revealed higher number of microsatellite tandem repeats in Poecilia latipinna (ATG16) compared to P. sphenops (ATG13–14). There is no notable pattern of ATG tandem repeats discovered in the hybrids. The full sequence of Msb069 is 734 bp in length and showed a 233 bp conserved region between Xiphophorus and Poecilia. BLAST search performed on this sequence revealed no significant similarities. Nonquantitative RT-PCR exhibited the presence of Msb069 transcripts in three different tissues in subgenus Poecilia. Meanwhile, quantitative RT- PCR expression on two different tissues showed relatively higher expression of Msb069 transcript in P. latipinna dorsal fin tissues in both male and female fishes, suggesting a repressive function of this transcript with respect to dorsal fin length. However the exact gene expression event of Msb069 is still unknown and requires further investigation.

Keywords. microsatellite; Msb069 full sequence; quantitative trait loci, dorsal ﬁn length; Poecilia; Xiphophorus maculatus.

Introduction In the subgenus Poecilia, dorsal fin is used for courting during mating process. This is especially for male Xiphophorus maculatus microsatellite Msb069 full P.latipinna, where the enlarged dorsal fin is fanned against sequence is a microsatellite containing sequence which potential females to induce copulation. Dorsal fin length has ATG tandem repeats and was isolated from DNA in P. latipinna is sexually dimorphic. Enlarged dorsal fin is of X. maculatus (platy fish). The Msb069 full sequence only present in the males but this feature is absent in the was 734-bp long and the Msb069 primer pairs encom- females (Ptacek 2002; Ptacek and Breden 1998). Besides passed region was mapped in Xiphophorus linkage map the importance of dorsal fin in courting, this feature has positioned at linkage group 14 (Walter et al. 2004). This diverse roles and functions. For instance, dorsal fin plays sequence was reported to be associated with a quantita- an important role in stabilizing the fish during forward tive trait loci (QTL). Briefly, the QTL study was conducted swimming and also withstanding lateral water forces that in subgenus Poecilia utilizing X. maculatus microsatellite might cause the fish to turn. In some fish species, dorsal markers designed by Walter et al. (2004) who had suc- fin has spines which serve as a defence against predators cessfully identified the Msb069 primer pairs encompassed (Kalish-Achrai et al. 2017). region to be linked with dorsal fin length, which showed Despite these, developmental process and genetic events high association (LOD > 3.0) (Keong et al. 2014). behind the varying length of dorsal fin remained vague and only a few researches were conducted. For example, Keong Bun Poh and Zarif Muaz Roslan contributed equally to this a developmental study on frog embryo had shown that work. dorsal fin emerged from migration of cells from neural

817 818 Keong Bun Poh et al. crest (NC) cells and somite located in the dorsomedial PCR amplification conditions and reverse region into the core of dorsal fin. In addition, a calcium transcription-polymerase chain reaction (RT-PCR) regulated gene, Wnt11-R is also expressed in migratory cells during dorsal fin development (Garriock and Krieg PCR and nonquantitative two-step RT-PCR reactions 2007). Another related yet different study focussing on were carried out by using 2× PCR master mix (1st Base, genetic analysis of mutated gene effect was also conducted Science Park 2, Singapore) in a 20 μL reaction volume on zebra fish. The study discovered that adult zebra fish comprising of 1× PCR master mix, 0.4 μM primer and which inherited stein und bein (sub) was found to be lacking 0.1 μg of DNA or cDNA. In two-step RT-PCR, the unpaired dorsal fin in homozygous individuals. Moreover, RNA was reverse transcribed to cDNA by using Quanti- stein und bein (sub) mutant fish also exhibited severely Nova Reverse Transcription Kit (Qiagen) prior to PCR. reduced pelvic fin (van Eeden et al. 1996). To the best The PCR amplification protocol was as follows: 30 cycles ◦ of our knowledge, genetic investigation on dorsal fin is of 1 min predenaturing step at 95 C, followed by 1 min of ◦ ◦ quite limited. Two most recent research related to dor- denaturing at 95 C, 1 min of annealing at 54 C, 1 min of ◦ ◦ sal fin in Actinopterygii or ray-finned fish were found, extension at 72 C and a final extension at 72 C for 5 min. but mainly focussed on development pattern (Richter and Morit 2017) and structure, composition, mechanics and growth of spines in dorsal fin (Kalish-Achrai et al. 2017). Electrophoresis and visualization Despite the important contribution of the dorsal fin in social activities (e.g. courting) and swimming performance, Amplified PCR products were electrophoresed in 2% × . μ / detailed data related to the QTL effect of Msb069 on dor- agarose gel (1 TBE buffer, 0 5 g mL gel red). Stained sal fin length is not reported so far. Therefore, this study gel was visualized under UV light using Imager Sys- was conducted (i) to characterize Xiphophorus Msb069 full tem (SmartView Pro Imager System,Taoyuan, Taiwan). sequence and (ii) to investigate the gene expression events GeneRuler 100 bp (Fermentas, Waltham, USA) and 1 kbp of this QTL in subgenus Poecilia. (Fermentas) were used as molecular size standard.

Analysis of different loci in X. maculatus microsatellite Msb069 Materials and methods full sequence in Poecilia

Experimental animals To test whether other regions within Msb069 DNA full sequence were conserved between Xiphophorus and Poe- The Poecilia samples which comprised of P.latipinna (sail- cilia, three primer pairs flanking the same tandemly fin molly), P. sphenops (shortfin molly) and hybrids (dal- repeated region (ATG) but with different product size were mation molly) were sampled from local breeding aquaria. designed (table 1;figure1). The three primer pairs namely; All fish samples were sexually mature adults with average Msb069_687bp, Msb069_450bp and Msb069_233bp were length of 2.50±1.23 cm SL. Wild samples of Poecilia are tested for amplifications on representative DNA samples. not available locally as this fish species is not native to The representative samples include two P. latipinna (one this country. Most of the existing fish stocks are artificially male and one female), two P. sphenops and two hybrids. breed in captivity.

Analysis of Msb069 sequences among species of Poecilia

Genomic DNA extraction A Msb069 primer pairs designed by Walter et al. (2004) and was downloaded from Xiphophorus Microsatellite DNA was extracted from freshly sampled fin clips Loci Database, (http://www.xiphophorus.org/microsats/ ∼ ( 10 mg) using an extraction kit (Qiagen, Hilden, Ger- microsat.htm) or alternatively, full sequence information many). Extraction procedure was conducted in accordance could be retrieved from EMBL/GeneBank Data Libraries with manufacturer’s instructions. under accession no. AY258838.1. The Msb069 primer pairs is flanking a tandemly repeat region of ATG (table 1; figure 1). This primer pairs were tested for PCR amplifi- Tissue specific RNA extraction cations on 30 DNA samples isolated from three different species of Poecilia. The fish samples include 10 P.latipinna From each fish, RNA was extracted from ∼10 mg of tis- (five male and five female), 10 P. sphenops and 10 hybrids. sues of dorsal fin, muscles and gonad (male and female). Positive amplified PCR products were send for direct These tissues were immediately frozen in liquid nitrogen sequencing to 1st Base Laboratory Sdn Bhd (Seri Kem- prior to sample disruption. The RNA was isolated by using bangan, Malaysia). Sequence alignment was performed by RNeasy Mini kit (Qiagen). using online software, ClustalW. Characterization and expression of X. maculatus microsatellite Msb069 819

Identiﬁcations of open reading frame (ORF) and nonquantitative expression of Msb069 in cDNA of dorsal ﬁn, muscle and gonad

A search for putative ORF was conducted on X. maculatus microsatellite Msb069 DNA full sequence by using accession no. Full sequence ORF Finder online graphical analysis tool. This search was conducted to identify any potential transcript encod- ing for protein residing within this locus. All statistical data wasexpressedasmeans± STDEV. Two-step nonquantitative RT-PCR was used to deter- mine the expression of Msb069 on tissue specific cDNA isolated from dorsal fin, muscle and gonad. The fish samples include four P. latipinna (two male and two female), Marker size (bp) four P. sphenops and four hybrids. Prior to tissue extraction, fishes were euthanized in crushed ice for 10 min. Dorsal fin, muscle and gonad were dissected out from the same fish and immediately crushed separately with liquid nitrogen before proceed with RNA isolation. A reference C)

◦ gene (beta actin; atcb1) were PCR on RNA samples to test (

m for any possible genomic contamination prior to cDNA T conversion (table 1). First strand cDNA conversion was Melting temp. carried out using Qiagen’s Quantinova Rev. Transcription Kit (Qiagen, Germany).

) Msb069 expression pattern on tissues speciﬁc samples to 3

For qPCR analysis, species of Poecilia was divided accord- ing to species groups: (i) P. latipinna; (ii) P. sphenops and (iii) hybrids. Transcriptional expression of Msb069 was carried out on tissue specific cDNA isolated from dorsal fin and gonad only. Four P. latipinna (two male and two female), four P. sphenops and four hybrids fish samples were used for this analysis. RNA extraction was prepared as described above. Quantification of extracted RNA was carried out using Qiagen’s QIAxcel. Prior to cDNA conversion, all RNA samples were treated with Qiagen’s QuantiNova gDNA removal mix following protocol listed in the instruction manual. RNA purity was measured through spectromet- ) Reverse (5 ric absorbance and indicated as ratio of A260/A230 and

to 3 A260/A280. The A260/A230 ratio greater than 1.7 was used as the threshold, while for the A260/A280, ratio greater than 1.8 was used as acceptable threshold. RNA samples with low purity were discarded. First strand cDNA was prepared as described above. The amount of cDNA was standardized to 250 ng/μL prior to real-time RT-PCR. Real-time RT-PCR was used to quantify Msb069 expression and was conducted at least AGAAGGACAGCTATGTAGGTGAGTCCAGAAGGTAAAGCACAGA AGCTCGTTGTAGAAGGTGTGA GCAGTTCCTGGTCACATAGTAA 54 –in triplicate 136 using 127 Rotor-Gene NM_001297475.1 AY258838.1 Q (RGQ, Qiagen). NTCs were included while running each batch of sample to detect PCR contamination. Real-time RT-PCR conditions ◦ Summary of primers information. included a PCR initial activation step of 95 C for 2 min, ∗ followed by 40 cycles of two-step ampliﬁcations of 95◦C ∗∗ for 5 min and 60◦C for 10 s using reagents from Quanti- Primer pairs used as reference gene for qPCR. Primer pairs used in quantitative RT-PCR. Table 1. PrimerMsb069_687bpMsb069_450bpMsb069_233bp GGTCCAGTTCTACTGATTTTMsb069 TTCTCATTGCTTCTGGTTCTactb1 CTCATTGGTTCTGGTTCTGT TGTTCATGCAGACAGAGT∗ Forward AGAGACTCTGGAGGACACAA (5 ∗∗ GATCTGTCAGCCATGTCCAGAAG GCAGTTCCTGGTCACATAGT TGGTCACATAGTAACCTACGGGTC 54 55 50 55 133 450 687 233 AY258838.1 AY258838.1 AY258838.1 AY258838.1 Msb069 Nova SYBR Green (Qiagen). Beta actin (atcb1) was used 820 Keong Bun Poh et al.

Figure 1. Full-length nucleotide sequence of X. maculatus microsatellite Msb069 sequence (accession number AY258838.1). Sequences are numbered at the left side of each line. Dotted arrows indicate the potential antisense ORF 1 sites of start (position 291) and stop (position 446) loci. Yellow shade indicates microsatellite tandemly repeat (ATG) region; green shade indicates putative start and stop codons. Long line under the sequence indicates primer pairs locus of Msb069_687bp; square dotted line indicates primer pairs locus of Msb069_450bp; round dotted line indicates primer pairs locus of Msb069_233bp; long dashed line indicates primer pair locus of Msb069. The alphabet below the lines indicates (F) forward and (R) reverse primers. as reference gene to normalized sample-to-sample varia- the three primer pairs when tested with the DNA of tions (table 1). X. maculatus. The three primer pairs were subsequently Gene expression levels were analysed by the 2−CT tested for amplifications on representative DNA sam- method. Results were presented as relative expression in ples of Poecilia and PCR amplifications were positive ratio (ratio = concentration of target gene / concentration only for Msb069_233bp. A representative sample of male of beta actin gene) using Rotor-Gene Q Series Software P. latipinna was PCR with Msb069_233bp, sequenced and analysis tool (Qiagen). deposited in repository of NCBI under accession number MF990735. BLAST search performed on this sequence against NCBI online database revealed no significant sim- Results ilarities. The other two primer pairs were unable to amplify even after optimization. Analysis of Xiphophorus Msb069 DNA full sequence in Poecilia

The three primer pairs, Msb069_687bp, Msb069_450bp Sequence analysis of Msb069 among species of Poecilia and Msb069_233bp were initially tested for PCR amplifications on two randomly selected DNA samples of ClustalW alignments of Msb069 sequences revealed spe- X. maculatus. PCR amplifications were positive for all cific length and pattern variation in microsatellite tandem Characterization and expression of X. maculatus microsatellite Msb069 821

Figure 2. Multiple alignment of Poecilia DNA sequences of Msb069 with representative samples from (a) male P. latipinna,(b) female P. latipinna,(c)maleP. sphenops,and(d)femaleP. sphenops. Highlighted region showed microsatellite tandemly repeated sequence (ATG). *Similar sequences. 822 Keong Bun Poh et al.

Table 2. Variations of microsatellite tandemly Table 3. ORF search results on X. maculatus repeated region of primer pairs Msb069 among P. microsatellite Msb069 DNA full sequence. latipinna, P. sphenops and hybrids. ORF Strand Start Stop Length (bp/aa) Microsatellite tandem Poecilia spp. Sex repeats motif 1 Sense 291 446 156/51 2 Sense 582 734 153/50 P. latipinna Male (ATG)4AGG(ATG)11 3 Antisense 688 524 165/54 P. latipinna Female (ATG)16 4 Antisense 552 451 102/33 P. sphenops Male (ATG)13 5 Antisense 342 202 141/46 P. sphenops Female (ATG)14 Hybrids Male (ATG)12 Bp, base pair; aa, amino acids. (ATG)13 (ATG)14 Hybrids Female (ATG)4AGG(ATG)11 (ATG)14 (ATG)15 (ATG)16

repeats (ATG) on both P.latipinna and P.sphenops samples only.The microsatellite tandem repeats were longer in both male and female P.latipinna compared to male and female P. sphenops. However, in male and female hybrids, no spe- ciﬁc pattern or trend in microsatellite tandemly repeated motif was detected. Other nonrepetitive sequences were almost synonymous (ﬁgure 2;table2).

ORF identification and tissue distribution of Msb069 in Poecilia Figure 3. Expression of Msb069 and actb1 (beta actin) as reference gene in different P. latipinna tissues. Expression of Msb069 The Msb069 full-sequence ORF search results revealed and actb1 were detected in tissues listed above by RT-PCR on five different, yet overlapping potential ORF regions. Two cDNA. For expression of Msb069, positive control using cDNA potential ORF regions were discovered on the sense strand from X. maculatus as template and negative control using water as template were included. while the other three potential ORF regions were positioned on the antisense stand (table 3). The Msb069 primer pairs encompassed region was found to be superimposed Discussion in ORF 1 which is having nucleotide length of 156 bp, pos- sibly encodes for 51 amino acids (figure 1;table3). All five Cross species PCR amplification between Xiphophorus and ORF transcripts were identified by performing BLASTp subgenus Poecilia was only positive for Msb069_233bp. against NCBI online database but no significant similari- The other two primer pairs flanking larger region were ties were found. unable to be amplified even after optimization. This result All tissues specific RNA samples that were PCR with a indicated that the conserved region between Xiphophorus reference genes (actb1) did not showed any positive ampli- and Poecilia was limited within a small region, 233- fication. This result rejects the possibilities of genomic bp long. Conserved microsatellite region between closely contamination in all the RNA samples. Nonquantitative related aquatic animals is common. Because of its highly RT-PCR analysis of the total cDNA from different tissues conserved nature, which enables positive cross species PCR showed that Msb069 transcripts are expressed in dorsal amplification, microsatellites had been applied in a wide fin, muscles and gonad (figure 3). variety of research such as genetic mapping, phylogeny and conservation genetics (Chistiakov et al. 2006). Quantitative expression pattern of Msb069 on tissues specific ClustalW alignments of Msb069 sequences showed that samples both male and female P.latipinna samples exhibited longer microsatellite tandem repeats compared to male and Tissue specific expression levels for Msb069 transcript female P. sphenops. Many studies had analysed the effect appeared to be low throughout all the cDNA samples eval- of microsatellite tandemly repeated length especially for uated. However, this transcript was highly expressed in the microsatellite type I markers (Goldstein and Schlötterer dorsalfinoffemaleP.latipinna but decreased 3-fold in dor- 1999). For instance, variations in the number of tandem sal fin of male P. latipinna (figure 4). repeats in functional microsatellite containing regions had Characterization and expression of X. maculatus microsatellite Msb069 823

Figure 4. Relative mRNA expression level of Msb069 from dorsal fin and gonad (both male and female) tissues. Relative expression levels were calculated as ratio (conc. of target gene / conc. of beta actin gene). The symbols on x axis: FBM2, female P. sphenops; MBM2, male P. sphenops; FHY1, female hybrids; MHY2, male hybrids; FSM2, female P. latipinna; MSM1, male P. latipinna. Error bars indicate standard deviation. *Significant difference (P < 0.05). caused plausible variations in biochemical level which to mutation, as mutation rates in microsatellite region were eventually affects the organism physiology and develop- high (Goldstein and Schlötterer 1999; Chistiakov et al. ment (Künzler et al. 1995; Kashi et al. 1997). Moreover, 2006). microsatellite containing region was also found to be resid- The nonquantitative RT-PCR analysis of total RNA ing in various parts of transcriptional units such as in pro- from different tissues showed Msb069 transcripts are moter region, upstream of promoter, binding protein and expressed in dorsal fin, muscle and gonad in all the three exon region. For instance, the 5 upstream promoter region species of Poecilia. To verify the enhancer or repressive of insulin gene in Nile tilapia contains microsatellite region effect of Msb069, quantitative RT-PCR was performed which is similar to those found in human and primates using real-time PCR. Quantitative RT-PCR demonstrated (Mansour et al. 1998). Studies had reported that longer that the expression of Msb069 transcript was highest in microsatellite tandem repeats on these transcriptional dorsalfinoffemaleP.latipinna but decreased 3-fold in dor- units site had transcriptional enhancer effect. Deletion sal fin of male P.latipinna. The high expression of Msb069 or lacking of microsatellite sequence markedly reduced transcript in dorsal fin tissues in both male and female transcriptional activity (Goldstein and Schlötterer 1999). P.latipinna further supported the QTL association discov- However, some research discovered that gene (contain- ered by (Keong et al. 2014). Moreover, as enlarged dorsal ing microsatellite) expression level was also significantly fin is only prominent in male P.latipinna and expression of influence by the environment (Chistiakov et al. 2006). For Msb069 transcript was highest in the female, it is hypoth- instance, for a dinucleotide (CA/GT)n microsatellite in esized that Msb069 might play role in downregulating the Nile tilapia prolactin 1 (PRL1) promoter, homozygous expression, causing a decreased in dorsal fin length. How- individuals having longer microsatellite repeats in PRL1 ever, more studies should be conducted to understand the expressed less in freshwater but more in brackish water genetic events of Msb069 with respect of dorsal fin length (Streelman and Kocher 2002). At this point, a direct cor- in Poecilia. To the best of our knowledge, the characteriza- relation between microsatellite repeat length and enhancer tion of Msb069 transcript has not been reported, making or repressive effect could not be ascertain in this study and it novel and incomparable with those of other researchers. requires further verifications. The variation in microsatel- In conclusion, in Xiphophorus Msb069 full sequence, lite tandemly repeat as observed in this study could be due conserved region between Xiphophorus and Poecilia was 824 Keong Bun Poh et al. confined to a small region of 233 bp. ClustalW alignments spines of the dorsal fin of blue tilapia Oreochromis aureus of Msb069 sequences showed length variation and pattern and common carp Cyprinus carpio. J. Fish Biol. 90, in tandem repeats for P. latipinna and P. sphenops. Non- 2073–2096. Kashi Y., King D. and Soller M. 1997 Simple sequence repeats quantitative RT-PCR analysis of total RNA from different as a source of quantitative genetic variation. Trends Genet. 13, tissues showed Msb069 transcripts were expressed in dor- 74–78. sal fin, muscle and gonad. Quantitative RT-PCR findings Keong B. P., Shapor S., Khalijah S., Malar J. and Nadia A. R. suggest a repressive function of Msb069 with respect of 2014 Identification of quantitative trait locus (QTL) linked to dorsal fin length. dorsal fin length from preliminary linkage map of molly fish, Poecilia sp. Gene 536, 114–117. Künzler P., Matsuo K. and Schaffner W.1995 Pathological, phys- Acknowledgements iological, and evolutionary aspects of short unstable DNA repeats in the human genome. Biol. Chem. Hoppe-Seyler 376, This work is funded by Ministry of Education (MOE) under 201–211. FRGS 2014-0115-101-02 to UPSI (Universiti Pendidikan Sul- Mansour M., Wright J. R. and Pohajdak B. 1998 Cloning, tan Idris). We thank the laboratory staff of the Department sequencing and characterization of the tilapia insulin gene. of Biology, UPSI, for providing essential facilities. We are also Comp. Biochem. Physiol. B Biochem. Mol. Biol. 121, grateful for all the contributions and support provided by all the 291–297. coresearchers. Ptacek M. B. 2002 Patterns of inheritance of mating signals in interspecific hybrids between sailfin and shortfin mollies (Poe- ciliidae: Poecilia: Mollienesia). Genetica 116, 329–342. Ptacek M. B. and Breden F. 1998 Phylogenetic relationships References among the mollies (Poeciliidae: Poecilia: Mollienesia) based on mitochondrial DNA sequences. J. Fish Biol. 53, 64–82. Chistiakov D. A., Hellemans B. and Volckaert F. A. M. 2006 Richter P. and Morit T. 2017 Lessons from the first dorsal fin in Microsatellites and their genomic distribution, evolution, atheriniforms-a new mode of dorsal fin development and its function and applications: a review with special reference to phylogenetic implications. J. Morphol. 278, 848–864. fish genetics. Aquaculture 255, 1–29. Streelman J. T. and Kocher T. D. 2002 Microsatellite vari- Garriock R. J. and Krieg P. A. 2007 Wnt11-R signal- ation associated with prolactin expression and growth of ing regulates a calcium sensitive EMT event essential for salt-challenged tilapia. Physiol. Genomics 9, 1–4. dorsal fin development of Xenopus. Develop. Biol. 304, van Eeden F. J., Granato M., Schach U., Brand M., Furutani- 127–140. Seiki M., Haffter P. et al. 1996 Genetic analysis of fin Goldstein D. B. and Schlötterer C. 1999 Microsatellites: formation in the zebrafish, Danio rerio. Development 123, evolution and applications. University Press, Oxford, 255–262. England. Walter R. B., Rains J. D., Russell J. E., Guerra T. M., Daniels C., Kalish-Achrai N., Monsonego-Ornan E. and Shahar R. Johnston D. et al. 2004 A microsatellite genetic linkage map 2017 Structure, composition, mechanics and growth of for Xiphophorus. Genetics 168, 363–372.

Corresponding editor: Indrajit Nanda