Abstract Olson, Eric Leonard

1 ABSTRACT 2

OLSON, ERIC LEONARD. Characterization of Stem Rust Resistance in US Wheat 3 Germplasm. (Under the direction of Gina Brown-Guedira.) 4 5 In 1999 in Uganda a race of stem rust, Puccinia gramins f. sp. tritici was 6 identified with virulence to Sr31. This race, designated as TTKS based on the North 7

American nomenclature system, combined Sr31 virulence with virulence to the majority 8 of Triticum aestivum L. derived stem rust resistance genes. The development of resistant 9 cultivars is needed as TTKS may reach global dispersal due to its unique virulence to 10 multiple known and unknown resistance genes and widespread cultivar susceptibility. 11

The ability to detect the presence of specific stem rust resistance genes using molecular 12 markers presents a viable method for identifying resistance to race TTKS in the absence 13 of the pathogen itself. The frequency of DNA markers associated with resistance genes 14

Sr24, Sr26, Sr36, and Sr1RSAmigo which confer resistance to TTKS was assessed in 15 diverse wheat cultivars and breeding lines from breeding programs throughout the United 16

States. The reliability of these markers in predicting the presence of the resistance genes 17 in diverse germplasm was evaluated through comparison with phenotypic data. 18

Introgression of undeployed seedling resistance genes is necessary to improve the 19 availability of resistance to TTKS. The stem rust resistance gene Sr22 confers resistance 20 to TTKS. Sr22 is present on a chromosomal translocation derived from Triticum 21 boeoticum Boiss. which is homoeologous to the A genome of T. aesitivum Linkage 22 analysis of SSR loci on 7AL was done to identify the loci most closely linked to Sr22. 23

Individuals with reduced T. boeoticum segments due to recombination between wheat 24 chromosome 7AL and the Sr22 introgression were identified with SSR markers in F2:3 25

populations of crosses between the germplasm stock Sr22Tb and the hard winter wheat 1 lines 2174 and Lakin. From analysis of F3:4 populations derived from F2 recombinants, 2

F3:4 individuals with further reduced translocation segments have been identified. 3

Recombinant lines with reduced translocations will provide a more agronomically 4 desirable source of Sr22 stem rust resistance in hard winter wheat germplasm that can be 5 readily deployed utilizing molecular markers. The identification of molecular markers 6 efficacious for the selection of genes for resistance to TTKS will hasten the development 7 of resistant cultivars. 8

Characterization of Stem Rust Resistance in US Wheat Germplasm 1 2

by 3 Eric Leonard Olson 4 5

A thesis submitted to the Graduate Faculty of 6 North Carolina State University 7 in partial fulfillment of the 8 requirements for the Degree of 9 Master of Science 10 11 12 Crop Science 13 14 15 Raleigh, North Carolina 16 17 18 2009 19 20 21 APPROVED BY: 22 23

24 25 26 ______27 Dr. David Marshall Dr. James B. Holland 28 29 30 31 32 33 34 ______35 Dr. Gina Brown-Guedira 36 Chair of Advisory Committee 37 38 39 40 41 42

1 2 BIOGRAPHY 3 4 Eric Leonard Olson was born in Dodgeville, WI in 1980 to Leonard and Catherine 5

Olson. Eric, the oldest of three siblings, lived and worked on the family dairy farm for 6 many years. The best years of his life were spent working beside his brother, father and 7 grandfather on the farm. Attending the University of Wisconsin in Platteville, Eric 8 developed a love of science and a desire to make meaningful contributions to agriculture 9 through science. Opportunity for graduate studies at North Carolina State University was 10 available and in 2007 Eric began work on an MS degree with Dr. Gina Brown-Guedira. 11

In January of 2009 Eric will begin a Phd. program at Kansas State University working 12 with Dr. Michael Pumphrey and Dr. Bikram Gill. 13

14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31

1 2 ACKNOWLEDGEMENTS 3 4 I would like to thank most of all those few who let me believe that graduate 5 school was a possibility. Thank you to my family for teaching me how to work hard and 6 for being there for me, always. Thank you to Dr. Gina Brown-Guedira for the 7 opportunity to do challenging and meaningful work. I am grateful to Jared Smith and 8

Kim Howell for sharing their valuable technical expertise. I sincerely thank Dr. Michael 9

Pumphrey for contributing populations and providing phenotypic evaluations. Thank 10 you to my committee members Dr. Jim Holland and Dr. David Marshall. A special 11 thanks to Dr. Gina Brown-Guedira and Dr. David S. Marshall for the opportunity to 12 travel to Kenya. Many thanks to all who took time to listen and helped me learn through 13 meaningful discussion. 14

iii

1 TABLE OF CONTENTS 2 3 Page 4 LIST OF TABLES…………………………………………………………………...... vi 5 6 LIST OF FIGURES……………………………………………………………..…...... vii 7 8 CHAPTER I. Literature Review.………………………………………………………….1 9 Importance of Wheat Cultivation to Humans….………………………………… 2 10 Significance of Wheat………………………………………………….....2 11 Wheat Evolution and Cytogenetics…………………………………………...... 4 12 Origins of modern wheat……………………………………………...... 4 13 Allopolyploidy……….……………………………………………………7 14 The Use of Wheat Relatives in Breeding for Disease Resistance………………...8 15 Wheat germlplasm resources.....…………………...…………………...…8 16 Introgression Methods…………………………………………………….9 17 Ph1 Mutants……………………………………………………….9 18 Gametocidal Genes……………………………………..………..10 19 Radiation…………………………………………………………11 20 The StemRust Pathogen………………………………………………………….12 21 Historical Impact…………………………………………………………12 22 Life Cycle……………………………………………………………...... 13 23 Infection Process…………………………………………………………16 24 Physiologic Races………………………………………………………..17 25 Population Genetics and Evolution………………………………………18 26 New Highly Virulent Pgt Race…………………………………………..19 27 Stem Rust Resistance…………………………………………………………….22 28 Sr and Avr gene interaction………………………………………………22 29 Stem Rust Resistance Genes………..……………………………………22 30 Resistance to Ug99…………………………………………………..…. 24 31 Development of Resistant Germplasm………...………………………...23 32 References……………………………………..…………………………………28 33 34 CHAPTER II. Genotyping of U.S. Wheat Germplasm for Presence of Stem Rust 35 Resistance Genes Sr24, Sr36 and Sr1RSAmigo 36 Abstract…………………………………………………………………………..47 37 Introduction………………………………………………………………………48 38 Materials and Methods…………………………………………………………...51 39 Plant Materials…………………………………………………………...51 40

Marker Analyses…………………………………………………………52 1 Phenotypic Analysis……………………………………………………...54 2 Results………………………………………….………………………………...55 3 Discussion………………………………………………………………………..61 4 References………………………………………………………..…..…….…….65 5 6 7 CHAPTER III. Genetic Characterization of Stem Rust Resistance Gene Sr22 8 Abstract………………………………………………..…..………………..……76 9 Introduction……………………………………………………..…..……....…....77 10 Materials and Methods………………………………………..…..…….…...…...81 11 Plant Materials………………………………………..…..…………...…81 12 Stem Rust Evaluations…………………………………..…..…………...83 13 Molecular Marker Analyses…………………………..…..……………...84 14 Results…………………………..…..……………………………………………86 15 Phenotypic Evaluation…………...……………..…..……………………86 16 Genetic and Ph y s i c a l Mapping of Sr22Tb Introgression.………...…...…87 17 Linkage Analysis of F3:4 Recombinant populations…………...…………90 18 Identification of Recombinants………………………………………...93 19 Discussion………………………………………………………………………..94 20 References………………….…………………………………………………….98 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38

LIST OF TABLES 1 2 CHAPTER II. Genotyping of U.S. Wheat Germplasm for Presence of Stem Rust 3 Resistance Genes Sr24, Sr36 and Sr1RSAmigo 4 5 Table 1. Number of U.S. wheat lines from different regions and market classes 6 having stem rust resistance genes Sr24, Sr36 and Sr1RAm , and Sr31 identified 7 with molecular markers.……………….…………………………………………71 8 9 Table 2. Species of origin, chromosomal location, diagnostic markers and 10 expected size in base pairs of amplified fragments for selection of Sr24, Sr36, 11 Sr1RAmigo, and Sr26.…….………………………….…...... ……..………………71 12 13 Table 3. Effective Sr1RAmigo resistance in the presence 14 of Sr24 virulence……………………………………………………...……….…71 15 16 Table 4. Stem rust resistance gene pyramids present……………………………72 17 18 Table 5. Lines resistant to TTKSK and TTKST without marker alleles for 19 Sr24, Sr36 or Sr1RAmigo...... 72 20 21 CHAPTER III. Genetic Characterization of Stem Rust Resistance Gene Sr22 22 23 Table 1. Markers used for linkage analysis of Sr22, primer sequences, parent 24 allele sizes in base pairs and primer annealing temperatures (Tm) in 25 degrees Celsius ……………………………………………………………..…102 26 27 Table 2. Segregation of Sr22 in F2:3 and F3:4 populations…….………………103 28 29 Table 3. Alleles of the Sr22Tb donor parent, the cultivar Steinwedel and 30 the hard winter wheat cultivars 2174 and Lakin for six markers...... 104 31 32 33 34

LIST OF FIGURES 1 2 CHAPTER II. Genotyping of U.S. Wheat Germplasm for Presence of Stem Rust 3 Resistance Genes Sr24, Sr36 and Sr1RSAmigo 4 5 Figure 1. PCR amplification of markers for selection of 6 Sr36, Sr1RAmigo, Sr24 and Sr26…………....……………………………………..73 7 8 Figure 2. PCR amplification of BARC71 for the identification of Sr24 and 9 differentiation between the 3DL/3Ae translocation derived from ‘Agent’ and the 10 1BL∙1BS-3Ae translocation derived from ‘Amigo’ of Sr24……...……………...74 11 12 CHAPTER III. Genetic Characterization of Stem Rust Resistance Gene Sr22 13 14 Figure 1a-b. Genetic linkage of U5615 and U5616 F 2:3 populations 15 segregating for stem rust resistance from Sr22 on wheat chromosome 7AL…105 16 17 Figure 2a-c. Genetic linkage of F3:4 populations derived from recombinant F2 18 individuals in the U5615 and U5616 populations………………………………106 19 20 Figure 3. Genetic linkage map of SSR loci linked to Sr22 and segregating in 21 F3:4 populations U5615-72 and U5615-98……………………………………107 22 23 Figure 4. Physical map of SSR loci linked to Sr22 on the long arm of 24 chromosome 7A…………………………………………………………….…..108 25 26 Figure 5. Physical maps of the long arm of chromosome 7A showing Triticum 27 boeoticum chromatin in recombinants identified from 28 2174/Sr22Tb (U5615) and Lakin/Sr22Tb (U5616) F2:3 and F3:4 29 populations…………………………………………………………………..…109 30

vii

Chapter 1 1 Literature Review 2

Importance of Wheat Cultivation to Humans 1

Significance of Wheat 3

The hunter-gatherer behavior of early societies began to change near the end of 4 the Pleistocene era due to several factors including climate change, availability of game 5 resources and increasing population densities (Diamond, 2002). With larger populations, 6 the more accessible and available foods including fruits and large game became more 7 scarce, leading to a selection of foods requiring more processing like grinding or 8 leaching. Cereals were ideal for this purpose and underwent selection and domestication 9 as population densities increased and the cultivation of cereals became a means of 10 providing a stable, surplus of food resources. 11

The domestication of cereal crop species including barley, rye and wheat was a 12 principal step in the formation of modern agrarian societies. The sowing of grasses 13 allowed for the production of an annual supply of food in one location instead of 14 migrating seasonally to sources of food or continuously hunting and gathering. Wild 15 wheat relatives were abundant in Mesopotamia. Population densities rose beyond the 16 capacity of the native species leading to migrations into more marginal areas less suited 17 for wheat relatives resulting in active cultivation of cereals and the advent of agriculture 18

(Binford, 1968). 19

Larger groups of individuals could congregate in a single location, and as food 1 availability became more secure, individuals within groups were allowed freedom for 2 activities other than food acquisition. Specialized trades and development of new 3 technologies became possible, as individuals were not constrained to the immediate 4 necessity of finding food. The complexity of groups and specialization of trades within 5 groups increased with a sedentary lifestyle and the availability of a stable food supply 6

(Bender, 1978). 7

Climate changes, which led to the migration of groups from more arid regions, 8 resulted in a wider dispersal of cereals. Wheat is a robust cereal which can be grown in 9 environments experiencing abiotic and biotic stresses. Wheat is a broadly adaptable crop 10 that can be grown in environments unsuitable for some other staple crops. It can be 11 produced in arid and semi-arid regions which experience little annual rainfall and high 12 winds, such as Kazakhstan, where nearly 12 million hectares of wheat are now grown 13

(Meng, 2000). Wheat underwent selection for adaptation to many environments as 14 migrations continued. 15

Wheat is a major staple food crop in modern societies, providing 20% of the 16 caloric intake globally (Porter et al., 2007). The wide adaptation of wheat permits its 17 cultivation from the equator to 60°N and 44°S and at elevations from sea level to 3000 m 18 and greater. The leading wheat producing nations are China, India, and the United 19

States, annually produce 100, 70 and 64 million tons, respectively. Globally, an average 20

of 600 million tons of wheat are produced annually, a large part of which is from 1 developing countries. In 2008, 671 million tons were produced globally (Vocke and 2

Alan, 2008). Only 10% of wheat produced is exported, with developing counties 3 consuming most exports (Aquino et al. 2002). Increasing modernization and 4 industrialization on a global scale has changed the diets of developing countries, leading 5 to increased consumption of grains and an increased global demand (Brown, 2004). 6

Wheat Evolution and Cytogenetics 8

Origins of modern wheat 10

Cultivated wheat, Triticum aestivum L., is an allohexaploid species (2n = 6x = 42) 11 derived from the union of three separate diploid genomes composed of a base 12 chromosome number of seven. The Triticum genus is assembled into three major 13 taxonomic groups: einkorn, emmer or durum wheat, and modern common wheat, based 14 on chromosome number. Einkorn wheats are diploid (2n = 2x = 14), emmer wheat is 15 tetraploid (2n = 4x = 28) and modern common wheat is hexaploid (2n = 6x = 42) 16

(Bonjean, 2001). 17

The three separate genomes of common wheat were derived from distinct 18 ancestral species which diverged from a common progenitor 2.5 to 4.5 million years ago 19

(Huang et al, 2002). The A genome of modern wheat is derived from the diploid species 20

Triticum urartu Thum. ex. Gandil with the AA genomic constitution. The original 1 hybridization event leading to tetraploid wheat combined the A genome of T. urartu with 2 another species closely related to the modern Aegilops speltoides Taush. (BB), resulting 3 in a fertile tetraploid (AABB). The specific donor of the B genome has not been 4 identified due the extinction of the original donor or the possibility of multiple 5 hybridization events (Schneider et al. 2008). The resulting wild tetraploid species, 6

Triticum turgidum L. ssp. dicoccoides (Körn. ex Aschers. & Graebn.) Thell. was 7 subsequently domesticated to become emmer wheat of the species Triticum turgidum L. 8 ssp. diccoccum Schrank ex Schübler. The tetraploid possessed the genomic resources of 9 both diploid ancestors and therefore exhibited greater vigor, and was more adaptable to a 10 broader array of environments than the original diploid progenitors. These traits allowed 11 emmer wheat to be grown across the climates of the Mediterranean as human populations 12 spread beyond Mesopotamia (Zohary and Hopf, 1993). 13

A second hybridization event occurred ~7000 years ago that led to the 14 development of modern bread wheat (Zohary and Hopf, 1993). The cultivation of T. 15 turgium northward out of the Mesopotamia brought emmer wheat into contact with the D 16 genome donor, Aegilops taushii Boiss., with the genomic constitution of DD. The 17 hybridization event leading to modern hexaploid wheat was between the tetraploid 18 emmer wheat (AABB) and the diploid Ae. taushii (DD). The resulting hybrid was the 19 progenitor of modern hexaploid bread wheat with the genomic constitution AABBDD. 20

Under normal reproductive conditions involving two haploid gametes from the 1 the tetraploid parent and the diploid parent, the resulting triploid progeny would be 2 sterile. Two conditions exist in which viable progeny are possible from the hybridization 3 of the tetraploid and diploid. One is the possibility the union of 2n gametes from both 4 parents. A 2n gamete that is AABB could be fertilized by a 2n DD gamete to form the 5 tetraploid. The reciprocal cross is possible but less likely due to the potential genetic 6 benefits of AABB maternal cytoplasm. Another possibility is the self fertilization of 7 unreduced gametes in pollen and egg of the triploid progeny of the union of AB and D 8 gametes. Both pollen and egg would be ABD resulting in an AABBDD diploid 9 individual. An additional possibility is the somatic doubling of chromosomes in the 10 triploid resulting from the union of the AB and D haploid gametes. If a mitotic mis- 11 division took place early in embryo development, or in meristematic tissue giving rise to 12 gametic cells, and the diploid chromosomes were doubled, the result would be an 13

AABBDD cell that would give rise through meiosis to gametes with even chromosome 14 numbers that would produce fertile AABBDD progeny. 15

The introgression of the D-genome conferred multiple beneficial traits to 16 hexaploid wheat. Ae. tauschii was adapted to the more continental climate of central 17

Asia expanded the geographical adaptation of hexaploid wheat beyond that of tetraploid 18 wheat (Zohary and Hopf, 1993). The D-genome carries alleles for friabilin proteins 19 including purodiniline-a and purodiniline-b that increase the softness of grain endosperm 20

and glutenin proteins that trap CO2 during yeast fermentation. The combination of these 1 traits made hexaploid wheat suitable for the baking of leavened bread (Chantret et al., 2

2005). Factors including improved geographical adaptation and improved end use 3 characteristics have allowed for the modern wide scale cultivation of hexaploid wheat. 4

Allopolyploidy 6

Major genomic changes took place during the course of polyploidization 7 involving genetic and epigenetic changes. Structural, genetic alterations occurred to 8 genomic DNA sequences and chromosome structure. These structural alterations led to 9 functional, epigenetic changes in gene expression (Levy and Feldman, 2004). 10

Regions of duplicated function underwent large scale deletion. Feldman et al. 11

(1997) and Liu et al. (1997) identified homologous sequences present in diploid wheat 12 relatives that are present in only a single genome of tetraploid or hexaploid wheat, 13 suggesting deletion of some duplicated sequences upon polyploidization. 14

The formation of tetraploid wheat was also accompanied by translocation events. 15

In the A genome diploid ancestor or early in the tetraploid ancestor, chromosomes 4AL 16 and 5AL exchanged terminal segments. In a later translocation in the tetraploid genome 17 a segment of 5AL present on 4AL was exchanged with a terminal segment of 7BS, 18 leaving behind an interstitial 5AL segment on 4AL (Naranjo, 1990). 19

Genome-wide methlyation patterns influence gene expression and gene silencing. 1

Studies of methylation patterns of cysteine residues indicated changes in methylation 2 status at 13% of genomic loci analyzed through methylation or demethylation (Shaked et 3 al., 2001). Kakush et al. (2002) observed novel gene expression between diploid parents 4 and synthetic allotetraploid progeny, with 48 observed transcripts present in the diploid 5 parents and absent in the allotetraploid. In the tetraploid, 12 transcripts were present that 6 were absent in the diploids. The silencing was associated in part, but not completely, 7 with methylation. 8

The Use of Wheat Relatives in Breeding for Disease Resistance 10

Wheat germlplasm resources 12

Gerplasm resources available for trait introgression include a wide array of 13 species within Poaceae with a base chromosome number of seven including the several 14 hundred genera within the Triticeae. The genepool available for trait introgression 15 include the species itself, T. aestivum, related species with which T. aestium can be 16 crossed readily to produce fertile offspring, and species to which wide crosses can be 17 made but require special techniques such as embryo rescue to obtain progeny. These 18 resources comprise the primary, secondary and tertiary gene pools, respectively (Harlan, 19

1975). 20

The genomes of wheat progenitor species are a reservoir of valuable alleles that 1 may be introgressed into modern cultivated wheat. Multiple traits have been introgressed 2 including stress tolerance and robustness, drought tolerace (rye translocations) (Villareal, 3

1990), grain quality (Pina, Pinb) (Bonafede et al., 2007), seed storage proteins (high 4 molecular weight glutenins, Payne et al., 1982), and disease resistance. As abiotic and 5 biotic stresses present in wheat growing regions change, the diversity of genetic resources 6 in the primary gene pool of T. aestivum can be improved with alleles for the traits of 7 interest from secondary and tertiary germplasm. 8

Introgression Methods 10

Ph1 Mutants 11

The Ph1 gene present on chromosome 5BL is the principal factor responsible for 12 the diploid meiotic behavior of hexaploid wheat. Under normal meiotic conditions in the 13 presence of the Ph1 gene, homoeologous chromosomes do not readily form chiasmata or 14 undergo recombination events (Riley &Chapman 1958, Sears 1977). A mutant stock of 15 the cultivar Chinese Spring designated ph1b has a 70 Mb deletion in the region of 5BL 16 carrying the Ph1 gene (Gill and Gill, 1991), in which pairing of homoeologous 17 chromosomes is evidenced by the formation of trivalents and higher order associations 18

(Riley, 1960). Another deletion of Ph1 exists as ph1c mutants of tetraploid T . turgidum 19

(Giorgi, 1978). An epistatic inhibitor of Ph1 exists known as PhI from Ae. speltoides 20

(Riley et al. 1968). The inhibition of Ph1 effects allows for homoeologous 1 recombination, which is a desireable method of alien chromosome integration, due to the 2 compensating effects of the resulting recombinants where wheat chromatin is replaced by 3 alien chromatin. 4

The technique of Ph1 inhibition has been used to introgress multiple disease 5 resistance genes and agronomic traits into T. aestivum germplasm. Zhang et al. (2005) 6 were able to separate the leaf rust seedling resistance gene Lr19 from the yellow pigment 7 gene Y present on chromosome 7E from the Lohopyrum ponticum (Podp.) using ph1b 8 mutants. Kuraparthy et al. (2007) used a PhI stock to minimize Ae. geniculata chromatin 9 from chromosome 5D to less than 5% of the chromosome arm. Lukaszewski (2000) used 10 ph1b mutants to develop recombinant 1RS∙1BL rye chromosomes that do not carry the 11

Sec-1 locus, thereby ameliorating the negative effects of the 1RS rye chromosome on 12 bread-baking quality. Bonafede et al. (2007) used the ph1b mutant to reduce the alien 13 chromatin of chromosome 5A introgressed from T. monococcum containing the Ha locus 14 which carries alleles for grain softness, including the Pina-Am1, Pinb-Am1, and GSP- Am1. 15

Gametocidal Genes 17

Random breakage and reformation of chromosomal segments can be induced with 18 the gametocidal genes (Gc) from Aegilops species (Masoudi-Nejad et al. 2002). 19

Chromosomes carrying Gc genes were first isolated in the production of Aegilops 20

substitution and addition lines, in which certain chromosomes were maintained during 1 backcrossing between Aegilops species and T. aestivum (Maan, 1975). Chromosomes 2 carrying Gc genes ensure their transmission by causing chromosomal breakage in 3 gametes not carrying the Gc genes. Their activity can range from complete lethality to 4 semi-lethality (Endo, 1990). The female gametes with chromosomal breakage can be 5 fertilized to produce offspring with chromosome aberrations that are stabilized in 6 subsequent generations (Endo, 1988). 7

Gametocidal chromosomes are derived from three diploid genomes, C, S, or M, 8 and are in homoeologous groups 2, 3, or 4 (Endo, 2007). The chromosomal aberrations 9 caused by Gc chromosomes can be highly beneficial as research tools. Deletion stocks 10 have been created for physical mapping of chromosomes allowing for approximations of 11 genes of interest (Endo and Gill, 1996). Further, the disruption of chromosomes allows 12 for breakage and fusion necessary to break up large linkage blocks of introgressed alien 13 chromatin carrying disease resistance genes. Masoudi-Nejad et al. (2002) used a Gc 14 system to recover 1RS chromosomes possessing reduced rye chromatin while 15 maintaining the locus carrying Sr31, Yr9, and Lr26. 16

Radiation 18

A physical method of disrupting chromosome segements is the use of ionizing 19 radiation (Sears, 1957). Wheat lines monosomic for alien addition chromosomes can be 20

irradiated inducing chromosomal breakage and fusion. Radiation frequently induces 1 reciprocal translocation between the alien chromosome and the wheat chromosome 2

(Badaeva et al., 2007). By inducing breakage of the alien chromosome and fusion of a 3 segment carrying the alleles of interest with a broken wheat chromosome, a reduction in 4 alien chromatin can be achieved. Sears (1956) achieved a successful transfer of leaf rust 5 resistance from Aegilops umbellata using ionizing radiation. Sears (1972) also produced 6 lines carrying Sr24/Lr24 from the 3D/3Ae#1 translocation from Agropyron elongatum. 7

The Sr24/Lr24 translocation has been one of the most widely deployed translocations 8 developed by ionizing radiation. 9

The Stem Rust Pathogen 11

Historical Impact 13

Wheat stem rust caused by the fungus Puccinia graminis f. sp. tritici has been a 14 threat to wheat production and food security for as long as wheat has been cultivated by 15 human agrarian societies. Passages from the bible refer to rusts, and smut epidemics as 16 punishments on the Israelites from God for their sins (Chester, 1946). The festival of 17

Robigalia was celebrated annually by the Romans around 700 A.D. to pacify the rust 18 gods and protect the wheat crop from rust (Chester, 1946; Peterson, 2001). 19

Major stem rust epidemics have occurred in all of the major wheat producing 1 countries. China experienced epidemics in 1948, 1951, 1952, and 1956 due to higher 2 than average temperatures and rainfall which led to ideal conditions for infection (Roelfs, 3

1977). 4

In the United States stem rust has affected primarily the spring wheat growing region. 5

One of the worst recent stem rust epidemics in the United States occurred in 1935 when 6

50% of the crop in Minnesota and North Dakota was lost to stem rust (Leonard, 2001). 7

Life Cycle 9

Puccinia graminis f. sp. tritici is a heteroecious fungus that requires two hosts, a 10 primary host and an alternate host to complete its life cycle. The life cycle consists of 11 multiple spore stages involving both monokaryotic and dikaryotic nuclear conditions. 12

The primary host of Pgt is T. aestivum and the alternate hosts are of the genus Berberis, 13 primarily common barberry (Berberis vulgaris). The sexual stage of the life cycle takes 14 place on the alternate host and asexual reproduction takes place on the primary host 15

(Leonard and Szabo, 2005). 16

Teliospores overwintering on infected straw germinate annually in conjunction 17 with the development of new growth of leaves of the barberry host (Roelfs, 1985). Each 18 teliospore consists of two cells each containing two haploid nuclei that undergo 19 karyogamy early in teliospore development. After karyogamy, meiosis begins but is 20

arrested in diplonema during dormancy (Boehm et al., 1992). Both cells germinate to 1 produce a basidum to which the four haploid nuclei migrate upon completion of meiosis. 2

Within the basidum, the four nuclei are separated by three transverse septa. From each 3 basidum a sterigma elongates, through which the haploid nuclei migrate into the 4 developing basidiospore as it forms at the tip of the sterigma (Roelfs, 1985). In the 5 basidiospore the haploid nuclei undergo mitosis to produce two identical haploid nuclei. 6

Basidiospores are ejected and carried by air currents to the barberry host, on 7 which they infect younger leaves. The structure produced from infection is a flask 8 shaped pycnia on the adaxial leaf surface. Two gametic cells of the pycnia are involved 9 in sexual recombination between the + and – mating types. The male gametes are the 10 pycniospores which are extruded from the pycnium in a drop of nectar, making them 11 available for dissemination among pycnia by insects and rain. The female gametes are 12 flexuous hyphae that extend out of the top of the pycnium. The contact of a pycniospore 13 with the nectar of an opposite mating type induces the formation of a pyncial cap of the 14 pycniospore (Anikster, 1999). When the pycniospore contacts a flexuous hypha, fusion 15 of the cells occurs and the haploid nucleus migrates through flexuous hypha , then 16 through the monokaryotic hyphae to the cells at the base of the pycnium (Johnson and 17

Newton, 1946). The dikaryotic state is established with the division and subsequent 18 union of + and – gametes. The result of this union is the production of a dikaryotic 19 aecium directly under the pycnium which eventually ruptures the abaxial leaf surface 20

through which chains of dikaryotic aeciospores are produced which are capable of 1 infecting the wheat host (Roelfs, 1985). 2

Aeciospores infecting the wheat host produce a dense mat of hyphae below the 3 host epidermis. From these, hyphae sporophores emerge to produce dikaryotic 4 urediniospores, leading to the formation of the visible infection structure known as the 5 uredinium. Infections generally take place on the stems and leaf sheaths of the wheat 6 host. Urediniospores then re-infect wheat hosts, causing secondary infections on the 7 same plants or primary infections on other plants. As wheat host plants begin to senesce, 8 the uredinia cease uredinospore production and produce teliospores. From then on, the 9 infection structure is called a telium (Cummins and Hiratsuka, 2003). 10

The uredial stage is able to persist throughout the year on susceptible wheat 11 varieties beginning on winter wheat in the southern Great Plains moving to winter wheat 12 of the northern Great Plains and on into spring wheat of the upper Midwest. With the 13 eradication of the alternate hose, barberry (Berberis vulgaris L.), urediniospores and not 14 aeciospores have become the source of primary inoculum in the United States. Uredinia 15 that persist on winter wheat grown in Texas and Gulf Coast states produce the 16 urediniospores that act as the primary inoculum. These are carried via air currents 17 northward and eastward on what is known as the Puccina pathway to spring wheat 18 growing regions (Stakman and Lambert, 1928). 19

Infection Process 1

The infection process of the uredinial stage begins with the landing of a 2 urediniospore on a stem or leaf surface. Spore germination takes place if it is in contact 3 with a film of water. The germinating urediniospore produces a germ tube which extends 4 its growth perpendicular to the long axis of epidermal cells of the stem or leaf, thereby 5 orienting itself towards the parallel rows of stomata. 6

Migration of the germ tube takes place until a stomate is reached and appressoria 7 formation is induced. Chemical and physical stimuli are inducers of appressoria 8 formation (Read et al. 1997; Collins et al. 2001). When the specific spacing of the 9 intercellular junctions of epidermal cells adjacent to stomata is encountered by the germ 10 tube, the induction of an appressoria above the stomatal opening is induced (Read et al. 11

1997). Other chemical factors may be involved in the signaling of appressoria formation 12 including the leaf alcohols cis-3-hexen-1-ol and trans-2-hexen-1-ol (Collins et al. 2001). 13

The two nuclei of the uredeniospore migrate from the germ tube to the 14 appressorium, where they undergo mitosis and are subsequently separated from the germ 15 tube by a septum. The appressoria forces a penetration peg through the stomata and an 16 elongate substomatal vesicle develops. Another round of mitosis takes place producing a 17 hypha from one of the substomatal vesicle. A pair of nuclei then migrate into the 18 developing infection hypha. Upon contact with a host cell, the infection hypha develops 19 a haustorial mother cell that becomes separated by a septum. The haustorial mother cell, 20

which contains two to four nuclei, enzymatically degrades the cell wall and causes an 1 invagination of the host cell membrance. Within the periplasmic space of the host cell, 2 the haustorium enlarges. It is through haustoria that fungal hyphae are able to extract 3 nutrients from host cells (Chong, 1985). 4

Physiologic Races 6

Within the classification of formae specialis of Pgt exists further subdivision of 7 the pathogen at the level of physiologic race. The differentiation of races of Pgt follow 8 observations based on the gene for gene concept of H.H. Flor, in which the resistance 9 gene in the host recognizes an avirulence target in the pathogen (Flor, 1955). The 10 development of virulence occurs when the avirulence target is modified so as to become 11 undetectable by the cognate recognition factor in the host. 12

The designation of races within Pgt is dertermined by specificities of avirulence 13 and virulence to a defined set of stem rust resistance genes present in a differential set of 14 host cultivars (Roelfs, 1988). The differential set consists of cultivars possessing single 15 dominant stem rust resistance genes to which the avirulence and virulence of a stem rust 16 isolate determines the race classification. 17

In the current nomenclature system, the presence of a high or low infection type 18

(IT) is determined for a race to four sets of genes consisting of four genes each. A letter 19 is assigned for the IT of a race to the genes in each set. In this way a race is designated 20

by its specific avirulence/virulence profile. A new race of Pgt can be designated upon the 1 development of a novel virulence/avirulence profile. The development of a new race of 2

Pgt in Eastern Africa and the subsequent development of novel virulences in subsequent 3 races derived from the race designated as TTKS has prompted a proposal to add a fifth 4 set of genes to the current nomenclature system (Jin and Szabo, 2008). 5

Population Genetics and Evolution 7

The deployment of single genes for resistance can lead to profound changes in the 8 population structure of Pgt populations. The large scale cultivation of wheat lines 9 carrying single genes for resistance deployed on a large scale places tremendous 10 directional selection pressure on stem rust pathogen populations towards the 11 predominance of pathotypes virulent to the resistance gene (Van der Plank, 1968). 12

The large scale deployment of a highly efficacious single gene effective against a 13 large fraction of the pathogen population and the subsequent evolution of the pathogen 14 population towards virulence is known as the ‘boom and bust’ cycle (Sun and Yang, 15

1999). The inefficacy of the resistance gene is not due to changes in the gene itself but to 16 the proliferation of mutants in the pathogen population with an aberrant avirulence gene. 17

These individuals are able to proliferate on hosts carrying the cognate resistance gene for 18 the avirulence gene that was mutated. The aberrant pathogens come to predominate the 19

population, as they are the only individuals able to proliferate on the widely deployed 1 host carrying the defeated gene. 2

With the near eradication of barberry in the United States, the opportunity for 3 sexual reproduction by Pgt has been greatly minimized. Without the opportunity for 4 sexual union of mating types and recombination during meiosis, most common genotypes 5 of Pgt have adapted to strictly asexual reproduction (Zambino et al. 2000). In this 6 adaptation they have lost the ability to produce teliospores and induce recombination 7 through meiosis. Sexual recombination is no longer a principal source of genetic 8 variation in Pgt populations in US populations. In asexual reproduction, the main source 9 of variation is mutation (McDonald and Linde, 2002). From Pgt isolates collected in 10

Minnesota, the greatest diversity of races in aeciospores and urediniospores were from 11 times prior to Barberry eradication (Peterson et al., 2005). 12

New Highly Virulent Pgt Race 14

A race of Pgt emerged in Uganda in 1998 which was identified in 1999 as the 15 only global race to possess virulence to Sr31 (Pretorius, 2000) present on the 1BL∙1RS 16 translocation derived from ‘Petkus’ rye (Secale cereale L.) (Zeller, 1983). This 17 translocation is the source of stem rust resistance in approximately 30% of the advanced 18 lines from CIMMYT (Singh, 2008). The race originally called Ug99 was designated as 19

TTKS (Wanyera et al. 2006) based on the North American nomenclature system (Roelfs, 20

1988). This designation indicates the race elicits a high IT to all genes in the first two 1 sets, a low IT to Sr36 in the third set and SrTmp in the fourth set. The original race 2

TTKS has now been designated TTKSK based on the addition of a fifth set of 3 differentials (Jin and Szabo, 2008). This new race combines Sr31 virulence with 4 virulence to the majority of T. aestivum derived stem rust resistance genes (designated 5

“Sr”genes). Since its identification, new variants with additional virulence, such as 6 virulence to Sr24 (Jin et al. 2008) have been identified in Kenya. TTKS is now divided 7 into two races, TTKSK and TTKST with avirulence and virulence to Sr24, respectively 8

(Jin et al. 2008). The expanded virulence adaptation of race TTKS further increased the 9 genetic vulnerability of wheat. 10

This virulence to Sr31 in concert with virulence to most genes derived from T. 11 aestivum and virulence to Sr38 present on a translocation from T. ventricosum is unique. 12

The development of Sr24 virulence indicates the potential for the TTKS lineage to 13 develop more complex virulence as the population size increases and additional selection 14 pressures are presented in the form of resistant varieties (Singh, 2008). 15

The highlands of East Africa are ideal for the development of new races of rust 16

(Saari and Prescott, 1985). The year round cultivation of susceptible wheat varieties 17 under ideal conditions that promote disease development will hasten the spread of TTKS 18 and its variants. Emergence of the virulent strains of Pgt from the East African countries 19 has followed a step wise range expansion further north to Sudan and across the Arabian 20

peninsula to Yemen and as far east as Iran. This is the same path observed for the Yr9- 1 virulent race of stripe rust (Puccinia striiformis Westend f.sp. striiformis) that originated 2 in the East African highlands and migrated across the Middle East through West Asia to 3

East Asia (Singh, 2004). The movement of TTKS into Yemen is of particular concern, as 4 seasonal airborne trajectories present in the country regularly favor a north-easterly 5 movement of inoculum. A buildup of urediniospores in Yemen will provide a continuous 6 source of inoculum (Singh, 2008). 7

International attention and support for the development of resistant cultivars is 8 needed as TTKS may reach global dispersal due to its unique virulence to multiple 9 known and unknown resistance genes (Singh, 2006). The majority of current cultivars 10 grown on 90% or more of the acreage in the migration path are susceptible to TTKS 11

(Singh, 2006). Approximately 1 billion people reside in the predicted path of TTKS. 12

Many of the people present in this region are in countries that consume all the wheat 13 produced within their borders. World stocks of wheat are at record lows due to poor 14 harvest in the largest producing countries and higher consumption in countries 15 undergoing industrialization (Brown, 2004). These scenarios and the potential for TTKS 16 to cause widespread losses of wheat yields provide the conditions for great social unrest 17 and personal hardship. 18

Stem Rust Resistance 1

Sr and Avr gene interaction 3

Resistance to Pgt is conferred by genes that interact with pathogen virulence 4 genes in a gene-for-gene manner (Flor, 1955). It is in this relationship a particular stem 5 rust resistance gene present in the host is cognate to an avirulence gene in the stem rust 6 pathogen. Several hypotheses regarding the physical interaction between resistance gene 7 products and avirulence gene products (Jones and Dangl, 2006). In a recptor ligand 8 relationship, the pathogen effector molecule (avirulece gene product) interacts directly 9 with the host recognition protein (resistance gene product) (Martin et al. 2003). Another 10 well supported model is the guard hypothesis, in which the host resistance protein 11 recognizes the perturbation of another host factor by the pathogen effector (Bent and 12

Mackey, 2007). In this model the host resistance protein detects the avirulence protein 13 indirectly. It is by these relationships that a mutation in an avirulence gene leads to 14 virulence in the pathogen due to the subsequent inability of the resistance gene product to 15 detect the presence of the avr gene product and induce a defense response. 16

Stem Rust Resistance Genes 18

Stem rust resistance genes have been derived from T. aestivum itself, members of 19 the Tritucum genus, Thinopyron genus and Secale cereale. At present, 46 Sr genes have 20

been designated, with three gene loci having multiple alleles (McIntosh et al. 1995) and 1 other stem rust resistance genes exist with temporary designation status. 2

Several of the genes derived from wild relatives present on Robertsonian 3 translocations or small chromosomal introgression segments have been relied upon in 4 breeding programs and have been deployed commercially including Sr24, 25, 31, 36 ,38, 5 and Sr1RAmigo. Many undeployed stem rust resistance genes are present on introgression 6 segments comprising large segments or entire chromosomes. These large introgressions 7 carrying substantial amounts of alien chromatin are associated with high levels of linkage 8 drag and decreased agronomic performance. Examples of these introgressions include 9

Sr32, Sr39 and Sr40 (Singh, 2008). 10

The majority of Sr genes confer seedling resistance, which is effective in both 11 seedlings and adult plants to varying degrees. Seedling resistance genes confer a range of 12 resistance phenotypes. Several genes confer complete hypersensitive immunity 13 evidenced by the absence of any symptoms of infection or minute hypersensitive 14 flecking. Examples of genes conferring a hypersensitive phenotype include Sr5, 17, 27, 15 and 36 (Singh, 2008). 16

Several genes confer an adult plant resistance that does not entirely prevent 17 infection by Pgt but slows the development of symptoms, so as to maintain normal plant 18 function through maturity. One of the most widely utilized adult plant resistance genes is 19

Sr2 (McFadden, 1930). The gene is most effective in concert with up to five other genes 20

with small effects comprising the “Sr2-Complex” (McIntosh, 1988). Resistance from Sr2 1 in the cultivar “Hope” and other emmer-derived resistance in the cultivar “Thatcher” 2 provided a foundation for stem rust resistance in spring wheat germplasm of the United 3

States and widely adapted lines developed by Dr. N. E. Borlaug (Hare and McIntosh, 4

1979). 5

Resistance to Ug99 7

The unique virulence profile of Ug99 (Pgt race TTKSK and derivatives) makes it 8 a tremendous threat to wheat production worldwide. For many years Sr31 provided 9 seemingly durable resistance globally but inevitably selection pressures led to the 10 development of virulence in Ug99. Developing lines with adequate and durable 11 resistance to Ug99 has presented unique and challenging problem to wheat scientists 12 worldwide with the majority of genes conferring resistance coming from wild relatives. 13

Many of the effective resistance genes are present on large translocations and are 14 associated with linkage drag. 15

Field evaluations in Kenya and greenhouse evaluations at the USDA Cereal 16

Disease Lab have elucidated Sr genes effective against Ug99 (Jin et al. 2007). These 17 include Sr13, 22, 24, 25, 26, 27, 28, 32, 33, 35, 36, 37, 39, 40, 44, Sr Tmp, and Tt-3 and 18

Sr1RSAmigo on the T1RS.1AL translocation (Jin et al., 2007). Of these effective resistance 19

genes, Sr24, Sr26, Sr36 and Sr1RSAmigo have been deployed in wheat cultivars in some 1 countries. 2

Virulence exists in other races endemic to particular growing regions of the world 3 to seven of the Sr genes effective against Ug99, including SrTmp, 13, 36, 24, 27, 29 and 4

Sr1RSAmigo (Singh et al., 2008). Virulence to the remaining effective genes does not exist 5 for several reasons. Some have proven durable over time despite deployment singly over 6 large acreages. More commonly, many Sr genes including Sr32, 37, 39, 40 and 44, have 7 not been deployed in modern cultivars due to their presence on large alien translocations 8 that have deleterious effects on important agronomic characteristics. 9

Development of Resistant Germplasm 11

Reducing the amount of alien chromatin associated with undeployed Sr genes 12 effective against Ug99 is necessary to ensure lines carrying the genes are able to meet the 13 needed annual increase in yields to meet growing demands. One example of yield 14 depression due to alien chromatin is in CIMMYT attempts to introgress Lr35 linked to 15

Sr39, resulting in a 15-20% yield detriment (Singh, unpublished data). In the original 16 release of germplasm carrying Sr26, a 10% yield penalty was associated with the gene 17 located on a Thinopyron elongatum translocation segment on chromosome 6DL (Friebe 18 et al., 1994). 19

Methods involved in the introgression of alien chromosome segments can be 1 employed in reducing the size of alien chromosome segments carrying resistance to 2

Ug99. Homoeologous recombination between alien chromosome segments and wheat 3 chromosomes can be induced using ph1b and PhI lines to generate critical recombinants, 4 followed by subsequent backcrosses to recover the majority of the recurrent parent 5 genome (Qi et al., 2007). 6

Diagnostic molecular markers linked to effective resistance genes are available 7 for Sr24, Sr26, Sr36 and Sr1RSAmigo, each of which was transferred to wheat from non- 8 homologuous or partially homologous genomes (Saal and Wricke, 1999; Mago et al., 9

2004; Tsilo et al., 2008). The ability to detect the presence of specific stem rust resistance 10 genes using molecular markers presents a viable method for identifying resistance to 11

TTKS in the absence of the pathogen itself. Markers will also facilitate the identification 12 of recombinant lines carrying reduced translocation segments. 13

Benefits of durability of resistance can be realized from the pyramiding of Sr 14 genes effective against TTKS. The hypothesis of the efficacy of resistance gene 15 pyramids is based on the low probability of a pathogen developing virulence to two or 16 more genes simultaneously. Multiple mutations to virulence must also not be 17 accompanied by any significant reduction in pathogen fitness (Ayliffe et al., 2008). 18

Subsequent reductions in fitness due to the development of virulence to a resistance gene 19

can potentially lead to residual effects of pyramiding defeated Sr genes (Ahmed et al., 1

1997; Kousik and Richie, 1998). 2

Several of the difficulties of developing lines with resistance to TTKS can be 3 circumvented with the use of molecular markers. Marker loci linked to effective Sr genes 4 can be used for selection in breeding populations. Screening for resistance genes with a 5 molecular assay allows for the screening of greater numbers in less time than using 6 phenotypic greenhouse assays or field evaluations. Molecular markers can aide in the 7 identification of lines currently carrying resistance to Ug99 and will be useful in the 8 future development of resistant cultivars. 9

Pyramiding multiple Sr genes in a single line utilizing specific 10 avirulence/virulence specificities of Pgt isolates can be complicated and time consuming 11 and nearly impossible for undeployed genes to which no virulence exists. The 12 pyramiding of multiple resistance genes in a single line becomes possible using 13 molecular markers by selecting for loci linked to the genes of interest. Pyramiding 14 multiple genes in linkage blocks in coupling phase becomes possible with sufficient 15 population sizes and the identification of critical recombinants. With the improved 16 capability of deploying resistance gene pyramids, the durability of resistance to Ug99 17 will be greatly enhanced. 18

References 1

Ahmed H.U., Finckh M.R., Alfonso R.F., Mundt C.C. (1997) Epidemiological effect of 2

gene deployment strategies on bacterial blight of rice. Phytopathology 87:66-70. 3

Anikster Y., Eilam T., Mittelman L., Szabo L.J., Bushnell W.R. (1999) Pycnial nectar of 5

rust fungi induces cap formation on pycniospores of opposite mating type. 6

Mycologia 91:858-870. 7

Ayliffe M., Singh R., Lagudah E. (2008) Durable resistance to wheat stem rust needed. 9

Current Opinion in Plant Biology 11:187-192. 10

Aquino P., Carrion, F., and Calvo, R. (2002) Selected wheat statistics. In “CIMMYT 12

2000-2001 World Wheat Overview and Outlook: Developing No-Till Packages 13

for Small Scale Farmers” (J.Ekboir, ed.) pp. 52-56. CIMMYT, Mexico D.F. 14

Badaeva E.D., Dedkova O.S., Gay G., Pukhalskyi V.A., Zelenin A.V., Bernard S., 16

Bernard M. (2007) Chromosomal rearrangements in wheat: their types and 17

distribution. Genome 50:907-926. 18

Bender, B. (1978) Gatherer-Hunter to Farmer: A Social Perspective. World Archaeology 20

10:204-222. 1

Bent A.F., Mackey D. (2007) Elicitors, effectors, and R genes: The new paradigm and a 3

lifetime supply of questions. Annual Review of Phytopathology 45:399-436. 4

Binford L.R. (1968) Post-Pleistocene Adaptations. In New Perspectives in Archaeology 6

(Binford S.R. and Binford L.R., eds.) pp. 313-341. Aldine, Chicago. 7

Boehm E.W.A., Wenstrom J.C., McLaughlin D.J., Szabo L.J., Roelfs A.P., Bushnell 9

W.R. (1992) An ultrastructural pachytene karyotype for Puccinia graminis fsp. 10

tritici. Canadian Journal of Botany-Revue Canadienne De Botanique 70:401-413. 11

Bonafede M., Kong L.R., Tranquilli G., Ohm H., Dubcovsky J. (2007) Reduction of a 13

Triticum monococcum chromosome segment carrying the softness genes Pina and 14

Pinb translocated to bread wheat. Crop Science 47:821-828. 15

Bonjean A.P., Angus W.J. (2001) The world wheat book: a history of wheat breeding 17

Intercept, London; Paris. 18

Brown L.R. (2004) Outgrowing the earth: the food security challenge in the age of falling 20

water tables and rising temperatures. Earth Policy Institute. W.W. Norton & Co., 1

New York. 2

Chantret N., Salse J., Sabot F., Rahman S., Bellec A., Laubin B., Dubois I., Dossat C., 4

Sourdille P., Joudrier P., Gautier M.F., Cattolico L., Beckert M., Aubourg S., 5

Weissenbach J., Caboche M., Bernard M., Leroy P., Chalhoub B. (2005) 6

Molecular basis of evolutionary events that shaped the hardness locus in diploid 7

and polyploid wheat species (Triticum and Aegilops). Plant Cell 17:1033-1045. 8

Chester K.S. (1946) The nature and prevention of the cereal rusts as exemplified in the 10

leaf rust of wheat Chronica Botanica Co., Waltham, Mass.,. 11

Chong J., Harder D.E., Rohringer R. (1985) Cytochemical studies on Puccinia graminis 13

fsp tritici in a compatible wheat host. 1. Walls of intercellular hyphal cells and 14

haustorium mother cells. Canadian Journal of Botany-Revue Canadienne De 15

Botanique 63:1713-1724. 16

Collins T.J., Moerschbacher B.M., Read N.D. (2001) Synergistic induction of wheat stem 18

rust appressoria by chemical and topographical signals. Physiological and 19

Molecular Plant Pathology 58:259-266. 20

Cummins G.B., Hiratsuka Y. (2003) Illustrated genera of rust fungi. 3rd ed. American 2

Phytopathological Society, St. Paul, Minn. 3

Diamond J. (2002) Evolution, consequences and future of plant and animal 5

domestication. Nature 418:700-707. 6

Endo T.R. (1988) Induction of chromosomal structural changes by a chromosome of 8

Aegilops cylindrical in common wheat. Journal of Heredity 79:366-370. 9

Endo T.R. (1990) Gametocidal chromosomes and their induction of chromosome 11

mutations in wheat. Japanese Journal of Genetics 65:135-152. 12

Endo T.R., Gill B.S. (1996) The deletion stocks of common wheat. Journal of Heredity. 14

87:295-307. 15

Endo T.R. (2007) The gametocidal chromosome as a tool for chromosome manipulation 17

in wheat. Chromosome Research 15:67-75. 18

Feldman M., Liu B., Segal G., Abbo S., Levy A.A., Vega J.M. (1997) Rapid elimination 20

of low-copy DNA sequences in polyploid wheat: A possible mechanism for 1

differentiation of homoeologous chromosomes. Genetics 147:1381-1387. 2

Flor H.H. (1955) Host-parasite interaction in flax rust - its genetics and other 4

implications. Phytopathology 45:680-685. 5

Friebe B., Jiang J., Knott D.R., Gill B.S. (1994) Compensation indexes of radiation 7

induced wheat agropyron-elongatum translocations conferring resistance to leaf 8

rust and stem rust. Crop Science 34:400-404. 9

Gill K.S., Gill B.S. (1991) A DNA fragment mapped within the submicroscopic deletion 11

of Ph1, a chromosome-pairing regulator gene in polyploid wheat. Genetics 12

129:257-259. 13

Giorgi, B. (1978) A homoeolgous pairing mutant isolated in Triticum 15

durum cv. Cappelli. Mutation Breeding News 11:4–5. 16

Hare R.A., McIntosh R.A. (1979) Genetic and cytogenetic studies of durable adult-plant 18

resistances in Hope and related cultivars to wheat rusts. Zeitschrift Fur 19

Pflanzenzuchtung-Journal of Plant Breeding 83:350-367. 20

Harlan J.R. (1975) Crops & man. American Society of Agronomy, Madison, Wis. 2

Huang S., Sirikhachornkit A., Su X.J., Faris J., Gill B., Haselkorn R., Gornicki P. (2002) 4

Genes encoding plastid acetyl-CoA carboxylase and 3-phosphoglycerate kinase of 5

the Triticum/Aegilops complex and the evolutionary history of polyploid wheat. 6

Proceedings of the National Academy of Sciences of the United States of America 7

99:8133-8138. 8

Jin Y., Szabo L.J., Pretorius Z.A., Singh R.P., Ward R., Fetch T. (2008) Detection of 10

virulence to resistance gene Sr24 within race TTKS of Puccinia graminis fsp. 11

tritici. Plant Disease 92:923-926. 12

Jin Y., Singh R.P., Ward R.W., Wanyera R., Kinyua M., Njau P., Pretorius Z.A. (2007) 14

Characterization of seedling infection types and adult plant infection responses of 15

monogenic Sr gene lines to race TTKS of Puccinia graminis fsp. tritici. Plant 16

Disease 91:1096-1099. 17

Johnson T., Newton M. (1946) Specialization, hybridization, and mutation in the cereal 19

rusts. Botanical Review 12:337-392. 20

Jones J.D.G., Dangl J.L. (2006) The plant immune system. Nature 444:323-329. 2

Kashkush K., Feldman M., Levy A.A. (2002) Gene loss, silencing and activation in a 4

newly synthesized wheat allotetraploid. Genetics 160:1651-1659. 5

Kashkush K., Feldman M., Levy A.A. (2003) Transcriptional activation of 7

retrotransposons alters the expression of adjacent genes in wheat. Nature Genetics 8

33:102-106 9

Kousik C.S., Ritchie D.E. (1999) Development of bacterial spot on near-isogenic lines of 11

bell pepper carrying gene pyramids composed of defeated major resistance genes. 12

Phytopathology 89:1066-1072. 13

Kuraparthy V., Chhuneja P., Dhaliwal H.S., Kaur S., Bowden R.L., Gill B.S. (2007) 15

Characterization and mapping of cryptic alien introgression from Aegilops 16

geniculata with new leaf rust and stripe rust resistance genes Lr57 and Yr40 in 17

wheat. Theoretical and Applied Genetics 114:1379-1389. 18

Leonard, K.J. (2001) Stem Rust – Future Enemy? In Stem Rust of Wheat Ancient 20

Enemy to Modern Foe. (Peterson, P.D. ed.) pp. 1–11. The American 1

Phytopathological Society, St. Paul MN. 2

Leonard K.J., Szabo L.J. (2005) Pathogen profile. Stem rust of small grains and grasses 4

caused by Puccinia graminis. Molecular Plant Pathology 6:489-489. 5

Levy A.A., Feldman M. (2004) Genetic and epigenetic reprogramming of the wheat 7

genome upon allopolyploidization. Biological Journal of the Linnean Society 8

82:607-613. 9

Liu B., Segal G., Vega J.M., Feldman M., Abbo S. (1997) Isolation and characterization 11

of chromosome-specific DNA sequences from a chromosome arm genomic 12

library of common wheat. Plant Journal 11:959-965. 13

Lukaszewski A.J. (1990) Frequency of 1RS∙AL and 1RS∙1BL translocations in united- 15

states wheats. Crop Science 30:1151-1153. 16

Lukaszewski A.J. (2000) Manipulation of the 1RS∙1BL translocation in wheat by induced 18

homoeologous recombination. Crop Science 40:216-225. 19

Maan S.S. (1975) Exclusive preferential transmission of an alien chromosome in 1

common wheat. Crop Science 15:287-292. 2

Mago R., Bariana H.S., Dundas I.S., Spielmeyer W., Lawrence G.J., Pryor A.J., Elllis 4

J.G. (2005) Development of PCR markers for the selection of wheat stem rust 5

resistance genes Sr24 and Sr26 in diverse wheat germplasm. Theoretical and 6

Applied Genetics 111:496-504. 7

Martin G.B., Bogdanove A.J., Sessa G. (2003) Understanding the functions of plant 9

disease resistance proteins. Annual Review of Plant Biology 54:23-61. 10

Masoudi-Nejad A., Nasuda S., McIntosh R.A., Endo T.R. (2002) Transfer of rye 12

chromosome segments to wheat by a gametocidal system. Chromosome Research 13

10:349-357. 14

McDonald B.A., Linde C. (2002) The population genetics of plant pathogens and 16

breeding strategies for durable resistance. Euphytica 124:163-180. 17

McFadden, E.S. (1930) A successful transfer of emmer characteristics to vulgare wheat. 19

Journal of the American Society of Agronomy 22: 1020-1034. 20

McIntosh R.A., Wellings C.R., Park R.F. (1995) Wheat rusts : an atlas of resistance genes 2

CSIRO ; Kluwer Academic Publishers, East Melbourne, Australia 3

Dordrecht ; Boston. 4

Meng E., Longmire J., Moldashev A. (2000) Kazakhstan's wheat system: priorities, 6

constraints, and future prospects. Food Policy 25:701-717. 7

Naranjo T. (1990) Chromosome structure of durum wheat. Theoretical and Applied 9

Genetics 79:397-400. 10

Payne P.I., Holt L.M., Lawrence G.J., Law, C.N. (1982) The genetics of gliadin and 12

glutenin, the major storage proteins of the wheat endosperm. Qualitas Plantarum 13

Plant Foods for Human Nutrition. 31:229-241. 14

Peterson P.D. (2001) Stem rust of wheat : From ancient enemy to modern foe. APS Press, 16

St. Paul, Minn. 17

Peterson P.D., Leonard K.J., Roelfs A.P., Sutton T.B. (2005) Effect of barberry 19

eradication on changes in populations of Puccinia graminis in Minnesota. Plant 20

Disease 89:935-940. 1

Porter J.R., Jameison P.D., andGrace P.R. (2007) Wheat Production and Global Climate 3

Change. In: Terrestrial Ecosystems in a Changing World. Springer Berlin, 4

Heidelberg. 5

Pretorius Z.A., Singh R.P., Wagoire W.W., Payne T.S. (2000) Detection of virulence to 7

wheat stem rust resistance gene Sr31 in Puccinia graminis fsp. tritici in Uganda. 8

Plant Disease 84:203. 9

Qi L.L., Friebe B., Zhang P., Gill B.S. (2007) Homoeologous recombination, 11

chromosome engineering and crop improvement. Chromosome Research 15:3-19. 12

Read N.D., Kellock L.J., Collins T.J., Gundlach A.M. (1997) Role of topography sensing 14

for infection-structure differentiation in cereal rust fungi. Planta 202:163-170. 15

Riley R., Chapman V. (1958) Genetic control of the cytologically diploid behaviour of 17

hexaploid wheat. Nature 182:713-715. 18

Riley R., Chapman V., Kimber G. (1960) Position of the gene determining the diploid- 20

like meiotic behaviour of wheat. Nature 186:259-260. 1

Riley R., Chapman V., Johnson R. (1968) Incorporation of alien disease resistance in 3

wheat by genetic interference with regulation of meiotic chromosome synapsis. 4

Genetical Research 12:199 5

Roelfs A.P. (1977) Foliar fungal diseases of wheat in peoples republic of china. Plant 7

Disease Reporter 61:836-841. 8

Roelfs, A.P. (1985) Wheat and rye stem rust. In: The Cereal Rusts, Vol. 2 (Roelfs, A.P., 9

and Bushnell, W.R. eds.) pp. 3-37. Academic Press, Orlando, FL. 10

Roelfs A.P., Martens J.W. (1988) An international system of nomenclature for Puccinia 12

graminis fsp. tritici. Phytopathology 78:526-533. 13

Saari E.E., Prescott J.M. (1985) World distribution in relation to economic losses. In: The 15

Cereal Rusts, Vol. 2 (Roelfs, A.P.,and Bushnell, W.R. eds.) pp. 3-37. Academic 16

Press, Orlando, FL. 17

Saal B., Wricke G. (1999) Development of simple sequence repeat markers in rye (Secale 19

cereale L.). Genome 42:964-972. 20

Schneider A., Molnar I., Molnar-Lang M. (2008) Utilisation of Aegilops (goatgrass) 2

species to widen the genetic diversity of cultivated wheat. Euphytica 163:1-19. 3

Sears, E.R., (1956) The transfer of leaf rust resistance from Aegilops umbellulata to 5

wheat. Brookhaven Symposium on Biology 9: 1-12. 6

Sears E.R., Steinitzsears, L.M. (1957) Ultraviolet and x-ray induced chromosomal 8

aberrations in wheat. Genetics 42:623-630. 9

Sears E.R. (1972) Agropyron-wheat transfers through induced homoeologous pairing. 11

Canadian Journal of Genetics and Cytology 14:736. 12

Sears E.R. (1977) Transferring genes to wheat chromosomes from those of its wild 14

relatives. Cereal Foods World 22:477-477. 15

Shaked H., Kashkush K., Ozkan H., Feldman M., Levy A.A. (2001) Sequence 17

elimination and cytosine methylation are rapid and reproducible responses of the 18

genome to wide hybridization and allopolyploidy in wheat. Plant Cell 13:1749- 19

1759. 1

Singh R., Huerta-Espino J., Rosewarne G. (2004) Wheat Rust In Asia: Meeting the 3

Challenges with Old and New Technologies, International Crop Science 4

Congress, ISBN, Brisbane, Australia. 5

Singh R., Hodson D., Jin Y., Huerta-Espino J., Kinyua M., Wanyera R., Njau P., Ward R. 7

(2006) Current status, likely migration and strategies to mitigate the threat to 8

wheat production from race Ug99 (TTKS) of stem rust pathogen. CAB Reviews: 9

Perspectives in Agriculture, Veterinary Science, Nutrition and Natural Resources 10

1. 11

Singh R.P., Hodson D.P., Huerta-Espino Jin Y., Njau P., Wanyera R., Herrera-Foessel 12

S.A., Ward R.W. (2008) Will stem rust destroy the world's wheat crop?, p. 271 13

309 Advances in Agronomy, Vol 98, Vol. 98. Elsevier Academic Press Inc, 14

San Diego. 15

Stakman E.C., Lambert E.B. (1928) The relation of temperature during the growing 17

season in the spring wheat area of the United States to the occurrence of stem rust 18

epidemics. Phytopathology 18:369-374. 19

Sun P., and Yang X.B. (1999) Two properties of a gene-for-gene co-evolution system 1

under human perturbations. Pytopathology. 89:911-816. 2

Van der Plank J.E. (1968) Disease resistance in plants Academic Press, New York,. 4

Tsilo, T.J., Y. Jin, Anderson J.A. (2008) Diagnostic microsatellite markers for the 6

detection of stem rust resistance gene Sr36 in diverse genetic backgrounds of 7

wheat. Crop Sci. 48:253-261. 8

Villareal R.L., Rajaram S., Mujeebkazi A., Deltoro E. (1991) The effect of chromosome 10

1B/1R translocation on the yield potential of certain spring wheats (Triticum 11

aestivum L.). Plant Breeding 106:77-81. 12

Vocke G., Alan E. 2008 Wheat Outlook, A report from the USDA-Economic Research 13

Service. 14

Wanyera R., Kinyua M.G., Jin Y., Singh R.P. (2006) The spread of stem rust caused by 16

Puccinia graminis fsp. tritici, with virulence on Sr31 in wheat in Eastern Africa. 17

Plant Disease 90:113-113. 18

Zambino P.J., Kubelik A.R., Szabo L.J. (2000) Gene action and linkage of avirulence 20

genes to DNA markers in the rust fungus Puccinia graminis. Phytopathology 1

90:819-826. 2

Zeller F.J., Fuchs E. (1983) Cytology and disease resistance of a 1A1R and some 1B1R 4

wheat-rye translocation cultivars. Zeitschrift Fur Pflanzenzuchtung-Journal of 5

Plant Breeding 90:285-296. 6

Zhang W.J., Lukaszewski A.J., Kolmer J., Soria M.A., Goyal S., Dubcovsky J. (2005) 8

Molecular characterization of durum and common wheat recombinant lines 9

carrying leaf rust resistance (Lr19) and yellow pigment (Y) genes from 10

Lophopyrum ponticum. Theoretical and Applied Genetics 111:573-582. 11

Zohary D., Hopf M. (1993) Domestication of plants in the Old World : the origin and 13

spread of cultivated plants in West Asia, Europe, and the Nile Valley. 2nd ed. 14

Clarendon Press; Oxford University Press, Oxford New York. 15

Chapter 2 1

Genotyping of U.S. Wheat Germplasm for Presence of Stem Rust Resistance Genes 2 Sr24, Sr36 and Sr1RSAmigo 3 4 5

Submitted to Crop Science 7

Genotyping of U.S. Wheat Germplasm for Presence of Stem Rust Resistance Genes Sr24, 1

Sr36 and Sr1RSAmigo 2

Eric L. Olson, Gina Brown-Guedira*, David S. Marshall, Yue Jin, Mohamed Mergoum, 4

Iago Lowe, and Jorge Dubcovsky 5

E.L. Olson, Department of Crop Science, North Carolina State University, Campus Box 7

7620, Raleigh, NC 27695-7620; G. Brown-Guedira, USDA-ARS Plant Science Research, 8

Department of Crop Science, North Carolina State University, Campus Box 7620, 9

Raleigh, NC 27695-7620; D.M. Marshall, USDA-ARS Plant Science Research, 10

Department of Plant Pathology, North Carolina State University, Campus Box 7616, 11

Raleigh, NC 27695-7616. Y. Jin, USDA-ARS, Cereal Disease Lab., 1551 Lindig St, 12

Univ. of Minnesota, St. Paul, MN 55108; M. Mergoum, Dep. of Plant Sciences, 270C 13

Loftsgard Hall 270C, North Dakota State University, Fargo, ND 58105-5051; I. Lowe 14 and J. Dubcovsky, Dep. of Plant Sciences, Univ. of California, Davis, CA 95616-8780 15

*Corresponding author E-mail: [email protected] 17

Mention of trade names or commercial products in this article is solely for the purpose of 1 providing specific information and does not imply recommendation or endorsement by 2 the U.S. Department of Agriculture. 3

Abbreviations: Pgt, Puccinia graminis f.sp. tritici; IT, infection type; SWW, soft winter 5 wheat; HWW, hard winter wheat; HSW, hard spring wheat; SRW, soft red winter wheat; 6

HRW, hard red winter wheat; HRS, hard red spring wheat; bp, base pairs; SSR, simple 7 sequence repeat; STS, sequence tagged site; PCR, polymerase chain reaction 8

Abstract 1

The stem rust resistance genes Sr24, Sr26, Sr36, and Sr1RSAmigo present on the 3

T1AL∙1RS rye translocation confer resistance to race TTKSK of Puccinia graminis f.sp. 4 tritici. A collection of 793 cultivars and breeding lines of wheat (Triticum aestivum L.) 5 from all growing regions of the United States were screened with simple sequence repeat 6

(SSR) and sequence tag site (STS) markers linked to Sr24, Sr26, Sr36, and Sr1RSAmigo to 7 determine frequencies of these genes in U.S. wheat germplasm. The efficacy of markers 8 was evaluated through comparison with phenotypic data from assays with the stem rust 9 pathogen. Markers for Sr24, Sr36 and Sr1RSAmigo proved efficacious in predicting the 10 presence of the genes as evidenced by the seedling infection type. Of all lines evaluated, 11 the most predominant gene is Sr24 present in the hard winter, hard spring and soft winter 12 wheat lines assayed. Resistance in soft winter wheat is primarily from Sr36. The 13

T1AL∙1RS translocation carrying Sr1RSAmigo is present at equal frequencies in hard 14 winter and soft winter wheat. Utilization of marker assisted selection for stem rust 15 resistance genes can hasten the development of wheat cultivars resistant to TTKSK and 16 its variants and allow for the development of resistance gene pyramids for more durable 17 stem rust resistance. 18

Introduction 1

The stem rust fungus Puccinia graminis f. sp. tritici Pers. (Pgt) has historically 3 caused dramatic yield losses in cultivated wheat (Triticum aestivum L. ). Stem rust posed 4 a major threat to wheat production in the United States in the early twentieth century with 5 the major epidemics of stem rust occurring between 1900 and the 1950s (Kolmer et al., 6

2007). Removal of the alternate host and development of lines possessing genes for 7 resistance has led to a significant decrease in the number and magnitude of stem rust 8 epiphytotics (Kolmer et al., 2007). The diversity of Pgt was also greatly reduced, with 9 limited number of races found recent surveys in the U.S. (Jin, 2005). Without stem rust 10 as a limiting factor in production, there has been less need for breeding programs to focus 11 on incorporating a diversity of stem rust resistance genes into new cultivars, 12 consequently, few lines possess more than one effective gene. Single gene resistance can 13 remain effective in the absence of a robust and diverse pathogen population but does not 14 always provide durable long-term resistance. 15

Worldwide, most wheat germplasm remained resistant to stem rust over the same 16 time period of stem rust quiescence in the United States. A widely distributed source of 17 stem rust resistance is the gene Sr31, located on the translocated chromosome T1RS∙1BL, 18 which consists of the short arm of chromosome one of “Petkus” rye (Secale cereale L.) 19 translocated onto the long arm of wheat chromosome 1B (Shegel and Korzun, 1997). 20

This source of resistance has been widely disseminated worldwide through CIMMYT 1 germplasm. Resistance conferred by Sr31 had remained effective for over thirty years 2 until 1999 in Uganda a stem rust race, reported as Ug99, was identified with virulence to 3

Sr31. This race was later designated as TTKS (Wanyera et al., 2006) based on the North 4

American race nomenclature system (Roelfs, 1988). This new race combined Sr31 5 virulence with virulence to the majority of T. aestivum derived stem rust resistance genes. 6

Since its identification, new variants with additional virulence, such as virulence to Sr24 7

(Jin et al. 2008) have been identified in Kenya. TTKS is now divided into two races, 8

TTKSK and TTKST with avirulence and virulence to Sr24, respectively (Jin et al., 2008). 9

The expanded virulence adaptation of race TTKS further increased the genetic 10 vulnerability of wheat. International attention and support for the development of 11 resistant cultivars is needed as TTKS may reach global dispersal due to its unique 12 virulence to multiple known and unknown resistance genes (Singh, 2006). 13

Field evaluations in Kenya and greenhouse evaluations at the USDA Cereal 14

Disease Lab have elucidated Sr genes effective against TTKSK (Jin et al., 2007). These 15 include Sr13, 22, 24, 25, 26, 27, 28, 32, 33, 35, 36, 37, 39, 40, 44, Sr Tmp, and Tt-3 and 16

Sr1RSAmigo on the T1RS∙1AL translocation (Jin et al., 2007). Of these effective resistance 17 genes, Sr24, Sr26, Sr36 and Sr1RSAmigo have been deployed in wheat cultivars in some 18 countries. Diagnostic molecular markers linked to effective resistance genes are 19 available for Sr24, Sr26, Sr36 and Sr1RSAmigo, each of which was transferred from wheat 20

relatives with non-homologuous or partially homologous genomes (Mago et al., 2004; 1

Tsilo et al., 2008; Saal and Wricke 1999). The ability to detect the presence of specific 2 stem rust resistance genes using molecular markers presents a viable method for 3 identifying resistance to race TTKSK in the absence of the pathogen itself. Our 4 objectives were to assess the frequency of DNA markers associated with resistance genes 5

Sr24, Sr26, Sr36, and Sr1RSAmigo in diverse wheat cultivars and breeding lines from 6 breeding programs throughout the United States and to assess the reliability of these 7 markers in predicting the presence of the resistance genes in diverse germplasm. 8

Materials and Methods 1

Plant Materials 3

Elite cultivars and breeding lines representing all market classes of wheat grown 4 in the United States were evaluated for the presence of resistance genes Sr24, Sr26, Sr36 5 and Sr1RSAmigo (Table 1). Seeds of advanced lines and check cultivars of the 2006 and 6

2007 Uniform Eastern and Southern Soft Winter Wheat Nurseries were obtained from 7

Dr. Harold Bockelman, USDA-ARS, Aberdeen, Idaho and include germplasm from the 8 eastern winter wheat growing region of the U.S.A. Seeds of entries in the 2006 Southern 9 and Northern Regional Performance Nurseries were obtained from Dr. Robert 10

Graybosch, USDA-ARS, Lincoln, Nebraska and include hard winter wheat lines from the 11

Great Plains. The 2006 Western Regional Soft Winter Wheat, Hard Winter Wheat, Soft 12

Spring Wheat, and Soft White Wheat Nurseries were obtained from Dr. Kim Garland 13

Campbell, USDA-ARS, Pullman, Washington and include lines adapted to the western 14 region of the U.S.A.. Additional winter wheat lines were obtained directly from breeding 15 programs and from collaborative nurseries, including the 2007 Gulf Atlantic Wheat 16

Nursery and the Mason-Dixon Wheat Nursery. Seeds of hard spring wheat cultivars and 17 breeding lines adapted to California and to the Northern Plains were obtained directly 18 from breeding programs. Cultivars with known resistance genes included as controls 19 were ‘NC-Neuse’ (Sr36; PI633037) (Murphy et al., 2004), ‘McCormick’ (PI632691; 20

Sr24 and Sr1RSAmigo) (Griffey et al., 2005), ‘AGS 2000’ (Sr31; PI692596) (Johnson et 1 al., 2002) and ‘Eagle’ (PI365582; Sr26) (Mago et al. 2005). 2

Marker Analyses 4

Genomic DNA was extracted from fresh tissue from up to 5 seedlings of each line 5 harvested into 96 well plates and stored at -80°C. Frozen tissue was macerated using 6 steel beads with a GenoGrinder 2000 (SPEX CertiPrep®, Metuchen, NJ). Extractions 7 were performed using a QIAGEN DNeasy® 96 Plant kit (QIAGEN, Valencia, CA) 8 according to the manufacturer’s instructions. 9

Four simple sequence repeat (SSR) markers were evaluated for efficacy in the 10 detection of the Sr36 gene: GWM319, WMC477, GWM271 and GWM501 (Table 2) 11

(Tsilo et al., 2008; Lehemensk et al., 2004; Bariana et al., 2001). The Agropyron 12 elongatum-derived segment carrying Sr24 was detected using the SSR marker Xbarc71 13 and the sequence tagged site (STS) marker Sr24#12 (Mago et al., 2005). The STS 14 marker Sr26#43 was used for detection of resistance gene Sr26 (Mago et al., 2005). The 15 presence of the short arm of rye chromosome one (1RS) in wheat germplasm was assayed 16 with the rye-specific SSR marker Xscm9 (Saal and Wricke, 1999). 17

The PCR master mix for STS and SSR primers consisted of 2 µL of 20 ng/µL 18 genomic DNA template, 0.40 µL of 10µM a forward and reverse primer mixture, 0.18µL 19

(0.9 U) of Taq polymerase, 1.20 µL of 10X buffer (10 mM Tris-HCL, 50 mM KCl, 1.5 20

mM MgCl2, pH 8.3), 0.96 µL of a 100 µM mixture of dNTPs and 7.26 µL of water 1 bringing the total reaction volume to 12 µL. A touchdown profile was initially used that 2 consisted of an initial denaturation at 95°C followed by 15 cyles of a 45 second 3 denaturation at 95°C, 65°C annealing decreasing by 1°C each cycle and a 72°C 4 extension for one minute followed by 25 cycles of 50°C annealing temperature. The 5 cycling conditions for WMC477 included an initial denaturation of 95°C followed by 35 6 cycles of 95°C for 45 seconds, 61°C for 45 seconds and 72°C for one minute followed 7 by a final extension of 4 minutes. Cycling conditions for the STS markers were as 8 follows: an initial step of 94°C for 3 minutes followed by 30 cycles of 94°C for 30 9 seconds, 56°C for 30 seconds, and 72°C for 40 seconds. 10

The forward primers for all SSR markers were 5’ modified to include the 11 fluorescent dye 6-FAM. Amplficiations were performed using an Eppendorf 12

Mastercycler® (Eppendorf AG, Hamburg, Germany). Sizing of PCR products was 13 performed by capillary electrophoresis using an ABI3130xl Genetic Analyzer (Applied 14

BioSystems, Foster City, CA). Analysis of PCR fragments was performed using 15

GeneMarker 1.60 software (SoftGenetics, State College, PA). STS markers were resolved 16 in 2.0% agarose gels, stained with ethidium bromide and photographed. 17

Phenotypic Analysis 1

Results of marker analyses were compared with results of phenotypic evaluation 2 of entries in the USDA Cooperative Regional testing program that are available from the 3

USDA-ARS Cereal Disease Lab (http://www.ars.usda.gov/Main/docs.htm?docid=9987). 4

Disease evaluation was perfomed in St. Paul, Minnesota, during the winters of 2005 and 5

2006. Races TTKSK and TTKST of Puccinia graminis f. sp. tritici were used for 6 evaluating wheat lines. Procedures for inoculation and disease assessment were 7 described previously (Jin et al., 2007). Phenotypic data on adult plant reaction to TTKS 8 were also available. Evaluations were done on selected US spring and winter wheat lines 9 and cultivars at the Kenyan Agricultural Research Institute in Njoro, Kenya in 2005, 10

2006, and 2007. 11

Results 1

Control lines amplified the appropriate sized fragment for each of the markers 3 assayed (Figure 1). The Agropyron elongatum-derived segment having Sr24 was 4 detected using the SSR marker Xbarc71 that amplified fragments of 83, 87, 101 bp in 5 lines possessing Sr24. These fragments were also amplified in the Sr24 positive control, 6

McCormick (Figure 2). The STS marker Sr24#12 (Mago et al., 2005) was also used to 7 detect this segment and amplified a 200 bp fragment in McCormick (Figure 1). Four 8

SSR markers reportedly linked to resistance gene Sr36, GWM271, GWM319, WMC477 9 and GWM501 were assayed and amplified fragments of 171, 168, 187 and 107 bp, 10 respectively, from the resistant control NC-Neuse (Figure 1). 11

The r y e -specific SSR marker Xscm9 acts as dominant marker to detect the 12 presence of the short arm of rye chromosome one (1RS) in wheat. This marker amplified 13 a fragment of 208 bp in lines having the T1RS∙1BL chromosome and resistance gene 14

Sr31. An amplified fragment 224 bp in length was observed in lines with T1RS∙1AL and 15 resistance gene Sr1RSAmigo (Figure 1). 16

A subset of 250 lines, which included cultivars of all market classes, was 17 evaluated with the STS marker Sr26#43. Of these, none amplified the diagnostic 207 bp 18 fragment that was present in the Australian cultivar Eagle (Sr26). No further evaluation 19 of lines for the presence of Sr26 was done. 20

Phenotypic data on the seedling reactions to Pgt race TTKS from was available 1 for 383 of the 793 lines evaluated with markers. Of these, 122 lines were predicted by 2 marker analyses to either possess Sr24, Sr36 or Sr1RSAmigo singly or in combinations. A 3 high degree of correspondence was observed between the marker data and seedling 4 infection types. In the collection of germplasm for which both genotypic and phenotypic 5 data were available, 9 lines that did not have marker alleles associated with Sr24, Sr36 or 6

Sr1RSAmigo exhibited resistant phenotypes, likely due to the presence of other effective 7 resistance genes (Table 3). 8

Of the two markers evaluated for the Sr24 translocation segment, Xbarc71 was 9 the most accurate. Although the STS marker Sr24#12 was generally predictive of the 10 presence of Sr24, it also generated false positives. Multiple lines yielding a faint 500bp 11

Sr24#12 fragment were susceptible to TTKSK and lacked the alleles associated with Sr24 12 at Xbarc71. A high level of correspondence between the genotypic and phenotypic data 13 was observed for the marker Xbarc71. Thirty-eight of forty lines having the 83, 87, and 14

101 bp Xbarc71 fragments exhibited an IT 2 when inoculated with race TTKSK, which is 15 avirulent to Sr24. When inolculated with Pgt race TTKST having Sr24 virulence, lines 16 possessing Sr24 singly were susceptible (IT 3). However, 10 lines were resistant (ITs 2, 17

2+) to TTKST due to the presence of effective resistance gene Sr1RSAmigo (Table 4). 18

Mago et al. (2005) reported that BARC71 acts as a co-dominant marker and maps 19 distal on 3DL. However, a number of U.S. wheat lines have obtained Sr24 on the 1BS- 20

Agropyron translocation present in the germplasm Amigo (The et al., 1992). The marker 1

BARC71 acts in a dominant manner in lines with this tranlocation, amplifying fragments 2 from both the wheat SSR Xbarc71 locus on 3DL and the A. elongatum-derived locus on 3

1BS. Mago et al. (2005) observed 83 and 103 bp fragments amplified from the A. 4 elongatum-derived segment. They observed various wheat alleles at the 3DL locus, 5 including a 107 bp fragment. Of the 90 lines identified phenotypically as c a r r y Sr24 in 6 our study, in 49 lines, BARC71 amplified only the fragments from the A. elongatum- 7 derived segment, indicating the presence of the 3DL translocation. In 51 lines, BARC71 8 amplified fragments from wheat and A. elongatum, indicating that they are either 9 heterozygotes or possess the ‘Amigo’ type translocation. 10

Phenotypic data was available for 19 lines predicted by marker analyses to have 11 the T1RS∙1AL chromosome from ‘Amigo’ and the Sr1RSAmigo resistance gene. Of these 12

19 lines, two were classified as susceptible to TTKSK. Presumably all lines evaluated 13 were homozygous at nearly all loci; however, heterogeneity was observed for IT in some 14 lines. This within-line heterogeneity could contribute to observed differences between the 15 phenotypic and genotypic data for the marker SCM9. 16

The four SSR loci located near the centromere of chromosome arm 2BL, 17

Xgwm319, Xgwm271, Xgwm501 and Xwmc477, reported to be linked to resistance gene 18

Sr36 (Lehemensiek et al., 2004; Tsilo et al., 2008) were not equally predictive of stem 19 rust resistance in the lines tested. This could be due to recombination between the SSR 20

loci and Sr36 in some lines. Tsilo et al. (2008) reported that the 187 bp fragment 1 amplified by marker WMC477 was tightly linked to Sr36 and was predictive of Sr36 in 2 diverse germplasm. In this study, low infection types (IT 0 or ; that was characteristic of 3

Sr36 to race TTKSK) were observed on 57 of 59 lines amplifying the 187 bp fragment 4 that were inoculated with Pgt race TTKSK. The remaining two lines were susceptible to 5

TTKSK either due to recombination between the marker and the gene or heterogeneity of 6 the lines. The 168 bp fragment amplified in the Sr36 control NC-Neuse by primer pair 7

GWM319 was not entirely predictive of the presence to Sr36 across or within market 8 classes. The Xgwm319 allele was present in only 48 of the 59 lines identified to carry 9

Sr36. Similar results were observed for the 171 bp Xgwm271 fragment and the 108 bp 10

Xgwm501 fragment. The Xgwm271 allele linked to Sr36 was present in 21 of the lines 11 having Sr36 and the Xgwm501 allele was present in 35 of the 59 Sr36 lines. All four 12 markers linked to Sr36 were found in only 16 lines. Phenotypic data were available for 13

12 of these lines, all of which yielded the Sr36 phenotype (IT 0;). Recombination 14 between the marker loci Xgwm319, Xgwm271, and/or Xgwm501 was identified in 43 of 15 the 57 lines having the Sr36 phenotype and the 187 bp allele of marker Xwmc477. 16

Approximately 24% of all 804 lines assayed with markers in this study were 17 predicted to possess either Sr24, Sr36 or Sr1RSAmigo (Table 1). Based on marker analyses, 18 the most prevalent gene identified in US germplasm is Sr24 that was present 19 approximately 11% of all lines followed by Sr36 and Sr1RSAmigo present in 9 and 7 % 20

percent of all lines, respectively. Soft red winter wheat germplasm from the eastern 1 growing region has the highest diversity of stem rust resistance with Sr24, Sr36, and 2

Sr1RSAmigo each present at frequencies ranging from 8 to 23 %. Almost half of all hard 3 winter wheat (HWW) lines from the Great Plains that were evaluated possess resistance 4 to TTKS due largely to Sr24 and Sr1RSAmigo. Hard spring wheat (HSW) of the northern 5 plains also has resistance primarily from Sr24, while Sr36 was found in at a much lower 6 frequency in lines from this region (Table 1). 7

The most broadly distributed resistance gene assayed was Sr24. The Xbarc71 8 fragments associated with the Sr24 segment were identified in hard red winter wheat and 9 hard red spring wheat from the Great Plains and soft red winter wheat lines of the eastern 10 growing region (Table 1). However, the majority of U.S. lines with Sr24 are HWW of 11 the Great Plains, with 26% of the HWW entries tested having Sr24. Approximately 13% 12 of HSW lines from the northern Great Plains and 8% of soft winter wheat (SWW) lines 13 from the Eastern U.S. also carry Sr24. No entries evaluated from the Western region 14 were positive for the Sr24 markers. 15

The marker analyses indicate that Sr36 is widespread in soft red winter wheat 16 germplasm (Table 1). Twenty-three percent of the SWW lines tested possessed the 187 17 bp fragment amplified by Xwmc477 associated with Sr36. In contrast, only four HWW 18 lines and one HSW line from the Great Plains were determined to have Sr36. No entries 19 in the nurseries from the Western region were positive for the Sr36 markers. 20

Marker analyses indicate that Sr1RSAmigo is present in approximately 14 % of 1

HWW lines from the Great Plains and 10 % of SWW lines from the eastern growing 2 region (Table 1). This translocation was not detected in any U.S. spring wheat 3 germplasm or any winter wheat lines from the western region. Amplification of a 224 bp 4 fragment by the rye-specific SSR marker Xscm9 indicates the presence of the T1RS∙1AL 5 chromosome from ‘Amigo’ and the Sr1RSAmigo resistance gene. Since a 208 bp fragment 6 may also be amplified by SCM9 that indicates the presence of the T1RS∙1BL 7 chromosome and Sr31, we could also assess the frequency of this gene in the germplasm 8 tested. The T1RS∙1BL translocation was common in U.S. winter wheat germplasm, 9 particularly in eastern SWW lines (21%) and HWW lines of the Great Plains (14%). The 10 translocation was also present in three hard spring wheat lines from the western region. 11

Lines carrying multiple stem rust resistance genes were identified (Table 5). The 12 pyramid of Sr24 and Sr1RSAmigo was the most frequent being present in 20 lines. Marker 13 analyses indicate that Sr24 and Sr36 were present together in two lines. Two 14 experimental lines were found to be have the Sr36 and Sr1RSAmigo combination and two 15 lines were found having Sr24, Sr36 and Sr1RSAmigo (VA05W-65 and SD00W024). 16

Phenotypically, VA05W-65 was heterogeneous for infection types, IT 0 (indicative of 17

Sr36) and IT 2 (indicative of Sr24 and Sr1RSAmigowithout Sr36). These results may be 18 due to heterogeneity within the line rather than a gene pyramid. Phenotypic data were 19 not available for SD00W024. 20

Discussion 1

The year round cultivation of susceptible wheat varieties under ideal conditions 2 for disease development will hasten the spread of TTKSK and its variants. Emergence 3 from the East African countries has followed a step wise range expansion further north to 4

Sudan and across the Arabian peninsula and as far east as Iran following the same path as 5 the Yr9-virulent race of stripe rust (Puccinia striiformis Westend f.sp. striiformis) that 6 originated in the East African highlands and migrated across the Middle East through 7

West Asia to East Asia (Singh, 2004). The majority of current cultivars grown on 90% or 8 more of the acreage in the migration path are susceptible to TTKSK (Singh, 2006). 9

To assess levels of resistance to TTKSK in spring and winter wheat germplasm 10 from the U.S., evaluation is being done at the Kenya Agricultural Research Institute in 11

Njoro, Kenya and during the winter in specialized research facilities at the Cereal Disease 12

Lab in St. Paul, Minnesota. The number of lines that can be assessed each season in 13 containment facilities is limited. Also, technical difficulties must be overcome to 14 accurately assess levels of resistance under field conditions, particularly for winter wheat 15 that must be artificially vernalized and transplanted in order to be evaluated in the field. 16

This study has demonstrated that molecular markers can be used with great 17 efficacy to identify wheat lines possessing the Sr24, Sr26, Sr36 and Sr1RSAmigo resistance 18 genes effective against race TTKSK of P. graminis f. sp. tritici. The ability to screen for 19 the presence of specific genes will allow for the timely identification of lines carrying 20

effective resistance. Molecular markers can also aid in determining which gene or gene 1 combinations are present in germplasm that is resistant to the pathogen. In this study, we 2 identified 25 lines in which stem rust resistance was due to the presence of multiple 3 genes, as well as lines that may possess unique resistance genes. 4

Stem rust resistance genes Sr24, Sr26, Sr36 and Sr1RSAmigo are present on 5 translocation segments that do not readily recombine with homoeologous regions of 6 wheat. Thus, the markers detecting the translocations co-segregate with resistance and 7 are considered diagnostic. By comparing marker genotype and phenotypic data for 383 8

U.S. wheat lines in this report, we determined that the markers used to detect Sr24 and 9

Sr1RSAmigo were predictive of the presence of the resistance genes. The few anomalies 10 present in our screening were found only in experimental lines that are not yet released as 11 cultivars. The seed that was used for genotyping was sent directly from breeding 12 programs whereas seed used for phenotypic evaluation was on seed sent directly from 13 nurseries. We believe that heterogeneity in seed sources may have lead to differences in 14 marker genotype and results from the pathogen assay. 15

Resistance gene Sr36 was introgressed into wheat from the tetraploid species T. 16 timopheevii Zhuk. having the At and G genomes that are partially homologous to the A 17 and B genomes, respectively, of T. aestivum. Sr36, along with powdery mildew 18 resistance gene Pm6, transferred to wheat chromosome 2B through homologous 19 recombination with chromosome 2G (Allard and Shands, 1954). Sr36 may have been 20

maintained in US germplasm due to its association with black point resistance 1

(Lehamensiek et al., 2004). Significant amounts of recombination between Sr36 and 2 marker loci Xgwm319, Xgwm271, and Xgwm501 were found in lines identified to carry 3

Sr36 in this study. The level of recombination among marker loci in the region of Sr36 4 may be attributed to the many generations of intercrossing since the introgression of Sr36 5 into wheat germplasm in the U.S. during the 1950s. However, the marker Xwmc477 was 6 identified as predictive of Sr36 by Tsilo et al. (2008) and reliably identified the Sr36 7 phenotype in this set of modern U.S. breeding lines and cultivars. 8

The results of our marker analyses are consistent with phenotypic evaluation of 9

U.S. wheat cultivars by Jin and Singh (2006). They also determined that the most 10 prevalent gene in U.S. cultivars is Sr24 and observed similar frequencies of the resistance 11 genes in the different market classes. Although selection for stem rust resistance has 12 received less emphasis, Sr24 has likely been maintained due to its complete association 13 with leaf rust resistance gene Lr24. In addition, the T1RS∙1AL chromosome that was 14 identified in both hard and soft winter lines has likely been selected for other desirable 15 traits such as presence of the effective powdery mildew resistance gene Pm17 on the rye 16 arm. Similarly, prevalence of Sr36 in Eastern U.S. could be due to linkage with 17 resistance gene Pm6. However, these genes are not completely linked and Pm6 no longer 18 provides effective resistance in the eastern U.S. (Niewoehner and Leath, 1998). A 19 number of authors have reported preferential transmission of the T. timopheevi segment 20

on chromosome 2B that may have contributed to the maintenance of this gene (Nyquist, 1

1962; Tsilo et al. 2007). The A. elongatum-derived gene Sr26 was not present in any of 2 the 250 lines tested, indicating an absence of this gene in U.S. wheat germplasm. 3

In the collection of germplasm screened, five soft red winter lines and four hard 4 red winter lines exhibited resistance to TTKS in the absence of Sr24, Sr26, Sr36 or 5

Sr1RSAmigo marker genotypes. Pedigree information along with reaction type led to 6 postulation of the effective resistance gene SrTmp in the hard red winter lines. These data 7 underscore that the resistance in U.S. wheat germplasm is due to a limited number of 8 effective stem rust resistance genes. Although five red winter wheat lines from the 9 breeding program at the University of Georgia were resistant to TTKS as the seedling 10 stage, not all of these lines were not scored as resistant under natural infection in the field 11 at Njoro, Kenya (Table 5). However, one of the breeding lines, GA991371-6E12, 12 exhibited a high level of resistance to natural inoculum in the field. Thus, the marker 13 analyses combined with phenotypic evaluation indicate the possibility of another 14 effective resistance gene in this line. Further examination of the resistant line should be 15 done in the search for new genes providing resistance to highly virulent strains of stem 16 rust. 17

References 1

Allard R.W., Shands R.G. (1954) Inheritance of resistance to stem rust and podery 3

mildew in cytologically stable spring wheats derived from Triticum timopheevi. 4

Phytopathology 44:266-274. 5

Bariana H.S., H a y d e n M.J., Ahmed N.U., Bell J.A., Sharp P.J. , McIntosh R.A. (2001) 7

Mapping of durable adult plant and seedling resistances to stripe rust and stem 8

rust diseases in wheat. Australian Journal of Agricultural Research. 52:1247- 9

1255. 10

Griffey C.A., Rohrer W.L., Pridgen T.H., Brooks W.S., Chen J. , Wilson J.A., Nabati D., 12

Brann D.E., Rucker E.G., Berl H.D., Vaughn M.E., Sisson W.L., Randall T.R., 13

Corbin R.A., Kenner J.C., Dunaway D.W., Pitman R.M., Bockelman H.E., Gaines 14

C., Long D.L., McVey D.V., Cambron S.E., Whitcher L. (2005) Registration of 15

'McCormick' wheat. Crop Science 45:417-419. 16

Jin Y. (2005) Races of Puccinia graminis identified in the United States during 2003. 18

Plant Disease 89:1121-1124. 19

Jin Y., Singh R.P. (2006) Resistance in US wheat to recent eastern African isolates of 1

Puccinia graminis f. sp. tritici with virulence to resistance gene Sr31. Plant 2

Disease 90:476-480. 3

Jin Y., Szabo L.J., Pretorius Z.A., Singh R.P., Ward R., Fetch T. (2008) Detection of 5

virulence to resistance gene Sr24 within race TTKS of Puccinia graminis f. sp. 6

tritici. Plant Disease 92:923-926. 7

Jin Y., Singh R.P., Ward R.W., Wa n y e r a R., Kinyua M., Njau P., Pretorius Z.A. (2007) 9

Characterization of seedling infection types and adult plant infection responses of 10

monogenic Sr gene lines to race TTKS of Puccinia graminis f. sp. tritici. Plant 11

Disease 91:1096-1099. 12

Johnson J.W., Barnett R.D., Cunfer B.M., Buntin G.D., D.E. Bland (2002) Registration 14

of 'AGS 2000' wheat. Crop Science 42:661-661. 15

Joshi A.K., Mishra B., Chatrath R., Ferrara G.O., Singh R.P. (2007) Wheat improvement 17

in India: present status, emerging challenges and future prospects. Euphytica 18

157:431-446. 19

Kolmer J.A., Jin Y., Long D.L. (2007) Wheat leaf and stem rust in the United States. 1

Australian Journal of Agricultural Research 58:631-638. 2

Lehmensiek A., Campbell A.W., Williamson P.M., Michalowitz M., Sutherland M.W., 4

and Daggard G.E. (2004) QTLs for black-point resistance in wheat and the 5

identification of potential markers for use in breeding programmes. Plant 6

Breeding 123:410-416. 7

Leonard K.J., Szabo L.J. (2005) Stem rust of small grains and grasses caused by 9

Puccinia graminis. Molecular Plant Pathology 6:99-111. 10

Mago, R., Bariana H.S., Dundas I.S., Spielmeyer W., Lawrence G.J., Pryor A.J., and Ellis 12

J.G. (2005) Development of PCR markers for the selection of wheat stem rust 13

resistance genes Sr24 and Sr26 in diverse wheat germplasm. Theoretical and 14

Applied Genetics 111:496-504. 15

Murphy J.P., Navarro R.A., Leath S., Bowman D.T., Weisz P.R., Ambrose L.G., Pate 17

M.H., Fountain M.O. (2004) Registration of 'NC-Neuse' wheat. Crop Science 18

44:1479-1480. 19

Niewoehner, A.S., Leath S. (1998) Virulence of Blumeria graminis f. sp. tritici on winter 1

wheat in the eastern United States. Plant Disease 82:64-68. 2

Nyquist W.E. (1962) Differential fertilization in the inheritnce of stem rust resistance 4

in hybrids involving a common wheat strain derived From Triticum timopheevi. 5

Genetics 47:1109-1124. 6

Pathan A.K., Park R.F. (2007) Evaluation of seedling and adult plant resistance to stem 8

rust in European wheat cultivars. Euphytica 155:87-105. 9

Pretorius Z.A., Singh R.P., Wagoire W.W., P a y n e T.S. (2000) Detection of virulence to 11

wheat stem rust resistance gene Sr31 in Puccinia graminis f. sp. tritici in Uganda. 12

Plant Disease. 84:203. 13

Roelfs A.P., Martens J.W. (1988) An international nomenclature for Puccinia 15

graminis f.sp. tritici. Phytopathology 78:526-533. 16

Saal B., Wricke G. (1999) Development of simple sequence repeat markers in rye (Secale 18

cereale L.). Genome 42:964-972. 19

Schlegel, R., Korzun V. (1997) About the origin of 1RS∙1BL wheat-rye chromosome 1

translocations from Germany. Plant Breeding. 116:537-540. 2

Singh R., Hodson D., Jin Y., Huerta-Espino J., Kinyua M., Wanyera R., Njau P., and 4

Ward R. (2006) Current status, likely migration and strategies to mitigate the 5

threat to wheat production from race Ug99 (TTKS) of stem rust pathogen. CAB 6

Reviews: Perspectives in Agriculture, Veterinary Science, Nutrition and Natural 7

Resources 1. 8

Singh R.P., Kinyua M.G., Wanyera R., Njau P., Jin Y., Huerta-Espino J. (2007) Spread 10

of a highly virulent race of Puccinia graminis tritici in Eastern Africa - 11

Challenges and opportunities. Wheat Production in Stressed Environments 12:51- 12

57. 13

Stakman E.C., Steward D.M., Loegering W.Q. (1962) Identification of physiologic races 14

of Puccinia graminis var. tritici. U.S. Department of Agriculture Research 15

Service E-617. 16

The T.T, Gupta R.B., Dyck P.L. , Appels R., Hohmann U., McIntosh R.A. (1992) 18

Characterization of stem rust resistant derivatives of wheat cultivar Amigo. 19

Euphytica 58:245-242 20

Tsilo T.J., Jin Y., Anderson J.A. (2008) Diagnostic microsatellite markers for the 2

detection of stem rust resistance gene Sr36 in diverse genetic backgrounds of 3

wheat. Crop Science. 48:253-261. 4

Villareal R.L., Rajaram S., Mujeebkazi A., and Deltoro E. (1991) The Effect of 6

chromosome 1B/1R on the yield potential of certain spring wheats (Triticum 7

aestivum L.). Plant Breeding. 106:77-81. 8

Villareal R.L., Banuelos O., Mujeeb-Kazi A., Rajaram S. (1998) Agronomic 10

performance of chromosomes 1B and T1BL.1RS near-isolines in the spring bread 11

wheat Seri M82. Euphytica 103:195-202. 12

Wanyera R., M.G. Kinyua, Y. Jin, R.P. Singh (2006) The spread of stem rust caused by 14

Puccinia graminis f. sp. tritici, with virulence on Sr31 in wheat in Eastern Africa. 15

Plant Dis. 90:113-113. 16

Table 1. Number of U.S. wheat lines from different regions and market classes having stem rust resistance genes Sr24, Sr36 and Sr1RAmigo , and Sr31 identified with molecular markers. Growing region Market class Sr24 Sr36 Sr1RAmigo Sr31 Number of lines Eastern Soft Winter 25 70 30 64 303 Great Plains Hard Spring 15 1 0 7 120 Hard Winter 50 3 27 29 195 Western Soft Spring 0 0 0 0 20 Soft Winter 0 0 0 5 40 Hard Spring 0 0 0 8 84 Hard Winter 0 0 0 0 31 Totals 90 74 57 110 793

Table 2. Species of origin, chromosomal location, diagnostic markers and expected size in base pairs of amplified fragments for selection of Sr24, Sr36, Sr1RAmigo and Sr26. Gene Origin Marker Fragment sizes (bp) Chromosome Sr24 Agropyron elongatum BARC71 83, 88,101 3DL Sr36 Triticum timophevi WMC477 187 2DL Sr1RAm Secale cereale SCM9 224 1RL Sr26 Agropyron elongatum Sr26#43 207 6AL

Table 3. Lines resistant to TTKSK and TTKST without marker alleles for Sr24, Sr36 or Sr1RAmigo. TTKS TTKST Njoro, Postulated Line Class (IT) (IT) Kenya gene GA0116366E22 SRW 2† 2+ * AGS2020 SRW 2 nd 40MR-10MS * GA98401-5E45 SRW S/2+‡ 23 80S * GA9912096E33 SRW S/2+ 2++ 80S * GA9913716E12 SRW 2+ 2+ 0 * BZ9W022051 HRW 2 2 10R/MR SrTmp CO03W269 HRW 2+ 2 10R SrTmp Millennium27, ALS1 HRW 2++ Tmp 2+ 10R SrTmp MT0495 HRW 2+ 2++ 30MR SrTmp * indicates the source of resistance is unknown †IT = 0; hypersensitive resistance, 1 resistant, 2 moderately resistant, 3 moderately susceptible, 4 susceptible (Stakman et al., 1962) ‡ indicates heterogeneity in infection type nd= no data

Table 4. Effective Sr1RAmigo resistance in the presence of Sr24 virulence. A plus indicates the Xbarc71, Sr24 genotype or the Xscm9, Sr1RAmigo translocation genotype Line Class Sr24 Sr1RAmigo TTKSK (IT) TTKST (IT) Arapahoe HRW + - 2† S‡ Trego HRW + - 2 S Nuplains HRW + - 2 S TX03A0563 HRW + - 2 S AR9800151 SRW + - 2 S M c C o r m i c k SRW + + 2 2 VA05W168 SRW + + 2 2 IL01-11934 SRW + + 2- 2 MD01W233068 SRW + + 2- 2 TX99A01531 HRW + + 2 2+ †IT = 0; hypersensitive resistance, 1 resistant, 2 moderately resistant, 3 moderately susceptible, 4 susceptible (Stakman et al., 1962) ‡ S indicates a fully susceptible phenotype

Table 5. Stem rust resistance gene pyramids present. A plus indicates the line possesses the marker alleles associated with the Sr gene. Line Class Sr24 Sr1RAmigo Sr36 TTKSK (IT) TTKST (IT) VA05W-65 SRW + + + 2/0†‡ 2/0 SD00W024 HRW + + + * * VA05W168 SRW + + - 2 2 VA05W78 SRW + + - 2 2 TX99A01531 HRW + + - 2 2+ M c C o r m i c k SRW + + - 2 2 MD01W233061 SRW + + - 2 2 VA05W168 SRW + + - 2 2 VA05W78 SRW + + - 0/2 2 IL01-11934 SRW + + - 2- 2 MD01W233068 SRW + + - 2- 2 OK102 HRW + + - 2- 2 KS980386-6-3-#1 HRW + + - * * KS970274-14-* 9 HRW + + - * * TRIBUTE SRW + + - 2 2+ TN604 SRW + - + 0/S * VA05W65 HRS + + + 0/2 0/2 VA05W313 SRW - + + 0;/2 0 * indicates that phenotypic data are unavailable † indicates heterogeneity in infection type ‡IT = 0; hypersensitive resistance, 1 resistant, 2 moderately resistant, 3 moderately susceptible, 4 susceptible (Stakman et al., 1962)

A 1 2 B 1 2 C 1 2 3 D 1 2

500bp

224bp 207bp 187bp 208bp

Figure 1. PCR amplification of markers for selection of Sr36, Sr1RAmigo, Sr24 and Sr26. (A) Fragments amplified by WMC477 for the detection of Sr36; Lane 1 NC-Neuse, (Sr36), 2 Yecoro Rojo. (B) Fragments amplified by SCM9 for the detection of Sr1RAmigo and Sr31; Lanes 1 TAM107 (T1RS∙1AL), 2 AGS2000 (T1RS∙1AL). (C) Fragments amplified by Sr24#12 for the detection of Sr24; Lane 1 McCormick (Sr24), 2 MN031604 (Sr24), 3 Lakin. (D) Fragments amplified by Sr26#43 for the detection of Sr26; Lane 1 Eagle (Sr26), 2 Milennium.

1 2 3 4 5 6 7 8

105 bp

101 bp

88 bp

83 bp

Figure 2. PCR amplification of BARC71 for the identification of Sr24 and differentiation between the 3DL/3Ae translocation derived from ‘Agent’ and the 1BL∙1BS-3Ae translocation derived from ‘Amigo’ of Sr24. Lane 1 Ernest, Sr24+ (3DL); 2 Keene, Sr24+ (3DL), 3 Amidon, Sr24-; 4 Choteau Sr24-; 5 McCormick, Sr24+ (1BS); 6 Millenium, Sr24+ (1BS); 7 Roane, Sr24-; 8 Lakin Sr24-

Chapter 3

Genetic Characterization of Stem Rust Resistance Gene Sr22

Abstract

The stem rust resistance gene Sr22 confers resistance to the Puccinia graminis f.sp. tritici race Ug99 that developed in Uganda and is an immediate threat to world wheat production. Sr22 is present on a chromosomal translocation derived from

Triticum boeoticum Boiss., which is homoeologous to the A genome of Triticum aesitivum L. Linkage analysis of SSR loci on 7AL was performed to identify the loci most closely linked to Sr22. Individuals with reduced T. boeoticum segments due to recombination between wheat chromosome 7AL and the Sr22 introgression were identified with SSR markers in F2:3 populations of crosses between the germplasm stock

Sr22Tb and the hard white winter wheat lines 2174 and Lakin. Analysis of F3:4 populations derived from F2 recombinants, led to identification of individuals with even smaller alien introgressions. Recombinant lines with smaller translocation segments will provide a more agronomically desirable source of Sr22 stem rust resistance in hard winter wheat germplasm that can be readily deployed utilizing molecular markers.

Introduction

Diploid and tetraploid relatives of modern bread wheat (Triticum aestivum L.) are an important source of novel genes conferring resistance to disease and insect pests.

Several genes for resistance to stem rust caused by Puccinia graminis f.sp. tritici Pers.

(Pgt) have been introgressed from related species, including the adult plant resistance gene, Sr2 from ‘Yaroslav” emmer wheat (McFadden, 1930), Sr24 from Agropyron elongatum (Host.) Beauv. (Sears, 1972), Sr31from Secale cereale L. and Sr36 from

Triticum timopheevii Zhuk. (Nyquist, 1962). These resistance genes have been widely deployed to provide stem rust resistance in nearly all wheat growing areas of the world.

Other effective Sr genes transferred from wheat relatives including Sr32, Sr39 and Sr40 remain undeployed in modern agriculture due to reduced agronomic performance associated with their presence on large alien chromosome introgressions (Singh et al.,

2008).

The resistance gene Sr22 that was introgressed into common wheat from wild and cultivated forms of diploid einkorn wheat provides effective resistance to all races of stem rust (The, 1973). The Sr22 gene was identified in the T. boeoticum Boiss. (syn.

Triticum monococcum ssp. aegilopoides (Link) (MacKey) accession G-21 (Gerechter-

Amati et al. 1971) and the T. monococcum L. (syn. Triticum monococcum ssp. monococcum L.) accession RL5244 (Kerber and Dyck, 1973). Introgressions from the two different donor species differ in the amount of alien chromatin present. The T.

boeoticum introgression into the common wheat cultivar Steinwedel includes nearly the entire long arm and a portion of the short arm of chromosome 7A. The T. monococcum introgression into Marquis consists of the distal region of 7AL (Kerber and Dyck, 1973;

Paull et al., 1994). Detriments to agronomic performance have been associated with these introgressions, including depression of yields and delayed heading date (Paull et al.,

1994). In addition, reduced transmission of gametes carrying Sr22 has been obvserved for both the T. boeoticum and T. monococcum introgressions. The compromise of agronomic performance and reduced transmission of Sr22 are attributed to the presence of the gene on the substantial chromosome introgression segment derived from the A- genome donors.

Reduced recombination between chromosomes of the A genome of T. aestivum and the A genome of einkorn wheat relatives has been well documented (Dubkovsky et al., 1995; Luo et al., 2000). The Ph1 gene of hexaploid wheat inhibits homoeologous pairing (Riley and Chapman, 1958) prevents recombination between homoeologous chromosomes. Consequently, introgressed chromosome segments from species with chromosomes that are not completely homologous may be inherited in large linkage blocks carrying substantial amounts of alien chromatin.

The effects on yield associated with the Sr22 introgressions vary, depending on the genetic background and the donor germplasm. In near isogenic lines (NILs) of different genetic backgrounds carrying Sr22, The et al. (1988) reported a mean yield that

was not significantly lower than non-Sr22 controls. However, the results varied among genotypes, with some Sr22 NILs yielding as much as 10% less than non-Sr22 controls.

Additionally, the presence of Sr22 is associated with a delay in heading date. Paull et al.

(1994) reported that lines without the T . boeoticum introgression headed at 58.7 days after planting whereas lines heterozygous and homozygous for the introgression headed at 64.7 and 65.8 days, respectively.

The associated detriments to agronomic performance have hindered the large scale deployment of Sr22 worldwide. Currently, no virulence to Sr22 exists in collections of Puccinia graminis f. sp. tritici (Pgt). This gene is of particular interest in contemporary wheat breeding as it confers resistance to Pgt race TTKS and its derivatives that have emerged from Eastern Africa (Singh et al., 2008). Analysis of the levels of recombination between the Sr22 introgression on chromosome 7A and identification of recombinant lines carrying reduced levels of T. boeoticum chromatin will aid in the deployment of Sr22 into modern cultivars. Identification of polymerase chain reaction (PCR)-based markers linked to Sr22 will be useful for marker-assisted deployment of the gene. In this study, recombination between simple sequence repeat

(SSR) markers located on wheat chromosome 7A and the introgression segment from T. boeoticum allowed for genetic linkage analysis of Sr22 and the identification of linked flanking marker loci for use in marker-assisted selection. In addition, recombinants have

been identified that carry reduced amounts of T. boeoticum chromatin that may prove useful in the deployment of Sr22 in breeding populations.

Materials and Methods

Plant Materials

For linkage analysis of Sr22, two F2:3 mapping populations were developed. The resistant parent for both crosses was the germplasm Sr22Tb with the pedigree T. boeoticum/2*Spelmar//2*Steinwedel. Seed of this Steinwedel selection that has the 7A chromosomal translocation from T. boeoticum carrying the stem rust resistance gene,

Sr22 (The, 1973) was provided by Dr. Yue Jin, USDA-ARS Cereal Disease Lab, St. Paul,

MN. A population of 138 F2:3 lines, referred to as U5615-F2:3, was developed from the cross of Sr22Tb with the hard red winter wheat cultivar 2174 (PI602595). An additional population of 140 F2:3 lines, referred as the U5616- F2:3, was developed from a cross between Sr22Tb and the hard winter wheat cultivar Lakin (PI617032). From these populations, three individual F2:3 lines having recombination between distal markers

Xcfa2019 and proximal marker Xbarc121 in the Sr22 region were selected for development of additional mapping populations and identification of recombinants having smaller introgression segments. Linkage analysis was perfomed using SSR loci segregating in F3:4 populations developed from the F2 individuals U5615-72, U5615-98 and U5616-20. From recombinant plant U5615-72 that was homozygous for 2174 alleles at the distal Xcfa2019 locus and segregating for Sr22, 104 F3:4 lines were developed

(population U5615-72-F3:4). From the U5615-98 recombinant that is homozygous for

2174 alleles at the proximal Xbarc121 locus and segregating for Sr22, 142 F3:4 lines were developed (population U5615-98-F3:4). A population of 152 F3:4 lines were derived from the recombinant F2 individual U5616-20 that is homozygous for Lakin alleles at the

Xbarc121 locus and heterozygous for Sr22 (population U5616-20-F3:4).

The chromosomal assignment of the SSR loci to the long arm of chromosome 7A was done using Chinese Spring (CS) nullisomic-tetrasomic and ditelosomic stocks including nullisomic 7A-tetrasomic 7B (N7AT7B), nullisomic 7A-tetrasomic 7D

(N7AT7D), nullisomic 7B-tetrasomic 7A (N7BT7A), nullisomic 7D-tetrasomic 7A

(N7DT7A), nullisomic 7D-tetrasomic 7B (N7DT7B); ditelosomic lines included 7AS

(Dt7AS) and 7AL (Dt7AL) (Sears and Sears 1979). Using the nullisomic-tetrasomic and ditelosomic stocks, the SSR marker loci could be assigned to 7AL. Physical mapping of the positions of SSR loci on the chromosome arm was done using Chinese Spring chromosomal deletion stocks of 7AL. The chromosomal deletion lines are designated by the chromosome arm carrying the deletion and the length of the terminal deletion as a fraction length (FL) of the whole arm. The lines used in deletion mapping include 7AL-

15 (0.99), 7AL-9 (0.89), 7AL-13 (0.83), 7AL-8 (0.83), 7AL-21 (0.74), 7AL-10 (0.49),

7AL-1 (0.39) (Endo and Gill 1996). Using the chromosomal deletion stocks, the physical deletion bin location of the SSR loci on 7AL could be determined. All anueploid and deletion stocks were obtained from the Wheat Genetics and Genomics Resource Center at

Kansas State University, Manhattan, KS.

Stem Rust Evaluations

Phenotypic pathogen assays were done with Puccinia graminins f.sp. tritici, race RKQQ that is avirulent to Sr22. Ten seedlings of all F2:3 and F3:4 lines and the resistance and susceptible parents were grown in a soil-peat mixture in 10 cm x 10 cm square pots in a greenhouse. Urediniospores were removed from liquid N2 storage and heat-shocked in a 40°C water bath for 5 minutes. Spores were suspended in Soltrol 170 oil (Chevron Phillips, The Woodlands, TX) and airbrushed onto two to three leaf stage seedlings. Inoculated plants were incubated in a dew chamber at 20°C, 100% relative humidity for 16 hours and then grown in the greenhouse at 18°C with 16 hour photoperiod. Infection types (IT’s) described by Stakman et al. (1962) were assessed 14 days after inoculation. Infection types of 0;, 1, and 2 indicate a resistant response. An IT of 0; indicates hypersensitive resistance. An IT of 1 indicates minimal pustule development with necrosis and an IT of 2 indicates moderate pustule development with necrosis or chlorosis. Infection types of 3 and 4 are indicated by a lack of necrosis or chlorosis and the development of large pustules, representing host susceptibility. Rust evaluations were repeated in a second experiment such that a total of twenty seedlings from each line were evaluated for resistance reaction and zygocity of the Sr22 locus.

Molecular Marker Analyses

Genomic DNA was extracted from the F2 plants that gave rise to the F2:3 lines and from a bulk of 10 plants of each F3:4 line. DNA isolations were done according to a protocol modified from Pallota et al. (2003) or using a QIAGEN DNeasy® 96 Plant kit

(QIAGEN, Valencia, CA) according to the manufacturer’s instructions.

The 2174, Lakin and Sr22Tb parents were screened for polymorphism with 42

SSR markers previously mapped to the long arm of chromosome 7A including: Xbarc29,

Xbarc49, Xbar108 Xbarc121, Xbarc174, Xbarc192, Xbarc195, Xbarc221, Xcfa2019,

Xcfa2040, Xcfa2123, Xcfa2257, Xcfd20, Xcfd68, Xcfd193, Xgwm4, Xgwm10, Xgwm63,

Xgwm260, Xgwm276, Xgwm282, Xgwm332, Xgwm344, Xgwm473, Xgwm554, Xgwm573,

Xpsp3094, Xwmc17, Xwmc96, Xwmc116, Xwmc139, Xwmc107, Xwmc139 Xwmc273,

Xwmc346, Xwmc426, Xwmc488, Xwmc525, Xwmc607, Xwmc633, Xwmc790, and

Xwmc809. Initially, a touchdown PCR profile was used to screen markers for polymorphism. Markers amplifying polymorphic fragments with a touchdown profile were run on aneuploid and deletion stocks to validate their chromosomal location and then evaluated on mapping populations. Ideal primer annealing conditions for markers not amplifying with a touchdown profile were identified using a temperature gradient on an Eppendorf Mastercycler® Gradient (Eppendorf, Hamburg, Germany) and then run on aneuploid and deletion stocks. Thirteen markers amplifying polymorphic fragments

between Sr22Tb and both hard winter wheat parents and assigned to choromosome 7AL were used for linkage analysis of segregating populations (Table 1).

The touchdown PCR profile consisted of an initial denaturation for 5 minutes at

95°C; followed by 15 cyles of a 45 second denaturation at 95°C; 65°C annealing decreasing by 1°C each cycle; and a 72°C extension for one minute, followed by 25 cycles of 50°C annealing temperature. Markers requiring specific annealing temperatures were run with an initial denaturation at 95°C for five minutes followed by 15 cyles of a

45 second denaturation at 95°C, 45 seconds of primer annealing at the temperature specific to the marker (Table 1), a 72°C extension for one minute and a final extension of four minutes at 72°C.

The PCR reactions included forward primers of SSR markers labeled with fluorophore dyes including 6-FAM, VIC, NED and PET. Reactions were performed in a

12 µL volume consisting of 7.15µL H2O, 1.20 uL of 10X Taq Buffer (10 mM Tris-HCL,

50 mM KCl, 1.5 mM MgCl2, pH 8.3), 0.96 µL of dNTPs (100 µM mixture of each dNTP), 0.60 µL, of pooled forward and reverse primers (10µM), 0.09 µL ( 0 .45 U) Taq polymerase and 2 µL of 10-40 nM genomic DNA. Marker PSP3094 was amplified using

M13 labeling protocol where the reaction consists of 5.26 µL of water, 1.20 uL of 10X

Taq Buffer (10 mM Tris-HCL, 50 mM KCl, 1.5 mM MgCl2, pH 8.3), 0.96 µL of dNTPs

(100 µM mixture of each dNTP), 0.96 µL of M13 tailed forward primer (1 µM), 0.72 µ L of reverse primer (10 µM), 0.72 µL of M13 primer with either a 6-FAM, VIC or PET

fluorophore label (10 µM), 0.18µL (0.9U) Taq polymerse and 2.0 µL of 10-40 nM genomic DNA.

All reactions were carried out in a 384-well format on an Eppendorf

Mastercycler® thermalcycler (Eppendorf, Hamburg, Germany). Sizing of PCR products was performed by capillary electrophoresis using an ABI3130xl Genetic Analyzer

(Applied BioSystems, Foster City, CA). Analysis of PCR fragments was performed using GeneMarker 1.60 software (SoftGenetics, State College, PA). Genetic linkage analysis was performed using MAPMAKER v 3.0 (Lander et al. 1987). Marker order was established using multipoint analysis and the Haldane centimorgan function with a minimum LOD of 3.0. Segregation of marker loci and resistance reaction was evaluated using a χ2 goodness-of-fit test.

Results

Phenotypic Evaluation

The presence of Sr22 in mapping populations was evidenced by the IT of 1+ exhibited b y Sr22Tb parent and resistant plants upon challenge with Pgt race RKQQ.

The parent 2174 was moderatel y susceptible to stem rust and exhibited an IT of 2+ to 3 upon challenge with RKQQ. The susceptible parent Lakin also exhibited an IT of 2+ to

3. In segregating populations, individuals homozygous or heterozygous for Sr22

exhibited a 1 to 1+ phenotype. Individuals with an IT of 2+ or greater in the populations were considered susceptible (sr22sr22).

Analysis of segregation ratios indicated that resistance to stem rust in all the populations was due to a single dominant gene (Table 2). Although reduced transmission of Sr22 had been previously reported by Paull et al. (1994), only in the U5615-20-F3:4 was there a significant deviation from the 1 resistant : 2 segregating : 1 susceptible segregation ratio expected for a single dominant gene (Table 2). In the U5616-20-F3:4,

26% more homozygous susceptible plants were observed than expected. Further, in the

U5616-20-F3:4 population segregation for Sr22 deviated from the expected 1:2:1 with a

χ2 value of 8.36 ( p = 0.003).

Genetic and physical mapping of Sr22Tb introgression

Of the 42 SSR loci evaluated, 13 were polymorphic between Sr22Tb and the hard winter wheat parents 2174 and Lakin. Linkage analysis of these makers on the U5615-

F2:3 and the U5616-F2:3 populations placed the markers onto two linkage groups. Nine of the SSR markers were placed onto a linkage group with Sr22. These loci included

Xbarc121, Xcfa2019, Xcfa2123, Xgwm260, Xgwm332, Xpsp3094, Xwmc607, Xwmc633 and Xwmc790 (Figure1). Four other loci, including Xcfa2257, Xgwm344, Xwmc346 and

Xwmc525, were placed in a linkage group that was unlinked to Sr22 (map not shown).

These four markers have previously been located terminally on 7AL (Miranda et al.,

2007; Perugini et al. 2008).

The orders of markers in the Sr22 linkage group agree in both populations (Figure

1). However, the nine linked markers covered a region of 5.6 cM in the U5615-F2:3 population, compared to a distance of 12.6 cM in the U5616-F2:3 population. Thus, approximately twice as much recombination was observed in the population derived from the cross Sr22Tb/Lakin as was observed in the Sr22Tb/2174 population. In both populations markers closely flanking Sr22 were identified. In U5615-F2:3, Sr22 was flanked proximally by Xcfa2123 at a distance of 0.6 cM and distally at 0.4 cM by co- segregating markers Xwmc633, Xgwm332 and Xwmc790. In the U5616-F2:3 population, proximal marker Xcfa2123 was 4.2 cM from Sr22 and the co-segregating markers

Xwmc633, Xgwm332 and Xwmc790 were 1.8 cM distal.

Marker evaluation of anueploid and deletion lines indicate that the markers linked to Sr22 are located on chromosome 7A. Nullisomic analysis of SSR loci placed

Xbarc121, Xcfa2019, Xcfa2123, Xgwm260, Xgwm332, Xpsp3094, Xwmc607, Xwmc633, and Xwmc790 on chromosome 7A. Ditelosomic analysis assigned all SSR loci to the long arm of 7A, with the exception of Xgwm260, which was located on the short arm of

7A. The fragment amplified by marker WMC607 was present only in the deletion stock

7AL-1 (FL = 0.39), indicating the presence of Xwmc607 in the proximal region of 7AL between the centromere and the 7AL-1 breakpoint (Figure 4). The Xbarc121 locus is

located between deletion breakpoints 7AL-10 (FL = 0.49) and 7AL- 21 (FL = 0.74) and the Xcfa2123 locus maps in the sub-microscopic region between deletion breakpoints

7AL-8 and 7AL-13, both of which have FL = 0.83. A fragment is amplified by marker

CFA2123 in deletion line 7AL-13 but there is not amplification product observed for line

7AL-8. The loci distal to Sr22, Xwmc633, Xgwm332, Xwmc790, Xpsp3094 and Xcfa2019 are located between the breakpoints 7AL-20 (FL = 0.89) and 7AL-15 (FL = 0.99) (Figure

4).

Six SSR loci in the linkage group with Sr22 including Xgwm260, Xbarc121,

Xwmc633, Xgwm332, Xwmc790 and Xcfa2019 were polymorphic between PI41081 and

PI27018 (different accessions of the cultivar Steinwedel) and the donor line Sr22Tb having the T. boeoticum introgression in a Steinwedel background (Tabel 3). These data, combined with our physical mapping of the markers, confirm the result of The et al.

(1994) that the transfer from T. boeoticum in Sr22Tb involves at least 89% of the long arm of chromosome 7A as well as a portion of the short arm. Our data place Sr22 in the deletion interval between the 0.83 and 0.99 breakpoints.

Although more recombination was observed in the U5616-F2:3 population than the

U5615-F2:3 population, a comparison of the physical location of markers and genetic distances indicate low levels of recombination in both populations, particularly in the proximal portion of the chromosome. Only 3.5 and 5.6 cM of genetic distance were observed in U5615-F2:3 and U5616-F2:3 populations, respectively, between markers

Xgwm260 and Xcfa2123 that span 83% of the long arm of chromosome 7A plus a portion of the short arm. In the region distal to Sr22, 1.1 and 1.0 cM of genetic distance was observed between SSR markers located in the deletion interval between the breakpoints for 7AL-9 (FL= 0.89) and 7AL-15 (FL= 0.99). The small genetic distances observed over large physical distances suggest low levels of recombination between the T. boeoticum introgression segment and wheat chromosome 7A.

Linkage analysis of F3:4 recombinant populations

In order to develop lines having reduced segments from T. boeoticum, additional populations of F3:4 were developed from three recombinant F2 individuals (U5615-72,

U5615-98, and U5616-20; Figure 5). Linkage analysis of the F3:4 populations was done at loci for which the U5615-72, U5615-98, and U5616-20 individuals were heterozygous.

This also allowed us to compare recombination in the populations derived from plants having different size introgression from T. boeoticum. In all three F3:4 populations, markers orders were consistent with the orders observed in the F2:3 populations (Figure

2).

The U5615-72-F3:4 population consisted of 104 lines that segregated for Sr22, proximal markers Xbarc121, Xcfa2123, and Xgwm260 as well as distal markers

Xgwm332, Xpsp3094, Xwmc607, Xwmc633 and Xwmc790. Recombination occurred between the Xcfa2019 locus and Sr22 in the previous generation; thus, the U5615-72-F3:4

population was fixed for 2174 alleles in the region of 7AL distal to the Xcfa2019 locus

(Figure 5). The 14.6 cM of genetic distance observed in the U5615-72-F3:4 population between locus Xgwm260 and locus Xpsp3094 was greater than the 5.2 cM observed in the

U5615-F2:3 population (Figure 2). In general, genetic distance was greater in the region proximal to Sr22, although marker Xcfa2123 co-segregated with Sr22 in this population.

The allele amplified by CFA2123 from 2174 is one base pair larger than that amplified from the Sr22Tb parent (Table 1). As a result, heterozygous individuals could not be reliably distinguished from homozygous resistant individuals, and marker CFA2123 was scored as dominant for the larger Sr22Tb allele. In this population, recombination was observed between the flanking locus Xwmc633, that was at a genetic distance of 1.5 cM distal to Sr22, and markers Xgwm332 and Xwmc790.

The U5615-98 F3:4 consisted of 142 lines that segregated for Sr22 and distal makers Xcfa2019, Xgwm332, Xpsp3094, Xwmc607, Xwmc633 and Xwmc790. This population was fixed for 2174 alleles at the SSR loci proximal to Sr22 (Figure 5). An increased level of recombination was also observed in this population. The genetic distance between Sr22 and Xcfa2019 was 7.6 cM in the U5615-98 F3:4 (Figure 2) compared to 2.8 cM in the U5615-F2:3. The most closely linked marker, Xwmc633, was located 2.1 cM distal to Sr22.

Markers segregating in both U5615 derived F3:4 populations included Xwmc633,

Xgwm332, Xwmc790 and Xpsp3094. Genotypic data for the two U5615 F3:4 populations

were pooled to obtain a better estimate of marker order and genetic distance. The order was the same as observed in the previous maps, with the most closely linked marker,

Xwmc633, located 1.9 cM distal to Sr22 (Figure 3).

The U5616-20 F3:4 population segregated for Sr22 and markers Xcfa2123,

Xgwm260, Xgwm332, Xpsp3094, Xwmc633, and Xwmc790. The U5616-20-F3:4 population was fixed for Lakin alleles at loci proximal to Xcfa2123 and segregated at all distal loci (Figure 5). A larger genetic distance between Xcfa2123, and Sr22 of 6.6 cM was found in this population compared to the U5615 F3:4 populations. The locus

Xwmc633 was at a genetic distance of 3.1 cM from Sr22 in this population. The other distal loci were tightly linked with a distance of only 0.3 cM between Xwmc633 and

Xgwm332. No recombination was identified between Xcfa2019, Xgwm332, Xpsp3094 and Xwmc790.

In the F3:4 populations, no deviations from the expected 1:2:1 for SSR loci occurred at the 0.05 confidence level. However, in the U5615-72- F3:4 population, an average 28% reduction of lines homozygous for Sr22Tb alleles was observed over all loci. This was accompanied by an increase in the number of lines homozygous and segregating for the susceptible parent allele. This population segregated for the region from Xgwm260 to Xpsp3094 that covered much of chromosome 7A. In the U5616-20-

F3:4 population that segregated for the region from Xcfa2123 to Xcaf2019, the number of lines homozygous for the Lakin parent allele at all marker loci ranged from 24 to 30

greater than expected. This effect was not observed in the U5615-72-F3:4 population in which only the distal portion of the chromosome from Sr22 to Xcfa2019 was segregating.

Identification of recombinants

Several recombinant genotypes were identified that carry reduced levels of T. boeoticum chromatin associated with Sr22. In the U5615-98-F3:4 population that was fixed for 2174 loci at marker loci proximal to Sr22, seven genotypes were identified that are resistant to stem rust and in which recombination had occurred between Sr22 and

Xcfa2019. Three recombinants are homozygous resistant, fixed for T. boeoticum alleles at Xwmc633, Xgwm332, Xwmc790 and Xpsp3094 (Figure 5) including U5615-98-112,

U5615-98-128 and U5615-98-136. Four recombinants are heterozygous for Sr22,

Xwmc633, Xgwm332, Xwmc790 and Xpsp3094, and homozygous for 2174 alleles at

Xcfa2019 including U5615-98-48, U5615-98-104, U5615-98-120 and U5615-98-144.

These lines can be used to develop further recombinants in subsequent generations of inbreeding. In the U5615-20 population, three genotypes were identified as resistant to stem rust yet homozygous for Lakin alleles at flanking markers Xcfa2123 and Xwmc633

(Figure 5). Two of these recombinants are heterozygous for Sr22, including U5616-20-

009 and U5615-20-047. One Lakin recombinant is homozygous for Sr22, U5615-20-

241. For these genotypes homozygous for susceptible alleles at loci flanking Sr22 it will

be necessary to identify new markers more closely linked to Sr22 for use in marker- assisted selection.

Discussion

Although the stem rust resistance gene Sr22 provides resistance to all races of

Pgt, it has not been widely used in agriculture. This is likely due to detrimental effects associated with introgression from the A genome diploid species. Our data support the hypothesis of Paull et al (1994) that the proximal regions of both the short and long arm of chromosome 7A are comprised of T. boeoticum chromatin in lines having Sr22 derived from this source. Paull et al. (1994) reported an RFLP locus polymorphic between T. boeoticum and hexaploid wheat in the distal region of 7AL, Xpsr119, was not found to be transmitted from T .boeoticum. They speculated that the terminal region of 7AL in the

Sr22 carrying lines is likely of T. aestivum origin while the proximal region was derived from T. boeoticum. The 13 SSR loci mapped in this study segregated into two unlinked groups, although all markers except Xgwm260 were located on the long arm of 7A. Four of the SSR loci that are located in the most distal region of 7AL were not linked to Sr22 and underwent much greater levels of recombination than observed in the Sr22 region

(data not shown). These data agree with the hypothesis that the terminal region of the long arm of 7A in the Sr22Tb parent are of T. aestivum origin.

Low levels for recombination were observed in the F2 populations when compared with previous intraspecific SSR maps of chromosome 7A. Somers et al.

(2004) reported the distance between Xgwm260 and Xcfa2019 to be 37 cM in the cross

Opata x Synthetic. The same interval in our study represented 5.6 cM in the U5615-F2:3 population and 12.6 cM in the U5616-F2:3 population. Although both populations exhibited suppressed recombination, greater recombination was observed in the F2:3 population from the cross Sr22Tb/Lakin than the Sr22Tb/2174 suggesting genetic background effects on recombination.

Recombination was found to be greater in the lines carrying reduced T. boeoticum introgression segments. The replacement of some T. boeoticum chromatin with T. aestivum chromatin may be responsible for the increased recombination in the F3:4 populations. This is evidenced in the U5615-98-F3:4 population, for which only a terminal segment of no more than 16% of the chromosome arm of T. boeoticum was present. Recombination between segregating markers in U5615-98-F3:4 was five times that observed in the U5615-F2:3 population and 2.5 times greater than the U5615-72-F3:4 population where at least 89% of the long arm was present.

The and McIntosh (1975) reported reduced transmission of Sr22 in pooled populations of lines with Sr22 from both T. monococcum and T. boeoticum. Segregation following the 1:2:1 ratio for 7AL alleles including Sr22 was observed in both of our F2:3 populations. However, segregation for Sr22 did not follow a 1:2:1 ratio in the U5616-20-

F3:4 population in which an abundance of homozygous susceptible individuals were identified. Although reduced transmission of Sr22 in breeding populations was reported

(Paull et al. 1994), our data suggests that this may depend on the make-up of the introgression segment and the genetic background. The genetic element responsible for aberrant transmission is present in the U5616-20-F3:4 population although there is a reduced amount of alien chromatin present. Sr22 may be transmitted more normally in the recombinants identified in this study having further reduced T. boeoticum-derived segments. Genetic background effects may be responsible for reduced transmission as segregation was normal in the 2174 populations.

The recombinant lines carrying reduced T. boeoticum chromatin identified in this study will be useful in the future use of Sr22 in breeding programs. Using these lines as donor parents should help to meliorate the negative effects associated with Sr22. These recombinant lines are being backcrossed to hard and soft winter wheat cultivars to produce populations where the effects of the introgression on agronomic performance can be evaluated. The marker loci employed in this study will prove useful in the marker assisted selection of Sr22 in breeding programs. Markers identified in this study can be used for selection among the progeny of the recombinant lines from the U5615-98 population to further reduce the size of the T. boeoticum chromosome segment. The most closely linked marker locus to Sr22 across all populations was the distal locus Xwmc633 and should prove the most useful in marker assisted selection. The proximal flanking

marker Xcfa2123 could also be used but greater recombination between this locus and

Sr22 is observed. The use of marker-assisted selection in progeny from crosses with the

U5616-20 recombinants will require the development of markers more closely linked to

Sr22. The identification of recombinants with reduced chromatin and the availability of molecular markers for use in marker assisted selection will help to facilitate the deployment of Sr22 in wheat germplasm.

References

Dubcovsky J., Luo M.C., Dvorak J. (1995) Differentiation between homoeologous

chromosomes 1A of wheat and 1A(M) of Triticum monococcum and its

recognition by the wheat Ph1 locus. Proceedings of the National Academy of

Sciences of the United States of America 92:6645-6649.

Endo T.R., Gill B.S. (1996) The deletion stocks of wheat. Journal of Heredity. 87: 295-

307.

Gerechte-Amati Z.K., Wahl I., Vardi A., Zohary D. (1971) Transfer of stem rust seedling

resistance from wild diploid einkorn to tetraploid durum wheat by means of a

triploid hybrid bridge. Euphytica 20:281

Kerber E.R., Dyck P.L. (1973) Inheritance of stem rust resistance transferred from

diploid wheat (Triticum monococcum) to tetraploid and hexaploid wheat and

chromosome location of gene involved. Canadian Journal of Genetics and

Cytology 15:397-409.

Lander E.S., Green P., (1987) Construction of mulit-locus genetic linkage maps in

humans. Proceedings of the National Academy of Sciences of the United States of

America. 84: 2363 – 2367.

Luo M.C., Yang Z.L., Kota R.S., Dvorak J. (2000) Recombination of chromosomes

3A(m) and 5A(m) of Triticum monococcum with homeologous chromosomes 3A

and 5A of wheat: The distribution of recombination across chromosomes.

Genetics 154:1301-1308.

McFadden E.S. (1930) A successful transfer of emmer characteristics to vulgare wheat.

Journal of the American Society of Agronomy 22: 1020-1034.

Miranda L.M., Perugini L., Srnic G., Brown-Guedira G., Marshall D., Leath S.,

Murphy J.P. (2007) Genetic mapping of a Triticum monococcum derived

powdery mildew derived resistance gene in common wheat. Crop Science

47: 2323-2329.

Pallotta M.A., Warner P., Fox R.L., Kuchel H., Jefferies, S.J., Langridge P. (2003)

Marker assisted wheat breeding in the southern region of Australia. Proceedings

of the Tenth International Wheat Genetics Symposium (1-6 September, 2003,

Paestum, Italy) p.789- 791.

Paull J.G., Pallotta M.A., Langridge P., The T.T. (1994) RFLP markers associated with

Sr22 and recombination between chromosome 7A of bread wheat and the diploid

species Triticum boeoticum. Theoretical and Applied Genetics 89:1039-1045.

Perugini L.D., Murphy J.P., Marshall D., Brown-Guedira G. (2007) Pm37, a new broadly

effective powdery mildew resistance gene from Triticum timopheevii.

Theoretical and Applied Genetics 11:417-425.

Riley R., Chapman V. (1958) Genetic control of the cytologically diploid behavior of

hexaploid wheat. Nature 182:713-715.

Schlegel, R., V. Korzun. 1997. About the origin of 1RS.1BL wheat-rye chromosome

translocations from Germany. Plant Breed. 116:537-540.

Singh R.P., Hodson D.P., Huerta-Espino J., Jin Y., Njau P., Wanyera R., Herrera-Foessel

S.A., Ward R.W. (2008) Will stem rust destroy the world's wheat crop?, p. 271-

309 Advances in Agronomy, Vol 98, Vol. 98. Elsevier Academic Press Inc, San

Diego.

Somers D.J., Issac P., Edwards K., (2004) A high density microsatellite map for bread

wheat (Triticum aestivum L.). Theoretical and Applied Genetics. 109: 1105-1114.

100

Stakman E.C., Steward D.M., Loegering W.Q. (1962) Identification of physiologic races

of Puccinia graminis var. tritici. U.S. Dep. Agric. Res. Serv. E-617.

The T.T., (1973) Chromosome location of genes conditioning stem rust resistance

transferred from diploid to hexaploid wheat. Nature New Biol 241:256

The T.T., Latter B.D.H., McIntosh R.A., Ellison F.W., Brennan P.S., Fisher J., Hollamby

G.J., Rathjen, A.J., Wilson R.E. (1988) Grain yields of near-isogenic lines with

added genes for stem rust resistance. In: Miller T.E., Koebner R.M.D. (eds) Proc

7th Int Wheat Genet Symp. Institute for Plant Science Research, Cambridge, pp

901-906

The T.T., McIntosh R.A. (1975) Cytogenetical Studies in Wheat. 8. Telocentric mapping

and linkage studies involving Sr22 and other genes on chromosome 7AL.

Australian Journal of Biological Sciences 28:531-538.

101

Table 1. Markers used for linkage analysis of Sr22, primer sequences, parent allele sizes in base pairs and primer annealing temperatures (Tm) in degrees Celsius.

Sr22 allele 2174 allele Lakin allele Marker primer sequence (5' - 3') (bp) (bp) (bp) Tm (C°) GWM260 F - GCCCCCTTGCACAAATC 153 163 163 60 R - CGCAGCTACAGGAGGCC WMC607 F - ATATATGCCCATGAAGCTCAAG 89 143 143 Touchdown R - GATCGAGCTAAAGCTGATACCA BARC121 F - ACTGATCAGCAATGTCAACTGAA 195 217 217 49 R - CCGGTGTCTTTCCTAACGCTATG CFA2123 F - CGGTCTTTGTTTGCTCTAAACC 234 235 241 Touchdown R - ACCGGCCATCTATGATGAAG WMC633 F - ACACCAGCGGGGATATTTGTTAC 117 221 229 49 R - GTGCACAAGACATGAGGTGGATT GWM332 F - AGCCAGCAAGTCACCAAAAC 193 195 275 Touchdown R - AGTGCTGGAAAGAGTAGTGAAGC WMC790 F - AATTAAGATAGACCGTCCATATCATCCA 89 209 100 49 R - CGACAACGTACGCGCC PSP3094 F - ACCAGGAGAGATAGTCGTTAGGC 228 149 183 Touchdown R - TTTGTACACCATGATAGGCTTCC CFA2019 F - GACGAGCTAACTGCAGACCC 238 217 217 60 R - CTCAATCCTGATGCGGAGAT

102

Table 2. Segregation of Sr22 in F2:3 and F3:4 populations, including number of lines (n), the observed and expected genotypic frequencies, and χ2 and p-values for fit to the 1:2:1 segregation expected for a single dominant gene. The proportionate difference between observed Sr22 genotypes and expected is given as a measurement of increased or reduced transmission of Sr22.

Population n genotype observed expected difference χ2 p-value

U5615-F2:3 138 Sr22Sr22 35 34.5 0.01 0.4928 0.7816 Sr22sr22 72 69 0.04 sr22sr22 31 34.5 -0.10

U5616- F2:3 139 Sr22Sr22 40 34.75 0.15 2.6115 0.6726 Sr22sr22 72 69.5 0.04 sr22sr22 27 34.75 -0.22 U5615-72-F3:4 104 Sr22Sr22 21 26 -0.19 1.5962 0.4502 Sr22sr22 53 52 0.02 sr22sr22 30 26 0.15 U5615-98-F3:4 140 Sr22Sr22 34 35 -0.03 0.0429 0.9788 Sr22sr22 71 70 0.01 sr22sr22 35 35 0.00 U5616-20-F3:4 152 Sr22Sr22 40 38 0.05 8.36 0.003 Sr22sr22 64 76 -0.16 sr22sr22 48 38 0.26

103

Table 3. Alleles of the Sr22Tb donor parent, the cultivar Steinwedel and the hard winter wheat cultivars 2174 and Lakin for six markers. Numbers indicate allele sizes in base pairs.

Cultivar Xgwm260 Xbarc121 Xwmc633 Xgwm332 Xwmc790 Xcfa2019 Sr22Tb 153 195 117 193 88 239 Steinwedel PI41081 146 234 260 184 152 237 Steinwedel PI27018 146 234 260 184 152 237

104

Figure 1a-b. Genetic linkage of U5615 and U5616 F 2:3 populations segregating for stem rust resistance from Sr22 on wheat chromosome 7AL.

(a) Sr22Tb/2174 (b) Sr22 Tb/Lakin U5615-F U5616-F 2:3 2:3

gwm260 gwm260 1.1 wmc607 0.7 3.0 barc121

1.7 cfa2123 0.4 wmc607 0.6 Sr22 barc121 wmc633 0.4 gwm332 2.2 0.7 wmc790 0.4 psp3094 cfa2019 cfa2123

4.2

Sr22 1.8 wmc633 gwm332 wmc790 0.5 0.5 psp3094 cfa2019

105

Figure 2a-c. Genetic linkage of F3:4 populations derived from recombinant F2 individuals in the U5615 and U5616 populations.

(a) Sr22Tb/2174 (b) Sr22Tb/2174 (c) Sr22Tb/Lakin

U5615-72-F3:4 U5615-98-F3:4 U5616-20-F3:4

gwm260 Sr22 cfa2123 2.1 3.2 wmc633 gwm332 6.6 0.4 wmc790 wmc607 2.2

psp3094 3.2 Sr22

2.9 3.1 barc121

cfa2019 wmc633

4.9 0.3 gwm332

0.7 cfa2123 Sr22 wmc790 psp3094 1.5 cfa2019 wmc633 0.5 gwm332 1.0 wmc790 psp3094

106

Figure 3. Genetic linkage map of SSR loci linked to Sr22 and segregating in F3:4 populations U5615-72 and U5615-98.

Sr22

1.9

wmc633 0.2 gwm332 0.2 wmc790

0.6

psp3094

107

Figure 4. Physical map of SSR loci linked to Sr22 on the long arm of chromosome 7A. Names of deletion lines and the deletion breakpoints shown at left.

7AL Physical Map

wmc607

7AL-1 0.39

7AL-21 0.49

barc121

7AL-21 0.74

7AL-13 0.83 cfa2123

7AL-9 0.89 wmc633 gwm332, wmc790 psp3094, cfa2019 7AL-15 0.99

108

Figure 5. Physical maps of the long arm of chromosome 7A showing Triticum boeoticum chromatin in recombinants identified from 2174/Sr22Tb (U5615) and Lakin/Sr22Tb (U5616) F2:3 and F3:4 populations. Regions shaded in gray represent regions of T. boeoticum chromatin. Deletion breakpoints are indicated as solid lines. Line names and fraction lengths are at left. C indicates the position of the centromere.

7AL Physical U5615-72 U5615-98 U5616-20 U5615-98-120 U5616-20-154 c

wmc607

7AL-1 0.39

7AL-10 0.49

barc121

7AL-21 0.74

7AL-13 0.83 cfa2123 Sr22 7AL-9 0.89 wmc633 gwm332 wmc790 7AL-15 0.99 psp3094 cfa2019

109