Structural Insight Into the Environment of the Serine/Threonine Protein Kinase Domain of Titin

Structural insight into the environment of the serine/threonine protein kinase domain of titin

Dissertation

zur Erlangung des akademischen Grades des Doktors der Naturwissenschaften an der Universitat¨ Konstanz Mathematisch-Naturwissenschaftliche Sektion Fachbereich Biologie

vorgelegt von Simone Muller¨

Tag der mundlichen¨ Prufung:¨ 30.03.2006 1. Referent: Prof. Dr. Wolfram Welte 2. Referent: PD Dr. Matthias Wilmanns 3. Referent: Prof. Dr. Helmut Plattner

Contents

Abbreviations ix

Summary xi

Zusammenfassung xiii

1 Introduction 1 1.1 Striated muscle and the structure of the sarcomere ...... 1 1.2 Titin ...... 3 1.3 Structure and function of titin ...... 5 1.3.1 Z-disc and anchoring of titin ...... 5 1.3.2 I-band and elasticity of the sarcomere ...... 5 1.3.3 A-band and the thick filament ...... 6 1.3.4 M-line and anchoring function ...... 7 1.4 Modules in titin: Ig and FnIII domains ...... 7 1.5 Titin kinase ...... 9 1.6 Titin kinase signalling pathway ...... 11 1.7 Disease association of a titin kinase mutation ...... 12 1.8 Muscle-specific RING finger protein MURF ...... 13 1.9 NBR1 ...... 15 1.10 The protein p62 ...... 16 1.11 Aim of the work ...... 17

2 The A-band immunoglobulin domains A168 and A169 19 2.1 Introduction ...... 19 2.1.1 Immunoglobulin domains ...... 19 2.1.2 Interaction of titin A168-A169 and MURF ...... 20 2.2 Materials and Methods ...... 21 2.2.1 Purification of A168-A169 ...... 21 2.2.2 Preparation of Selenomethionine incorporated A168-A169 22 2.2.3 Purification of titin A168-A169-A170 ...... 22 2.2.4 Crystallisation of A168-A169-A170 and diffraction tests . 23 2.2.5 Crystallisation of A168-A169 ...... 24 2.2.6 A168-A169 X-ray data collection and processing . . . . . 24 2.2.7 Structure solution of A168-A169 ...... 27 2.2.8 Tilt and twist angle in module assembly ...... 28 2.3 Results ...... 29

i ii Table of Contents

2.3.1 Overall structure of titin A168-A169 ...... 29 2.3.2 Comparison of the Ig domains ...... 30 2.3.3 Comparison with other tandem Ig domains ...... 32 2.4 Discussion ...... 34 2.4.1 Insertion loop in A169 between strand A and A’ . . . . . 34 2.4.2 Continuous β-strand bridging the two domains ...... 37 2.4.3 Interdomain geometry ...... 37 2.4.4 Tight connection and rigid structure ...... 38 2.4.5 Relevance of the bulge in the function of A168-A169 . . . 39

3 The titin M-band immunoglobulin domain M1 41 3.1 Introduction ...... 41 3.1.1 MLCK and related kinases surrounded by FnIII and Ig domains ...... 41 3.1.2 Two examples of a subsequent Ig domain of a kinase - telokin and the twitchin Ig domain Ig26 ...... 41 3.1.3 Scope of the work ...... 42 3.2 Materials and Methods ...... 43 3.2.1 Preparation of titin M1 ...... 43 3.2.2 Crystallisation of titin M1 ...... 44 3.2.3 Data collection and processing ...... 44 3.2.4 Molecular replacement and refinement ...... 45 3.3 Results ...... 46 3.3.1 Purification and crystallisation of M1 ...... 46 3.3.2 Structure solution and refinement ...... 46 3.3.3 Overall structure of titin M1 ...... 47 3.3.4 Comparison with telokin and twitchin Ig26 ...... 49 3.4 Discussion ...... 50

4 NBR1 PB1 in complex with p62 PB1 53 4.1 Introduction ...... 53 4.1.1 Protein interaction via PB1 domains ...... 53 4.1.2 PB1 domains – Mode of interaction ...... 54 4.1.3 Speciﬁcity determination of PB1 domains ...... 56 4.1.4 Overview of PB1 domain structures ...... 56 4.2 Materials and Methods ...... 56 4.2.1 Preparation of NBR1 PB1 ...... 56 4.2.2 Crystallisation of NBR1 PB1 ...... 58 4.2.3 X-ray data collection and processing of NBR1 PB1 . . . . 58 4.2.4 Structure solution of NBR1 PB1 by MAD ...... 59 4.2.5 Preparation of p62 PB1 and mutants ...... 60 4.2.6 Complex formation of NBR1 PB1 and p62 PB1 (DDAA) 61 4.2.7 Crystallisation of the PB1 complex ...... 62 4.2.8 Data collection and processing of the PB1 complex . . . . 63 4.2.9 Structure solution of the PB1 complex ...... 64 4.3 Results ...... 65 4.3.1 Puriﬁcation and crystallisation of NBR1 PB1 ...... 65 Table of Contents iii

4.3.2 Preparation of p62 PB1 and mutants ...... 65 4.3.3 Complex formation of NBR1 PB1 and p62 PB1 (DDAA) 66 4.3.4 Crystallisation and data collection of the PB1 complex . . 66 4.3.5 Structure solution and refinement of NBR1 PB1 . . . . . 67 4.3.6 Overall structure of NBR1 PB1 ...... 67 4.3.7 Comparison with other PB1 domains ...... 69 4.3.8 Interaction surface of NBR1 PB1 domain ...... 70 4.3.9 Structure solution and refinement of the PB1 complex . . 72 4.3.10 Cadmium chloride bound to p62 PB1 ...... 75 4.3.11 Overall structure of the heterodimer ...... 75 4.3.12 Heterodimeric PB1 domain interface ...... 76 4.3.13 Comparison with other heterodimeric PB1 complexes . . 79 4.4 Discussion ...... 80 4.4.1 Cadmium bound to H66 in p62 PB1 ...... 80 4.4.2 The three classes of PB1 domains ...... 80 4.4.3 Model of the p62 PB1 homodimer ...... 80 4.4.4 Affinity of the NBR1/p62 PB1/PB1 heterodimer complex 81 4.4.5 p62 interactions ...... 81 4.4.6 Biological relevance of the NBR1/p62 heterodimer complex 81

5 Conclusions 83

A Titin kinase 87 A.1 Introduction ...... 87 A.2 Materials and Methods ...... 87 A.2.1 Cloning ...... 87 A.2.2 Expression of titin kinase ...... 88 A.2.3 Puriﬁcation ...... 90 A.2.4 Western blot ...... 91 A.3 Results and Discussion ...... 91 A.3.1 Cloning ...... 91 A.3.2 Expression ...... 92 A.3.3 Puriﬁcation ...... 93 A.3.4 Titin kinase truncations and mutations ...... 95

References 99

List of Figures

1.1 Striated muscle ...... 2 1.2 Titin ...... 4 1.3 Titin kinase ...... 10 1.4 Titin kinase downstream signalling pathway ...... 12 1.5 Domain architecture of MURF family members ...... 14

2.1 Titin kinase downstream signalling pathway ...... 21 2.2 Diﬀraction patterns of A168-A169-A170 ...... 25 2.3 Crystals of A168-A169 ...... 27 2.4 Overall structure of the tandem Ig domains ...... 29 2.5 Superimposition of the tandem Ig domains ...... 30 2.6 Schematic representation of the continuous β-strand interaction . 33 2.7 Tandem domain interface ...... 34 2.8 Structure-based sequence alignment of titin Ig-like domains . . . 35 2.9 Superimposition of A169 and 1Flt-D2 ...... 36

3.1 Schematic domain arrangement representation ...... 42 3.2 Titin kinase downstream signalling pathway ...... 43 3.3 Crystal of M1 ...... 44 3.4 Ramachandran plot for the M1 structure ...... 47 3.5 Structure-based sequence alignment on M1 ...... 48 3.6 Structure of M1 ...... 48 3.7 Electron density of M1 ...... 49 3.8 Superimposition of M1, telokin, and Ig26 ...... 50 3.9 Model of titin kinase with M1 ...... 52

4.1 Titin kinase downstream signalling pathway ...... 54 4.2 Model of PB1 interaction ...... 55 4.3 Crystals of the PB1 domain of NBR1 grown in ammonium sulphate 58 4.4 Crystals of the PB1 complex ...... 63 4.5 SEC of p62 PB1 (DA) and p62 PB1 (DDAA) ...... 66 4.6 SEC of the complex of the two PB1 domains ...... 67 4.7 ITC of NBR1 and p62 (DDAA) ...... 68 4.8 Structure of NBR1 PB1 ...... 70 4.9 Electron density of NBR1 PB1 ...... 72 4.10 Superimposition of PB1 domains ...... 73 4.11 Sequence alignment of PB1 domains ...... 74

v vi List of Figures

4.12 Anomalous diﬀerence fourier map ...... 75 4.13 Overall structure of the NBR1/p62 PB1/PB1 heterodimer . . . . 76 4.14 Stereo view of the main PB1 interaction site ...... 77 4.15 Electrostatic potential of NBR1 PB1 and p62 PB1 ...... 78 4.16 Molecular interaction between p62 PB1/PB1 heterodimer . . . . 78

A.1 Expression of 170TK and TKM1 ...... 93 A.2 Anion exchange chromatography of 170TK and TKM1 ...... 94 A.3 SDS-PAGE of 170TK and TKM1 ...... 95 List of Tables

1.1 Interaction partners of p62 ...... 17

2.1 X-ray data collection statistics of A168-A169 ...... 26 2.2 Selenium sites in A168-A169 ...... 27 2.3 Reﬁnement statistics of A168-A169 ...... 28 2.4 Structural comparison of titin Ig domains ...... 31

3.1 X-ray data and structure reﬁnement statistics of M1 ...... 45 3.2 Structural comparison of titin M1 ...... 49

4.1 PDB entries for PB1 domain structures ...... 57 4.2 X-ray data collection statistics of NBR1 PB1 ...... 59 4.3 Primers for cloning of p62 PB1 and mutants ...... 60 4.4 X-ray data collection statistics of the PB1 heterodimer complex . 64 4.5 Reﬁnement statistics of NBR1 PB1 ...... 69 4.6 Structural comparison of PB1 domains ...... 71 4.7 Reﬁnement statistics of the PB1 complex ...... 72

A.1 Primers for titin kinase cloning ...... 89 A.2 Titin kinase constructs ...... 92 A.3 Summary of titin kinase construct preparation ...... 95

vii

Abbreviations

1 A˚ 10−10 m aPKC atypical protein kinase C Bicine N,N-Bis(2-hydroxyethyl) glycine DESY Deutsches Elektronen Synchrotron E. coli Escherichia coli DTT dithiothreitol FnIII fibronectin type-III HEPES 4-(2-hydroxyethyl), 1-piperazineethane sulphonic acid IEX Ion Exchange Ig immunoglobulin IMAC immobilized metal ion chromatography IPTG isopropyl-β-D-thiogalactopyranoside ITC isothermal titration calorimetry LB Luria-Bertani MAD multiwavelength anomalous dispersion MPD 2-methyl-2, 4-pentanediol MURF muscle-specific RING finger protein NBR1 next to BRCA1 PAGE polyacrylamide gel electrophoresis PB1 phox and bem1 PBS phosphate-buffer saline PCR polymerase chain reaction PDB protein data bank PEG polyethylenglycol PEG-MME polyethylenglycol-monomethylesther pI isoelectric point r.m.s.d. root mean square deviation rpm rounds per minute SDS sodium dodecyl sulfate SEC size exclusion chromatography TEV tobacco etch virus TK titin kinase Tris tris-(hydroxymethyl)-aminoethane UBA ubiquitin associated

Summary

The giant muscle protein titin is the largest polypeptide known and constitutes, in addition to actin and myosin, the third ﬁlament system in the striated muscle sarcomere. Titin spans half of the sarcomere and interacts with many proteins along all its range. Three regions of accumulated interaction and associated signalling are found in the Z-disc, the I-band and the M-line, respectively.

Among about 300 predicted domains in titin, to date only one has been identi- ﬁed to comprise a catalytic function, a serine/threonine kinase domain within the M-line, referred to as ’titin kinase’. The aim of this work was to unravel the structural, molecular context of titin kinase in terms of adjacent titin domains and downstream signalling domains.

The tandem immunoglobulin domains A168-A169 are located amino-terminal to titin kinase at the end of the A-band within titin in the sarcomere. The structure solved in this work implies that these two domains are tightly connected via a continuous β-strand by merging of the last β-strand of A168 with the ﬁrst of A169. A bulge is formed between two strands in A169 at a position which is rather uncommon for an insertion in an immunoglobulin (Ig) domain. This insertion is involved in the interaction of A168-A169 with muscle speciﬁc RING protein MURF-1. In addition to A168-A169, the carboxy-terminal domain to titin kinase, the Ig domain M1 was solved.

The proteins NBR1 and p62 are substrates of titin kinase, and NBR1 links p62 to titin kinase. The interaction of NBR1 and p62 within the signalling pathway was studied here. Both proteins interact via their N-terminal PB1 domain, a recently identiﬁed interaction domain. The structure of NBR1 PB1 was solved as a single domain and in complex with p62 PB1. The complex reveals two patches of positive (p62 PB1) and negative (NBR1 PB1) charge. The aﬃnity of the complex is in the nanomolar range.

This work extends our structural knowledge about titin immunoglobulin domains. Furthermore, it contributes to the understanding of interaction among domains of the titin kinase downstream signalling pathway. Thereby, it may help to unravel the connection between signalling related to titin stretching and transcription control in the context of muscle degradation.

xiii

Zusammenfassung

Das Muskelprotein Titin ist das größtebekannte Polypeptid und stellt neben Aktin und Myosin das dritte Filamentsystem im Sarkomer des gestreiften Muskels dar. Titin erstreckt sich über die Hälftedes Sarkomers und interagiert mit vielen Proteinen entlang seiner Spannweite. Drei Regionen mit gehäuftvor- kommenden Interaktionen und damit verbundener Signalübertragung befinden sich in der Z-Scheibe, der I-Bande und der M-Linie.

Unter den etwa 300 vorhergesagten Domänenin Titin, wurde bis heute nur eine mit katalytischer Funktion identifiziert, eine Serine/Threonin Kinase Domänein der M-Linie, auch als ”Titin Kinase” bezeichnet. Das Ziel dieser Arbeit war es, den strukturellen, molekularen Zusammenhang von Titin Kinase bezüglich be- nachbarter Titin Domänenund nachgeschalteter Signaldomänenaufzudecken.

Die Tandem Immunoglobulin DomänenA168-A169 befinden sich N-terminal zu Titin Kinase am Ende der A-Bande in Titin im Sarkomer. Die in dieser Arbeit gelösteStruktur impliziert, dass diese Domänenüber ein durchgehendes β-Faltblatt verknüpftsind, durch Verschmelzung des letzten β-Faltblattes von A168 mit dem ersten β-Faltblatt von A169. An einer füreine Immunoglobulin- (Ig) Domäneeher ungewöhnlichen Stelle ist eine Auswölbungzwischen zwei Faltblätternin A169 ausgebildet. Diese Insertion ist an der Interaktion von A168-A169 mit dem muskel-spezifischen RING Protein MURF-1 beteiligt. Zusätzlich zu A168-A169 wurde die sich C-terminal zu Titin Kinase befind- ende Domäne,die Ig DomäneM1, gelöst.

Die Proteine NBR1 und p62 sind Substrate von Titin Kinase, und NBR1 verbindet p62 mit Titin Kinase. Hier wurde die Interaktion von NBR1 und p62 im Signalweg untersucht. Beide Proteine interagieren über ihre N-terminale PB1 Domäne,eine erst kürzlich identifizierte Domäne. Die Strukturen von NBR1 PB1 als einzelne Domänesowie im Komplex mit p62 PB1 wurden gelöst. Der Komplex lässtjeweils zwei Stellen positiver (p62 PB1) und negativer (NBR1 PB1) Ladung erkennen. Die Affinitätdes Komplexes befindet sich im nanomo- laren Bereich.

Die vorliegende Arbeit erweitert damit unser strukturelles Wissen über Im- munoglobulin Domänenvon Titin. Darüber hinaus trägtsie zum Verständnis von Interaktionen zwischen Domänendes Titin Kinase Signalweges bei. Dies könnte helfen, die Beziehung von Signalen, die durch Dehnung von Titin aus- gelöstwerden, und Transkriptionskontrolle im Zusammenhang von Muskelab- bau aufzudecken.

Chapter 1

Introduction

Movement is one of the basic phenomena of life including deliberate movements as well as many essential body functions in animals and men. The crucial role in generating motility falls to muscles. Basically three different types of muscle are found in the vertebrate musculature. Smooth muscles are so called non-striated muscles and are mainly responsible for the contraction of hollow organs such as the gastrointestinal tract, the vascular system and the uterus. Another type of muscle is the striated heart muscle or cardiac muscle. Owing to its prominent task of maintaining blood circulation it features some unique characteristics. These differentiate it from the third type of muscle, the striated skeletal muscle often briefly called striated muscle. As the name implies the skeletal muscle is connected to the skeleton. Its contraction underlies deliberate control and is stimulated by the nervous system, in contrast to the cardiac and smooth muscle. Skeletal muscles generate force applying two specialised types of contraction. These are isotonic contraction for moving and isometric contraction for generating tension. The key to a deeper understanding of muscle functionality lies in their structural assembly, briefly outlined in the following.

1.1 Striated muscle and the structure of the sarcomere

Striated muscle are assembled by bundles of muscle fibres composed of multi- nucleated cells which are typically 10 to 100 µm in diameter and several centime- ters in length. The muscle fibres are composed by parallel myofibrils separated by the sarcoplasmic reticulum and transversely running tubules (T tubules). A repetitive contractile unit in the myofibrils, called the sarcomere, packs end to end from one Z-disc to the next over a distance of 2.0-2.5 µm. The repetitive unit emerges from the ordered arrays of myosin (thick) filaments and actin (thin) filaments. In the light microscope, the myofibrils display a characteristic pattern of alternating striation where the dark A-band (anisotrop) and the light I-band (isotrop) reflect the behaviour in polarised light (Figure 1.1). Cross-sections along the sarcomere show the arrangement of thick and thin filaments. In the part of the A-band where both filaments overlap, the actin filaments adapt a trigonal arrangement to fit to the hexagonal array of myosin

1 2 Introduction

Figure 1.1: Striated muscle and the components of the sarcomere. Top panel: electron micrograph of a longitudinal seciton of a skeletal muscle myofibril (adapted from Stryer, 1996). Bottom panel: schematic presentation of the sarcomere with its main components: the thin filament, the thick filament and titin, shown in blue (adapted from Tskhovrebova and Trinick, 2004).

filament, whereas their organisation towards the Z-disc gradually changes into a tetragonal array (Squire, 1997). During muscle contraction the length of the I- band changes, while that of the A-band remains the same. The sliding filament model, which was independently proposed by A. Huxley and R. Niedergerke (1954) and H. Huxley and J. Hanson (1954), explains the generation of force. During muscle contraction the thick and thin filament slide past one another without changing the length of the filaments. Thereby, force is developed based on the interaction of the actin and myosin filaments during sliding. The mechanism of the so-called cross-bridge cycle is ATP-dependent and describes the movement of the myosin-heads along the actin filament (Geeves and Holmes, 2005). The thin filament comprises a number of proteins and the globular 42 kDa actin (G-actin) is a major component. Single G-actin (globular) molecules polymerise in an ATP-dependent manner into the double-helical (filament) F- actin. Tropomyosin and three troponin subunits, TnC (Ca2+-binding), TnI (inhibitory), and TnT (tropomyosin-binding), represent the other constituents 1.2 Titin 3 of the thin filament. Tropomyosin extends over seven actin subunits and troponin regulates its binding to myosin. In the presence of Ca2+, TnC binds Ca2+ resulting in a conformational change and movement of tropomyosin into a position with exposure of the myosin-binding site. The myosin molecule consists of a globular head region, the S1 fragment, which can interact with actin and possesses ATPase activity. The S2 fragment comprises a flexible region of regulatory and essential myosin light chains (MLC) and a tail which combines via a long coiled-coil region with tails of other molecules. A thick filament is assembled by approximately 300 myosin molecules with the myosin heads pointing away from the M-line where they are anchored. Besides the thick and the thin filament, a third filament system exists. In contrast to the actin and myosin filament, it is constituted by a single protein called titin. This immensely large protein extends over half of the sarcomere length. Due to its size and location, titin can interact with numerous sarcomeric proteins existing in the different regions (Granzier and Labeit, 2004; Miller et al., 2004). Therefore, it is capable of regulating diverse processes. The giant protein is involved in muscle assembly and elasticity of the sarcomere as well as signalling pathways through interaction with binding partners. Since titin fulfills many diverse functions, it has been entitled a molecular ’control freak’ (Trinick and Tskhovrebova, 1999). Titin will be described in more detail in the following.

1.2 Titin

Titin, also known as connectin, has been identified as a large component of striated muscle (Maruyama et al., 1977; Wang et al., 1979). The flexible molecule spans half of the sarcomere (Nave et al., 1989) from the Z-disc to the M-line and is more than 1 µm long. With a molecular weight of up to 3.7 MDa in the skeletal N2A titin, the giant protein titin is the largest polypeptide known (Labeit and Kolmerer, 1995). In human, titin is encoded by a single gene on chromosome 2, region 2q31 (Labeit et al., 1990), containing 363 exons coding together for 38138 residues (GenBank accession code: AJ277892) (Bang et al., 2001). The sequence of human titin was first published in 1995 (Labeit and Kolmerer, 1995) and was completed by additional PEVK exons and three unique I-band exons (termed novex-1 to -3) in 2001 (Bang et al., 2001). The sequence revealed several splicing alternatives leading to different lengths of the titin I-band. Hence, size differences in splice variants are manifested above all in the shorter cardiac titin isoforms with a molecular weight of approximately 3 MDa. The larger skeletal isoforms show sizes from 3.3 MDa in psoas muscle up to 3.7 MDa in soleus muscle (Maruyama, 1997). Besides titin occurring in striated muscle of vertebrates, titin-like proteins are also present in invertebrate muscle, however, with a lower molecular weight. These members of the titin family (Tskhovrebova and Trinick, 2003) are 4 Introduction iue12 oansrcueo h in ucepoenttn anycmoe fimngoui I)dmis(e)adfibronectin and (red) domains (Ig) Gregorio immunoglobulin of from composed (adapted mainly (white) titin, domains protein muscle (FnIII) giant III the type of structure Domain 1.2: Figure tal. et 1999). , 1.3 Structure and function of titin 5 known as I-connectin (from crayfish, 2 MDa; Fukuzawa et al., 2001), D-titin (from Drosophila melanogaster, 2 MDa; Machado and Andrew, 2000; Zhang et al., 2000), kettin (about 0.5-0.7 MDa; Lakey et al., 1993; Hakeda et al., 2000; Kolmerer et al., 2000), stretchin (Caenorhabditis elegans; Champagne et al., 2000), twitchin (Benian et al., 1989) and projectin (0.8-1.0 MDa; Ayme- Southgate et al., 1991). Titin is a modular protein and 90 % of its length consists of two modules, each comprising about 90 to 100 residues. The type I are the fibronectin III (FnIII) and type II are the immunoglobulin (Ig) domains (Labeit et al., 1990). These form repetitive patterns, characteristic for their distinct occurrence within titin in the sarcomere. The designated unique sequences and other elements con- stitute the remaining 10 %, among it a single serine/threonine kinase domain (Figure 1.2).

1.3 Structure and function of titin

Titin can be divided functionally and structurally according to the location of its regions within the sarcomere.

1.3.1 Z-disc and anchoring of titin The amino-terminal part of titin is anchored in the Z-disc by overlapping of molecules of two neighbouring sarcomeres. Titin in the Z-disc consists of Ig- like domains and a tissue-dependent number of the 45-residue motif called Z- repeat, which is diﬀerentially spliced (Sorimachi et al., 1997; Gautel et al., 1996). A characteristic protein of the Z-disc is α-actinin which cross-links actin- ﬁlaments of opposing polarity through its actin-binding domain (Schroeter et al., 1996; Blanchard et al., 1989) with titin binding to the Z-repeats via its C-terminal EF-hand (Sorimachi et al., 1997). Additionally, α-actinin interacts with other Z-disc proteins such as FATZ (Faulkner et al., 2000), actinin- associated LIM-protein (Xia et al., 1997) and ZASP (Faulkner et al., 1999). Another protein which interacts with titin (Z1 and Z2, Ig domains) in the Z- disc is telethonin (Mues et al., 1998), also called T-cap (Gregorio et al., 1998), which presumably plays a role in the anchoring of the N-terminus of titin. Functional connections beyond the contractile unit, laterally to the sarcomere or longitudinally to the neighbouring sarcomere, are transmitted via protein networks at the costameres and the intercalated discs, respectively, which are linked to the Z-disc (Miller et al., 2004).

1.3.2 I-band and elasticity of the sarcomere The extensibility of the sarcomere is physiologically important for muscle contraction. Therefore, an elastic connection between the thick and thin ﬁlaments is required, and this task is maintained by titin (Horowits et al., 1986). Together with the passive tension, a force that restores the sarcomere to its slack length, titin has been assigned as ’molecular spring’ with the basis in the I-band of titin. 6 Introduction

The I-band titin is composed of different segments: a constitutive I-band region consisting of tandem Ig domains, the N2-region, and the PEVK region, which is rich in proline (P), glutamic acid (E), valine (V) and lysine (K). The PEVK region itself comprises of pattern of the PPAK motifs (pI about 10) and polyE segments (pI about 3-4) which despite large differences, results in a pI of about 5 (Greaser, 2001). Tissue-specific alternative splicing leads to the large size differences in the titin isoforms, predominantly caused by a differing amount of tandem Ig domains in the non-constitutive region of up to 53 extra Ig domains in the skeletal muscle (Freiburg et al., 2000). Furthermore, the PEVK region in the stiffer cardiac muscle is much shorter (163 residues) than in the skeletal muscle (up to 2174 residues), implying importance in elasticity and passive tension. Differential splicing results in the N2A, the N2B and the combination N2BA isoform. The N2A isoform usually occurs in skeletal muscle, whereas the N2B and N2BA isoforms are found exclusively in cardiac muscle (Labeit and Kolmerer, 1995; Freiburg et al., 2000). Coexpression of the cardiac N2A and N2BA isoforms at different ratios have been described to extend independently in the half-sarcomere (Trombitáset al., 2001). The components of the I-band act as a molecular spring (Labeit and Kolmerer, 1995; Linke and Granzier, 1998; Granzier and Labeit, 2002) generating passive tension during extension. Extension beyond the resting length entails first in a straightening of the tilted tandem Ig domains, followed by an unfolding of the PEVK sequence and N2 regions. The PEVK region has long been assumed to present a coiled unstructured conformation. However, some evidence of a preferred conformation of repeats of a 28-residue motif within the PEVK, which adapt a polyproline II helix, has been provided (Greaser, 2001; Ma et al., 2001).

1.3.3 A-band and the thick filament In the A-band, titin is involved in the control of the thick filament assembly and its centering in the A-band (Whiting et al., 1989). Hence, it has been ascribed to act as a template in the sarcomere assembly. The A-band constitutes the largest part of titin with almost 2 MDa and a length of approximately 0.8 µm (Labeit and Kolmerer, 1995). Notably, this is the only part in titin, where the FnIII domains are found. The FnIII domains are embedded in two types of super- repeats together with the Ig-like domains (Gautel et al., 1996; Gautel, 1996). In the D-zone (Figure 1.2) the super-repeat is composed of 5 FnIII and 2 Ig- like domains with a pattern of Ig-FnIII-FnIII-Ig-FnIII-FnIII-FnIII-FnIII. This pattern is repeated seven times (Gautel, 1996; Gregorio et al., 1999). In the C-zone (Figure 1.2) of the A-band (Labeit and Kolmerer, 1995), however, the eleven times repeated pattern Ig-FnIII-FnIII-Ig-FnIII-FnIII-FnIII-Ig- FnIII-FnIII-FnIII consists of 11 domains, seven FnIII and four Ig-like domains, resulting in a length of 43 nm as evidenced by electron microscopy (EM) and immunofluorenscence. The myosin binding proteins (MyBP) as ’accessory’ proteins of myosin show eleven repeats with a periodicity of about 43 nm (Fürst 1.4 Modules in titin: Ig and FnIII domains 7 et al., 1989; Trinick, 1996). The correlation with titin A-band super-repeats suggests a role as a scaffold involved in arrangement of the thick filaments and definition of their length (Trinick, 1996). Therefore, titin was attributed as a ’molecular ruler’ or template in the sarcomere (Whiting et al., 1989). The interaction of titin and MyBP-C is directed by titin Ig domains (Freiburg and Gautel, 1996). The P-zone (Figure 1.2) comprises of a unique patch of Ig-Ig- FnIII-FnIII-Ig-Ig-FnIII and a kinase domain. Together with the M-line region of titin, the D-zone, C-zone, P-zone reflect the zones of myosin in the A-band.

1.3.4 M-line and anchoring function The M-line region corresponds to the carboxy-terminal part of titin with a kinase domain at its periphery to the A-band (Obermann et al., 1996). Besides, the M-line titin consists predominantly of Ig-like domains interspersed with unique sequences such as the KSP-repeats between Ig modules M5 and M6, phosphorylated by titin KSP kinase during muscle differentiation (Gautel et al., 1993). Comparable to the anchoring of titin in the Z-disc, the titin filaments also overlap in the M-line with those titin filaments from opposite sarcomeres (Ober- mann et al., 1997). The M-line Ig domain M5 interacts with myomesin (Ober- mann et al., 1997), a protein mainly comprised of Ig-like and FnIII domains. Myomesin has been suggested to crosslink myosin, as an antiparallel dimer, with titin by binding to myosin with its N-terminal domain. Furthermore, myosin was shown to interact with its central part with two antiparallel overlapping titin molecules (Lange et al., 2005b; Agarkova and Perriard, 2005). An additional M-band component, the M-protein, is related with myomesin in domain composition of Ig-like and FnIII-domains. In contrast to myomesin, it is not equally expressed in different muscle types (Agarkova et al., 2003). M- protein as well as myomesin bind to myosin filaments (Bahler et al., 1985) and to titin (Nave et al., 1989) in isolated muscle. The M-protein bridges myosin filaments at the M-line (Obermann et al., 1996). The recent three-dimensional model of the M-band network presents the arrangement of titin, myosin and myomesin within the M-band (Lange et al., 2005b). Expression of a truncated titin devoid of the kinase domain and the MURF-1 binding sites, resulted in sarcomere disassembly (Gotthardt et al., 2003). In- terestingly, in the truncated M-line titin, expression of CARP (cardiac ankyrin repeat protein) and ankrd2, a CARP-like protein, are upregulated. Both have been implicated in linking between the sarcomere and the nucleus (Miller et al., 2003; Kojic et al., 2004).

1.4 Modules in titin: Ig and FnIII domains

The Ig-like domains and the FnIII domains appear like beads on a string in the electron micrograph images of the sarcomere (Trinick et al., 1984). The number of Ig- and FnIII domains varies from 244 to 297 (Witt et al., 1998), 8 Introduction due to alternative splicing in different muscle tissue. The Ig-like domains make up about 112 to 166 of the titin domains. According to differences in sequence similarities and a resulting variable number and length of the strands in Ig domain structures, Ig domains are classified in the V-(variable), C1-, C2-(constant) and I-(intermediate) set. It is still unclear, whether the Ig domains evolved by convergence to a stable fold, or by divergence from one ancestral domain (Williams and Barclay, 1988; Bork et al., 1994; Kenny et al., 1999). Assuming a common ancestor within the Ig domain sets, diverse options of the primordial domain have been discussed (Williams and Barclay, 1988; Hunkapiller and Hood, 1989; Smith and Xue, 1997). The I-set of Ig domain was introduced based on sequence comparisons and the structure of telokin, a muscle member of the immunoglobulin superfamily (Harpaz and Chothia, 1994). Accordingly, Ig domains of sarcomeric proteins were predicted to belong to the I-set (Kenny et al., 1999; Improta et al., 1996). The first structure of a titin Ig domain, M5 of the M-band, confirmed its classification as an I-set Ig domain (Pfuhl and Pastore, 1995). Although the sequence identity of the overall Ig domain is about 20-35 % and the similarity about 50 % (Fraternali and Pastore, 1999), some subgroups with a high similarity of about 90 % exist (Tskhovrebova and Trinick, 2004). Among the different Ig-like domains of titin, there are groups of closer related domains. In the I-band, where the Ig-like domains are arranged mainly in tandem domains, ”proximal” and ”distal” to the PEVK segment differences in their consensus sequence exist. In the A-band, the FnIII and Ig-like domains are assembled in the 7- and 11-domain super-repeats, repeated six and eleven times, respectively (Gautel, 1996), in which domains at similar positions have higher sequence homology (Amodeo et al., 2001a; Muhle-Goll et al., 1998; Fraternali and Pastore, 1999). In titin, FnIII domains are exclusively found in the A-band arranged in the super-repeats (Tskhovrebova and Trinick, 2004). Similarly to Ig domains, the FnIII domains in titin are less than 50 % conserved within the family. The atomic structures of FnIII and Ig domains are similar; both share a greek- key superfold with a two β-sheet sandwich structure. Of the seven strands in the FnIII domains, strands A, B, E compose one β-sheet and strands G, F, C and C’ the other. Based on the structural similarity of the overall fold with the different types of Ig domains, these domains were all joint in the immunoglobulin fold family IgFF, including the FnIII domains (Halaby et al., 1999). Superimposition of Ig and FnIII domains reveals that strand C’ is on two different β-sheets on the two domain types (Erickson, 1994). Despite their overall structural similarity, the consensus sequence of the Ig and FnIII domains is different. The structure of the first intracellular FnIII domain, A71 of the titin A-band, confirmed the characteristic FnIII fold (Muhle-Goll et al., 1998). 1.5 Titin kinase 9

1.5 Titin kinase

The catalytic domain of titin, a serine/threonine kinase termed titin kinase, is located in the transition between the A-band and the M-line of titin (Labeit et al., 1992). In general protein kinases are involved in diverse, important biological functions where they control the reversible process of phosporylation. The reaction which they catalyse is the transfer of the γ-phosphate of ATP to the hydroxyl group of a serine, threonine, or tyrosine within the substrate protein. Phosphorylation can evoke distinct responses, which are comparable to molecular switches, where an on or off signal results in a reverse molecular reaction such as conversion of enzyme activation to inhibition (Johnson and O’Reilly, 1996). The class of serine/threonine kinases is a well conserved superfamily which is reflected both in the sequence similarity and in the overall structural fold of the activated kinase owing to chemical constraints of the catalysed reaction (Huse and Kuriyan, 2002). The kinases can exhibit conformational differences between the active or ’on’ state and the inactive, also called ’off’ state. The regulation mechanism of the kinases which can be determined by interaction with specific regulatory domains or proteins, e.g. in response to second messengers (Johnson et al., 1996), generates a conformational plasticity of the inactive kinases (Huse and Kuriyan, 2002). Comparison with other kinases and biochemical assays (Mayans et al., 1998) revealed an assignment of titin kinase to the subfamily of Ca2+/calmodulin (calcium modulating protein, abbreviated as CaM) regulated kinases. Regulation of the activation of the kinase by binding of Ca2+/CaM or the related protein S100 is typical for kinases like the CaMK family (Ca2+-calmodulin-dependent protein kinase (CaMK) family), the MLCK (myosin light chain kinase), and the twitchin kinase, another muscle kinase but found in invertebrate smooth muscle. In absence of calmodulin, the substrate binding site is blocked by an intrinsic autoinhibition mechanism (Kobe et al., 1996). Calmodulin is an ubiquitously expressed, highly conserved protein with four binding sites for calcium. Two EF-hands at each end which are connected by a short linker can each bind a calcium ion. Upon calcium binding, calmodulin undergoes a conformational change resulting in a dumbbell-shaped structure. When calmodulin binds to a synthetic calmodulin recognition peptide (Vetter and Leclerc, 2003; Hoeflich and Ikura, 2002) which covers the calmodulin binding site of for example, titin kinase (Amodeo et al., 2001b), smMLCK (Meador et al., 1992), CaMKIIα (Meador et al., 1993), or CaMKK (Kurokawa et al., 2001), it forms a globular structure wrapped around the substrate helix by bending the central linker. However, in complex with a Ca2+-pump (Elshorst et al., 1999), a K+-channel (Schumacher et al., 2001) and the anthrax adenylate cyclase exotoxin (Drum et al., 2002) calmodulin shows an extended conformation. Structurally, protein kinases present the typical bilobal fold, with a smaller N lobe consisting of a five-stranded β-sheet and one prominent α-helix αC, and a larger predominately helical C lobe. The ATP binding site is situated in the cleft between the two lobes beneath the conserved phosphate binding P 10 Introduction

Figure 1.3: The ribbon presentation of titin kinase (Mayans et al., 1998) illustrates the typical protein kinase fold of a bilobal structure. The regulatory tail in the C-terminal lobe is shown in red (with the helices αR1 and αR2 and the strand βR1), the catalytic loop in violet and the activation segment in green which is including the P+1 loop in yellow. The catalytic residue D127 and residue Y170, which is phosphorylated in the activation process, are displayed in grey.

loop (GXGXΦG with Φ=Y or F) connecting β1 and β2 of the N lobe. The substrate binds to the activation loop or activation segment. In many kinases, the activation segment needs to be activated by phosphorylation. In the C lobe, the catalytic loop with the catalytic site, an invariant aspartate, is found. Kinases that are regulated by phosphorylation in the activation segment are all so-called RD-kinases, in which the catalytic aspartate is preceded by an arginine residue (Johnson et al., 1996). Titin kinase, however, with a phenylalanine instead of the arginine, was the first described non-RD kinase which is activated by phosphorylation (Mayans et al., 1998). Studies on titin kinase revealed that both phosphorylation of tyrosine 170 (Y170) in the P+1 loop and the binding of Ca2+/CaM are required to acti- vate the kinase (Mayans et al., 1998). The structure of titin’s kinase domain 1.6 Titin kinase signalling pathway 11 has been solved (Mayans et al., 1998) and it revealed an autoinhibited conformation, in which the catalytic residue aspartate 127 (D127) is embedded in a hydrogen-network with the residues R129 (in the catalytic loop), Q150 (in the activation segment), and Y170 (in the P+1 loop, which in other kinases typically forms a substrate binding site for the P+1 position, when the substrate is phosphorylated at position P=0). Since these residues block the active site from substrate binding, the basis in the autoinhibition was assumed to lay therein. A dual activation mechanism was proposed involving the phosphorylation of Y170. Thereby, the P+1 loop is released from the substrate-binding site and, in addition, the adjacent Y169 is set free from the interaction with the αR1-helix to which Ca2+/CaM binds (Gautel et al., 1995; Amodeo et al., 2001b) upon a conformational change that includes a release of the pseudosubstrate-like αR2 helix (Figure 1.3). Two different models of the activation mechanism have been proposed (Wilmanns et al., 2000). One model describes the complete release of the regulatory tail consisting of αR1, αR2, and the βR1 (”fall-apart”), while according to the second model the αR1 and the βR1 are anchored and solely the αR2 is ”looping-out” (Wilmanns et al., 2000). Results of molecular dynamics studies suggested that titin kinase acts as a force sensor in the sarcomere for conversion of mechanical stress into a biochemical signal, where rupture of the βR1-βC10 sheet and the βR1-βC11 sheet gives rise to rearrangement of the autoinhibitory tail and, thus, opens the active site for kinase activity (Gräteret al., 2005). Hence, this would favour the ”fall-apart” over a ”looping-out” mechanism, but the precise activation mechanism still remains to be elucidated. Interestingly, telethonin which binds in differentiated muscle to the Z-disc of the sarcomere (Mues et al., 1998; Gregorio et al., 1998) has been found to be a substrate of titin kinase. Since telethonin is phosphorylated in developing muscle, a role of titin kinase in myofibrillogenesis has been assumed (Mayans et al., 1998). Two more substrates of titin kinase, NBR1 (phosphorylated at S115 or S116) and p62, have been identified recently, involved in a titin kinase signalling pathway, which will be considered in the next section (Lange et al., 2005a).

1.6 Titin kinase signalling pathway

Mechanical tension during muscle contraction and stretching opens the active site of titin kinase (Gr¨ateret al., 2005) which allows the interaction with NBR1 (Lange et al., 2005a). NBR1 is phosphorylated at S115 or S116, and targets the titin kinase substrate p62 to the sarcomere by interaction via the PB1 domains. MURF-1 and -2 bind to the Ig-like domains A168-A169 in close proximity to the titin kinase (Centner et al., 2001; Pizon et al., 2002). Furthermore, the RING B-box domain of MURF-2 interacts with the C-terminal ubiquitin- association (UBA) domain of p62 (Lange et al., 2005a). Under atrophic conditions as induced mechanical arrest, MURF shuttles to the nucleus (Pizon et al., 2002; Bodine et al., 2001). In the nucleus, the RING domain of MURF is responsible for the interaction with nuclear components. The transactivation 12 Introduction

Figure 1.4: Titin kinase (TK) downstream signalling pathway. The proteins titin (domains A168 to M1), NBR1, p62 and MURF are presented schematically by their domain composition and are described in the text. Ig domains are presented in oval shape and in red, while the FnIII domain is in white. The domains are as follows: B-box = type of zinc ﬁnger, CC = Coiled coil, MFC = MURF family conserved, NBR1 = next to breast cancer 1, PB1 = Phox and Bem1p, RING = really interesting new gene, UBA = ubiquitin association, ZZ = type of zinc ﬁnger.

domain of the serum response factor (SRF) has been identiﬁed as nuclear lig- and of MURF-2 (Lange et al., 2005a). Hypertrophic stimuli, however, result in SRF-driven transcription of immediate-early genes. Thus, MURF is involved in regulation of the myogenic transcription (Li et al., 2005). Titin kinase activity, encompassed by the hypertrophy marker brain natriuretic peptide upregulation, can compensate for mechanical arrest and disturb the inhibitory inﬂuence of MURF-2 towards SRF (Lange et al., 2005a).

1.7 Disease association of a titin kinase mutation

A mutation mapped in the titin kinase αR1 helix (R279W) is associated with the hereditary myopathy with early respiratory failure (HMERF) (Lange et al., 2005a). Due to the mutation, the binding of NBR1 to titin kinase is abrogated resulting in an abnormal NBR1 localisation. Consequentially, p62 and MURF are also not assembled in the signal complex at the titin kinase. Disruption of the signalling pathway could be the cause for the HMERF, which is characterised by structural disorder of the sarcomeres (Edstrom et al., 1990) leading to death by respiratory failure. Proteins involved in the pathway (Figure 1.4), such as the scaffold proteins NBR1 and p62, and the RING finger-containing protein MURF are described in more detail in the following. 1.8 Muscle-specific RING finger protein MURF 13

1.8 Muscle-speciﬁc RING ﬁnger protein MURF

The muscle-specific RING finger protein MURF is connected to the titin signalling pathway (Figure 1.4). The three family members MURF-1 (Dai and Liew, 2001; Centner et al., 2001), MURF-2 (Pizon et al., 2002; McElhinny et al., 2002) and MURF-3 (Spencer et al., 2000) are found on distinct chromosome loci (1p31.1-p33, 8p12-13, 2q16-21) (Centner et al., 2001). All share a similar domain architecture (Figure 1.5), with an N-terminal RING finger domain, a B-box, a leucine-rich coiled-coil domain and a C-terminal acidic domain. More- over, a typical MURF family-conserved domain (MFC) of 30 amino acids sepa- rates the RING finger and the B-box domain (Centner et al., 2001; McElhinny et al., 2004; Witt et al., 2005). The RING finger domain (for Really Interesting New Gene) (Lovering et al., 1993) is a widespread domain in proteins of diverse cellular distribution and organisms (Saurin, 1996). Proteins which contain a RING domain mediate protein-protein interaction in large macromolecular scaffolds and have recently been implicated in the process of ubiquitylation and sumoylation (Freemont, 2000; Borden, 2000). The RING finger detected in the MURF sequence belongs to the C3HC4 finger (Freemont et al., 1991) in which two zinc ions are coordinated in a so-called ’cross-brace’ arrangement with a conserved distance of 14 A˚ (Borden and Freemont, 1996). Due to the evolutionary conserved tripartite organisation of RING finger, B-box, and coiled-coil domain, the MURF family is classified as a RBCC (RING-B-box-coiled coil) subclass of the RING proteins (Borden, 1998). Homo- and heterodimers among the MURF proteins are formed via the coiled-coil domain (Spencer et al., 2000; Centner et al., 2001) except for cardiac muscle MURF-2/p27 which lacks this coiled-coil domain. Beyond this interaction, a number of diverse proteins interact with MURF. First identification of MURF emerged from the binding of MURF-3 to the serum response factor SRF, although the biological relevance was ambiguous to the authors (Spencer et al., 2000). MURF interaction with the carboxy-terminal region of titin (A168-169) in proximity to the M-line has been shown for MURF-1 (Centner et al., 2001) and a transient interaction of MURF-2 and -3 with this part of titin unravelled later (Centner et al., 2001; Pizon et al., 2002). Both, MURF-1 and -2, have been described to bind to the ubiquitin-conjugating enzyme 9 (Ubc9) and isopepti- dase T-1 (ISOT-3), involved in SUMO modification (McElhinny et al., 2002). The RING domain of MURF-1 (previously called SMRZ for striated muscle RING zinc finger) was mapped to be responsible for interaction with SMT3b (Suppressor of MIF (migration inhibitory factor) Two 3 homolog 2) (Dai and Liew, 2001), a ubiquitin-related protein, now termed SUMO-2 (small ubiquitin- like modifier) (Dai and Liew, 2001). Moreover, MURF has been reported to bind to the nuclear glucocorticoid modulatory-element binding protein GMEB- 1 that regulates transcription as response to changes in cellular glucocorticoid levels (McElhinny et al., 2002). Further myofibrillar proteins, proteins of the energy metabolism, mitochondrial proteins, and some unknown proteins were identified to interact with MURF-1. Most of them also interacted with MURF- 14 Introduction

Figure 1.5: Domain architecture of MURF family members. Adapted from Centner et al. (2001) and Pizon et al. (2002). Accession codes for the different MURFs with the first of two given MURF-2 variants having an N-terminal extension of 16 residues, and sequence differences in a few residues: MURF- 1 (AJ291713), MURF-2/p27 (AJ277493), MURF-2/p50 (AJ243488, AJ291712 short), MURF-2/p60 (AJ243489, AJ291712 long), MURF-2/p60B (AJ431704), MURF-3 (AJ291714 short), MURF-3’ (AJ291714). Differential splicing has been reported for MURF-3 (Centner et al., 2001) and MURF-2 (p27, p50 and p60), while a frameshift in the reading frame causes an alternative C-terminus for the longest isoform (p60B) of MURF-2 (Pizon et al., 2002).

2 as well, in a yeast two-hybrid screen on adult skeletal muscle cDNA (Witt et al., 2005). Thus, proteins like RACK-1 (Arya et al., 2004) and p62 (Lange et al., 2005a) were identified as MURF binding partners as well as troponin I, troponin T3, telethonin (also called T-cap), nebulin, NRAP, myotilin, and MLC-2 (Witt et al., 2005). The localisation of the muscle protein MURF is reflected by the diversity of MURF-interacting proteins. Interestingly, apart from the M-line and the Z-disc in muscle sarcomere as well as its association to microtubules (Pizon et al., 2002; Spencer et al., 2000) and myosin (Pizon et al., 2002), MURF is also found in the nucleus (Dai and Liew, 2001). Allocation to the nucleus is controlled by the RING-finger domain, whereas the central part of MURF targets to the M-line and Z-disc (McElhinny et al., 2002). Muscle under atrophic conditions upregulates the ubiquitin ligase MURF (Bodine et al., 2001). As the inhibition of discrete ubiquitin ligases could decrease muscle loss due to atrophy-inducing stimuli, MURF-1 has been proposed as potential drug target (Glass, 2003). 1.9 NBR1 15

1.9 NBR1

NBR1 was isolated from serum directed against ovarian tumor antigen CA125 (Campbell et al., 1994), which is used for monitoring ovarian cancer (Lavin et al., 1987). The gene nbr1 is located on the chromosome region 17q21 (Campbell et al., 1994) and lies head-to-head with the the BRCA1 (Breast cancer type 1 susceptibility protein) gene, that is transcripted in opposite directions (Dimitrov et al., 2001). Due to the location of the NBR1 gene close to the BRCA1 gene, the originally termed 1A1.3B product was called NBR1, i.e. next to BRCA1. Three alternative splicing variants have been identified (Dimitrov et al., 2001). A potential role in ovarian and breast cancer has not been demonstrated for NBR1 so far. The antigen CA125 has been identified as the mucin MUC16, which was shown to be entirely different from NBR1 (Yin and Llyod, 2001). NBR1 contains a PB1 domain, a ZZ domain and an UBA domain. Thus it has a similar domain composition as the human p62, the rat homologue ZIP, or ref(2)p from Drosophila. The ZZ domain is a putative zinc-finger domain, coordinating two Zn2+ per motif, with a signature motif Asp-Tyr-Asp-Leu and a core consensus sequence C-x2-C-x5-C-x2-C similar to the B-box (Ponting et al., 1996). The ubiquitin-association domain (UBA) is associated with ubiquitination. Binding of ubiquitin has been demonstrated for p62 (Vadlamudi et al., 1996), but this is not a general feature of the domain. Conferring target specificity to enzymes of the ubiquitination system was proposed (Hofmann and Bucher, 1996), and also interaction with proteins lacking ubiquitin-like domains or any link to ubiquitin have been found (Buchberger, 2002). Generally, the diverse proteins that contain a UBA domain are involved in the ubiquitin-proteasome pathway, DNA excision repair, and cell signalling via protein kinases (Hofmann and Bucher, 1996). The domain consists of a sequence motif comprising about 40-45 residues. Structurally, the UBA domain forms a compact three helix bundle (Dieckmann et al., 1998). NBR1 interacts with fasciculation and elongation protein zeta-1 (FEZ1), a PKCζ-interacting protein, and a calcium- and integrin- binding protein (CIB). Thereupon, a role in signal transduction in neural development has been proposed (Whitehouse et al., 2002). Interaction of the PB1 domains of NBR1 and p62 has been described, although the function remained unclear (Lamark et al., 2003). Self-interaction of NBR1 is not mediated by the PB1 domain, but by a region C-terminal to it (Whitehouse et al., 2002; Lamark et al., 2003). Formation of NBR1 dimers via a coiled-coil domain and via binding of the N- terminal PB1 domain of NBR1 to titin kinase has been presumed recently and a function as a scaffold protein linking titin kinase to p62 and MURF-2 has been suggested (Lange et al., 2005a). 16 Introduction

1.10 The protein p62

The protein p62 with a molecular weight of 62 kDa, is involved in a variety of different biological processes and has been given diverse names. p62 has been primarily identified as a ligand of p56lck binding to the SH2 domain of p56lck (Park et al., 1995). As ubiquitin-binding protein sequestosome 1 (SQSTM1), it is associated with the Paget disease of bone (Laurin et al., 2002; Hocking et al., 2002). The counterpart of human p62 in rat is known as zeta- interation protein (ZIP), which has been assigned to act as scaffold protein for linking aPKCζ to protein tyrosine kinases and cytokine receptors (Puls et al., 1997). A170 from murine peritoneal macrophages is induced upon oxidative stress (Ishii et al., 1996). Moreover, the signal transduction and adaptor protein STAP from the mouse osteoblastic cell line MC3T3-E1 is identical to A170 (Okazaki et al., 1999). The 60 kDa EBIAP, Epstein-Barr virus (EBV)- induced gene 3 (EBI3) association protein, corresponds to p62. It associates with the hematopoietin receptor EBI3, which is induced in Epstein-Barr virus- infected B lymphocytes (Devergne et al., 1996). Chicken ovalbumin upstream promotor transcription factor (COUP-TF) is an orphan member of the nuclear hormone receptor superfamily which regulates transcription and binds presumably via DNA to ORCA, orphan receptor coactivator, again identical to p62 (Marcus et al., 1996). The human p62 encodes a 440 amino acid protein and is highly conserved, particularly in the functional domains. These domains include an N- terminal PB1 domain (3-102), a ZZ zinc finger domain (122-163), two PEST sequences (266-294 and 345-377), and a ubiquitin association domain UBA (396-431) (Geetha and Wooten, 2002). Both, the PB1 domain and the ZZ zinc finger, mediate protein-protein interaction. The UBA domain confers non- covalent ubiquitin binding to mono- and poly-ubiquitin chains and interaction with other proteins (Hofmann and Bucher, 1996; Buchberger, 2002). The solution structure of the UBA domain of p62 has been solved recently (Ciani et al., 2003). The PEST sequences, rich in proline (P), glutamic acid (E), serine (S), and threonine (T), are a characteristic degradation signal in proteins with a short life time (Rechsteiner and Rogers, 1996) and occur in key regulatory proteins (Okazaki et al., 1999). Due to several functional domains (see above), p62 is capable of interacting with a variety of different proteins (see Table 1.1). Human p62 is ubiquitously expressed and is found within the cell in the cy- tosol and nucleus. The widespread location within the cell and interaction with diverse proteins define p62 as a multifunctional protein. The presumably best characterised function of p62 is its role as scaffold protein in a number of signalling pathways (Geetha and Wooten, 2002). A regulatory role in the ubiquitin proteasomal degradation is derived from p62’s property to bind non-covalently to ubiquitin and signalling proteins (Vadlamudi et al., 1996; Pridgeon et al., 2003). p62 has been implicated to shuttle and anchor ubiquitinated targets for proteolytic degradation (Seibenhener et al., 2004; Shin, 1998). p62 itself and in 1.11 Aim of the work 17

Protein Citation aPKCι/λ Puls et al., 1997; Avila et al., 2002 MEK5 Lamark et al., 2003; Noda et al., 2003 NBR1 Lamark et al., 2003 PAR-4 Chang et al., 2002 p38 MAPK Sudo et al., 2000 p120 ras-GAP Ellis et al., 1990 TrkA Geetha and Wooten, 2003 RIP Sanz et al., 1999 TRAF6 Sanz et al., 2000 p56lck Park et al., 1995 Grb14 Cariou et al., 2002 Kvβ2 Gong et al., 1999 GABAC Croci et al., 2003 COUP-TFII Marcus et al., 1996 ubiquitin Vladlamundi et al., 1996 p62 Lamark et al., 2003; Wilson et al., 2003

Table 1.1: Interaction partners of p62. Abbreviation of the proteins are given in the following: aPKC = atypical protein kinase C, MEK5 = mitogen-activated protein kinase kinase 5, PAR-4 = prostate apoptosis response-4, MAPK = mitogen-activated protein kinase, p120 ras-GAP = p120 ras-specific GTPase- activating protein, TrkA = neurotrophic tyrosine kinase receptor, RIP = receptor-interacting protein, TRAF6 = TNF (tumor necrosis factor) receptor- associated factor 6, p56lck = lymphocyte-specific protein tyrosine kinase, Grb14 = growth factor receptor-bound protein 14, Kvβ2 = potassium channel β2 sub- unit, GABAC = gamma-aminobutyric acid receptor C, COUP-TFII = chicken ovalbumin upstream promotor transcription factor association with ubiquitin-protein conjugates constitutes the so-called sequestosome, an alternative storage of cytoplasmic ubiquitinylated proteins which are not degradated by the proteasome in the first place (Shin, 1998).

1.11 Aim of the work

The enormous size of titin, extending over half of the sarcomere, and its location enables titin to interact with a variety of different muscle proteins, and hence get involved in signal transduction. This diversity in interactions together with its various functions makes titin a particularly interesting protein to study. The immense size by its assembly of about 300 domains entail the flexible nature of this protein, which is obviously not suitable for crystallisation. In order to obtain structural information about titin, segments encompassing single or several domains are studied. In this study, the region of titin in proximity to titin kinase as well as a connected signalling pathway are considered. Several domains of titin, namely 18 Introduction the Ig-like domains A168 and A169 of the A-band region, M1 in the M-line and extended constructs of titin kinase are investigated. The work on titin connected pathways focuses on the proteins NBR1 and p62 and their interaction via the lately identified PB1 domain. Both proteins are a substrate of titin kinase and are linked to titin. Throughout all of the work, a special emphasis is placed on interactions of the studied domains. Since the era of characterisation of the molecular and biochemical properties of signalling pathways in titin has just started, this work intends to shed some light on the molecular structure of domains and their interactions involved in the titin kinase downstream signalling pathway. Chapter 2

The A-band immunoglobulin domains A168 and A169

2.1 Introduction

The assembly of large proteins from small building blocks or modules is considered a common practice for generating a diversity of multifunctional proteins (Spitzfaden et al., 1997; Bork et al., 1996). These mosaic proteins are primarily extracellular proteins which excel in the immune system in recognition and in cell-cell interactions. But, also intracellular proteins exhibit the modular arrangement of contiguous domains such as for structural organisation of the muscle. Typically, modules of the β-fold emerge – often with their N-and C-terminus at opposite ends – which provide the basis for easy array assembly and spacer formation. The most abundant protein module is the immunoglobulin (Ig) domain (Doolittle and Bork, 1993) with a large functional, structural and sequential diversity (Bork et al., 1994).

2.1.1 Immunoglobulin domains Antibodies (immunoglobulins) were eponymous for the immunoglobulin domains, ﬁrst discovered in the immune system. Due to their wide distribution and great number, proteins containing Ig domains cover diverse biological functions, such as recognition, growth, development, signalling, and carbohydrate recognition (Srinivasan and Roeske, 2005). Ig domains display no enzymatic activity but are good in being recog- nised (Barclay, 2003). The stable fold that is resistant to proteolysis, has the ability to interact by formation of homo- and heterodimers either along the β- strands or through loops. Their broad range of high aﬃnity interaction resides mainly in the hypervariable loops, which are located at one end of the ellipsoid domain (Barclay, 2003). The fold topology of Ig-like domains follows the Greek key fold with two twisted β-sheets comprising seven to nine antiparallel β-strands which form a β-sandwich structure (Richardson, 1981; Lesk and Chothia, 1982). Despite the

19 20 The A-band immunoglobulin domains A168 and A169 conserved common fold, the Ig-like domains represent distant sequence similarity. Similar residues within the module of about 100 residues were detected and a conserved disulphide-bridge has long been considered as the hallmark of the Ig-like domains (Williams and Barclay, 1988). Typically, it is formed in the extracellular Ig domains connecting two cysteines between strand B and F. However, many intracellular and also some extracellular Ig-like domains are devoid of disulphide bridges. If the disulphide bridge is present, it packs against an invariant tryptophan in the hydrophobic core forming the so-called ’pin’ motif (Lesk and Chothia, 1982). Overall, the loops intervening the strands show variability in length and particularly the B-C and F-G loops play a key role in protein recognition as well as in determining the size of the domain. Ig domains of giant proteins such as titin have been grouped to the I-set class (Harpaz and Chothia, 1994). The ﬁrst structure of a muscle Ig-like domain, termed telokin, was solved from the C. elegans twitchin protein (Holden et al., 1992) and became the representative of this group.

2.1.2 Interaction of titin A168-A169 and MURF The muscle-speciﬁc RING protein MURF interacts with diverse proteins in- and outside the nucleus. One of the binding partners is the titin tandem Ig domain A168-A169. The interaction has been demonstrated for MURF-1 using yeast two-hybrid assays and pulldown experiments of in vitro translated protein (Centner et al., 2001). Investigations regarding the binding capability of the MURF family members MURF-2 and MURF-3 to titin A168-A169 have been inconsistent so far (Centner et al., 2001; Witt et al., 2005; Pizon et al., 2002). As MURF-1 was found to bind to A168-A169, a potential role in modulating the activity of titin kinase was suggested due to the close proximity of titin kinase and A168-A169 (Centner et al., 2001). Several regions of MURF-1 were mapped to contribute in binding to titin A168-A169 (Witt et al., 2005). MURF-1 plays an important physiological role in regulating muscle degradation (Bodine et al., 2001). Under atrophic conditions in muscle, upregulation of MURF-1 and muscle atrophy F-box protein MAFbx was detected. Fur- thermore, MURF-1 knock-out mice were described to be resistant to muscle wasting (Bodine et al., 2001). MURF-1 has E3-like ubiquitin ligase activity and may thereby be involved in sumoylation (Dai and Liew, 2001; McElhinny et al., 2002) or ubiquitination processes involved in proteasome-dependent proteolysis of muscle proteins (Bo- dine et al., 2001; Kedar et al., 2004; Witt et al., 2005). Location of MURF-1 in the nucleus, where it acts in transcription regulation (Dai and Liew, 2001; McElhinny et al., 2002), and its interaction with titin (Centner et al., 2001) and other sarcomeric proteins (Witt et al., 2005; Kedar et al., 2004) suggest a dynamic role as adaptor, linking myoﬁbrillar signalling with transcription control. To structurally elucidate the basis for the interaction of the titin A168-A169 and MURF-1, the structure of A168-A169 has been solved. Since some studies 2.2 Materials and Methods 21

Figure 2.1: Titin kinase downstream signalling pathway. The proteins titin (domains A168 to M1), NBR1, p62, and MURF are presented schematically by their domain composition. The domains mainly analysed in this chapter, the tandem Ig domain A168 and A169, are highlighted in red.

on the interaction between titin and MURF include the FnIII domain A170, analysis of A168-A169-A170 has also been enclosed in this chapter. In Figure 2.1 the domains A168-A169 are highlighted in red with respect to their location in titin.

2.2 Materials and Methods

2.2.1 Purification of A168-A169 The sequences encoding the two A-band Ig domains 168 and 169 of titin, corresponding to titin residues 24429-24623 (accession code: Q10466), were amplified from a human cardiac titin library (G. Stier, EMBL Heidelberg, Germany) by polymerase chain reaction (PCR) using the oligonucleotides A168/169 NcoI (5’-AAACCATGGC ACCACACTTT AAAGAGGAA-3’) and A168/169 KpnI (5’-AAAGGTACCT CAATCAGCCA CATCCAGTTC AAC-3’) as forward and reverse primers, respectively. The DNA fragments were subcloned with NcoI and KpnI restriction sites into vector pETM11 (based on pET24d (Novagen), modified by G. Stier, EMBL) containing a polyhistidine tag cleavable by TEV protease. The construct was verified by sequencing (MWG Biotech). In the following, the protein sequence of A168-A169 has been renumbered in 1-195. The protein was expressed in BL21(DE3) CodonPlus RIL cells grown at 37◦C to an optical density (λ=600 nm) of 1.0 and expression was induced by adding 1 mM IPTG. After growth for three hours at 37◦C, the cells were harvested by centrifugation (6000 rpm (JLA 8.1000, Beckman), at 4◦C for 10 min) and frozen at -20◦C. The pellet of 1 liter cells was resuspended in 25 ml lysis buffer (25 mM Tris pH 8.0, 300 mM NaCl, 5 mM imidazol and 5 mM β-mercaptoethanol) and 22 The A-band immunoglobulin domains A168 and A169 lysed by sonication (Bandelin electronic) for 2-3 min (pulses of 0.7 s and pauses of 0.3 s). After centrifugation (18000 rpm (SS-34, Sorvall), 30 min, 4◦C) the supernatant was passed through a 0.45 µm filter to 1 ml pre-equilibrated Ni- NTA beads (Qiagen). The resin was washed with lysis buffer and the protein was eluted with 400 mM imidazol in buffer (25 mM Tris pH 8.0, 300 mM NaCl). To cleave the polyhistidine-tag, TEV protease (in a molar ratio of about 1:20) and 2 mM DTT were added and incubated over night at room temperature. The protein was concentrated and further purified by gel filtration chromatography using a Superdex 75 10/30 (GE Healthcare) equilibrated in 25 mM HEPES pH 7.5, 150 mM NaCl and 5 mM DTT. The protein sequence was confirmed by mass spectrometry (T. Franz and X. Li, Proteomics Core Facility, EMBL).

2.2.2 Preparation of Selenomethionine incorporated A168-A169 For substitution of the methionines M1 and M109 by selenomethionine (Hen- drickson et al., 1990), the A168-A169 containing plasmid was transformed in the methionine auxotrophic E. coli strain B834(DE3) (Novagen). Selenomethionine- labelled protein was prepared according to a protocol described elsewhere (van Duyne et al., 1993) with minor modifications. A colony was picked and plated on an agar plate with the appropriate antibiotics. Several of these new colonies were inoculated in the preculture consisting of M9 minimal medium (Sam- brook et al., 1989) supplemented with a mixture of L-amino acids (all except L-Selenomethionine; each 40 mg/l), 60 mg/l L-selenomethionine, 1 × trace elements, 0.4 % glucose, 1 mM MgSO4, 0.3 mM CaCl2, 1 mg/l Biotin, 1 mg/l Thi- amine and 50 µg/ml kanamycin, and grown for about 20 hours at 37◦C. The trace elements solution (100 ×) contained 5 g EDTA, 0.83 g FeCl3 × 6 H2O, 84 mg ZnCl2, 13 mg CuCl2 × 2 H2O, 10 mg CoCl2 × 6 H2O, 10 mg H3BO3 and 1.6 mg MnCl2 x 6 H2O in 1 liter with the pH adjusted to pH 7.5. The cells were centrifuged at 4000 rpm and 4◦C for 10 min and resuspended in M9 medium. The medium of the main culture was composed of the same supplements in the M9 minimal medium as the preculture medium with 60 mg/l L-selenomethionine, in which the preculture was diluted at a ratio of 1:10. A 2 liter baffled flask was filled with 0.5 liter medium to allow better aeration. The cells were grown to an optical density of 0.6-0.7 before the induction of the expression by adding 1 mM IPTG and an incubation time of about 10 hours at 37◦C. The cells were harvested by centrifugation at 6000 rpm (JLA 8.1000, Beckman) and 4◦C for 10 min, washed in PBS, pelleted, and frozen at -20◦C. The selenomethionine-incorporated protein was purified using the same protocol as for the native protein. Incorporation of the selenomethionine was confirmed by mass spectrometry (T. Franz and X. Li, Proteomics Core facility, EMBL).

2.2.3 Purification of titin A168-A169-A170 Human titin encoding the three A-band domains A168-A169-A170 corresponding to residues 24429-24730 were amplified by PCR from the TOPO con- 2.2 Materials and Methods 23 struct A168-M1 (see Appendix A) of a cardiac muscle library (G. Stier, EMBL). The oligonucleotides A168/169 NcoI (see above) and A170 BamHI (5’-AAAGGATCCT CACTCTTCAT CATAGTTCAT AGCTC-3’) were used as forward and reverse primers, respectively. The DNA fragments were subcloned into pETM11 via the NcoI and BamHI restriction sites. Sequencing confirmed the correct sequence of the 302 amino acids encompassing construct. Titin A168-A169-A170 was expressed in the E. coli strain Bl21(DE3) Codon- Plus RIL in LB medium in the presence of 50 µg/ml kanamycin and 34 µg/ml chloramphenicol (resolved in 70 % ethanol). The cells were grown at 37◦C and the expression of A168-A169-A170 was induced for four hours by application of 1 mM IPTG. After centrifugation at 6000 rpm (JLA 8.1000, Beckman) for ten minutes, the cells were washed in PBS, pelleted, and frozen at -20◦C. For purification, the protocol used consisted of an IMAC using a Ni-NTA resin (Qiagen), TEV cleavage over night in the presence of 20 mM β-mercaptoethanol, and a size exclusion chromatography. The IMAC and preceding TEV-protease cleavage was performed as described for A168-A169. Gel filtration was carried out on a Superdex 75 16/60 column (GE Healthcare) in 20 mM Bis-Tris-Propane pH 7.5 and 50 mM KCl.

2.2.4 Crystallisation of A168-A169-A170 and diffraction tests For crystallisation, the protein was concentrated to 5-10 mg/ml. Crystallisa- tion conditions were screened using 96-well plates with 100 µl reservoir solution and equal volumes of protein and well solution in the droplet to give a final volume of 2 µl. A hit was obtained at 20◦C in condition 88 of the Index Screen (Hampton Research), which contains 0.2 M tri-ammonium citrate pH 7.0 and 20 % PEG 3350. The small crystals in this condition were detected to consist of clusters of crystals. Optimisation by screening around this condition, resulted in 250 mM tri-ammonium citrate, 150 mM ammonium sulphate and 18 % PEG 3350 by using a protein concentration of 5 mg/ml. As the thin plates grew as rosettes of crystals, a part was split off to test its diffraction properties. Diffraction of a crystal plate soaked in mother liquor with 25 % glycerol was tested on BW7A (EMBL/DESY, Hamburg) on a MarCCD 165 mm detector. Diffraction patterns of the tested crystal are shown in Figure 2.2 at positions 90◦ apart from each other. The edge of the image corresponds to 2.6 A˚ resolution with single detected reflections to 2.8 A˚ resolution. The detector-crystal distance was 220 mm. While one image displays diffraction restricted along one axis, the diffraction of the 90◦-rotated crystal shows a distribution of the diffraction spots over the whole image (Figure 2.2, bottom panel). The anisotropic diffraction may arise from the thin crystal shape. Due to the anisotropy of the crystal, a full data set could not be collected. The space group could be either P1 or C2. Assuming the triclinic space group the cell dimensions are a = 69.1 A,˚ b = 73.0 A,˚ c = 95.6 A˚ and α = 86.9◦, β = 68.9◦, and γ = 74.5◦. For the monoclinic space group C2, cell dimensions would be a = 69.1 A,˚ b = 178.4 A,˚ c = 73.0 A˚ and α = γ = 90◦ and β = 105◦ as determined by DENZO (Otwinowski 24 The A-band immunoglobulin domains A168 and A169 and Minor, 1997). Further optimisation of the crystallisation conditions is required to obtain crystals suitable for full data collection.

2.2.5 Crystallisation of A168-A169 For crystallisation, A168-A169 was concentrated to about 14 mg/ml. Crystalli- sation screens were set up by the hanging-drop vapour diﬀusion method with droplets of 2 µl volume composed at a 1:1 ratio of reservoir and protein solution, equilibrated against 500 µl of reservoir solution. In total, three native crystals were grown in 0.1 M Bicine pH 9.0 to pH 9.2 and 1.4 M to 1.6 M ammonium sulphate. The initial condition was obtained from condition B6 (1.6 M ammonium sulphate, 0.1 M Bicine pH 9.0) of the ammonium sulfate grid screen (Hampton Research). The crystal used for data collection grew in 0.1 M Bicine pH 9.2 and 1.4 M ammonium sulphate (Figure 2.3, left). During data collection, new but smaller crystals grew in a diﬀerent space group, raising from partial air- drying of the drop during crystal mounting. More native crystals could only be obtained by streak-seeding with these new crystals. In contrast, crystals of the selenomethionine-incorporated protein, were grown reproducible in 1.5-1.6 M ammonium sulphate and 0.1 M Bicine (pH 8.7- 9.2) (Figure 2.3, middle and right).

2.2.6 A168-A169 X-ray data collection and processing Two native data sets were collected at X13 (EMBL/DESY, Hamburg) on a MarCCD 165 mm detector of crystals grown in 0.1 M Bicine pH 9.2 and 1.4 M ammonium sulphate. The crystal (native 1) was soaked in 0.1 M Bicine pH 9.2 and 1.4 M ammonium sulphate and 18 % glycerol prior to flash freezing in the cryo-stream. Diffraction to 2.48 A˚ resolution was obtained. The second data set was collected on one of the smaller, novel grown crystals (native 2), which was soaked in mother liqour containing 20 % glycerol before mounting in the cryo-stream. This crystal diffracted to 1.99 A˚ resolution. The data were processed and scaled with DENZO and SCALEPACK (Otwinowski and Minor, 1997). Crystal native 1 belongs to the orthorhombic space group C222 with cell dimensions of a = 95.6 A,˚ b = 122.5 A,˚ c = 98.7 A.˚ Crystal native 2 crystallised in the orthorhombic space group I222 with a unit cell of a = 69.6 A,˚ b = 87.1 A,˚ c = 104.8 A.˚ A three-wavelength MAD (multiple anomalous dispersion) data set was collected at the tuneable beamline BW7A (EMBL/DESY, Hamburg) on a Mar- CCD 165 mm detector. Data sets for the MAD experiment were collected on one crystal grown in 1.5 M ammonium sulphate, 0.1 M Bicine (pH 9.0) which was soaked in mother liquor with 25 % glycerol prior to data collection (Figure 2.3). The MAD data sets were processed and scaled with XDS/XSCALE (Kabsch, 1993) in XDSi (Kursula, 2004). The crystal belongs to the orthorhombic space group I222 with cell dimensions of a = 69.4 A,˚ b = 89.3 A,˚ c = 106.5 A.˚ Data collection statistics are shown in table 2.1. 2.2 Materials and Methods 25

Figure 2.2: Diffraction patterns of a weak diffracting titin A168-A169-A170 crystal at the start position (top panel) and 90◦ rotated (bottom panel) show anisotropy of the crystal. The images were taken at BW7A (EMBL/DESY, Hamburg). The edge is at 2.6 A˚ resolution. A few single reflections were detected to 2.8 A˚ resolution. 26 The A-band immunoglobulin domains A168 and A169 al .:Xrydt olcinstatistics. collection data X-ray 2.1: Table pcgopC2 22I2 22I222 22,485 I222 37,855 165,702/ BW7A 32,479 I222 267,707/ BW7A 21,381 247,713/ I222 BW7A 123,378/ 20,714 C222 110,450/ I/ X13 R (%) completeness reflections unique reflections/ of number ( range resolution ( X13 dimensions cell spacegroup ( wavelength (EMBL/DESY) beamline rcsig EZ/DNO D/XS XDS/ XSCALE XDS/ XSCALE XDS/ XSCALE SCALEPACK DENZO/ SCALEPACK DENZO/ scaling processing/ sym σ I ∗ (%) ∗ )083 .00091 .810.9191 0.9821 0.9817 0.8030 0.8030 A) ˚ )a ,c9.,125 876.,8.,1486.,8.,106.5 89.3, 69.4, 104.8 87.0, 69.6, 98.7 122.5, 95.6, c b, a, A) ˚ ∗ )2-.82-.92-. 02120-2.5 20-2.1 20-2.2 25-1.99 25-2.48 A) ˚ 0. 100 60(78 98(0.)9. 9.)9. (97.3) 99.3 (0.256) 0.062 (97.4) 99.4 (0.526) 0.123 (100.0) (0.374) 99.8 0.095 (0.570) 0.057 (97.8) 96.0 (0.461) 0.040 (100.0) 100.0 31(.)2. 40 46(.4 .5(.)2. (7.39) 22.2 (3.3) 9.85 (4.34) 14.6 (4.0) 28.7 (5.5) 43.1 aie1ntv ee pa)SMt(neto)SMt(remote) SeMet (inflection) SeMet (peak) SeMet 2 native 1 native ∗ ubr nprnhssrfrt h ihs eouinselo bevddata. observed of shell resolution highest the to refer parentheses in numbers 2.2 Materials and Methods 27

Figure 2.3: Crystals of A168-A169. Left: Native crystal grown in 1.4 M ammonium sulphate and 0.1 M Bicine pH 9.2, used for data collection to 2.48 A˚ resolution. Middle: Selenomethionine crystal grown in 1.5 M ammonium sulphate and 0.1 M Bicine pH 9.0, used for MAD data collection. Right: Selenomethio- nine crystal grown in 1.6 M ammonium sulphate and 0.1 M Bicine pH 8.7.

---TOP SOLUTION FOUND BY SOLVE ( = 0.50; score = 7.50) ---

X Y Z OCCUP B HEIGHT/SIGMA

1 0.477 0.039 0.224 1.720 52.3 11.4 1 0.063 0.108 0.194 0.304 39.8 8.5 1 0.090 0.091 0.213 0.457 60.0 7.4

Table 2.2: Selenium sites in A168-A169 located by SOLVE.

2.2.7 Structure solution of A168-A169 Structure solution by MAD in space group I222 The structure of the tandem Ig domains A168-A169 from human titin has been solved by a three-wavelength MAD experiment on crystals grown of selenomethionine-substituted protein in the space group I222. Three selenium sites per asymmetric unit were located using the program SOLVE (Terwilliger and Berendzen, 1999). Two sites were in near proximity to each other, corresponding to the two conformations of the flexible N-terminal selenomethionine (Table 2.2). The two sites approved the assumption of one molecule per asymmetric unit derived by calculation of the Matthews coefficient (Matthews, 1968) to be 3.7 A˚3/Da with a solvent content of 66%. The program RESOLVE (Terwilliger and Berendzen, 1999) was used for density modification. An initial model of the 1.99 A˚ data set was built by ARP/wARP (Per- rakis et al., 1999), which was autotracing 187 out of 195 residues. The structure was refined in iterative rounds with REFMAC5 (Murshudov et al., 1997) in the CCP4 package (CCP4, 1994) applying TLS refinement and manual building with the program O (Jones et al., 1991). The refinement statistics are given in Table 2.3. 28 The A-band immunoglobulin domains A168 and A169

Structure solution by Molecular Replacement in space group C222 Calculation of the Matthews coefficient (Matthews, 1968) resulted in 3.6 A˚3/Da, corresponding to two molecules in the asymmetric unit and a solvent content of 66 %. Phases of the 2.48 A˚ data set in space group C222 were obtained by applying the molecular replacement method with the program MOLREP (Vagin and Teplyakov, 1997) and using the coordinates of the I222 data set as a search model. Since the orientation of the two Ig domains to each other was slightly different in the second crystal, the search had to be split into two parts. The molecular replacement was first carried out with the domain A168 (residues 1- 95). Thereby, two molecules were found that were kept fixed during the second iteration in which the domain A169 (residues 96-195) was used as a search model. The R factors after the first and the second round were 57.3/55.4 % and 51.7/47.6 % with correlation coefficients of 25.0/30.5 and 40.3/50.1, respectively. The R and Rfree after rigid body refinement were 27.2 % and 29.8 %, respectively. The structure was refined to final R and Rfree of 24.4 % and 30.3 %, respectively, using REFMAC5 with TLS refinement. One of the molecules in the asymmetric unit was less ordered compared with the other molecule and compared with the I222 structure. The refinement statistics are given in Table 2.3.

2.2.8 Tilt and twist angle in module assembly Information about the tandem domain-domain arrangement was obtained by determination of the orientation (tilt) and rotation (twist) of the domains towards each other. Therefore, the inertia tensor of the ﬁrst domain (correspond-

data set native 1 native 2 resolution range (A)˚ 25-2.48 25-1.99 space group C222 I222 molecules/ asymmetric unit 2 1 R (%) 24.4 19.6 Rfree (%) 30.3 22.8 number of atoms 3115 1736 number of solvent atoms 52 170 rmsd from ideal bond length (A)˚ 0.014 0.012 rmsd from bond angles (◦) 1.736 1.487 Ramachandran plot residues in most favoured regions (%) 88.3 88.6 residues in disallowed regions (%) 0.0 0.0 average B-factor (A˚2) main chain 63.0 39.3 side chain 63.9 42.9

Table 2.3: Reﬁnement statistics of A168-A169 for models from both space groups, C222 and I222. 2.3 Results 29

Figure 2.4: Overall structure of the tandem Ig domains A168-A169. The domain A168 is shown in red and A169 in dark red. The continuous strand is highlighted in blue and the extended loop between strand A and A’ in yellow.

ing to the reference domain) was calculated. A new coordination frame was deﬁned with the eigenvectors of the inertia tensor as the new coordinate axes and the center of mass of this domain as the origin. The z-axis is the longest axis of the module and directs toward the C-terminus of that domain. The tilt describes the angle between the z-axis of the rotated domain and the reference domain. The twist angle is the angle of rotation around the z-axis which is required to align the two domains. The interdomain geometry was determined (Bork et al., 1996) and the values were calculated using the program ’mod22’ written and kindly provided by Bruno Kieﬀer (unpublished).

2.3 Results

2.3.1 Overall structure of titin A168-A169 The structure of A168-A169 has been solved to 1.99 A˚ and 2.48 A˚ resolution in the space groups I222 and C222 with one and two molecules per asymmetric unit, respectively. Both Ig domains adopt the topology of a greek key β-sandwich. They consist each of two β-sheets composed of nine β-strands, the sheets ABED of which form one strand and A’GFCC’ the other. In the second sheet all strands are antiparallel, except for the A’ strand which is parallel to the G strand. Comparison of these structural features like number and length of the strands, the connection between the strands as well as the presence of I-set key residues allows to classify A168 as well as A169 to the I-set (intermediate set) of immunoglobulin 30 The A-band immunoglobulin domains A168 and A169

Figure 2.5: Superimposition of the tandem Ig domains A168 (purple) and A169 (red) shows a large overall resemblance with other titin Ig domains. The insertion in A169 between strand A and A’ emerges strikingly as a unique feature among the available three-dimensional titin Ig domains, which are Z1 (orange), Z2 (yellow), I1 (light green), I27 (dark green), M1 (blue) and M5 (teal).

domains (Harpaz and Chothia, 1994). A 310 turn is present between the E and the F strand at residues D69-D71 and R168-D170 in domain A168 and A169, respectively.

2.3.2 Comparison of the Ig domains Inserted bulge in A169 The structures of the Ig domains A168 and A169 have an overall r.m.s.d. of 1.2 A˚ (91 Cα) and a sequence identity of 20.5 % (Table 2.4). Superimposition of the two domains, however, displays an extended loop in the immunoglobulin domain A169 between the strands A and A’. The insertion in A169 in comparison to A168 comprises ﬁve additional residues, TLEGM, in the connecting loop between strand A and A’, which form a bulge (Figure 2.5). This bulge is located along the longest side of the domain. Apart from the bulge in domain A169, the single tandem Ig domains resemble both a typical I-set immunoglobulin domain. Remarkably, this insertion in A169 not only stands out in comparison with A168, but also in comparison with the other titin Ig domains with known 2.3 Results 31

A168 A169 Z1 Z2 I1 I27 M1 M5 A168 20.5 35.6 37.1 31.0 20.5 24.4 21.3

A169 1.20 26.8 26.2 26.9 16.7 21.8 18.8 (91) Z1 0.83 1.14 44.3 36.0 28.2 30.7 21.4 (92) (90) Z2 1.16 1.36 0.88 35.9 20.7 21.8 22.6 (93) (88) (92) I1 0.93 1.40 1.07 1.32 19.2 26.3 17.0 (94) (89) (93) (93) I27 1.12 1.48 1.19 1.19 1.06 18.6 7.7 (86) (82) (87) (85) (88) M1 1.32 1.43 1.30 1.50 1.25 1.15 17.4 (90) (87) (88) (88) (88) (85) M5 1.75 1.64 1.76 1.72 1.70 1.77 1.84 (79) (75) (83) (80) (83) (76) (82)

Table 2.4: Structural comparison of titin Ig domains. In the top right, numbers represent sequence identity (in %) between the Ig domains. In the bottom left, the r.m.s.d. in A˚ is given, obtained by LSQMAN (Kleywegt et al., 1997) with a cut-oﬀ of 3.5 A˚ and the number of matching Cα in parentheses.

three-dimensional structure. A structure-based sequence alignment (Figure 2.8) against other Ig structures of titin clearly displays the bulge region in A169, which is, however, not present in the other structures. For comparison, available Ig domain structures of diﬀerent regions in titin were analysed. Two Ig domains from the Z-disc, Z1 and Z2 (Z1-Z2 in complex with telethonin, X-ray structure solved by N. Pinotsis), two Ig domains from the I-band, I1 (PDB code: 1G1C) and I27 (X-ray structure solved by C. Vega), and two Ig domains of the M-line, M1 (see chapter 3) and M5 (PDB code: 1TNM) were compared with A168 and A169 from the A-band. Interestingly, the bulge is not emerging in sequence alignments (ClustalW, T-Coﬀee) based only on sequences. Structure comparisons and the sequence identity between the analysed structures are given in Table 2.4. For both domains, A168 and A169, the titin Ig domain structure with the lowest deviation is Z1, with an r.m.s.d. of 0.83 A˚ (92 Cα) and 1.08 A˚ (89 Cα) for A168 and A169, respectively.

Loop and crystal contacts The bulge is involved in crystal contacts with the symmetry related molecule. This can be observed in both crystal forms. The interactions found in the crystal contacts are mainly hydrogen bonds, but also a salt bridge between E107 of one and K54 of the other molecule is found. The interactions are restricted to the residues P103, K104, T105, and E107 on the side of the loop contribution in 32 The A-band immunoglobulin domains A168 and A169 domain A169. These residues are interacting with the residues A45, I52, Q53, E54, and K56 located in the D strand of domain A168 of the second molecule. In addition, one water molecule is involved in the interaction. Interestingly, in both crystal forms (all three molecules) a glycerol is found stabilizing the bulge. The B-factors of the bulge do not emerge by high values, but rather adopt values in the range of the stable core region.

2.3.3 Comparison with other tandem Ig domains Continuous β-strand The two Ig domains are connected by a continuous β-strand. Owing to the extension of the G strand of A168 into the A strand of A169, the two domains are tightly connected. The strand G of A168 with residues G84 to E95 merges in the domain A169 in the residues V96 to I100. The secondary structure elements as derived from DSSP (Definition of secondary structure of proteins) (Kabsch and Sanders, 1983) assign residues G84 to I100 to an extended β-strand in the structure with 1.99 A˚ resolution in space group I222. While the amino acids G84 to S91 bridge in an antiparallel way with the residues Q81 to V74 (F strand of A168), residues L92 to E95 form bonds to the parallel oriented strand A’ of A168 with the amino acids L12 to R15 (Figure 2.6). The antiparallel strand B of A169 participates in β-bridging with residues F126, S127, and K129 to the end of the continuous β-strand, of which V96, K99, and I100 are involved. One chain of the lower resolution structure is not attributed as a continuous β- strand, since it shows an interruption of the strand at residue E95 according to DSSP. In the higher resolution structure, P97 and A98 do not form hydrogen- bonds to another β-strand, despite their assignment to the continuous β-strand. Residues S85, T89, and A98 are assigned according to DSSP to the chirality of a right-handed α-helix in contrast to other residues in this β-strand labelled as ideally twisted β-strand. In the continuously attributed β-strand, not all residues comply with all requirements of a continuous β-strand. No hydrogen bonds are formed between the backbone Cα of one domain with those of the other domain. Backbone hydrogen-bonding occurs between E95 of domain A168 with V14 and R15, and between V96 of domain A169 with K129 (Figure 2.7). A few weak interactions are found in the interface, but an inter-domain interaction stabilizing the two domains could not be observed. The continuous β-strand is found in the structures refined in space group I222 and in one molecule refined in space group C222, while the other shows an interruption in the strand in one residue between the two domains at residue E95. The three molecules superimpose well with an r.m.s.d. of 1.08 A˚ (193 Cα), 0.86 A˚ (195 Cα), and 0.84 A˚ (194 Cα) for I222 and A-chain of C222, I222 and B-chain of C222, and A-and B-chain of C222, respectively. The values of the B-factors are increased both in the linking region between the domains as well as in the regions where the strands are connected within the domain. 2.3 Results 33

S121

I122

K123

I124 strand B

P125 I100 F126 K99 S127 Y16 A98 G128 P97 K129 R15 V96

V14 E95 strand A’ N13 V94

L12 E93

L92

V74 S91

Y75 A90

Q76 T89

strand F V77 G88 R78 S87

A79 V86

T80 S85

N81 G84

Q82 G83

Figure 2.6: Schematic representation of the continuous β-strand interaction. The continuous β-strand is shown in blue. Hydrogen-bonding by the strands A’ and F from domain A168 (in red) and by the strand B of domain A169 (dark red) are represented. 34 The A-band immunoglobulin domains A168 and A169

Figure 2.7: Tandem domain interface. Backbone hydrogen bonding of E95 with V14 and Y16 in domain A168 (red), and of V96 with K129 in domain A169 (dark red). The continuous β-strand is shown in blue.

Tandem domain-domain arrangement The tilt angle and twist angle were calculated according to Bork et al. (1996). A plain interdomain linkage with a tilt angle between the two domains of 23◦ and a twist angle of 137◦ in the structure in space group I222 are found. The two chains in space group C222 display slightly diﬀerent values: chain A has a tilt of 23◦ and a twist angle of 125◦ and the chain B has 26◦ and 132◦, respectively.

2.4 Discussion

2.4.1 Insertion loop in A169 between strand A and A’ The inserted loop in domain A169, interposed between the β strands A and A’, is found in an unusual position for an insertion in an immunoglobulin domain fold. In contrast to the conventional and prominent B-C and F-G loop positions at the end of the elongated Ig domain, the location of the bulge is along the longest side of the Ig domain. In an extensive search through the PDB using Macromolecular Structure Database (MSD) at the EMBL-EBI site (www.ebi.ac.uk/msd/) another structure (PDB code: 1FLT) was found with a loop at a similar position, preceding the A’ strand. The second domain (1Flt- D2) out of seven Ig domains of the receptor tyrosine kinase VEGFR1, which is also called ﬂt-1 for fms-like tyrosine kinase 1, has been solved in complex with the VEGF to 1.7 A˚ resolution. VEGFR1 has been shown to be a member of 2.4 Discussion 35

Figure 2.8: Structure-based sequence alignment of titin Ig-like domains. Blue characters indicate the secondary structure elements of A168 and A169. The key residues of the Ig domain I-set according to Harpaz and Chothia (1994) are marked by stars. Residues in agreement with the key I-set are shaded in green: mostly hydrophobic; in cyan: basic; in red: Asp; in yellow: Gly (Ala); in violet: Cys; and in pink: Tyr respectively Trp. A detailed annotation of residues in these positions was published previously (Harpaz and Chothia, 1994). Additional positions of key residues are marked by an arrow and shaded in grey according to Fong et al. (1996).

the I-set family of Ig domains (Wiesmann et al., 1997). However, despite this classification, some particularities were found, including a shorter B strand and primarily the absence of the A strand (Wiesmann et al., 1997). In 1Flt-D2, the residues usually forming the A strand take the shape of a loop. In addition to the different conformations in the free and bound state, this loop can adopt distinguishable conformations when in complex with VEGF (Starovasnik et al., 1999; Wiesmann et al., 1997). A structural change towards a strand upon binding to VEGF and PLGF has not been observed, and the flexibility appears to be the intrinsic property (Wiesmann et al., 1997; Christinger et al., 2004). Moreover, the loop region preceding the A’ strand of 1Flt-D2 is participating in interaction with VEGF, mainly involving hydrophobic residues. There, 1Flt-D2 is interacting with its insertion loop, the connection between C and C’, the 310 helix, and the N-terminus of the F strand as well as the C-terminus of the G 36 The A-band immunoglobulin domains A168 and A169

Figure 2.9: Superimposition of A169 in dark red with the insertion in yellow, and 1Flt-D2 in gray with the unstructured region preceding the A’ strand highlighted in green.

strand. A comparison of the loop formation in A169 and 1Flt-D2 is shown in Figure 2.9. Although the A strand of A169 is structured in contrast to the flexible amino- terminus of 1Flt-D2, the inserted loop between strand A and A’ demonstrates a unique feature at a comparable position as observed in 1Flt-D2. In structure- based sequence comparisons with other structures of titin Ig domains the insertion emerges clearly (Figure 2.8), whereas alignments based on the sequence only could not uncover an insertion at that position without the structural information. In the sequence alignment, the insertion and the short linker region between the two domains may have cancelled out each other. Sequence identity among Ig domains is low. Moreover, for the A strand of I-set Ig domains no key residue had been identified (Harpaz and Chothia, 1994). However, key residues of the strands A and A’ have been assigned for C. elegans Ig18’ (Fong et al., 1996). In a structural comparison among the Ig domains Ig18’, telokin, M5, and VCAM-1, residues with the same structure were defined key residues. In the sequence alignment (Figure 2.8) these additional key residues were marked by an arrow and shaded in grey. The bulge in domain A169 presents a new 2.4 Discussion 37 feature which was not predicted from previous sequence alignments of titin Ig domains.

2.4.2 Continuous β-strand bridging the two domains The two Ig domains A168 and A169 are connected by a continuous β-strand which associates them tightly. This feature is also found in the domains 1 and 2 of CD4 (Wang et al., 1990; Ryu et al., 1990) and domains 3 and 4 of CD4 (Brady et al., 1993). Both tandems in CD4 consist of a V-set Ig domain in the ﬁrst position (domains 1 and 3) and a truncated C2-set Ig domain in the second domain (domains 2 and 4). A connection by a continuous β-strand generated by merging the strand G and the strand A of two consecutive I-set Ig domains has not been described before. Comparison of the Ig domains A168-A169 with those in CD4 shows that the titin tandem is less intertwined than CD4. In the structure here, the β-strand bends oﬀ from A168 into domain A169. The continuous β-strands of the CD4 tandem domains are straighter and place the domains at opposite sites of the strand, supported also by a larger twist of the successive domains. While the twist angle between A168 and A169 is about 135◦, in CD4 it is about 160◦ for domain 1 and 2 (Wang et al., 1990) and about 185◦ for domain 3 and 4. This higher twist angle allows tighter stacking of the two domains. In CD4 the close domain connections are further supported by the hydrophobic interactions which are much less in A168-A169. A similarly intimate association is not observed in the A168-A169 structure. The linking β-strand observed here and in the CD4 structures represent distinct variations of connecting two domains. A rigid structure due to the linkage is observed in A168-A169. The two tandem domains in the CD4 structures are beyond the rigid structure merged into one unit. In summary, the tandem domain A168- A169 can be considered as two distinct but closely linked domains connected by a continuous β-strand.

2.4.3 Interdomain geometry The tilt value of two consecutive Ig modules varies usually between 15◦ to 50◦ (Bork et al., 1996). In A168-A169 the tilt angle lies in the lower region of this range (between 23◦ and 26◦). Importance of a stiff and plain conformation may be attributed rather to the A-band than to the I-band which is functionally designated as a ’molecular spring’. In the I-band part of titin, domains need a higher degree of flexibility to comply with the elasticity which may be reflected in higher tilt angles of some tandem domains. In the A-band part where titin adopts a function as a ’molecular ruler’ the distances of the center of mass between modules needs to be kept constant. Potential minor variability of the tilt angle may occur but is supposed to be avoided to a large extent. The plain and presumably restricted flexibility of the A168-A169 structure forming a unit at the C-terminal part of the titin A-band may be required to provide titin with rigidity in this region. The connection of the preceding titin kinase embedded within the FnIII domain A170 and the Ig domain M1 may 38 The A-band immunoglobulin domains A168 and A169 be more flexible and may allow responses to sarcomere stretches (Gräteret al., 2005). The contribution of the connection between A169 and A170 in this part of titin still has to be examined. The structure of the triple domain A168-A169- A170 will shed light on the conformational behaviour of the connection of A169 to A170. Longer linkers between two domains do not necessarily result in higher tilt angles, as seen in structures such as C-Cadherin (Boggon et al., 2002) or the Z-disc Z1-Z2 which can adopt different tilts in the crystal structure (Zou et al., 2006). The domains may gain a higher degree of flexibility by additional amino acids in the linking region between two modules, but they need not use it. The weak interactions found in the interface as well as the absence of interdomain interactions comply with the finding that specific interactions in the interface are not expected for modular proteins (Spitzfaden et al., 1997). The location of a protein is crucial for accomplishing its function. In titin, the formation of a rigid module-module shape as seen here or the flexibility to adopt differently tilted orientations between two domains may allow the modular protein titin to fulfil its structural functions in the different regions in the sarcomere. It is not possible to provide a prediction of the tilt range from the number of linking residues between two domains so far. On the contrary, a closer connection and strengthening of the connection by a lack of linking residues in combination with a continuous β-strand lead to a plain and rigid structure rather than allowing much flexibility among the domains.

2.4.4 Tight connection and rigid structure An overall similarly rigid structure is observed in all three molecules of A168- A169. The rigidity is reflected by the low tilt angles of 23◦ to 26◦. The tight connection of the domains due to the continuous β-strand allow little flexibility of the modules towards each other. In contrary, the titin tandem Ig domains Z1-Z2 of the Z-disc show a high degree of flexibility. In three different Z1-Z2 molecules the tilt angle adopts the largely differing values of 16◦ (in complex with telethonin), 31◦, and 135◦. In contrast to A168-A169, the domains Z1 and Z2 are connected by a linking region of three residues. Although A168-A169 presents only weak interactions in the interface, the compact structure due to the absence of a linker between the domains, makes this tandem Ig domain a rigid unit. Despite the tight connection, no inter-domain interactions were identified. Weak interactions to allow a certain degree of stiffness and setting constraints on the domain motions are one option to arrange consecutive modules in mosaic proteins (Improta et al., 1998; Spitzfaden et al., 1997; Copieéet al., 1998). This configuration applies also for A168-A169. For the I-band Ig domains I27-I28 weak module-module interactions were also assumed, structurally investigated by small-angle X-ray scattering (SAXS) and nuclear magnetic res- onance (NMR) in comparison with a construct containing an artificial three residues linker (I27gggI28) (Politou et al., 1996; Improta et al., 1998). The presence of a continuous β-strand as observed in CD4 appeared remote (Poli- tou et al., 1996; Improta et al., 1998). Differences in the connecting strand in 2.4 Discussion 39

CD4 and A168-A169 were identiﬁed (see above). The unexpected feature of the β-strand in the titin Ig domains and the consequential connection of the domains, emphasises the rigid character of A168-A169. The presence of this property is likely to be found in the physiological environment in muscle.

2.4.5 Relevance of the bulge in the function of A168-A169 The tandem Ig domain A168-A169 has been shown to interact with MURF-1 based on yeast two-hybrid experiments and in vitro translated protein pulldown assays (Centner et al., 2001). Streches of amino acids involved in the binding on the site of MURF-1 have been mapped recently (Witt et al., 2005), yet the interacting residues of A168-A169 have not been determined. Taking into account that the tandem Ig domain A168-A169 possesses a unique or rare insertion among titin Ig domains between strand A and A’, which is similar to that of 1Flt-D2 where it participates in binding, an involvement of the bulge in interaction can be assumed. The residue E107 in the insertion region was proposed to be of importance for binding due to the negatively charged character and its exposed position in the bulge. The introduction of the mutation E107R abrogates the binding to MURF-1 in a pull-down assay (data not shown, personal communication, S. Lange). More analysis of the amino acids of A168- A169 involved in binding with MURF-1 is required to obtain a complete picture of the interaction site of the two proteins. These preliminary results (S. Lange), which were structurally predicted, conﬁrm the importance of the bulge in the interaction with MURF-1.

Chapter 3

The titin M-band immunoglobulin domain M1

3.1 Introduction

3.1.1 MLCK and related kinases surrounded by FnIII and Ig domains Protein kinases play a key role in regulation of various cellular processes and the activation mechanisms of these kinases are numerous (Huse and Kuriyan, 2002). Among the protein kinases activated by phosphorylation, members of the MLCK family, including titin kinase, represent a distinct subgroup. The absence of the conserved arginine preceding the catalytic aspartate and its role in activating the kinases has been described previously (Johnson et al., 1996). Moreover, the related kinase domains in the giant muscle proteins from diverse organisms and the smooth muscle myosin light chain kinase are surrounded by Ig and FnIII domains (Kamm and Stull, 2001; Champagne et al., 2000). In particular, the pattern of the Ig and FnIII domain distribution in these proteins is very similar and the kinase domain is mostly accompanied by a FnIII domain ahead and a preceding Ig domain in the nearest neighbourhood (Figure 3.1). A structure of the twitchin kinase from C. elegans together with the additional C-terminal Ig domain has been solved to 3.3 A˚ resolution (Kobe et al., 1996).

3.1.2 Two examples of a subsequent Ig domain of a kinase - telokin and the twitchin Ig domain Ig26 Telokin, also known as kinase related protein KRP, is an acidic protein of 17 kDa which is independently expressed in distinct smooth muscle tissue though with an identical amino acid sequence to the C-terminal domain of MLCK (Gal- lagher and Herring, 1991; Ito et al., 1989). Telokin binds to the neck region of smooth muscle myosin (Shirinsky et al., 1993). The residue S13 phosphorylated by cyclic GMP-dependent kinase is involved in modulation of smooth muscle relaxation (Walker et al., 2001). Even though the X-ray structure of telokin has been solved (Holden et al., 1992) to 2.0 A˚ resolution (PDB: 1FHG), the clear function of telokin in smooth muscle has not been identiﬁed. However,

41 42 The titin M-band immunoglobulin domain M1

Figure 3.1: Schematic domain arrangement representation. Comparison of the domain structure in proximity to the catalytic domain of giant muscle kinases titin, and twitchin, and smMLCK according to Hu et al. (1994) and Kobe et al. (1996). The Ig domains are highlighted in red, the FnIII domain in grey, and the kinase domains in light blue. In twitchin and smMLCK, the Ig and FnIII domains are numbered separately, while in titin the consecutive numbering of domains is according to their location in the Z-disc, I-band, A-band and M- line. Domains of which the structure is known are marked by a star: titin kinase (Mayans et al., 1998), M1 (this chapter), twitchin kinase TWK-43 from Aplysia (Hu et al., 1994), and twitchin kinase pJK4 from C. elegans (Kobe et al., 1996). All kinase structures are autoinhibited. The domain structure of smMLCK (Olson et al., 1990) is given for comparison.

diverse controversial suggestions are discussed (Shirinsky et al., 1993; Masato et al., 1997; Walker et al., 2001; Sobieszek et al., 2005). The N- and C-terminus with the phosphorylation site and the acidic tail cannot be seen in the crystal structure and appear to be ﬂexible (Holden et al., 1992). The Ig domain Ig26 is located C-terminal to twitchin kinase from C. elegans and a structure of both domains has been solved (Kobe et al., 1996).

3.1.3 Scope of the work In this chapter, the Ig domain M1 preceding titin kinase is analysed and implications on its relevance in combination with titin kinase are drawn. The location within titin close to the titin kinase is highlighted in Figure 3.2. 3.2 Materials and Methods 43

Figure 3.2: Titin kinase downstream signalling pathway. The proteins titin (domains A168 to M1), NBR1, p62, and MURF are presented schematically by their domain composition. The domain analysed in this chapter is the Ig domain M1 highlighted in red.

3.2 Materials and Methods

3.2.1 Preparation of titin M1 The titin Ig domain M1 of human cardiac muscle comprises the residues 25071-26925 (protein accession code Q10466; nucleotide accession code X90568 with nucleotides 57343-75630). The DNA of this segment was amplified by polymerase chain reaction (PCR). The TOPO vector construct A168-M1 (see appendix A) was used as a template and M1 NcoI (5’-AAACCATGGT TTCTGGGCAG ATAATGCATG-3’) and M1 BamHI (5’-AAAGGATCCTCA TTCTCTCACA CCTTTAACAA ATAGCTC-3’) were used as forward and reverse primers, respectively. The PCR products were digested with NcoI and BamHI restriction enzymes and subcloned into the pETM11 vector (based on pET24d (Novagen), modified by G. Stier, EMBL). Identity of the cloned fragment was confirmed by DNA sequencing (MWG-Biotech). The vector encodes a six-histidine-tag amino-terminally to the recombinant protein followed by a TEV cleavage site. The N-terminus of the protein sequence has been changed from G-P to G-A-M due to cloning. The residues in the protein model were renumbered in 0-96. For expression, the E. coli strain BL21(DE3)CodonPlus RIL (Stratagene) was used. One colony was picked for the preculture in Luria Bertani (LB) medium containing 50 µg/ml kanamycin and 34 µg/ml chloramphenicol, and grown over night at 37◦C in a shaker. The preculture was diluted 1:40 in LB medium with the appropriate antibiotics and grown to an OD600 = 0.5. The cells were induced with 0.75 mM IPTG and grown for four hours. Harvesting was performed by centrifugation for ten minutes at 6000 rpm (JLA 8.1000 rotor, 44 The titin M-band immunoglobulin domain M1

Figure 3.3: Crystals of titin M1, grown in 2.2 M ammonium sulfate and 0.1 M Bis-Tris, pH 7.0.

Beckman) at 4◦C. The cells were washed in PBS, pelleted and frozen at -20 ◦C. For purification, the cells were resuspended in lysis buffer (25 mM Tris/HCl pH 8.0, 300 mM NaCl, 5 mM imidazol) with addition of about 1 mg/ml lysozyme, sonicated and centrifuged at 18000 rpm for 30 min at 4 ◦C. The supernatant was filtered and loaded onto Ni-NTA beads (Qiagen) which had been equilibrated in lysis buffer before. The beads were washed by lysis buffer, and the protein was eluted with 400 mM imidazol in 25 mM Tris/HCl pH 8.0 and 300 mM NaCl. The polyhistidine tag was cleaved off by addition of TEV protease and incubation overnight at room temperature. After concentration of the protein, a size exclusion chromatography was performed on a superdex75 16/60 column in 25 mM Bis-Tris-Propane pH 7.4 and 50 mM NaCl. The protein was concentrated to about 8 mg/ml and purity was confirmed by SDS-PAGE.

3.2.2 Crystallisation of titin M1 For crystallisation, droplets of 1 µl M1 in concentrations of 8 mg/ml and 4 mg/ml were mixed with 1 µl of reservoir solution. In a hanging drop vapour diﬀusion experiment, the droplets were equilibrated against the reservoir solution. Initial crystallisation conditions were obtained from the ammonium sulfate grid screen (Hampton Research). Optimisation of the conditions was performed by variation of the pH and concentration of ammonium sulfate using hanging and sitting drop vapour diﬀusion. Amount and sizes of crystals in each droplet varied with the conditions which were in the range of pH 6.0-7.0 Bis- Tris and 1.8-2.2 M ammonium sulfate. The crystals which were used for data collection grew at 21 ◦C in 2.2 M ammonium sulfate and 0.1 M Bis-Tris, pH 7.0 (Figure 3.3).

3.2.3 Data collection and processing Experimental setup and data collection A native data set was collected on beamline X11 (EMBL/DESY, Hamburg, DORIS storage ring) on a Mar165 mm CCD detector at a wavelength of 3.2 Materials and Methods 45

0.8128 A.˚ The detector-crystal distance was 140 mm. The crystal was ﬂash frozen in the cryostream (Oxford Systems) after a cryoprotectant soak (30- 45 sec) containing 25 % glycerol in mother liquor. A complete native data set was collected to a resolution of 1.69 A.˚

Data processing Data were processed with XDS and scaled using XSCALE (Kabsch, 1993) in XDSi (Kursula, 2004). Data statistics are summarised in Table 3.1. The crystal belongs to the tetragonal space group I41 with the unit cell dimensions a = b = 68.78 A,˚ c = 48.18 A.˚

beamline X11 (EMBL/DESY) wavelength (A)˚ 0.8128 space group I41 resolution range (A)˚ 20-1.69 (1.8-1.69)∗ number of reﬂections 94,405 (16,296) ∗ number of unique reﬂections 24,619 (4,264)∗ completeness % 99.6 (100)∗ ∗ Rmerge % 4.2 (40.7) ∗ Rmeas † (%) 4.9 (47.5) I/σ(I) 18.14 (3.89)∗ R% 18.9 Rfree % 23.0 number of residues 97 number of atoms 919 number of solvent atoms 130 r.m.s.d. bond length (A)˚ 1.393 r.m.s.d. bond angles (◦) 0.015

Table 3.1: X-ray data and structure reﬁnement statistics. ∗ numbers in parentheses refer to the highest resolution shell of observed data. † Diederichs and Karplus (1997)

3.2.4 Molecular replacement and reﬁnement The Matthews coeﬃcient (Matthews, 1968) was calculated from the volume of 3 the unit cell. The value of VM =2.6 A˚ /Da and a solvent content of about 44 % suggested one molecule per asymmetric unit. Initially, a molecular replacement approach was performed using molrep (Va- gin and Teplyakov, 1997) and phaser (McCoy et al., 2005) with the titin Ig domains (Z1 and Z2 (N. Pinotsis, unpublished coordinates), A168 and A169 (see chapter 2), I1 (1G1C), I27 (C. Vega, unpublished coordinates), M5 (1TNM)) and telokin (1FHG) as search models, but a prominent result could not be found. 46 The titin M-band immunoglobulin domain M1

The structure was determined by molecular replacement with CaspR, a web- server for automated molecular replacement using homology modelling (Claude et al., 2004). This web tool executes structure-sequence alignments by T- COFFEE (Notredame et al., 2000), homology model building by MOD- ELLER (Sali and Blundell, 1993), molecular replacement with AMoRe (Navaza, 2001) and model refinement with CNS (Brüngeret al., 1998). As starting models the 2.0 A˚ crystal structure of telokin (1FHG), the NMR averaged structure of titin M5 (1TNM) and the 2.1 A˚ crystal structure of titin I1 (1G1C) were used which share 29%, 18% and 24% sequence identity with M1, respectively. The correlation coefficient and the R-factor of the solution model created by MODELLER were 24.9% and 52.6%, respectively. The R-factors of the final model after CNS minimization were 42.8% and 46.2% for the working set and the test set, respectively. The final solution given by CaspR was obtained by a search model created by MODELLER with telokin, M5 and I1 as reference models. Model building was carried out with COOT (Emsley and Cowtan, 2004). The CCP4 package (CCP4, 1994) including ARP/wARP (Perrakis et al., 1999) was used for refinement. Standard protocols were used in REFMAC5 (Murshudov et al., 1997) comprising one TLS group for the whole Ig domain.

Coordinates of titin M1 The M1 coordinates and structure factors have been deposited at the Protein Data Bank under the accession number 2BK8.

3.3 Results

3.3.1 Purification and crystallisation of M1 The recombinant human titin Ig domain M1 was prepared to high purity by applying affinity chromatography followed by removal of the poly-histidine affinity tag and size exclusion chromatography. Crystals of the tetragonal space group I41 were obtained at neutral pH in ammonium sulfate as precipitant (Figure 3.3).

3.3.2 Structure solution and refinement The structure of M1 was solved by molecular replacement with a model generated by MODELLER based on the immunoglobulin domains telokin (1FHG), titin M5 (1TNM) and titin I1 (1G1C), and refined to 1.69 A˚ resolution. The first two residues G0 and A1 were disordered in the electron density map. The average B-factor of the model and the protein main chain are 37.4 A˚2 and 35.7 A˚2, respectively. The Ramachandran plot (Ramachandran et al., 1963) as a mean to assess model quality was generated by PROCHECK (Laskowski et al., 1993) and is given is Figure 3.4. In the most allowed region of the Ramachandran plot 3.3 Results 47

93 % of the residues are found, and none in the disallowed region. The only residue in the generously allowed region is A1, for which the electron density was disordered.

Figure 3.4: Ramachandran plot for immunoglobulin domain M1, generated with PROCHECK (Laskowski et al., 1993).

Data collection and reﬁnement statistics are given in Table 3.1.

3.3.3 Overall structure of titin M1 The overall structure of M1 shows the typical fold of an I-set immunoglobulin. The I-set key residues (Harpaz and Chothia, 1994) are conserved in 18 out of 20 sites (Figure 3.5). Two β-sheets consisting of the strands ABDE and A’GFCC’ pack against each other to adopt the topology of a greek key β- sandwich (Figure 3.6). A short 310 helix is located ahead of the F-strand. Intracellular reducing environment does not support disulphide bridge formation. However, in the titin Ig domain I1 a reversible disulphide bond was found (Mayans et al., 2001). This observation raised the question, whether a disulphide bridge might also be present in titin M1. The two cysteines in M1 are in a conserved position in the B-strand and the F-strand among Ig domains. However, the thiol groups of C23 and C74 are 3.99 A˚ apart and the electron density clearly shows that the sulfur atoms do not form a covalent bond (Fig- ure 3.7). The residues V33 and A57 are in corresponding positions of C37 and 48 The titin M-band immunoglobulin domain M1

Figure 3.5: Structure-based sequence alignment of M1 (2BK8) with telokin (1FHG) and Tw-Ig26 (1KOA). The residues corresponding to the I-set key residues are marked with a closed circle and are shaded in grey if conserved in the sequence. Additional conserved residues in the three structures are shaded in blue.

C62 in titin I1, respectively, where a disulphide bond is formed between the C-strand and the E-strand (Mayans et al., 2001).

Figure 3.6: Ribbon representation of the M1 Ig domain. The β-strands are labelled from A to G, including A’ and C’. 3.3 Results 49

A57

V33

C74

C22

3.99

Figure 3.7: 2 Fo-Fc electron density map of the M1 Ig domain at σ = 2.0 after reﬁnement to 1.69 A˚ resolution. The distance of 3.99 A˚ between the sulphurs in C22 and C74 disproves disulphide bond formation.

M1 Telokin Ig26 M1 28 22.6 Telokin 1.26 (90) 36.6 Ig26 1.35 (90) 1.11 (94)

Table 3.2: Structural comparison of Titin M1 with Telokin and TwTelokin. In the top right, numbers represent sequence identity (in %) between the Ig domains. In the bottom left, the r.m.s.d. in A˚ is given, obtained by LSQ- MAN (Kleywegt et al., 1997) with a 3.5 A˚ cut-oﬀ and the number of matching Cα in parentheses.

3.3.4 Comparison with telokin and twitchin Ig26 Since the position of the titin M1 Ig domain proximal to titin kinase corresponds to the domain arrangement found in MLCK and titin related proteins, available structures from similar positions were considered for structural comparison. Two structures which meet this criterium, were the structure of the Ig domain C-terminal to the C. elegans twitchin kinase (1KOA) comprising residues 375- 472 and the high resolution structure of 2.0 A˚ resolution of telokin (1FHG) from Meleagris gallopavo (turkey). 50 The titin M-band immunoglobulin domain M1

Figure 3.8: Superimposition of M1, telokin (1FHG), and Ig26 (1KOA). The domains are colour-coded: M1 in red, telokin in blue and Ig26 in green.

A structure-based sequence alignment is given in Figure 3.5. Supplementary to the predominately conserved I-set key residues (Harpaz and Chothia, 1994), six additional conserved residues were found in the three structures which are highlighted in blue in the alignment. A structural comparison with telokin and Ig26 is given in Table 3.2. Superimposition of the M1, telokin and twitchin Ig26 structure (Figure 3.8) illustrates the large structural agreement of Ig domains from diﬀerent proteins, but related positions within. Worth mentioning is the deviation at the site of the N-terminus in the B-C loop which forms contacts in Ig26 with twitchin kinase.

3.4 Discussion

In titin, twitchin, MLCK and related proteins a conservation of the domain arrangement particularly close to the kinase domains has been stated (Kamm and Stull, 2001; Champagne et al., 2000). The overall structures of titin kinase (Mayans et al., 1998) and twitchin kinase from Aplysia (Hu et al., 1994) and C. elegans (Kobe et al., 1996) are similar. They match in a remarkable regulatory tail, association of which with the kinase core explains the autoinhibited character of the kinases (Kobe et al., 1996; Mayans et al., 1998). Truncation of this regulatory segment leads to activation of the kinases (Mayans et al., 1998; Heierhorst et al., 1995; Heierhorst et al., 1996b; Lei et al., 1994). More- over, binding of an effector protein (calmodulin, and the structurally related SA100Al2) to a segment of the autoregulatory tail of titin kinase and twitchin kinase is part of the activation mechanism (Mayans et al., 1998; Heierhorst 3.4 Discussion 51 et al., 1996a). The high structural and functional similarities may be related to a conservation in the arrangement of these kinase domains and their adjacent modules. Interdomain associations, even though less analysed so far, may reflect this as well. Between the twitchin kinase and Ig26 from C. elegans a relatively rigid interdomain relationship has been proposed due to the large buried surface area and the hydrophobic and partially charged character of the interface (Kobe et al., 1996). Based on these data, an assembly model of the titin kinase to M1 domain is given, obtained by superimposition (Figure 3.9). The largest deviation between Ig26 and M1 is found in the B-C loop, which is involved in interdomain interaction with twitchin kinase. Although, differences in the interaction interface may originate therein, a different conformation of this loop could be formed in M1, when attached to titin kinase, resembling that of Ig26. The overall higher B-factors and the lower resolution of Ig26 cannot be neglected. However, the overall shape and, thus, the conformation permit- ting the interaction between the domains may be maintained. Similarly, the largest differences between the kinases are found in the last strand. However, the presence of the other domains can result in a slight conformation change. The hydrophobic and charged composition is less conserved in the titin kinase and M1 domain interface and may not support a connection as strong and rigid as in twitchin kinase from C. elegans. A stretch-based mechanism was proposed for titin kinase to encompass the active form (Gräteret al., 2005). This would additionally require a rupture of the kinase and Ig domain interface prior to detaching the last β-strand from hydrogen-bridging with another β-strand, provided that this interaction would be existent and relevant. Further experimental evidence on the basis of the shape of titin kinase-M1 could be obtained by small-angle X-ray scattering (SAXS) studies of the two domain construct TKM1 that consists of titin kinase and M1 (Appendix A). Figure 3.9: Model of titin kinase with M1. Superimposed structures of titin kinase (1TKI) and M1 with twitchin kinase with the adjacent Ig domain Ig26 (1KOA) are basis for the presented interdomain arrangement. Ribbon representation of titin kinase in blue with the regulatory tail in green and M1 in red and surface representation; twitchin kinase and Ig26 are not shown. Chapter 4

NBR1 PB1 in complex with p62 PB1

4.1 Introduction

Protein-protein interactions mediated by scaffold proteins play a pivotal role in signal transduction. In cellular signalling, scaffold proteins are involved in coupling signalling pathways regulating cell polarity, survival, and differentiation (Moscat and Diaz-Meco, 2000; Ohno, 2001). Protein interaction occurs via specific interaction domains recognising dedicated patterns and other domains. A lot is known about the basis of interaction of domains such as the SH2-, SH3,- or WW-domain, which were studied intensively. Constantly, new domains are discovered and their molecular basis of interaction is unravelled. One of these recently identified domains is the PB1 domain. In the titin kinase downstream signalling pathway, the interaction of two scaffold proteins through their PB1 domain plays a key role. Both proteins are substrates of titin kinase. While NBR1 directly binds to titin kinase, p62 is linked via the PB1 domain interaction (Lange et al., 2005a). The schematic representation of the titin kinase signalling pathway (Figure 4.1) highlights the PB1 domains, which are subject of this work.

4.1.1 Protein interaction via PB1 domains The PB1 domain has recently been identiﬁed as an interaction module mediating hetero-dimerisation and homo-oligomerisation. PB1 domains are present in a variety of signalling proteins, evolutionary conserved from yeast to human. They were named after their ﬁrst discovery in p67phox and Bem1p (PB1), a cytosolic NADPH oxidase and a budding yeast polarity factor. Initially, a motif associated to a consensus sequence of 28 residues, the octicosapeptide repeat (OPR), was found to be characteristic (Ponting, 1996). This motif was also discovered to be embedded in the PC domain (phox and cdc), where it is required for interaction with the PB1 domain of Bem1p and p67phox which do not contain this motif (Nakamura et al., 1998). Interaction analysis on the atypical protein kinase C (aPKC) revealed a minimal stretch of residues essential for binding with aPKC-binding partners. Hence, the sequence motif was called AID (aPKC interaction domain) (Moscat and Diaz-Meco, 2000). Due to sequence

53 54 NBR1 PB1 in complex with p62 PB1

Figure 4.1: Titin kinase downstream signalling pathway. The proteins titin (domains A168 to M1), NBR1, p62, and MURF are presented schematically by their domain composition. The domains analysed in this chapter, the PB1 domains of NBR1 and p62, are highlighted in green.

analysis and functional investigation, it was suggested that the multiple names PC, OPR, and AID for the same sequence motif found in PB1 domains should be replaced by the consistent name ’OPCA motif’ (OPR, PC, AID) (Ponting et al., 2002). The OPCA motif is embedded in the PB1 domain, but not all PB1 domains bear the OPCA motif. Hence, the family of PB1 domains can be subdivided into the PB1 domains with the OPCA motif (type-A) and those without. In contrast, the second type of PB1 domains is characterised by a basic back (type-B) generated by a lysine residue (Figure 4.2). A multiple sequence alignment for this domain family is available via the SMART domain database (Schultz et al., 1998).

4.1.2 PB1 domains – Mode of interaction Heterodimeric assembly occurs through type-A and -B PB1 domains. The interaction is mainly of electrostatic nature, which has been characterised for the Bem1p-cdc24p interaction (Ito et al., 2001) and for the complexes of p40phox- p67phox (Wilson et al., 2003) and aPKCι-par6α (Hirano et al., 2005). The electrostatic interaction involves the conserved acidic DX(D/E)GD part of the OPCA motif (in the β3-β4 loop) on the type-A and a conserved lysine (β1) on the type-B surface, respectively (Wilson et al., 2003). They are referred to as acidic (A1) and basic (B1) cluster, respectively. The importance of the residues in the acidic-basic clusters for the interaction has been demonstrated for diﬀerent complexes by mutational analysis (Nakamura et al., 1998; Ito et al., 2001; Kuribayashi et al., 2002). Recent studies on PB1 complexes revealed a second acidic-basic cluster, which was not emerging strikingly from sequence comparison before (Hirano et al., 2005). This additional electrostatic acidic- 4.1 Introduction 55

Figure 4.2: Model of molecular recognition between PB1 domains, adapted from Noda et al., 2003 and Wilson et al., 2003. For simplicity, only the interaction of the clusters A1 and B1, represented by the OPCA motif and the lysine is shown (see text). A: Model of type-A and -B domains with the acidic hairpin and the basic back, respectively, and representatives from each group. B: p62 as type-AB forms homo-oligomers through the PB1 domain. C: The p62 DDAA mutant acts as type-B PB1 domain in the interaction with NBR1 PB1.

basic cluster A2-B2 is located in spatial proximity to A1-B1. Contributing residues are a conserved glutamate/aspartate in α2 located in the OPCA motif (A2) and an arginine/lysine in α1 (B2) or β2 (B2’) (Hirano et al., 2005). Some of the PB1 domains bear characteristics of both type-A and -B, and were therefore named type-AB (Wilson et al., 2003; Noda et al., 2003) (Fig- ure 4.2). Heterotypic complexes with PB1 domains of either type-A or type-B can be formed. A homotypic front-to-back arrangement is generated by p62 PB1 interaction. This results in large arrays or aggregates, also known as ’sequesto- somes’ which are additionally linked to polyubiquitinated proteins attached to the C-terminal ubiquitin- association domain (UBA) of p62. Moreover, p62 as a type-AB PB1 domain, utilises its characteristics to specifically interact as a type-B domain with NBR1 (Lamark et al., 2003), MEK5 (Lamark et al., 2003), and aPKCζ (Wilson et al., 2003). Also, aPKC in general has been classified as a type-AB. In addition to binding in a type-A manner with p62 and par6α (Noda et al., 2003; Wilson et al., 2003; Hirano et al., 2005), aPKC has been reported to interact with the exclusive type-A MEK5 (Diaz-Meco and Moscat, 2001; Noda et al., 2003) in a type-B manner. However, this remains controverse, since no significant direct interaction was found in several further investigations (Lamark et al., 2003) and no basic amino acid in position B2 or B2’ is located in the sequence alignment (Hirano et al., 2005). 56 NBR1 PB1 in complex with p62 PB1

4.1.3 Specificity determination of PB1 domains The interaction of two PB1 domains is highly specific and occurs with high affinity. The specificity has been demonstrated by domain-swapping of the PB1 domain of Bem1p with that of p67phox, resulting in abrogation of the interaction with cdc24 (Ito et al., 2001). In addition to the electrostatic clusters on the surface, specificity is determined by high sequence diversity among the PB1 domains, by insertions between secondary structure elements, by N- or C-terminal extensions (Wilson et al., 2003), or by variation of the tilt angle between the domains (Hirano et al., 2005).

4.1.4 Overview of PB1 domain structures At the beginning of this work, the PB1 domain family had been identiﬁed to be a new domain family involved in interaction. At that time, the OPR (Ponting, 1996), the PC (Nakamura et al., 1998), and the AID (Moscat and Diaz-Meco, 2000) motif had just been described, and ﬁrst studies had elucidated the crucial role of the OPCA motif in interaction through PB1 domains (Nakamura et al., 1998). However, no structural information was available. Now, a number of structures of PB1 domains are solved. They are summarised in Table 4.1. A solution structure of the protein Kiaa0049 (Nomura et al., 1994) has been solved by the RIKEN Structural Genomics/Proteomics Initiative (RSGI) and has been published in the PDB (Hamada et al., 2004). Sequence comparison revealed identity with the PB1 domain of NBR1, the crystal structure of which is described in this chapter.

4.2 Materials and Methods

4.2.1 Preparation of NBR1 PB1 Cloning The PB1 domain encoding region of NBR1 (residues 1-85) was amplified by polymerase chain reaction (PCR) with NBR1 (residues 1-199) in a modified pET24 vector (kindly provided by A. Yakovenko and M. Gautel, King’s Col- lege, London) used as template (accession code: X76952, and protein accession code: Q14596 for the full length protein of 966 amino acids). NBRN- coI (5’-AAAACCATGG AACCACAGGT TACTC-3’) and NBR1PB1 KpnI (5’- AAAGGTACCT CACCCTTCGT GGACTTGCAT CTG-3) were used as forward and reverse primers. The amplified PCR fragments were cloned into the NcoI and KpnI restriction sites of the expression vector pETM11 (EMBL) containing an N-terminal six-histidine tag and a preceding TEV-protease cleavage site. 4.2 Materials and Methods 57

Code Protein 1 Protein 2 Reference Method

1IPG bem1p Terasawa et al., 2001 NMR 1IP9 1OEY p67phox p40phox Wilson et al., 2003 X-ray 1Q1O cdc24p Yoshinaga et al., 2003 NMR 1VD2 aPKCι Hirano et al., 2004 NMR 1WI0 MEK5 Yoneyama M., Hayashi F., Tochio N., NMR Koshiba S., Inoue M., Kigawa T., Yokoyama S., published in PDB, 2004 1WJ6 Kiaa0049/ Hamada T., Hirota H., Hayashi F., NMR NBR1 Yokoyama S., published in PDB, 2004 1PQS Sc cdc24p Leitner et al., 2005 NMR 1WMH aPKCι par6α Hirano et al., 2005 X-ray 1TZ1 cdc24p Yoshinaga S., Terasawa H., Ogura K., NMR short Noda Y., Ito T., Sumimoto H., Inagaki F., published in the PDB, 2005 2BKF NBR1 Muller¨ et al., 2005, submitted X-ray

Table 4.1: PDB entries for PB1 domain structures are listed here. The structure of the PB1 complex of NBR1-p62 is in preparation for submission to the PDB and is therefore not yet included.

Expression The recombinant protein was expressed in the E. coli strain BL21(DE3) Codon- Plus RIL (Stratagene). One colony of the transformation to this strain was selected and grown in Luria Bertani (LB) medium in presence of 50 µg/ml kanamycin and 34 µg/ml chloramphenicol at 37◦C in a shaker over night. This preculture was diluted in a ratio of 1:40 in LB medium with the appropriate ◦ antibiotics. Cells were grown to an OD600 = 0.6 at 37 C and expression was induced by 1 mM IPTG for three to four hours. The culture was harvested by centrifugation at 6000 rpm (JLA 8.1000, Beckman) for ten minutes at 4◦C. The cells were washed in PBS, pelleted, and frozen at -20◦C.

Purification For protein purification, the cells were thawed on ice and resuspended in 50 to 100 ml lysozyme (1 mg/ml)- and DNaseI (10 µg/ml)- containing lysis buffer (300 mM NaCl, 5 mM imidazole, 25 mM Tris pH 8.0) for cells from 3 liter culture. Cell disruption was completed by sonication for two to three minutes with pulses of 0.7 s and interrupting pauses of 0.3 s (Bandelin electronic) on ice. After centrifugation at 18000 rpm (SS-34, Sorvall) for 30 minutes at 4◦C, the supernatant was applied to Ni-NTA beads (Qiagen) equilibrated in lysis buffer. Thereafter, the resin was washed with lysis buffer and the protein was eluted 58 NBR1 PB1 in complex with p62 PB1

Figure 4.3: Crystals of NBR1 PB1 grown in 1.6 M ammonium sulphate and 0.1 M sodium acetate pH 4.3 (left panel) and in 1.6 M ammonium sulphate and 0.1 M sodium acetate pH 4.1 (right panel).

in elution buffer (400 mM imidazole in 300 mM NaCl and 25 mM Tris pH 8.0). The eluted protein was incubated overnight in the presence of about 20 mM β-mercapoethanol and TEV-protease (1:20 molar ratio for TEV protease to protein) for cleavage of the hexa-histidine tag. The protein was concentrated and then purified by gel filtration through a Superdex 75 16/60 column (GE Healthcare) equilibrated in 20 mM Bis-Tris-Propane pH 7.4, 50 mM KCl, and 5 mM DTT. The purified protein was confirmed to be NBR1 PB1 by mass spectrometry analysis (EMBL proteomics core facility, Heidelberg).

4.2.2 Crystallisation of NBR1 PB1 For crystallisation purpose, the protein was concentrated to 9 mg/ml in 20 mM Bis Tris Propane, pH 7.4, 50 mM KCl and 5 mM DTT. Droplets of equal volumes of protein and well solution with a final droplet volume of 2 µl were equilibrated against a well solution of 500 µl by hanging drop vapour diffusion. Initial crystallisation conditions for NBR1 PB1 were found in the crystal screen I (Hampton Research), condition 47 (2.0 M ammonium sulphate, 0.1 M sodium acetate pH 4.6). The crystals of NBR1 PB1 grew at 20◦C in 0.1 M sodium acetate pH 4.1-4.4 and 1.5-2.2 M ammonium sulphate with a protein concentration of 4.5 mg/ml (dilution of 1:1 of the concentrated protein with the gelfiltration buffer) and 9.0 mg/ml. The size of the crystals was about 150 x 150 x 300 µm3. Replacement of ammonium sulphate by lithium sulphate at a slightly lower concentration (1.4 to 1.6 M) in the same pH range also resulted in single crystals with the same dimensions. In Figure 4.3 crystals of the NBR1 PB1 domain with a hexagonal shape are shown.

4.2.3 X-ray data collection and processing of NBR1 PB1 A complete X-ray data set was collected up to 1.55 A˚ resolution at the EMBL Beamline X13 (EMBL/DESY, Hamburg) from a crystal grown in 1.6 M ammonium sulphate and 0.1 M sodium acetate pH 4.1. The crystal was ﬂash-frozen 4.2 Materials and Methods 59

data set native bromide bromide bromide (peak) (inﬂection) (remote)

beamline X13 BW7A BW7A BW7A wavelength (A)˚ 0.8030 0.9177 0.9183 0.9068 resolution 20.0-1.55 20.0-2.45 20.0-2.45 20.0-2.5 range (A)˚ ∗ (1.61-1.55) (2.54-2.45) (2.54-2.45) (2.59-2.50) no. of unique reﬂections 18,729 5,003 5,038 4,651 redundancy 18.9 23.1 23.8 5.3 completeness 99.6 (100.0) 99.9 (99.6) 99.9 (99.6) 97.3 (94.5) (%) ∗ ∗ Rmerge 0.062 (0.593) 0.084 0.086 0.080 (0.397) (0.483) (0.323) I/σ(I) ∗ 46.6 (4.9) 36.3 (9.8) 38.8 (8.7) 16.5 (4.8)

Table 4.2: X-ray data collection statistics of NBR1 PB1. ∗ numbers in parentheses refer to the highest resolution shell of observed data. The native data set was generated by scaling together a high resolution data set (25.0-1.55 A)˚ and a low resolution data set (20.0-2.1 A).˚

in the liquid nitrogen stream using 25 % glycerol as cryoprotectant. Data were collected at 100 K. The native data set was recorded on a Mar CCD 165 mm detector in a high- (457 frames, ∆ϕ=0.3, detector-crystal distance=130 mm) and a low-resolution sweep (250 frames, ∆ϕ=0.5, detector-crystal distance=200 mm). The data were processed and scaled using the DENZO and SCALEPACK package (Otwinowski and Minor, 1997). The low and high resolution data sets were merged using scalepackbig. Data collection statistics are given in Table 4.2. The crystals belong to the hexagonal space group P6322 with unit cell dimensions of a = b = 100.6 A,˚ c = 42.2 A˚ and α = β = 90◦ and γ = 120◦. Assuming a molecular weight of 9.7 kDa, the Matthews coeﬃcient is calculated to be 2.7 A˚3/Da for one molecule in the asymmetric unit with a solvent content of 54%.

4.2.4 Structure solution of NBR1 PB1 by MAD The structure of NBR1 PB1 was solved by a three wavelength MAD experiment. The MAD data set was collected on beamline BW7A (EMBL/DESY, Hamburg) using 1 M sodium bromide for obtaining the phases. Therefore, a crystal grown in 0.1 M sodium acetate pH 4.1 and 2 M ammonium sulphate (protein concentration = 9 mg/ml) was soaked in 1 M sodium bromide, 0.6 M ammonium sulphate, 20 % glycerol and 0.1 M sodium acetate pH 4.2. Seven bromide sites were located by SOLVE (Terwilliger and Berendzen, 1999). RE- SOLVE (Terwilliger, 2003) was used for density modiﬁcation and for building an initial model. Arp/wArp (Perrakis et al., 1999) was used to extend the phases 60 NBR1 PB1 in complex with p62 PB1

Identity Sequence (from 5’ to 3’) Description p62 NcoI AAACCATGGCGTCGCTCACC forward, NcoI restriction GTGAAG site p62 PB1 AAAGGTACCTCATTTCTCTT reverse, KpnI restriction KpnI TAATGTAGATTCGGAAG site p62 CAGGCGCACTACCGCGCTGA forward, p62 D69A D69Af GGACGGGGACTTG p62 CAAGTCCCCGTCCTCAGCGC reverse, p62 D69A D69Ar GGTAGTGCGCCTG p62 CGATGAGGACGGGGCATTGG forward, p62 D73A D73Af TTGCCTTTTCCAGTG p62 CACTGGAAAAGGCAACCAAT reverse, p62 D73A D73Ar GCCCCGTCCTCATCG

Table 4.3: PCR primers for cloning of p62 PB1 (1-102) and mutants. In the description the direction of the primer, the restriction site if included and the mutation introduced for the site-directed mutagenesis are given. to 1.55 A˚ and to build the model at that resolution. Chain tracing placed 81 out of the 85 residues. Manual model building was carried out with the program O (Jones et al., 1991) and iterative rounds of reﬁnement with REFMAC5 (Murshudov et al., 1997) applying one TLS group for the NBR1 PB1 domain. The resulting statistics are summarised in Table 4.2.

PDB accession code The coordinate data set and the structure factors of the NBR1 PB1 domain are deposited in the PDB with the accession code 2BKF.

4.2.5 Preparation of p62 PB1 and mutants Cloning The human p62 DNA (GenBank code U466751 and the accession code Q13501), encoding 440 residues, was kindly provided by M. Gautel (King’s College, Lon- don) in a modified pET24 vector. After amplification by PCR (for primers see Table 4.3) the p62 PB1 domain encompassing residues 1-102 was cloned via the NcoI and KpnI restriction sites into the expression vector pETM11 (based on pET24d (Novagen), modified by G. Stier, EMBL). The DNA sequence was confirmed by sequencing (MWG-Biotech, Ebersberg).

Site-directed mutagenesis P62 forms homo-oligomers via its PB1 domains. In order to avoid self- aggregation and -oligomerisation of p62 PB1, a double mutation was introduced. The mutations have been described previously for the PB1 domain 4.2 Materials and Methods 61 of p62 (1-122) (Wilson et al., 2003) and of p62 (1-134) for a single mutation D69A (Lamark et al., 2003). Accordingly, these mutations were imple- mented consecutively in the construct p62 (1-102). Site-directed mutagenesis was performed according to QuikChangeTM Site-Directed Mutagenesis Kit (Stratagene) and the sequences of primers are given in Table 4.3. First, the single mutation D69A was introduced, then the mutation D73A was added. The construct with the single mutation at position D69 is hence called p62 (DA), and the double mutant with the mutation D69A and D73A is termed p62 (DDAA) (Wilson et al., 2003). Successful introduction of the mutations was conﬁrmed by sequencing (MWG-Biotech, Ebersberg).

Expression and purification Expression and purification described here is valid for p62 PB1 (DDAA). At- tempts of wild type and the single mutant preparation were carried out similarly. P62 PB1 (DDAA) was transformed to the E. coli strain BL21(DE3) Codon- Plus RIL. A single colony was selected from a LB plate for the preculture in LB medium with 50 µg/ml kanamycin and 34 µg/ml, which was incubated in the shaker over night at 37◦C. The preculture was diluted at a ratio of 1:20 to inoculate the LB medium with the appropriate antibiotics. At an OD600 = 0.6, expression was induced by addition of 1 mM IPTG for four hours. The cells were harvested (6000 rpm (JLA 8.1000, Beckman), 10 min at 4◦C), washed in PBS and frozen at -20◦C. For purification, cells were thawed on ice in lysis buffer (see above) with 1 mg/ml lysozyme. Sonication was performed for two to three minutes with pulses of 0.7 s and 0.3 s pause intervals (Bandelin electronics). After centrifugation at 18000 rpm (SS-34, Sorvall) for 30 minutes at 4◦C, the filtered supernatant was applied to Ni-NTA resin (Qiagen) pre-equilibrated in lysis buffer. The resin was washed with lysis buffer, and the bound protein was eluted with imidazol in the elution buffer. TEV protease cleavage was performed overnight in the presence of about 20 mM β-mercaptoethanol. The protein was concentrated and applied to size exclusion chromatography carried out with a Su- perdex 75 10/30 column (GE Healthcare) equilibrated in 25 mM HEPES pH 7.5 and 50 mM NaCl.

4.2.6 Complex formation of NBR1 PB1 and p62 PB1 (DDAA) Size exclusion chromatography The complex of the PB1 domains of NBR1 and p62 (DDAA) was formed by mixing the two purified proteins in an equimolar ratio in 25 mM HEPES pH 7.5 and 50 mM NaCl. After incubation of a few minutes, the sample containing both PB1 domains was applied to an analytical size exclusion chromatography on a Superdex 75 10/30 column (GE Healthcare) in 25 mM HEPES pH 7.5 and 50 mM NaCl. Preparative gelfiltration using a Superdex 75 16/60 column (GE Healthcare) with the same buffer was applied for complex preparation. 62 NBR1 PB1 in complex with p62 PB1

By application of this puriﬁcation step the complex and uncomplexed material were separated in case of a slight excess of one of the PB1 domains and a higher homogenity for crystallisation was achieved.

Isothermal titration calorimetry The binding of NBR1 PB1 and p62 PB1 (DDAA) was studied by isothermal titration calorimetry (ITC) (MicrolCal Inc.). NBR1 PB1 and p62 PB1 (DDAA) were purified as described above. Prior to the ITC experiment, both domains were dialysed in separate dialysis cassettes (Slide-A-lyzer cassette (Pierce) with a cut-off of 3.5 kDa and a capacity of 0.5-3 ml) in the same, twice exchanged dialysis buffer containing 25 mM HEPES pH 7.5 and 50 mM NaCl. Thermostating at 30◦C of 1.4 ml of 40-50 µM p62 PB1 (DDAA) was performed in the sample cell of the ITC instrument. NBR1 PB1 was titrated successively into the cell in steps of 5-10 µl at a ten times higher molarity (400- 500 µM) with the injection syringe of the instrument. The raw data were processed using the MicroCal Origin software. The stoi- 0 chiometry n, the association constant Ka and the enthalpy ∆H were calculated 0 0 and the dissociation constant Kd, the free enthalpy ∆H and the entropy ∆S can be derived from these values.

4.2.7 Crystallisation of the PB1 complex Crystallisation of the complex formed by the NBR1 PB1 and p62 PB1 (DDAA) was carried out under various conditions with different PB1 complex concentrations. Hanging drop vapour diffusion method was predominately used for screening crystallisation conditions with droplets of 2 µl volume consisting of equal amounts of protein and well solution and a reservoir of 500 µl. Besides this, screening was carried out at the automated crystallisation facility at the OPPF (Oxford Protein Production Facility, Oxford, U.K.) with automated solution pipetting robots Hydra (Robbin) and the Cartesian Dispensing robot. Here, in a 96-well Greiner plate for sitting drop vapour diffusion, 100 nl of reservoir solution was mixed with 100 nl of the PB1 complex at 6.5 mg/ml concentration. Images of the crystallisation droplets were taken regularly by the automated imaging system (Veeco) attached to the storage vault (21◦C), and were observed online. Conditions for PB1 complex crystallisation were found, which include 0.1 M sodium citrate pH 5.2, 1.5 M ammonium sulphate with 50 mM urea (5-6.5 mg/ml protein concentration) and 1.7-1.8 M sodium formate pH 4.9-5.2 (15 mg/ml). However, these crystals were not suitable for data collection, since the small needles (approximately 10 x 10 x 50 µm3) obtained could only be improved little in size. 4.2 Materials and Methods 63

Figure 4.4: Crystals of the complex NBR1 PB1 and p62 PB1 (DDAA) in the absence (left panel) and presence (right panel) of 10 mM cadmium chloride dihydrate. Crystals were grown in 16% PEG 3350, 0.8 M sodium formate and 0.1 M sodium acetate pH 4.0 (left panel) and 15% PEG 3350, 0.8 M sodium formate, 0.1 M sodium acetate pH 4.0 and 0.01 M CdCl2 (right panel).

PB1 complex crystallisation in PEG and sodium formate So far, PB1 complex crystals appear in general at low pH around pH 5.0. There- fore, the clear strategy screen 1 and 2 (Molecular Dimensions), MD1-14 and MD1-15, according to Brzozowski (Brzozowski and Walton, 2001) were set up at pH 4.5 and pH 5.5 at a PB1 complex concentration of 15 mg/ml. A shower of microneedles appeared in clear strategy screen 1 in conditions 6, 12 and 18, which contain 0.8 M sodium formate and 25% PEG 2000 MME, 0.8 M sodium formate and 15% PEG 4000 and 0.8 M sodium formate, 10% PEG 8000 and 10% PEG 1000, respectively. Grid screening around these conditions included variation of concentration and size of PEGs, the concentration of sodium formate and pH ranges from 4.0 to 5.0 in steps of 0.1 unit. The largest of these needles with a size of about 30 x 30 x 150 µm were obtained in 15-17% PEG 3350, 0.8 M sodium formate and 0.1 M sodium acetate pH 4.0 and 4.6. Crystals grown at 0.1 M sodium acetate pH 4.1 to 4.5 required higher concentration of PEG. Since crystals still appeared in a shower of needles only partially separated, they were not suitable for x-ray measurement (Figure 4.4, left panel). Additive screening with 16% PEG 3350, 0.8 M sodium formate and 0.1 M sodium acetate pH 4.0 revealed condition 2 of the additive screen 1 (Hampton Research) as a suitable additive to improve crystal size. Crystals reached sizes of about 50 x 50 x 300 µm up to 50 x 50 x 750 µm (Figure 4.4) where 100 mM cadmium chloride dihydrate was diluted in the droplet in a ratio of 1:10 (v/v).

4.2.8 Data collection and processing of the PB1 complex For cross-linking of the crystals, 10 µl of a 25 % glutaldehyde solution were added to 500 µl well solution, composed of 15 % PEG 3350, 0.8 M sodium formate, 0.1 M sodium acetate pH 4.6. The droplet solution (protein:well:additive 64 NBR1 PB1 in complex with p62 PB1 solution in a ratio of 5:4:1 to give a ﬁnal drop volume of 2.5 µl) with the crystal inside was incubated for 20 min against the glutaldehyde containing reservoir solution. The crystal was soaked in 25 % MPD as cryoprotectant for about 10-20 s prior to ﬂash-freezing in the liquid nitrogen stream (100 K). A native data set was collected at BW7A (EMBL/DESY, Hamburg) to 2.1 A˚ resolution. Data were processed and scaled with XDS/XSCALE (Kabsch, 1993) using the XDSi interface (Kursula, 2004). The crystal belongs to the orthorhombic space group P212121 with unit cell parameters a = 54.6 A,˚ b = 65.9 A,˚ c = 93.2 A.˚ Data collection statistics are given in Table 4.4.

PB1 complex (cross-linked) beamline (EMBL/DESY) BW7A wavelength (A)˚ 0.9201 space group P212121 resolution range (A)˚ ∗ 20-2.1 (2.2-2.1) number of reﬂections ∗ 172,962 (21,559) number of unique reﬂections ∗ 20,159 (2,567) completeness (%)∗ 99.4 (99.6) ∗ Rsym (%) 0.078 (0.466) I/σ(I)∗ 18.63 (4.95)

Table 4.4: X-ray data collection statistics of the PB1 heterodimer complex. ∗ numbers in parentheses refer to the highest resolution shell of observed data.

4.2.9 Structure solution of the PB1 complex

Calculation of the Matthews coefficient (Matthews, 1968) resulted in VM = 2.1 A˚3/Da and a solvent content of 40.8 %, assuming two PB1 complexes in the asymmetric unit. The structure of the PB1 complex was solved by molecular replacement using PHASER (Storoni et al., 2004; McCoy et al., 2005). The structure of the NBR1 PB1 (2BKF) was used as a search model in an initial search for two molecules. Two NBR1 PB1 monomers were located which can be transformed by a twofold symmetry. The R and Rfree were 43.1 % and 46.8 %, respectively. This solution was fixed in PHASER, and a poly-alanine model of NBR1 PB1 was used as search model for one p62 PB1. The R and Rfree were 39.7 % and 43.7 %, respectively after this round. One PB1 complex, constituted by one NBR1 PB1 and the poly-alanine PB1, as search model in PHASER resulted in location of the second PB1 complex in the asymmetric unit with R and Rfree of 34.5 % and 41.8 %, respectively. Refinement was carried out with iterative rounds of model building with COOT (Emsley and Cowtan, 2004) and REFMAC5 (Murshudov et al., 1997) applying a TLS group for each domain. NCS (Non-crystallographic symmetry) restraints were set between the two NBR1 PB1 domains and the two p62 PB1 domains, respectively. 4.3 Results 65

4.3 Results

4.3.1 Purification and crystallisation of NBR1 PB1 The human NBR1 PB1 was isolated as recombinant protein applying affinity chromatography, TEV-protease cleavage of the histidine-tag and size exclusion chromatography. The protein was more than 98% pure as judged by SDS- PAGE. Crystals in the hexagonal space group P6322 were grown in ammonium sulphate (1.5-2.2 M) and sodium acetate (pH 4.1-4.4) (Figure 4.3). NBR1 PB1 used for crystallisation was obtained successively from the longer NBR1 (1-199) by the design of several constructs. The two cysteines in NBR1 (1-199) were mutated to serines (C141S, C191S) to prevent potential cysteine bridge formation. The construct NBR1 (1-185) was designed after considera- tion of secondary structure prediction using the PHD server (Rost and Sander, 1993). This construct has its C-terminus after a predicted helical secondary structure (residues 151-185). Although many crystallisation conditions were screened for NBR1 (1-185, C141S), no crystal was obtained. A limited proteolysis approach and mass spectrometry were applied in order to determine a smaller, structurally more stable NBR1 fragment to facilitate crystallisation. By application of mass spectrometry peptide mapping (EMBL Proteomics Core Facility, Heidelberg) and comparison of possible trypsin-cleavage sites, the C- terminus of the trypsin-digested protein was determined to be at residue K108. Crystallisation of the recombinant protein encompassing residues 1-108 has not succeeded so far. At the beginning of the work a sequence alignment of the N-terminus of NBR1 outlined just the OPCA motif. Only later, when the domain borders of NBR1 PB1 (1-85) were defined (Ponting et al., 2002) by SMART (Simple Modular Architecture Research Tool) (Schultz et al., 1998), a suitable construct for crystallisation of this member of the recently discovered PB1 domain family was found.

4.3.2 Preparation of p62 PB1 and mutants For the wild type p62 PB1, a distinct single band could not be detected on an SDS-PAGE after the first purification step by affinity chromatography. Altering expression conditions by diverse parameter combinations such as temperature (25◦C, 30◦C and 37◦C), different strains and addition of glucose, did neither change towards one clear overexpression band nor result in a single band after affinity chromatography, but various bands were detected on the SDS-PAGE. Aiming to obtain a single state of the protein, several washing steps with different supplements were applied while the protein was bound to the resin. How- ever, the pattern with many bands persisted. Diverse oligomerisation states were assumed, and consequently a way was chosen to interrupt the intrinsic interaction of p62 PB1. After introduction of the first mutation (D69A), a single band was detected on the SDS-PAGE in the elution fractions of the IMAC. However, the protein 66 NBR1 PB1 in complex with p62 PB1

mAU mAU 400

70.0

60.0 300

50.0

40.0 200

30.0

100 20.0

10.0

0 0.0 0.0 5.0 10.0 15.0 20.0 25.0 ml 0.0 5.0 10.0 15.0 20.0 25.0 ml

Figure 4.5: Size exclusion chromatography of p62 PB1 (DA), left panel, and p62 PB1 (DDAA), right panel, on a Superdex 75 10/30 (GE Healthcare). Ab- sorption is detected at λ = 260 nm and plotted against volume. P62 PB1 with one mutation (DA) exists in multiple oligomerisation states displayed by several merging peaks over the total elution proﬁle, while the p62 PB1 double mutant (DDAA) shows a single peak.

still existed in multiple oligomerisation states as disclosed by size exclusion chromatography (Figure 4.5, left panel). The double mutant (D69A and D73A) prevented the p62 PB1 domains to interact with each other. Size exclusion chromatography of the double mutant revealed a single peak (Figure 4.5, right panel).

4.3.3 Complex formation of NBR1 PB1 and p62 PB1 (DDAA) Size exclusion chromatography Evidence for complex formation was achieved by analytical size exclusion chromatography. In Figure 4.6 NBR1 PB1 is shown in blue, p62 PB1 (DDAA) in green and the complex of both in red.

Isothermal titration calorimetry The aﬃnity of the binding of NBR1 PB1 and p62 PB1 (DDAA) was studied by isothermal titration calorimetry. In Figure 4.7 results of a typical ITC experiment for titration of NBR1 PB1 to p62 PB1 (DDAA) are shown. The data analysis was performed assuming a stoichiometry of 1:1 resulting from the size exclusion experiment. Titration of NBR1 PB1 domain into p62 PB1 (DDAA) was exothermic with an enthalpy of the complex formation of ∆H = -6.2 kcal/mol. Formation of a tight complex was obtained and the dissociation coeﬃcient was calculated to be Kd = 12 nM ± 1 nM.

4.3.4 Crystallisation and data collection of the PB1 complex The PB1 complex was crystallised in PEG 3350 with sodium formate in sodium acetate buﬀer at pH 4.0 and pH 4.6 and cadmium chloride as additive. In other crystallisation conditions containing sodium malonate or ammonium sulphate, 4.3 Results 67

mAU

100

0.0 5.0 10.0 15.0 20.0 25.0 ml

Figure 4.6: Analytical size exclusion chromatography of the PB1 domains of NBR1 in blue, p62 (DDAA) in green and the complex of both in red on a Superdex 75 10/30 (GE Healthcare). The absorption at λ = 260 nm is plotted against volume. PB1 complex formation is demonstrated by a shift of the elution peak to the left corresponding to a higher molecular weight.

the crystal size remained too small for mounting even after screening of these conditions. Although, crystals grown in the PEG condition were larger and were diffracting, initially, diffraction patterns with split individual spots were a common problem. Careful handling during mounting of the crystals, i.e. avoid- ing to strike them with the loop, and the choice of MPD as cryoprotectant and short soaking times therein circumvented breaking of the crystals. Moreover, cross-linking as a tool to avoid the cracking of the crystal and to improve the resolution of diffracting crystals was applied, and hence a resolution of 2.1 A˚ was achieved.

4.3.5 Structure solution and refinement of NBR1 PB1 The structure of NBR1 PB1 was solved by a three wavelength MAD experiment with a halide soaked crystal, and refined to 1.55 A˚ resolution. Validation of the model quality was performed (PROCHECK (Laskowski et al., 1993)) and 89 % of the residues in the Ramachandran plot are found in the most favoured region and none in the disallowed region. The refinement statistics are given in Table 4.5.

4.3.6 Overall structure of NBR1 PB1 The structure of the PB1 domain of NBR1 shows the topology of an ubiquitin- like β-grasp fold typical for PB1 domains. The domain comprises two α-helices 68 NBR1 PB1 in complex with p62 PB1

Figure 4.7: ITC of PB1 domain of NBR1 and p62 (DDAA) in 25 mM HEPES pH 7.5 and 50 mM NaCl at 30◦C. In this experiment 500 µM NBR1 PB1 in the injection syringe and 50 µM of p62 PB1 (DDAA) in the sample cell were applied. The upper part of the ﬁgure shows the raw data with each peak arising from an injection, and the measuring points in the lower part of the ﬁgure correspond to the integration of the data. The raw data are given in µcal/sec against time, while the heat produced per injection in kcal/mole is plotted against the molar ratio. 4.3 Results 69

Resolution range (A)˚ 21.8-1.55 R (%) 19.9 Rfree (%) 22.6 Ramachandran plot (%) Residues in most favoured region 88.8 Residues in disallowed region 0 Number of atoms 816 Number of water molecules 94 R.m.s.d. from ideal bond length (A)˚ 0.014 R.m.s.d. from ideal bond angles (◦) 1.484

Table 4.5: Refinement statistics of NBR1 PB1. and a mixed β-sheet, consisting of five β-strands (Figure 4.8). The β-sheet is slightly bent around helix α1. The OPCA motif is present in the PB1 domain and adopts the ββα-fold. In the β-hairpin turn between strands β3 and β4 the acidic features of the OPCA motif are harboured. The conserved DX(D/E)GD amino acid stretch corresponds to residues 50 to 54 in NBR1 PB1. The aspartate expected from the consensus sequence in position 54, is exchanged in NBR1 PB1 by a glutamate (E54), maintaining the acidic character of the OPCA motif. The electron density for the sidechains of residues E51, E52 and N53 in the loop is not visible (Figure 4.9, left panel). This represents the flexibility of the OPCA motif constituting the main area of interaction with p62 NBR1. Other regions of less defined electron density and higher B-factors include the loop between α1 and β3, prior in sequence to the OPCA loop. In comparison with the solution structure (1WJ6) the average overall r.m.s.d. is 0.83 A˚ and the overall fold of the domain is essentially the same. The 20 con- formers of Kiaa0049/NBR1 PB1 show their largest variation in supplemented N- and C-terminal residues not adopting structural features. Prominence of more flexible regions within the PB1 domain were not detected at this level.

4.3.7 Comparison with other PB1 domains Superimposition of NBR1 PB1 was accomplished with structures of the other available PB1 domains, p40phox (1OEY), p67phox (1OEY), aPKCι (1WMH), par6α (1WMH), p62 (see below) (crystal structures) and cdc24p (1Q1O), Bem1p (1IPG) and MEK5 (1WI0) (solution structures) (Table 4.6). A structure-based sequence alignment of the available PB1 structures is shown in Figure 4.11. Despite low sequence similarity, the overall PB1 fold is established as shown by superimposition with type-A PB1 domains (Figure 4.10). How- ever, p40phox PB1 features a tilted β-sheet in comparison with the other PB1 domains and makes it more diﬃcult to compare (Figure 4.10 B). Variations, such as insertions in loop regions (in cdc24p between α1 and α2 (Figure 4.10 A) and extensions at the domain termini (in p40phox at the C-terminus, Fig- ure 4.10 B) as well as the tilted β-sheet contribute to the determination of the 70 NBR1 PB1 in complex with p62 PB1

Figure 4.8: Overall structure of the PB1 domain of NBR1 (in ribbon representation), which adopts a β-grasp ubiquitin-like fold. Key residues of the OPCA loop D50, E52, E54 (A1 cluster) and E63 (A2) cluster, which are involved in PB1 domain interaction, are represented in a ball-and-stick mode. The ﬁgure was prepared using the programs MOLSCRIPT (Kraulis, 1991) and Raster3D (Merrit and Bacon, 1997).

speciﬁcity of these domains. Remarkably, aPKCι and MEK5 (Figure 4.10 C, D) bear higher overall resemblance with the NBR1 PB1 domain than p40phox and cdc24p. NBR1, aPKCι and MEK5 as type-A domains have all been reported to bind to p62 as type-B domain.

4.3.8 Interaction surface of NBR1 PB1 domain The electrostatic potential of the molecular surface is shown in Figure 4.15. The conserved acidic clusters in the OPCA motif of the type-A PB1 domains are composed of D50, E52 and E54, referred to as acidic cluster A1, and E63 in the second α-helix builds up A2. These two acidic clusters are the basis for the interaction with the basic clusters in the type-B PB1 domain p62 PB1 (Lamark et al., 2003). The opposite surface of NBR1 PB1 does not feature positive or negative patches which could refer to an additional binding site as a type-B domain. The NBR1 PB1 is a solely type-A domain in accordance with the 4.3 Results 71 p62 phox ˚ A is given, obtained by SSM (Krissinel and bem1p p67 α par6 ι MEK5 PKC phox in parentheses, and in the top right the sequence identity of the matching residues is α (78) 2.24(75) 2.59 (75) (77)1.12 (75)(78) 1.311.60 (68) (78)(76) 19.1 2.13 1.47 16.7 (72) (70)(70) 1.87 2.511.83 22.1 (75) (77) (68)(75) 2.23 2.24 14.9 (71) (67) (67)(74) 1.19 1.95 13.9 16.4 (73) (69) (72) (67) 20.8 2.01 14.5 (69) (70) (72) 2.08 (70) 10.8 10.0 (74) (68) 2.10 23.2 (75) 14.7 (69) 2.51 18.7 (69) (75) (67) 15.7 (70) NBR1 cdc24p p40 ι α phox phox p40 MEK5 1.79PKC 2.81par6 2.30bem1p 1.56p67 2.46p62 13.3 2.46 14.1 1.66 2.63 4.4 2.05 1.58 12.8 1.92 1.59 14.7 2.18 1.61 10.1 1.79 14.9 2.05 1.36 NBR1cdc24p 1.63 20.5 17.3 25.3 15.6 21.8 21.3 11.8 20.5 12.9 14.3 17.3 8.8 18.9 7.5 13.4 given in %. Table 4.6: StructuralHenrick, comparison 2004) of with PB1 the domains. number of In matching C the bottom left, the r.m.s.d. in 72 NBR1 PB1 in complex with p62 PB1

Figure 4.9: 2 Fo-Fc electron density map at σ=1.5 of the OPCA loop in NBR1 PB1. The sidechains of the residues E51, E52 and E54 are not visible in the electron density of the single NBR1 PB1 at 1.55 A˚ resolution (left panel), but are ordered in the PB1 complex at 2.1 A˚ resolution (right panel). The ﬁgure was prepared using the program Pymol (DeLano, 2002).

sequence alignment (Figure 4.11). Moreover, this is supported by mutational studies, in which a D50R point mutation, located in the OPCA motif, abrogates the binding of NBR1 to p62. In contrast, the NBR1 PB1 mutation K12A, implying a basic cluster in this position, interacts with p62 (Lamark et al., 2003) and disproves NBR1 PB1 to act as a type-B in the interaction with p62 PB1.

4.3.9 Structure solution and refinement of the PB1 complex The structure of the PB1 complex was solved using molecular replacement with NBR1 PB1 as search model, and was refined to 2.1 A˚ resolution. Two PB1 complexes are located in the asymmetric unit which are related in a two-fold NCS. The refinement statistics are given in Table 4.7.

Resolution range (A)˚ 20.0-2.1 R (%) 20.6 Rfree (%) 26.1 Ramachandran plot (%) Residues in most favoured region 91.9 Residues in disallowed region 1.0 Number of atoms 2764 Number of water molecules 122 R.m.s.d. from ideal bond length (A)˚ 0.015 R.m.s.d. from ideal bond angles (◦) 1.374

Table 4.7: Reﬁnement statistics of PB1 complex. 4.3 Results 73

Figure 4.10: Superimposition of the type-A PB1 domains. The PB1 domain of NBR1 is shown in blue. The OPCA loop points towards the left. A: superimposition with cdc24p (1Q1O) in yellow, B: superimposition with p40phox (1OEY) in red, C: superimposition with aPKCi (1WMH) in green, D: superimposition with MEK5 (1WI0) in orange. 74 NBR1 PB1 in complex with p62 PB1 cdc(1 2 n ai B,B,B’ lsesaehglgtdi e n nbu,rsetvl.Tescnaysrcueelements structure secondary The the of respectively. residues blue, Key in and boxed. red is in motif highlighted OPCA are the clusters PB1. of B2’) NBR1 sequence B2, to The according (B1, indicated domains. basic are PB1 and of A2) alignment (A1, sequence acidic Structure-based 4.11: Figure p b p p P M p c N 6 e a 6 K E 4 d B 7 m r 2 C K 0 c R p 1 6 5 p 2 1 L h p h 4 Į o o p x x

S T V Q S Q I A T

I T L V L V V Y N

L K V T T R E T W

E B F I I L V V V L L 1 R R N R K K K K K 1 I I V V V F S A A

S K T Y H Y K Y Y Y I F Y Y Y F Y L N P K Y K K D R L N - - E - - - - G N - - D - - - - K S - - T - - - - E N ------N ------T ------D

T ------A

S N - I - - - - A

S S N S - D A G R

E G E T Y D E D E

B I A I I T I F I I E F V Q K V F M R R 2 2 T D S D V A I R R L W F I M L T F F

L T L A K M H S A V V V V T L F F L E H S E Q K E C P - S D E - - - C - - - P D - - - S - - - - L - - - P ------E ------P ------E ------A ------E ------A ------E - - G - S - - - A - K P E S P G P A R V Q N T G D S A A W L T P L T I G S ------P V ------G S N L T L P T S P G F F W L Y Y F C F D R A K S K E E Q

D D D D Q E G R E

L V I L V L L L F

D I L E L R R C L S

M D A E D S N S R 1

A V M L M K E R L

I I V T V I V V L

N G K R S A R A R

B S Q V R K P D A A K V S E M L V K R 2 I L F F C F H L I S P D Q S P Q E D ’

N E L R F A I L T T A - - D L P R D H - - - N R G L - N - - - E - - - - N ------N ------I ------S - - - - P - - - P T N E Q G L E - I T T D L G D H N T T I I F F V T F K A Q A T Q L K K E I F I L M A L L L 3 K E K N K H G S Q Y Y Y Y W Y Y Y T Q E L R I R T R K D D D D D D D P L A E E E A E A A R F D D E E E D H D D 1 G G N G G G G S G D D E D D D D N S ------E - F R E L P L L L G E V I V V C V L V E V T S R T A P P E 4 L V I L V F L L I

G R N L S S T S K

S S S S S S N E T

D D Q D Q D D - D

E E G E L E D D S A D E E D E E S S Q W M Y V L L L M V 2 N K E A E T H K S

V A E L E M R D N D A M A M A A A A I 2 K L L V F M L W I E S K R R S A G Q M Y M Q L Y S Q A L Y A A Y V G V - E Y V - E K - K - A S K - L D - N - N T Q R N - - - - N V - G K - - - - E M - L D - - - - - E - P ------Q - S ------Q - Q ------V - K - - - - -

- N - R - - - - -

- G ------

- Q ------

- L - L - - - - -

- I G F - - P - -

K E N P S D P Y -

F P Q - E I P C K

L L L W L F L L L B E N Q Q K L T K R R 1 5 I I M L I L I L I R F Q H H W S L Y

L P V I V C V V I Y R H T F E K H Q / A E Q P N E D K C G K C T K I R D / N Y R V Y N T M P 4.3 Results 75

Figure 4.12: Anomalous diﬀerence fourier map at σ = 4.0. In the NBR1/p62 complex structure to 2.1 A˚ resolution, cadmium is coordinated by H66 of p62 PB1 and three waters. Here, the cadmium site with a 10.8 σ peak in the anomalous diﬀerence fourier map is shown. The water molecules are in hydrogen distance from the cadmium ion.

4.3.10 Cadmium chloride bound to p62 PB1 Presence of 10 mM cadmium chloride dihydrate facilitated crystal growth to en- able data collection. The cadmium signal for the data collected at λ = 0.9201 A˚ (with f” = 1.9 at this wavelength) can be detected, but is not strong enough for solving the structure. In the anomalous fourier map, two strong cadmium peaks appear with 10.8 σ and 7.6 σ for the two cadium sites. An anomalous dif- ference fourier map is shown at σ = 4.0 for the first site in Figure 4.12. During structure refinement the cadmium was refined anisotropically. The cadmium is bound on the surface of the structure, in a tetra-coordination in each complex of the asymmetric unit. The heavy metal cadmium is coordinated by H66 of p62 PB1 and three water molecules, which are in hydrogen distance.

4.3.11 Overall structure of the heterodimer The overall structure of the complex of the PB1 domains of NBR1 and p62 is given in Figure 4.13. Both domains adopt a β-grasp like fold comprising 5 β-strands and 2 α-helices as described for the single NBR1 PB1 domain (see above). The OPCA motif of NBR1 PB1 with residues T43 to M70 which is involved in the interaction is coloured in violet. Hence, NBR1 PB1 is categorised as type-A and p62 PB1 as type-B in this interaction. Some residues in p62 in the elongated loops between strands β1 and β2 and strand β1 and α1 are disordered and, therefore, they are not shown in Figure 4.13. These residues are E14 and D15 and C27 to G40, which make 16 out of 187 residues in the complex. Moreover, the two N-terminal residues of NBR1 PB1 are not visible in the electron density. The NBR1 PB1 domain is generally better deﬁned than p62 PB1. Moreover, a higher hydration of NBR1 PB1 is observed. 76 NBR1 PB1 in complex with p62 PB1

Figure 4.13: Ribbon presentation of the NBR1 PB1/p62 PB1 heterodimer. The NBR1 PB1 is shown in blue with the OPCA motif indicated in violet, and the p62 PB1 is rendered in green. Parts of two loops in p62 PB1 are not visible in the electron density, comprising E14 and D15 (in the β1-β2 loop) and C27 to G40 (in the long β2-α1 loop).

Since the structure of NBR1 PB1 has been solved as a single molecule and in complex with p62 PB1, a comparison of the two different states can be made. The overall fold is similar with an r.m.s.d. of 1.03 A˚ (86 Cα) as determined by LSQMAN (Kleywegt et al., 1997) with a cut-off of 3.5 A.˚ The density of the OPCA loop is defined in the PB1 heterodimer presumably due to the participation of these residues in the interaction (Figure 4.9, right panel) and is illustrated in comparison with the single NBR1 PB1 (Figure 4.9, left panel). The largest differences are found in the loop from S21 to N26, residues of which are involved in crystal contacts with that loop from another molecule in the complex structure.

4.3.12 Heterodimeric PB1 domain interface The front-to-back interaction of NBR1 PB1 and p62 PB1 is mediated by two areas on the surface of each domain. NBR1 PB1 interacts as the type-A domain with residues from the OPCA motif, which are D50, E52 and E54. P62 PB1 contributes as a type-B domain to the interaction with the ’basic back’ lysine 4.3 Results 77

Figure 4.14: Stereo view of the NBR1/p62 PB1 interaction site at the cluster A1-B1. The residues of the NBR1 PB1 are shown in blue, and those of the p62 PB1 in green, which make up the A1-B1 interaction site. The lysine K9 (p62 PB1) interacts with D50, E52 and E54 (on NBR1 PB1), and Y9 and R96 (p62 PB1) support this interaction. The residue R22 (p62 PB1) cannot be seen in this orientation. The 2 Fo-Fc map is contoured at σ = 1.3.

K7. Moreover, the binding is further supported by Y9 and R96 from p62 PB1 (Figure 4.14). This leads to a particular strong interaction in the ﬁrst cluster A1-B1, which is mainly built up by salt bridges between the residues. The second acidic-basic cluster in this complex, A2-B2, is formed by E63 and N59 (NBR1 PB1) representing cluster A2, and R21 (p62 PB1) representing cluster B2. The residue R21 is stabilised by interdomain interaction with residue E19. While R21 participates in the A2-B2 cluster the preceding R22 points toward the opposite site of the strand β2 and interacts with D50 form the A1-B1 cluster. The contributing residues to this cluster are shaded in red (for the A1) and in blue (for the B1) in the sequence alignment (Figure 4.11). The total accessible surface area buried in the interface is 1146 A,˚ which is less than the usually observed value in structures of dimers (Lo Conte et al., 1999). The electrostatic surface potential for the complex is shown in an open-book style in Figure 4.15. On the left the electrostatic potential is given for NBR1 PB1 and on the right p62 PB1 is shown. NBR1 PB1 displays the acidic patches as discussed for the single domain, and p62 PB1 carries the basic patches in agreement with the sequence comparison (Figure 4.11) and surface patterns from other PB1 domain complexes (Hirano et al., 2005). In Figure 4.16 the molecules NBR1 PB1 and p62 PB1 are represented as ribbon model in the same orientation as in Figure 4.15 with the residues involved in the interaction highlighted in a stick presentation. The two patches on each molecule are encircled. 78 NBR1 PB1 in complex with p62 PB1

Figure 4.15: Electrostatic potential of the PB1 domain of NBR1 and p62 in an open-book style. On the left, NBR1 PB1 is shown with residues of the acidic cluster A1 (D50, E52, E54) and A2 (E63). On the right, p62 PB1 is given with the residues of the basic cluster B1 (K7, R22, R96) and B2 (R21). The surface is coloured by electrostatic potential in blue (positive) and red (negative). The ﬁgure was prepared using the program GRASP (Nicholls et al., 1991).

Figure 4.16: Molecular interaction between p62 PB1/PB1 heterodimer. The ribbon and stick presentation is given in an open-book style in the same orientation as Figure 4.15. Residues from the acidic regions in NBR1 PB1 and from the basic regions in p62 PB1 are encircled. 4.3 Results 79

4.3.13 Comparison with other heterodimeric PB1 complexes The crystal structures of the PB1 complexes p67phox-p40phox and aPKCι-par6α have been solved previously (Wilson et al., 2003; Hirano et al., 2005). In addition, the solution structures of the PB1 domains of bem1p (Terasawa et al., 2001) and cdc24p (Yoshinaga et al., 2003), which are also forming a complex, were determined by NMR as single domains. Comparison of the residues contributing to the interaction within cluster A1-B1 shows that the lysine is the key residue on the type-B domain. In the structure-based sequence alignment the residues involved in interaction are accentuated. In NBR1-p62, Y9, R96, and R22 further strengthen the binding in addition to the lysine. This interaction by at least three residues on both domains in the first cluster is not present in the other complexes with known structure. In the p40phox-p67phox complex, a single residue in the type-B domain p67phox, the conserved lysine, contributes to the interaction with the type- A OPCA motif. In aPKCι-par6α, in addition to the lysine (here K19), R89 in par6α PB1 is involved in the binding at an equivalent position to R96 in p62 PB1. Although no complex structure of bem1p and cdc24p is available, comparison of residues at equivalent positions reveals that besides the lysine on the type-B domain, a tyrosine (Y18) at a corresponding position to Y9 in p62 PB1 is found, which could be involved in binding. The equivalent residue to R96 (p62 PB1) is K79 (bem1p). Although this residue is not an arginine, participation in the binding owing to the basic character of that residue may be possible and cannot be excluded at this point. In contrary to the cluster A1-B1, the acidic-basic cluster A2-B2/B2’ is less strictly defined in terms of conserved residues on the type-B domain. Location at two different positions in the sequence (see Figure 4.11) has been identified (Hirano et al., 2005). The complex NBR1-p62 belongs to the A2-B2 category with the residues in the second acidic-basic cluster located in the strand β2. The constellation with residue R21 mediating a salt bridge formation in one cluster and R22 with the other cluster has also been described for the complex interface of aPKCι-par6α. There, the second basic site comprises residue R27 (par6α PB1, corresponding to R21 in p62 PB1) in interaction with S72 and E76 (aPKCι PB1, corresponding to N59 and E63 (NBR1 PB1)). The first basic cluster built up by R28 (par6α PB1) interacts with D63 (aPKCι PB1, corresponding to D50 (NBR1 PB1)). Residue E17 of the same molecule (par6α PB1) which is involved in the interaction does not have a correspondence in p62 PB1. The complex p40phox-p67phox does not show this pattern of interaction in the second basic cluster, since residue K382 (p67phox PB1) in helix α1 mediates mainly the interaction with D302 (p40phox PB1). 80 NBR1 PB1 in complex with p62 PB1

4.4 Discussion

4.4.1 Cadmium bound to H66 in p62 PB1 During optimisation of PB1 complex crystal growth, cadmium chloride was found to be an eﬀective additive to improve crystal size. In the structure, a cadmium atom is tetra-coordinated at H66 and three water molecules at the surface of the p62 PB1. Cadmium has been investigated as additive in crystallisation and has been reported to be the cation of choice for protein crystallisation (Trakhanov and Quiocho, 1995). Diverse coordination of Cd2+ have been described, such as tetra-, penta- and hexacoordination even within the same structure, e.g. of the histidine-binding protein from E. coli (Trakhanov and Quiocho, 1995). Generally, cadmium ions are positioned at the interface between two neighbouring protein molecules. These metal ions can form a complex with the electron donors such as histidine and cysteine but also glutamate, aspartate, arginine, or lysine (Trakhanov et al., 1998). Hence, coordination usually forms cadmium bridges across the interface of protein molecules. Here, bridging of two molecules could not be observed since contribution from amino acids in the coordination is limited to H66 (p62 PB1) and the three water molecules. For one of the cadmium ions in the asymmetric unit, the coordination of one water could be replaced by D81 (p62 PB1) from a symmetry molecule due to vicinity of D81 to the cadmium. However, the sidechain of D81 (p62 PB1) is disordered and hence it was not modelled. A clear bridging of symmetry molecules could not be observed, however, the binding of cadmium to p62 PB1 may cover patches on the surface which unfavour crystallisation.

4.4.2 The three classes of PB1 domains The PB1 complex of NBR1-p62 constitutes the third complex structure of a PB1 complex. NBR1 PB1 represents the type-A domain in this interaction and the mutated p62 (DDAA) PB1 the type-B domain. NBR1 PB1 represents a typical domain of the type-A category according to sequence and structure. Wild type p62 PB1 is known to homo-oligomerise and, thus, arrays of p62 PB1 domains are formed which can create large aggregation of p62. Hence, p62 PB1 was classiﬁed as type-AB domain. p62 PB1 exerts its role as a type-B domain in the NBR1/p62 heterodimer due to the introduced mutations D69A and D73A which prevent self-oligomerisation. In the basic cluster B1, a remarkably strong interaction was detected, based on mainly four residues (K7, Y9, R22 and R96).

4.4.3 Model of the p62 PB1 homodimer Superimposition of a p62 (DDAA) PB1 with NBR1 PB1 demonstrates how wild type p62 PB1 would homodimerise. The residues of the OPCA loop backbone adopt a similar location as in NBR PB1, and the corresponding residue of E63 (NBR1 PB1) which is D82 is in vicinity to R21 (p62 PB1). Only the distance of S78 (equivalent of N59) to R21 in the direct superimposition is too large for 4.4 Discussion 81 interaction, but a change towards a similar arrangement as seen in the aPKCι- par6α complex with S72 (aPKCι, corresponding to S78 (p62 PB1)) and R27 (par6α, corresponding to R21 in the other p62 PB1 molecule) upon binding is conceivable. Further investigations of the p62 PB1 homodimer without aggregation may provide a second mutation construct of p62 PB1. Instead of mutating the propensities of the type-A domain, the characteristic residues of the type-B domain can be mutated. Mutation of residue R21 (Wilson et al., 2003) and eventually E19, which stabilises R21, will result in a type-A domain. This can be used to study the aﬃnity by ITC as shown here or for structural investigations which may also visualise the loop region between β2 and α1.

4.4.4 Affinity of the NBR1/p62 PB1/PB1 heterodimer complex The affinity of the heterodimer complex has been studied by ITC and the dissociation constant determined to be Kd = 12 nM ± 1 nM. PB1 complex formation has been studied using ITC by other groups before. For the PB1 phox phox complex of p40 -p67 a dissociation coefficient Kd = 10 nM has been reported (Lapouge et al., 2002). The low value of the dissociation constants Kd (Kd = 1/Ka with Ka being the equilibrium binding coefficient) in both complexes indicates a high affinity of PB1 domains towards each other and a tight complex formation.

4.4.5 p62 interactions In addition to the NBR1/p62 PB1 heterodimer and the discussed p62 homodimer complex formation, interaction of p62 PB1 occurs with MEK5 PB1 (Lamark et al., 2003) and with aPKCζ PB1 (Wilson et al., 2003). The evidenced association of p62 PB1 as the type-B domains with MEK5 and aPKCζ may occur under similar prerequisites as with NBR1. A reminiscent compact structure devoid of additional insertions has been found in all three structures (Figure 4.10 C, D). The r.m.s.d. of these PB1 domains is low (Table 4.6). The overall structural appearance of MEK5 PB1 and aPKCζ PB1 and particular the conservation of the OPCA motif permit binding of these domains to p62 PB1 in a similar manner as NBR1 PB1. Large structural diﬀerences were not detected which may explain potential favouring of p62 PB1 for one domain or another. Owing to the fact that p62 is a ubiquitously distributed protein, interaction of p62 PB1 with the according binding partners NBR1, MEK5, and aPKC depends on the spatial and temporal distribution and availability.

4.4.6 Biological relevance of the NBR1/p62 heterodimer complex Despite its discovery already in 1994, little was known about the protein NBR1, the cDNA of which was originally isolated from a serum directed against ovarian tumor antigen CA125 (Campbell et al., 1994). However, it was shown that the antigen CA125 is the mucin MUC16, which is entirely diﬀerent from 82 NBR1 PB1 in complex with p62 PB1

NBR1 (Yin and Llyod, 2001). A potential role in ovarian and breast cancer could not be demonstrated for NBR1 so far, albeit it was speculated due to its location head-to-head with the BRCA1 gene (Dimitrov et al., 2001). Then, an interaction was detected between NBR1 PB1 and p62 PB1 (Lamark et al., 2003), a protein which mainly associates with cytosolic inclusions of ubiquitinylated proteins. However, the biological function of this interaction was only spotted, when a connection emerged between the kinase domain in the giant muscle protein titin and a downstream signalling pathway transducing the signal to the nucleus (Lange et al., 2005a). In this pathway, NBR1 acts as a key scaﬀold protein, which connects p62 to the serine/threonine protein kinase domain through its amino-terminal part. Chapter 5

Conclusions

Binding sites of titin ligands occur mainly at three positions along the titin filament at distinct spots in the Z-disc, the I-band, and the M-line (Granzier and Labeit, 2004; Granzier and Labeit, 2005). In this study, the region around titin kinase at the transition to the M-line was at the focus of the investigations. Several domains in this area were studied. The two domains A168-A169, known to bind to the muscle specific RING finger protein MURF-1 from yeast two- hybrid studies (Centner et al., 2001), were analysed structurally (Chapter 2). These tandem domains do not occur as two independent modules with a high degree of flexibility but rather they form a rigid entity. Connection between the domains is provided by merging of the last β-strand of A168 with the first β-strand of A169. This close linkage of the domains is supported by the lack of linking residues between the Ig domains. Binding of MURF-1 to this titin tandem domain is mediated via a special characteristic found in A169. An insertion between the strands A and A’ in A169, which is unique among the Ig domains with known three-dimensional structure, bulges out along the longest side of the Ig domain. The basic residue E107 is exposed in this bulge and has been shown to be involved in binding to MURF-1 (S. Lange, personal communication). A deeper insight in the interaction between titin A168-A169 is desirable. This can be gained by mapping potential other residues on titin which support the binding to MURF-1, e.g. in a similar way as the residues on MURF-1, involved in binding to A168-A169, were mapped (Witt et al., 2005). Clearly, the structure of MURF-1 and particularly the structure of the complex with titin A168-A169 would give insight to the complex formation. Moreover, structural analysis of MURF-1 is of special interest since its versatile interaction with other sarcomeric proteins beyond titin and even nuclear proteins allocates MURF-1 as an important adaptor in linking titin to the nucleus. Owing to this property, MURF-1 appears to be not only of significance in binding to titin and, thus, contributing to signalling in proximity to titin kinase, but also has been shown to play a role in the concept of muscle atrophy by upregulation of specific genes. The proteins NBR1 and p62 are linked to titin as substrates of the serine/threonine kinase domain titin kinase. Particularly, the N-terminus of

83 84 Conclusions

NBR1 (PB1 domain and ZZ domain) has been reported to bind to a truncated titin kinase construct. This construct is supposed to represent an active state kinase (Lange et al., 2005a) which is assumed to arise from stretching of titin (Gräteret al., 2005). The N-terminal NBR1 PB1 has been another subject of this study (Chapter 4). The interaction of NBR1 PB1 or the elongated NBR1 N-terminus (PB1 and ZZ domain) with the truncated titin kinase may be subject of further investigations. These could provide the ’structurally’ missing link between titin and NBR1. First attempts towards obtaining active state titin kinase constructs have been made (Appendix A). Eukaryotic expression (bacculovirus/insect cell) has proven to be problematic with the active kinase constructs. A change to a prokaryotic expression system (E. coli) was attempted. So far, an expression and purification protocol has been established for two autoinhibited titin kinase constructs, bearing in addition to the kinase domain the FnIII domain A170 ahead (A170TK) and the preceding Ig domain M1 (TKM1), respectively. A demonstration of how titin kinase together with M1 may look like is illustrated in Chapter 3. These extended titin kinase constructs and the constructs mimicking the active state of the kinase were intended to further investigate the activation mechanism by crystallisation and co-crystallisation with substrate peptide and ATP-analogues. However, crystallisation has not been achieved yet. Posttranslational modification as provided in the eukaryotic expression system may be a key to obtain protein suitable for crystallisation. Another possibility to obtain an active titin kinase might be by expression of these autoinhibited constructs in the prokaryotic expression system with an internal cleavage site for removal of the regulatory tail. Studies on the binding of NBR1 to titin kinase can also be performed with synthetic peptides representing the αR1 helix of titin kinase. This part of titin kinase was assumed to be the binding site for NBR1 (Lange et al., 2005a). The mapping of the exact binding site on titin kinase as well as on NBR1 will be a valuable piece of information in linking the downstream signalling to titin. The PB1 domain has previously been identified as an interaction domain which mainly forms heterotypic interactions with other PB1 domains (Noda et al., 2003; Wilson et al., 2003). As for p62 homotypic interactions have been reported. In this study, this interaction property was shown in particular for NBR1 PB1 and p62 PB1 (Chapter 4). In order to prevent self-oligomerisation of p62 PB1, two mutations (D69A and D73A) in one of the interacting motifs, the OPCA motif, were introduced, which do not avoid the binding to PB1 NBR1. Thus, complex formation and thermodynamics of the binding could be studied by ITC. The crystal structure revealed the residues which contribute to the interaction of both proteins. In summary, titin domains from the titin kinase region and domains of the associated titin kinase signalling pathway have been investigated in this study. This work has shed some light on the interactions occurring in this area of titin. This represents a further step towards elucidating the concept of M-line signalling in particular and titin signalling in general on a strucutral basis. Conclusions 85

More structural investigations on the entity of this region are required. Due to limitations in crystallisation of the generally large and ﬂexible titin, other methods may be applied to obtain more structural knowledge. Further studies by methods such as small angle X-ray scattering or electron microscopy on titin fragments encompassing several domains, e.g. the domains A168 to M1 may provide insight if and how the overall more rigid structure of A168-A169 can combine with the titin kinase which is assumed to be stretched during muscle activity.

Appendix A

Titin kinase

A.1 Introduction

The structure of titin kinase was solved previously (Mayans et al., 1998). It explains the basis for activation achieved by tyrosine phosphorylation and calcium/calmodulin binding. Two potential models for the release from autoinhibition by the pseudosubstrate have been suggested (Wilmanns et al., 2000). Structures of titin kinase mutants and truncations should give further insight into the activation mechanism. Initially, titin kinase used for crystallisation was isolated from the bacculovirus/insect cell system (Mayans et al., 1998; Mayans and Wilmanns, 1999). However, for mutants and truncations of titin kinase, the insert introduced into the bacculovirus vector was lost after two to three cell generations (P. Zou, personal communication). The instability of the vector in correlation with the physiologically problematic presence of excess titin kinase in the active state disabled the expression in eukaryotic cells. Thus, a change to the prokaryotic expression system was carried out. Several mutation constructs had been prepared for expression in E. coli (P. Zou). Starting from these constructs, expression and purification protocols were tested on autoinhibited titin kinase and some mutants which were designed to mimic the active kinase. Only one of the mutants (TKYD, description see below) was expressed and purified at a low yield of about 0.1 mg purified protein from ten liters of culture. Hence, as new strategy, the design of new constructs in a different vector was chosen.

A.2 Materials and Methods

A.2.1 Cloning A fragment of human titin comprising the domains A168 to M1 (residues 24429- 26925, protein accession code Q10466; nucleotide accession code X90568) was ampliﬁed by PCR from the cardiac muscle library (G. Stier, EMBL Heidelberg) and cloned into the PCR blunt vector following the TOPO clone strategy (In- vitrogen). This construct was further used as a template for PCR in subsequent cloning of smaller fragments. Titin kinase-containing fragments were directly

87 88 Titin kinase cloned into the expression vector pET151/D-TOPO (Invitrogen) and the DNA sequence was veriﬁed (MWG-Biotech). The construct containing the additional N-terminal FnIII-type domain A170 is further referred to as 170TK. The construct with the extra C-terminal Ig domain M1 is called TKM1. Abbreviations of some titin kinase constructs and mutants were kept for historical reasons as TKS (semi-truncated titin kinase), TKYD (double mutant of the full length titin kinase with Y170E and D127S), and kin4 (Mayans et al., 1998) with further description given in Table A.2.

TOPO cloning 1: Zero Blunt TOPO cloning (Invitrogen) Zero Blunt TOPO cloning was used for direct insertion of blunt end PCR product to the vector. The PCR-Blunt II-TOPO linearised vector is topoisomerase I-activated. DNA topoisomerase I acts both as a restriction enzyme and as a ligase. As restriction enzyme it recognises the 5’-(C/T)CCTT-3’ sequence which was introduced at 5’-end of the PCR product, attaches a phosphate at the 3’ thymidine, and cleaves the DNA strand. Ligation occurs at the cleaved strands with the linearised vector. Zero Blunt TOPO cloning was performed according to the manufacturer’s protocol (Invitrogen).

TOPO cloning 2: Directional TOPO cloning (Invitrogen) The pET directional TOPO cloning allows cloning of the target insert directly from the PCR into the expression vector. This is due to the linearized, topoisomerase I-activated pET expression vectors and the speciﬁc recognition sequence at the 5’-end attached to the PCR product. The pET directional TOPO vector used here, was the Champion pET TOPO vector pET151/D-TOPO (Invitro- gen) which features an N-terminal six histidine-tag, a TEV-protease cleavage site and ampicillin resistence. Primer design, PCR, cloning, and transformation were performed according to the manufacturer’s recommendation. A listing of the used primers is given in Table A.1.

Site-directed mutagenesis Site-directed mutagenesis was performed with the QuikChange Site-Directed Mutagenesis Kit (Stratagene) and was used to introduce single amino acid substitutions in the titin kinase domain. The mutations D127S, Y170E, and R279W were introduced using the primers listed in Table A.1.

A.2.2 Expression of titin kinase Extensive optimisation of the expression conditions was needed to achieve at least 0.2 mg purified protein from one liter E. coli culture. Expression temperature and time as well as the composition of the medium finally differed from the standardised initial expression protocol. Due to low protein yields, the titin kinase was mostly expressed in six or 12 liter charges in batches of one liter per two liter baffled Erlenmeyer flask. A.2 Materials and Methods 89

Identity Sequence (from 5’ to 3’) Description A168 NdeI AAACATATGGCACCACACTT forward, Zero blunt TAAAGAGGAAC TOPO, NdeI, A168-M1 M1 BamHI AAAGGATCCTCATTCTCTCA reverse, Zero blunt CACCTTTAACAAATAGCTC TOPO/ pET151, BamHI, A168-M1/ TKM1 170 151N CACCATGCCTGACCCACCCA forward, pET151, 170TK GAGGAG TK 151N CACCATGAAGGAACTCTATG forward, pET151, TKM1/ AGAAATATATGATTG TK/ TKS/ kin4 TK BamHI AAAGGATCCTCAAATTTCAA reverse, pET151, BamHI, TGGATGCCACTTTAACTTTA TK G TKS BamHI AAAGGATCCTCAGTTGAGGT reverse, pET151, BamHI, CTTTCTTGATCAGGGTG TKS Kin4 BamHI AGGATCCTCATCTGATAACT reverse, pET151, BamHI, TTAGTACTGACTCTTTCT kin4 TKD127Sf GTCATAATATTGGACACTTT forward, for SDM of titin AGCATTAGACCAGAAAATAT kinase, D127S C TKD127Sr GATATTTTCTGGTCTAATGC reverse, for SDM of titin TAAAGTGTCCAATATTATGA kinase, D127S C TKY170Ef CACTGCCCCAGAATACGAGG forward, for SDM of titin CACCTGAAGTCCACC kinase, Y170E TKY170Er GGTGGACTTCAGGTGCCTCG reverse, for SDM of titin TATTCTGGGGCAGTG kinase, Y170E TKR279Wf GTTATCAGAACATTAAAACA forward, for SDM of titin CTGGCGTTATTACCACACCC kinase, R279W TG TKR279Wr CAGGGTGTGGTAATAACGCC reverse, for SDM of titin AGTGTTTTAATGTTCTGATA kinase, R279W AC

Table A.1: Primers for the cloning of titin kinase constructs including truncations and mutations. The description states the direction of cloning (forward or reverse), the target vector (Zero blunt TOPO or pET151), the restriction site if available, and the target construct are given. For site-directed mutagenesis (SDM), the direction, the purpose of use in SDM, and the mutation site are given. 90 Titin kinase

The recombinant titin kinase was expressed in the E. coli strain Rosetta (DE3) pLysS or alternatively in BL21 Star (DE3). A single colony from an LB agar plate was inoculated to 100 ml LB medium supplemented with 50 µg/ml carbenicillin and 34 µg/ml chloramphenicol as antibiotics. This starter culture was grown overnight at 37◦C in a shaking incubator. The suspension was then used at a ratio of 1:40 to inoculate 1 liter LB medium supplemented with the appropriate antibiotics and 1% glucose in a 2000 ml baﬄed Erlenmeyer ﬂask. For the expression, carbenicillin was used instead of ampicillin. The main cultures were grown in a shaking incubator at 37◦C until an optical density (λ=600 nm) of 0.9 to 1.0 was reached. The temperature was lowered to 15◦C and the expression was induced by adding 1 mM IPTG. After 20 hours the cells were harvested by centrifugation at 6000 rpm (JLA 8.1000, Beckman) at 4◦C for ten minutes, resuspended in about 20 ml PBS per liter culture, pelleted by centrifugation at 4000 rpm at 4◦C for 10 min and frozen at -20◦C.

A.2.3 Purification Once conditions to express the protein were found, the protein was purified by IMAC, anion exchange and size exclusion chromatography. Anion exchange and size exclusion chromatography were carried out on an AEKTA purification system at a temperature pf 8◦C. Cells were thawed in about 20-30 ml DNaseI- (10 µg/ml) and lysozyme- (1 mg/ml) containing lysis buffer (25 mM Tris pH 8.0, 300 mM NaCl, 5 mM imidazol) per liter of cultured cells. The cells were disrupted on ice by ul- trasonication using a KE76 tip (Bandelin Sonoplus Ultrasonic homogenizer HD 2200) and pulses of 0.7 s sonication and 0.3 s pause intervals for 2-10 min de- pending on the consistency of the solution. After centrifugation (30 min at 18000 rpm (SS-34, Sorvall) at 4◦C), the supernatant was applied to Ni-NTA beads (Qiagen). After washing steps with lysis buffer and lysis buffer supplemented with a low concentration of imidazol (10-30 mM) in order to dispose of non-specifically bound protein, the protein was eluted in elution buffer (lysis buffer plus 400 mM imidazol). The eluted protein (5 ml) was diluted in 50 mM Tris pH 8.0 up to a volume of 50 ml and then applied to a 5 ml anion-exchange HiTrap Q HP column (GE Healthcare) pre-equilibrated in 50 mM Tris pH 8.0 and 50 mM NaCl. Elution from the anion-exchange column was performed by applying a salt gradient from 50 mM to 1 M NaCl in two successive gradients. The first salt gradient up to 50% of the high salt buffer extended over eight column volumes, the second gradient from 50 % up to 100 % high salt solution over three column volumes. After the IEX chromatography, titin kinase fusion protein was cleaved by TEV protease in order to separate the polyhistidine-tag from the protein. Final size exclusion chromatography on a Superdex 75 10/30 column (GE Healthcare) in 25 mM HEPES pH 7.5, 150 mM NaCl and 5 mM DTT was used to achieve a homogenous sample of titin kinase for crystallisation. A.3 Results and Discussion 91

A.2.4 Western blot For Western Blot, the proteins separated by SDS-PAGE were electroblotted from the gel by electrical transfer onto the nitrocellulose membrane (Schleicher & Schuell), which was equilibrated in transfer buffer (NuPage Transfer buffer, Invitrogen), at 125 mA for 90 min in transfer buffer. For blotting the XCell SureLock Mini-Cell system was used with its Blot Module (Invitrogen), and semi-dry blotting was performed according to the manufacturer’s recommen- dations. The blotted membrane was immersed in blocking buffer (5 % milk powder in phosphate-buffered saline (PBS)) for one hour at room temperature. All incubation steps were carried out with gentle agitation and were separated by several washing steps with PBS at room temperature. The rabbit anti-titin kinase antibody (kindly provided by M. Gautel) was incubated as a primary antibody at a dilution of 1:2000 in PBS at 4◦C overnight. The horse radish peroxidase-conjugated secondary antibody (anti-rabbit antibody, GE Health- care) was incubated at room temperature for one hour at a dilution of 1:2000 in PBS. Enhanced chemiluminescence (ECL) Western blotting detection system (GE Healthcare) was applied. The blot was incubated with the detection solution for 1 min while agitating. Development of the blot was completed after 0.5 min to several minutes and was visualised with the chemiluminescence option at the Gel Documentation System (BioRad) and analysed with the Quantity One software (BioRad).

A.3 Results and Discussion

From previous work on this project carried out by colleagues, it is known that the limiting factor in studying titin kinase and its mutants is to obtain solu- ble eukaryotic protein expression in adequate amounts and the puriﬁcation of the protein. Therefore, also in this experimental set-up, when the E. coli expression system was applied, the results are limited to cloning, expression, and puriﬁcation. New constructs were designed and optimisation of the preparation procedure was achieved for two titin kinase constructs with adjacent FnIII and Ig domains. Further investigations have to follow.

A.3.1 Cloning Initially, diverse standard cloning strategies were assayed. Complications during cloning process originated from several internal restriction sites in the titin fragment of interest. These restriction sites are usually also found in the MCS (multiple cloning site) especially of the pETM-series (EMBL). For in- stance, restriction sites for the restriction enzymes KpnI and NcoI and the NcoI-isochizomeres BspHI and PciI are found within the titin kinase sequence. Consequently, restriction cleavage by these enzymes would result in fragmenta- tion of the designed insert. Therefore, a so-called distant cutter, BsaI, was used to create a sticky end overhang site of the NcoI type. This is achieved without digestion of the DNA by the enzyme NcoI but by cutting with BsaI. However, 92 Titin kinase this strategy was not successful, either. It was also not possible to clone the titin fragments into pET14b and pET16b via the NdeI and BamHI sites. Due to the problems occurring in association with restriction of the products and subsequent ligation, a cloning strategy was aimed for without the application of classical restriction enzymes. Hence, the TOPO cloning strategy (Invitrogen) was used, which allows to bypass digestion of the PCR products in the classical way. Due to the little amount of available cardiac muscle library as template DNA, a product encompassing several domains was first cloned to the BluntII-TOPO vector as a preliminary vector. Once direction and sequence of the insert were confirmed by sequencing, the vector containing the five domain construct of titin A168-M1 was used as template DNA for further PCR of different domain constructs. Cloning of several constructs was performed successfully by directional TOPO cloning to the expression vector pET151 (Invitrogen) containing an N-terminal His-Tag and a TEV-protease cleavage site. The cloned constructs are given in Table A.2.

Constructs Description A168-M1 Domains A168-A169-A170-TK-M1, BluntII-TOPO vector TKM1 Full length TK and Ig domain M1 170TK FnIII domain A170 and full length TK TK Full length TK TKS TK truncated after residue N291; lacks part of the regulatory tail from αR2 onwards kin4 TK truncated after residue R274; lacks the complete regulatory tail from αR1 onwards TKYD TK with two mutations: D127S and Y170E TKM1 R279W TKM1 construct with mutation R279W 170TK R279W 170TK construct with mutation R279W TKM1 Y170E TKM1 construct with mutation Y170E 170TK Y170E 170TK construct with mutation Y170E

Table A.2: Cloned titin kinase constructs. Except for the ﬁrst construct which was cloned into the BluntII-TOPO vector for further use as a template for PCR, all other constructs were cloned into pET151.

A.3.2 Expression A comparison of expression at different temperatures is given in Figure A.1 for the constructs 170TK and TKM1 at both, 15◦C and 37◦C. The protein was expressed at 37◦C for three to four hours or expressed overnight at 15◦C after preceding cell growth at 37◦C. Due to low yields, expression bands could not be directly displayed on an SDS-PAGE gel. Therefore, the first purification step by IMAC was performed to compare the influence of the expression temperature on expressed titin kinase. For both constructs, a clear preference for lower A.3 Results and Discussion 93

Figure A.1: SDS-PAGE of protein from IMAC to estimate the expression level of 170TK (left panel) and TKM1 (right panel). Lane 1: marker Precision Plus (Bio-Rad) with the thicker bands representing 25, 50, and 75 kDa, respectively; lanes 2 and 6: ﬂow through; lanes 3 and 7: wash; lanes 4 and 8: elution 1; lanes 5 and 9: elution 2. For the left panel (170TK), lanes 2 to 5 describe expression at 15◦C and lanes 6 to 9 at 37◦C. For the right panel (TKM1) lanes 2 to 5 describe expression at 37◦C and lanes 6 to 9 at 15◦C.

temperature could be assessed. In Figure A.1, lanes 4 and 5 in the left panel and lanes 8 and 9 in the right panel show protein bands of the expected size. The constructs 170TK and TKM1 have a size of 51 kDa and 49 kDa, respectively, not including the polyhistidine-tag of about 3 kDa. Expression at 15◦C enabled protein production using the constructs 170TK and TKM1 in the E. coli expression system.

A.3.3 Purification The two recombinant titin kinase constructs, 170TK and TKM1, were purified in a three-step purification, including affinity, anion exchange, and size exclusion chromatography. The elution profiles of the anion exchange (IEX) chromatography for 170TK and TKM1 are given in Figure A.2. The peaks of 170TK and TKM1 are indicated with an arrow in the chromatograms. The protein 170TK elutes at a conductivity of 15 mS/cm (Figure A.2, top panel), while TKM1 elutes at a conductivity of 20 mS/cm (Figure A.2, bottom panel). Cleavage by TEV protease confirmed the presence of the histidine-tag containing recombinant protein in the sample. For both, 170TK and TKM1, a protein sample taken before and after TEV cleavage demonstrates successful cleavage. Finally, protein and tag were separated by gelfiltration. Purified constructs 170TK and TKM1 are shown on an SDS-PAGE in Figure A.3. Identity of the constructs TKM1 and 170TK was confirmed by Western Blot and by mass spectrometry (X. Li, Proteomics Core Facility, EMBL). Yields of purified protein varied among the purified batches in the range of 0.2 mg/liter culture up to 1 mg/liter culture (Table A.3). 94 Titin kinase

Figure A.2: Anion exchange chromatography of 170TK (top panel) and TKM1 (bottom panel). In the elution proﬁle the absorption is monitored at λ = 280 nm (in blue) plotted against volume. The concentration of the salt gradient is shown in green and the conductivity in brown. The proteins 170TK and TKM1 elute in the peak indicated with an arrow at a conductivity of 15 mS/cm and 20 mS/cm, respectively. A.3 Results and Discussion 95

Figure A.3: Puriﬁed 170TK and TKM1 on a 10% SDS-PAGE.

Construct Expression Puriﬁcation Yield [mg/l] TKM1 X X 0.2-1.0 170TK X X 0.2-0.5 TK X TKS – kin4 TKYD X – TKM1 R279W X 170TK R279W X TKM1 Y170E 170TK Y170E X X 0.2

Table A.3: Summary of titin kinase construct preparation: expression, purification, and obtained yield of purified protein per liter E. coli culture. An ’X’ indicates successful accomplishment with the established protocol for TKM1 and 170TK. A ’–’ indicates no expression or purification under these conditions after several trials. No indication is given if the analysis was not performed.

A.3.4 Titin kinase truncations and mutations The aim was to also purify and crystallise other titin kinase constructs and mutants other than 170TK and TKM1. Therefore, the constructs and mutants were cloned into the expression vector pET151 Table A.2). Three different mutations were introduced, which were either single mutations or combinations of the mutations. The mutation Y170E is mimicking the phosphorylated state of the kinase, a prerequisite to its activation. The residue D127, representing 96 Titin kinase the catalytic base, was mutated to a serine. Mutation R279W in the αR1-helix is described to increase the affinity of titin kinase towards calmodulin (Lange et al., 2005a). So far, the only mutant expressed and purified successfully is the 170TK Y170E mutant, following the same preparation protocol. The yield is in the same range as for the non-mutated titin kinase constructs. For the other mutants as for the truncation mutants the expression and purification protocol needs to be optimised. The construct TK was used to compare its expression and purification behaviour with the constructs bearing an additional domain. 170TK and TKM1 could be purified as described. List of publications and conference contributions 97

Publications and conference contributions

List of publications

M¨uller,S., Diederichs, K., Breed, J., Kissmehl, R., Hauser, K., Plattner, H. and Welte, W. (2002) Crystal structure analysis of the exocytosis-sensitive phosphoprotein, pp63/parafusin (phosphoglucomutase), from Paramecium reveals signiﬁcant conformational variability. J Mol. Biol. 315, 141-153.

M¨uller,S., Kursula, I., Zou, P., and Wilmanns, M. (2006) Crystal structure of the PB1 domain of NBR1. FEBS Lett. 580, 341-344.

M¨uller,S., Lange, S., Gautel, M., Kursula, I., Pastore, A., and Wilmanns, M. (2005) Rigid conformation of an immunoglobulin tandem repeat in the A-band of the giant muscle protein titin. manuscript in preparation.

M¨uller,S. and Wilmanns, M. (2005) Structure of the M1 domain of titin. manuscript in preparation.

M¨uller,S., Panjikar, S., and Wilmanns, M. (2005) Heterodimeric complex of the PB1 domains of NBR1 and p62 – mediators in the titin kinase downstream signalling pathway. manuscript in preparation.

List of conference contributions

M¨uller,S., Zou, P., Lehmann, F., and Wilmanns, M. Structural basis of the titin kinase regulation mechanism. Molecular mechanisms in signal transduction (FEBS-EMBO advanced lecture course). August 18-29, 2003, Spetses, Greece (Poster).

M¨uller,S., Kursula, I., and Wilmanns, M. Structure of the PB1 domain of NBR1 and complex formation with the PB1 domain of p62. 22nd European Crystallography Meeting: ECM22. August 26-31, 2004, Budapest, Hungary (Poster).

M¨uller,S., Kursula, I., and Wilmanns, M. Structural basis of PB1 domain- mediated signalling by the NBR1/p62 scaﬀold. Structural Biology at cross- roads: From Biological Molecules to Biological Systems. September 15-18, 2004, Hamburg, Germany (Poster). 98 List of publications and conference contributions

Müller,S., Zou, P., Pinotsis, N., Kursula, I., and Wilmanns, M. Structural studies on the giant muscle protein titin. Jahrestagung der DGK (Deutsche Gesellschaft fürKristallographie). February 28- March 4, 2005, Köln,Germany (Talk).

M¨uller,S., Kursula, I., and Wilmanns, M. Structural studies on titin and the downstream signalling pathway of titin kinase. XX Congress of the Interna- tional Union of Crystallography (IUCR). August 23-31, 2005, Florence, Italy (Poster).

M¨uller,S. and Wilmanns, M. High resolution structures near to titin kinase: from proximal titin domains to downstream signalling components. Coiled- Coils, Collagen and Co-Proteins IV. September 11-17, 2005, Alpbach, Austria (Poster). References

Agarkova, I., Ehler, E., Lange, S., Schoenauer, R., and Perriard, J. C. (2003) M-band: a safeguard for sarcomere stability? J. Muscle Res. Cell Motil. 24, 191-203. Agarkova, I. and Perriard, J. C. (2005) The M-band: an elastic web that crosslinks thick filaments in the center of the sarcomere. Trends Cell Biol. 15, 477-485. Amodeo, P., Fraternali, F., Lesk, A. M., and Pastore, A. (2001a) Modularity and homology: modelling of the titin type I modules and their interfaces. J. Mol. Biol. 311, 283-296. Amodeo, P., Castiglione Morelli, M. A., Strazzullo, G., Fucile, P., Gautel, M., and Motta, A. (2001b) Kinase recognition by calmodulin: modeling the interaction with the autoinhibitory region of human cardiac titin kinase. J. Mol. Biol. 306, 81-95. Arya, R., Kedar, V., Hwang, J. R., McDonough, H., Li, H.-H., Taylor, J., and Patterson, C. (2004) Muscle ring finger protein-1 inhibits PKCε activation and prevents cardiomyocyte hypertrophy. J. Biol. Chem. 167, 1147-1159. Avila, A., Silverman, N., Diaz-Meco, M. T., and Moscat, J. (2002) The Drosophila atypical protein kinase C-Ref(2)p complex constitutes a conserved module for signaling in the toll pathway. Mol. Cell. Biol. 22, 8787- 8795. Ayme-Southgate, A., Vigoreaux, J., Benian, G., and Pardue, M. L. (1991) Drosophila has a twitchin/titin-related gene that appears to encode projectin. Proc. Natl. Acad. Sci. USA 88, 7973-7977. Bahler, M., Wallimann, T., and Eppenberger, H. M. (1985) Myofibrillar M-band proteins represent constituents of native thick filaments, frayed filaments and bare zone assemblages. J. Muscle Res. Cell Motil. 6, 783-800. Bang, M.-L., Centner, T., Fornoff, F., Geach, A. J., Gotthardt, M., McNabb, M., Witt, C. C., Labeit, D., Gregorio, C. C., Granzier, H., and Labeit, S. (2001) The complete gene sequence of titin, expression of an unusual approximately 700-kDa titin isoform, and its interaction with obscurin identify a novel Z-line to I-band linking system. Circ. Res. 89, 1065-1072. Barclay, A. N. (2003) Membrane proteins with immunoglobulin-like domains - a master superfamily of interaction molecules. Sem. Immunol. 15, 215-223. Benian, G. M., Kiff, J. E., Neckelmann, N., Moerman, D. G., and Waterston, R.H. (1989) Sequence of an unusually large protein implicated in regulation of myosin activity in C. elegans. Nature 342, 45-50. Blanchard, A., Ohanian, V. and Critchley, D. (1989) The structure and function of alpha-actinin. J. Muscle Res. Cell Motil. 10, 280-289.

99 100 References

Bodine, S. C., Latres, E., Baumhueter, S., Lai, V. K.-M., Nunez, L., Clarke, B. A., Poueymirou, W. T., Panaro, F. J., Na, E., Dharmarajan, K., Pan, Z.-Q., Valenzuela, D. M., DeChiara, T. M., Stitt, T. N., Yancopoulos, G. D., and Glass, D. J. (2001) Identification of ubiquitin ligases required for skeletal muscle atropy. Science 294, 1704-1708. Boggon, T. J., Murray, J., Chappuis-Flament, S., Wong, E., Gumbiner, B. M., and Shapiro, L. (2002) C-cadherin ectodomain structure and implications for cell adhesion mechanisms. Science 296, 1308-1313. Borden, K. L. B. (1998) RING fingers and B-boxes: zinc-binding protein-protein interaction domains. Biochem. Cell Biol. 76, 351-358. Borden, K. L. B. (2000) RING domains: master builders of molecular scaffolds? J. Mol. Biol. 295, 1103-1112. Borden, K. L. B. and Freemont, P. S. (1996) The RING finger domain: a recent example of a sequence-structure family. Curr. Opin. Struct. Biol. 6, 395-401. Bork, P., Holm, L., and Sander, C. (1994) The immunoglobulin fold. Structural classification, sequence patterns and common core. J. Mol. Biol. 242, 309- 320. Bork, P., Downing, A. K., Kieffer, B., and Campbell, I. D. (1996) Structure and distribution of modules in extracellular proteins. Quart. Rev. Biophys. 29, 119-167. Brady, R. L., Dodson, E. J., Dodson, G. G., Lange, G., Davis, S. J., Williams, A. F., and Barclay, A. N. Crystal structure of domains 3 and 4 of rat CD4: relation to the NH2-terminal domains (1993) Science 260, 979-983. Brünger,A. T., Adams, P. D., Clore, G. M., DeLano, W. L., Gros, P., Grosse- Kunstleve, R. W., Jiang, J.-S., Kuszewski, J., Nilges, M., Pannu, N. S., Read, R. J., Rice, L. M., Simonson, T., and Warren, G. L. (1998) Crystal- lography and NMR system (CNS): a new software suite for macromolecular structure determination. Acta Cryst. D54, 905-921. Brzozowski, A. M. and Walton, J. (2001) Clear strategy screens for macromolecular crystallization. J. Appl. Cryst. 34, 97-101. Buchberger, A. (2002) From UBA to UBX: new words in the ubiquitin vocab- ulary. Trends Biochem. Sci. 12, 216-221. Campbell, I. G., Nicolai, H. M., Foulkes, W. D., Senger, G., Stamp, G. W., Allan, G., Boyer, C., Jones, K., Bast, R. C. Jr, Solomon, E., Trowsdale, J., and Black, D. M. (1994) A novel gene encoding a B-box protein within the BRCA1 region at 17q21.1. Hum. Mol. Genet. 3, 589-594. Cariou, B., Perdereau, D., Cailliau, K., Browaeys-Poly, E., Béréziat, V., Vasseur-Cognet, M., Girard, J., and Burnol, A.-F. (2002) The adaptor protein ZIP binds Grb14 and regulates its inhibitory action on insulin signaling by recruiting protein kinase Cζ. Mol. Cell. Biol. 22, 6959-6970. Collaborative Computational Project, Number 4 (1994) The CCP4 suite: Pro- grams for protein crystallography. Acta Cryst. D50, 760-763. Centner, T., Yano, J., Kimura, E., McElhinny, A. S., Pelin, K., Witt, C. C., Bang, M.-L., Trombitas, K., Granzier, H., Gregorio, C. C., Sorimachi, H., and Labeit, S. (2001) Identification of muscle specific ring finger proteins as potential regulators of the titin kinase domain. J. Mol. Biol. 306, 717-726. References 101

Champagne, M. B., Edwards, K. A., Erickson, H. P., and Kiehart, D. P. (2000) Drosophila stretchin-MLCK is a novel member of the Titin/Myosin light chain kinase family. J. Mol. Biol. 300, 759-777. Chang, S., Kim, J. H., and Shin, J. (2002) p62 forms a ternary complex with PKCζ and PAR-4 and antagonizes PAR-4-induced PKCζ inhibition. FEBS Lett. 510, 57-61. Christinger, H. W., Fug, G., de Vos, A. M., and Wiesmann, C. The crystal structure of placental growth factor in complex with domain 2 of vascular endothelial growth factor receptor-1 (2004) J. Biol. Chem. 279, 10382- 10388. Ciani, B., Layfield, R., Cavey, J. R., Sheppard, P. W., and Searle, M. S. (2003) Structure of the ubiquitin-associated domain of p62 (SQSTM1) and implications for mutations that cause Paget’s disease of bone. J. Biol. Chem. 278, 37409-37412. Claude, J.-B., Suhre, K., Notredame, C., Claverie, J.-M., and Abergel, C. (2004) CaspR: a web server for automated molecular replacement using homology modelling. Nucleic Acids Res. 32, W606-W609. Copieé,V., Tomita, Y., Akiyama, S. K., Aota, S.-i., Yamada, K. M., Venable, R. M., Pastor, R. W., Krueger, S. and Torchia, D. A. (1998) Solution structure and dynamics of linked cell attachment modules of mouse fibronectin containing the RGD and synergy regions: comparison with the human fibronectin crystal structure. J. Mol. Biol. 277, 663-682. Croci, C., Brandstätter,J. H., and Enz, R. (2003) ZIP3, a new splice variant of the PKC-ζ-interacting protein family, binds to GABAC receptors, PKC-ζ, and Kvβ2. J. Biol. Chem. 278, 6128-6135. Dai, K.-S., and Liew, C.-C. (2001) A novel human striated muscle RING zinc finger protein, SMRZ, interacts with SMT3b via its RING domain. J. Biol. Chem. 276, 23992-23999. DeLano, W.L. (2002) The PyMOL Molecular Graphics System, on World Wide Web http://www.pymol.org. Devergne, O., Hummel, M., Koeppen, H., Le Beau, M. M., Nathanson, E. C., Kieff, E., and Birkenbach, M. (1996) A novel interleukin-12 p40-related protein induced by latent Epstein-Barr virus infection in B lymphocytes. J. Virol. 70, 1143-1153. Diaz-Meco, M. T. and Moscat, J. (2001) MEK5, a new target of the atypical protein kinase C isoforms in mitogenic signaling. Mol. Cell. Biol. 21, 1218- 1227. Dieckmann, T., Withers-Ward, E. S., Jarosinski, M. A., Liu, C. F., Chen, I. S., and Feigon, J. (1998) Structure of a human DNA repair protein UBA domain that interacts with HIV-1 Vpr. Nat. Struct. Biol. 12, 1042-1047. Diederichs, K. and Karplus, P. (1997) Improved R-factors for diffraction data analysis in macromolecular crystallography. Nat. Struct. Biol. 4, 269-275. Dimitrov, S., Brennerova, M., and Foreijt, J. (2001) Expression profiles and intergenic structure of head-to-head oriented Brca1 and Nbr1 genes. Gene 262, 89-98. Doolittle, R. F. and Bork, P. (1993) Evolutionarily mobile modules in proteins. Sci. Am. 269, 50-56. 102 References

Drum, C. L., Yan, S. Z., Bard, J., Shen, Y. Q., Lu, D., Soelaiman, S., Grabarek, Z., Bohm, A., and Tang, W. J. (2002) Structural basis for the activation of anthrax adenylyl cyclase exotoxin by calmodulin. Nature 415, 396-402. Edstrom, L., Thornell, L. E., Albo, J., Landin, S., and Samuelsson, M. (1990) Myopathy with respiratory failure and typical myofibrillar lesions. J. Neu- rol. Sci. 96, 211-228. Ellis, C., Moran, M., McCormick, F.,and Pawson, T. (1990) Phosphorylation of GAP and GAP-associated proteins by transforming and mitogenic tyrosine kinases. Nature 343, 377-381. Elshorst, B., Hennig, M., Forsterling, H., Diener, A., Maurer, M., Schulte, P., Schwalbe, H., Griesinger, C., Krebs, J., Schmid, H., Vorherr, T., and Carafoli, E. (1999) NMR solution structure of a complex of calmodulin with a binding peptide of the Ca2+ pump. Biochemistry 38, 12320-12332. Emsley P. and Cowtan K. (2004) Coot: model-building tools for molecular graphics. Acta Cryst. D60, 2126-2132. Erickson, H. P. (1994) Reversible unfolding of fibronectin type III and immunoglobulin domains provides the structural basis for stretch and elasticity of titin and fibronectin. Proc. Natl. Acad. Sci. USA 91, 10114-10118. Faulkner, G., Pallavicini, A., Formentin, E., Comelli, A., Ievolella, C., Trevisan, S., Bortoletto, G., Scannapieco, P., Salamon, M., Mouly, V., Valle, G., and Lanfranchi G. (1999) ZASP: a new Z-band alternatively spliced PDZ-motif protein. J. Cell Biol. 146, 465-475. Faulkner, G., Pallavicini, A., Comelli, A., Salamon, M., Bortoletto, G., Iev- olella, C., Trevisan, S., Kojić,S., Dalla Vecchia, F., Laveder, P., Valle, G., and Lanfranchi, G. (2000) FATZ, a filamin-, actinin-, and telethonin- binding protein of the Z-disc of skeletal muscle. J. Biol. Chem. 275, 41234- 41242. Fong, S., Hamill, S. J., Proctor, M., Freund, S. M. V., Benian, G. M., Chothia, C., Bycroft, M., and Clarke, J. (1996) Structure and stability of an immunoglobulin superfamily domain from twitchin, a muscle protein of the nematode Caenorhabditis elegans. J. Mol. Biol. 264, 624-639. Fraternali, F. and Pastore, A. (1999) Modularity and homology: modelling of the type II module family from titin. J. Mol. Biol. 290, 581-593. Freemont, P. S., Hanson, I. M., and Trowsdale, J. (1991) A novel cystein-rich sequence motif. Cell 64, 483-484. Freemont, P. S. (2000) Ubiquitination: RING for destruction? Curr. Biol. 10, R84-R87. Freiburg, A. and Gautel, M. (1996) A molecular map of the interactions between titin and myosin-binding protein C. Implications for sarcomeric assembly in familial hypertrophic cardiomyopathy. Eur. J. Biochem. 235, 317-323. Freiburg, A., Trombitás,K., Hell, W., Cazorla, O., Fougerousse, F., Centner, T., Kolmerer, B., Witt, C., Beckmann, J. S., Gregorio, C. C., Granzier, H., Labeit, S. (2000) Series of exon-skipping events in the elastic spring region of titin as the structural basis for myofibrillar elastic diversity. Circ. Res. 86, 1114-1121. References 103

Fürst,D. O., Nave, R., Osborn, M., and Weber, K. (1989) Repetitive titin epitopes with a 42 nm spacing coincide in relative position with known A band striations also identified by major myosin-associated proteins. An immunoelectron-microscopical study on myofibrils. J. Cell Sci. 94, 119- 125. Fukuzawa A, Shimamura J, Takemori S, Kanzawa N, Yamaguchi M, Sun P, Maruyama K, Kimura S. (2001) Invertebrate connectin spans as much as 3.5 µm in the giant sarcomeres of crayfish claw muscle. EMBO J. 20, 4826- 4835. Gallagher, P. J. and Herring, B. P. (1991) The carboxyl terminus of the smooth muscle myosin light chain kinase is expressed as an independent protein, telokin. J. Biol. Chem 266, 23945-23952. Gautel, M., Leonard, K., and Labeit, S. (1993) Phosphorylation of KSP motifs in the C-terminal region of titin in differentiating myoblasts. EMBO J. 12, 3827-3834. Gautel, M., Castiglione Morelli, M. A., Pfuhl, M., Motta, A., and Pastore, A. (1995) A calmodulin-binding sequence in the C-terminus of human cardiac titin kinase. Eur. J. Biochem. 230, 752-759. Gautel, M. (1996) The super-repeats of titin/connectin and their interactions: glimpses at sarcomeric assembly. Adv. Biophys. 33, 27-37. Gautel, M., Goulding, D., Bullard, B., Weber, K., and Fürst,D. O. (1996) The central Z-disk region of titin is assembled from a novel repeat in variable copy numbers. J. Cell Sci. 109, 2747-2754. Geetha, T. and Wooten, M. W. (2002) Structure and functional properties of the ubiquitin binding protein p62. FEBS 512, 19-24. Geetha, T. and Wooten, M. W. (2003) Association of the atypical protein kinase C-interacting protein p62/ZIP with the nerve growth factor receptor TrkA regulates receptor trafficking and Erk5 signaling. J. Biol. Chem. 278, 4730- 4739. Geeves, M. A. and Holmes, K. C. (2005) The molecular mechanism of muscle contraction. Adv. Protein Chem. 71, 161-193. Glass, D. J. (2003) Molecular mechanisms modulating muscle mass. Trends Mol. Med. 9, 344-350. Gong, J., Xu, J., Bezanilla, M., van Huizen, R., Derin, R., and Li, M. (1999) Differential stimulation of PKC phosphorylation of potassium channels by ZIP1 and ZIP2. Science 285, 1565-1569. Gotthardt, M., Hammer, R. E., Hubner, N., Monti, J., Witt, C. C., McNabb, M., Richardson, J. A., Granzier, H., Labeit, S., and Herz, J. (2003) Con- ditional expression of mutant M-line titins results in cardiomyopathy with altered sarcomere structure. J. Biol. Chem. 278, 6059-6065. Gräter,F., Shen, J., Jiang, H., Gautel, M., and Grubmüller,H. (2005) Me- chanically induced titin kinase activation studied by force-probe molecular dynamics simulations. Biophys. J. 88, 790-804. Granzier, H. and Labeit, S. (2002) Cardiac titin: an adjustable multi-functional spring. J. Physiol. 541, 335-342. 104 References

Granzier, H. L. and Labeit, S. (2004) The giant protein titin. A major player in myocardial mechanics, signaling, and disease. Circ. Res. 94, 284-295. Granzier, H. L. and Labeit, S. (2005) Titin and its associated proteins: the third myofilament system of the sarcomere. Adv. Protein Chem. 71, 89-119. Greaser, M. (2001) Identification of new repeating motifs in titin. Proteins 43, 145-149. Gregorio, C. C., Trombitás,K., Centner, T., Kolmerer, B., Stier, G., Kunke, K., Suzuki, K., Obermayr, F., Herrmann, B., Granzier, H., Sorimachi, H., and Labeit, S. (1998) The NH2 terminus of titin spans the Z-disc: its interaction with a novel 19-kD ligand (T-cap) is required for sarcomeric integrity. J. Cell Biol. 143, 1013-1027. Gregorio, C. C., Granzier, H., Sorimachi, H., and Labeit, S. (1999) Muscle assembly: a titanic achievement? Curr. Opin. Cell Biol. 11, 18-25. SWISS-MODEL and the Swiss-PdbViewer: An environment for comparative protein modeling. Electrophoresis 18, 2714-2723. Hakeda, S., Endo, S., and Saigo, K. (2000) Requirements of Kettin, a giant muscle protein highly conserved in overall structure in evolution, for normal muscle function, viability, and flight activity of Drosophila. J. Cell Biol. 148, 101-114. Halaby, D. M., Poupon, A., and Mornon, J. (1999) The immunoglobulin fold family: sequence analysis and 3D structure comparisons. Protein Eng. 12, 563-571. Hamada, T. Hirota, H. Hayashi, and F. Yokoyama, S. (2004) Solution structure of RSGI RUH-024, a PB1 domain in human cDNA, KIAA0049. To be published. Harpaz, Y., and Chothia, C. (1994) Many of the immunoglobulin superfamily domains in cell adhesion molecules and surface receptors belong to a new structural set which is close to that containing variable domains. J. Mol. Biol. 238, 528-539. Heierhorst, J., Probst, W. C., Kohanski, R. A., Buku, A., and Weiss, K. R. (1995) Phoshporylation of myosin regulatory light chains by the molluscan twitchin kinase. Eur. J. Biochem. 233, 426-431. Heierhorst, J., Kobe, B., Feil, S. C., Parker, M. W., Benian, G. M., Weiss, K. R., and Kemp, B. E. (1996a) Ca2+/S100 regulation of giant protein kinases. Nature 380, 636-639. Heierhorst, J., Tang, X., Lei, J., Probst, W. C., Weiss, K. R., Kemp, B. E., and Benian, G. M. (1996b) Substrate specificity and inhibitor sensitivity of Ca2+/S100-dependent twitchin kinases. Eur. J. Biochem. 242, 454-459. Hendrickson, W. A., Horton, J. R., and LeMaster, D. M. (1990) Selenome- thionyl proteins produced for analysis by multiwavelength anomalous diffraction (MAD): a vehicle for direct determination of three-dimensional structure. EMBO J. 9, 1665-1672. Hirano Y., Yoshinaga S., Ogura K., Yokochi M., Noda Y., Sumimoto H., and Inagaki F. (2004) Solution structure of atypical protein kinase C PB1 domain and its mode of interaction with ZIP/p62 and MEK5. J. Biol. Chem. 279, 31883-31890. References 105

Hirano, Y., Yoshinaga, S., Takeya, R., Suzuki, N. N., Horiuchi, M., Kohjima, M., Sumimoto, H., and Inagaki, F. (2005) Structure of a cell polarity regulator, a complex between aPKC and par6 PB1 domains. J. Biol. Chem. 280, 9653-9661. Hocking, L. J., Lucas, G. J. A., Daroszewska, A., Mangion, J., Olavesen, M., Cundy, T., Nicholson, G. C., Ward, L., Bennett, S. T., Wuyts, W., van Hul, W., and Ralston, S. H. (2002) Domain-specific mutations in the sequestosome 1 (SQSTM1) cause familial and sporadic Paget’s disease. Hum. Mol. Genet. 22, 2735-2739. Hoeflich, K. P. and Ikura, M. (2002) Calmodulin in action: diversity in target recognition and activation mechanism. Cell 108, 739-742. Hofmann, K., and Bucher, P. (1996) The UBA domain: a sequence motif present in multiple enzyme classes of the ubiquitination pathway. Trends Biochem. Sci. 21, 172-173. Holden, H. M., Ito, M., Hartshorne, D. J., and Rayment, I. (1992) X-ray structure determination of telokin, the C-terminal domain of myosin light chain kinase at 2.8 A˚ resolution. J. Mol. Biol. 227, 840-851. Horowits, R., Kempner, E. S., Bisher, M. E., and Podolsky, R. J. (1986) A physiological role for titin and nebulin in skeletal muscle. Nature 323, 160- 164. Hu, S.-H., Parker, M. W., Lei, J. Y., Wilce, M. C. J., Benian, G. M., and Kemp, B. E. (1994) Insights into autoregulation from the crystal structure of twitchin kinase. Nature 369, 581-584. Hunkapiller, T. and Hood, L. (1989) Diversity of the immunoglobulin gene superfamily. Adv. Immunol. 44, 1-63. Huse, M. and Kuriyan, J. (2002) The conformational plasticity of protein kinases. Cell 109, 275-282. Huxley, A. F. and Niedergerke, R. (1954) Structural changes in muscle during contraction; interference microscopy of living muscle fibres. Nature 173, 971-973. Huxley, H. E. and Hanson, J. (1954) Changes in the cross-striations of muscle during contraction and stretch and their structural interpretation. Nature 173, 973-976. Improta, S., Politou, A. S., and Pastore, A. (1996) Immunoglobulin-like modules from titin I-band: extensible components of muscle elasticity. Struc- ture. 4, 323-337. Improta, S., Krueger, J. K., Gautel, M., Atkinson, R. A., Lefèvre, J. F., Moulton, S., Trewhella, J., and Pastore, A. (1998) The assembly of immunoglobulin-like modules in titin: implications for muscle elasticity. J. Mol. Biol. 284, 761-777. Ishii, T., Yanagawa, T., Kawane, T., Yuki, K., Seita, J., Yoshida, H., and Bannai, S. (1996) Murine peritoneal macrophages induce a novel 60-kDa protein with structural similarity to a tyrosine kinase p56lck-associated protein in response to oxidative stress. Biochem. Biophys. Res. Commun. 226, 456-460. 106 References

Ito, M., Dabrowska, R., Guerriero, V. Jr, and Hartshorne, D. J. (1989) Iden- tification in turkey gizzard of an acidic protein related to the C-terminal portion of smooth muscle myosin light chain kinase. J. Biol. Chem. 264, 13971-13974. Ito, T., Matsui, Y., Ago, T., Ota, K., and Sumimoto, H. (2001) Novel modular domain PB1 recognizes PC motif to mediate fuctional protein-protein interactions. EMBO J. 20, 3938-3946. Johnson, L. N., Noble, M. E. M., and Owen, D. J. (1996) Active and inactive protein kinases: structural basis for regulation. Cell 85, 149-158. Johnson, L. N. and O’Reilly, M. (1996) Control by phosphorylation. Curr. Opin. Struct. Biol. 6, 762-769. Jones, T. A., Zou, J. Y., Cowan, S. W., and Kjeldgaard, M. (1991) Improved methods for building protein models in electron density maps and the location of errors in these models. Acta Cryst. A47, 110-119. Kabsch, W. and Sander, C. (1983) Dictionary of protein secondary structure: pattern recognition of hydrogen-bonded and geometrical features. Biopoly- mers 22, 2577-2637. Kabsch, W. (1993) Automatic processing of rotation diffraction data from crystals of initially unknown symmetry and cell constants. J. Appl. Cryst., 26, 795-800. Kamm, K. E. and Stull, J. T. (2001) Dedicated myosin light chain kinases with diverse cellular functions. J. Biol. Chem. 276, 4527-4530. Kedar, V., McDonough, H., Arya, R., Li, H.-H., Rockman, H. A., and Pat- terson, C. (2004) Muscle-specific RING finger 1 is a bona fide ubiquitin ligase that degrades cardiac troponin I. Proc. Natl. Acad. Sci. USA 101, 18125-13140. Kenny, P. A., Liston, E. M., and Higgins, D. G. (1999) Molecular evolution of immunoglobulin and fibronectin domains in titin and related muscle proteins. Gene 232, 11-23. Kleywegt, G. J. and Jones, T. A. (1997) Detecting folding motifs and similarities in protein structures. Methods Enzymol., 277, 525-545. Kobe, B., Heierhorst, J., Feil, S. C., Parker, M. W., Benian, G. M., Weiss, K. R., and Kemp, B. E. (1996) Giant protein kinases: domain interactions and structural basis of autoregulation. EMBO J. 15, 6810-6821. Kojic, S., Medeot, E., Guccione, E., Krmac, H., Zara, I., Martinelli, V., Valle, G., and Faulkner, G. (2004) The Ankrd2 protein, a link between the sarcomere and the nucleus in skeletal muscle. J. Mol. Biol. 339, 313-325. Kolmerer, B., Clayton, J., Benes, V., Allen, T., Ferguson, C., Leonard, K., Weber, U., Knekt, M., Ansorge, W., Labeit, S., and Bullard, B. (2000) Sequence and expression of the kettin gene in Drosophila melanogaster and Caenorhabditis elegans. J. Mol. Biol. 296, 435-448. Kraulis, P. J. (1991) MOLSCRIPT: A program to produce both detailed and schematic plots of protein structure. J. Appl. Cryst. 24, 946-950. Krissinel E. and Henrick K. (2004) Secondary-structure matching (SSM), a new tool for fast protein structure alignment in three dimensions. Acta Cryst. D60, 2256-2268. References 107

Kuribayashi, F., Nunoi, H., Wakamatsu, K., Tsunawaki, S., Sato, K., Ito, T., and Sumimoto, H. (2002) The adaptor protein p40phox as a positive regulator of the superoxide-producing phagocyte oxidase. EMBO J. 21, 6312- 6320. Kurokawa, H., Osawa, M., Kurihara, H., Katayama, N., Tokumitsu, H., Swindells, M. B., Kainosho, M., and Ikura, M. (2001) Target-induced conformational adaptation of calmodulin revealed by the crystal structure of a complex with nematode Ca2+/calmodulin-dependent kinase kinase peptide. J. Mol. Biol. 312, 59-68. Kursula, P. (2004) XDSi: a graphical interface for the data processing program XDS. J. Appl. Cryst. 37, 347-348. Labeit, S., Barlow, D. P., Gautel, M., Gibson, T., Holt, J, Hshieh, C.-L., Francke, U., Leonard, K., Wardale, J., Whiting, A., and Trinick, J. (1990) A regular pattern of two types of 100-residue motif in the sequence of titin. Nature 345, 273-276. Labeit, S., Gautel, M., Lakey, A., and Trinick, J. (1992) Towards a molecular understanding of titin. EMBO J. 11, 1711-1716. Labeit, S. and Kolmerer, B. (1995) Titins: Giant proteins in charge of muscle ultrastructure and elasticity. Science 270, 293-296. Lakey, A., Labeit, S., Gautel, M., Ferguson, C., Barlow, D. P., Leonard, K., and Bullard, B. (1993) Kettin, a large modular protein in the Z-disc of insect. EMBO J. 12, 2863-2871. Lamark, T., Perander, M., Outzen, H., Kristiansen, K., Øvervatn, A., Michaelsen, E., Bjørkøy, G., and Johansen, T. (2003) Interaction codes within the family of mammalian phox and Bem1p domain-containing proteins. J. Biol. Chem. 278 34568-34581. Lange, S., Xiang, F., Yakovenko, A., Vihola, A., Hackman, P., Rostokova, E., Kristensen, J., Brandmeier, B., Franzen, G., Hedberg, B., Gunnarsson, L. G., Hughes, S. M., Marchand, S., Sejersen, T., Richard, I., Edstr¨om,L., Ehler, E., Udd, B., and Gautel, M. (2005a) The kinase domain of titin controls muscle gene expression and protein turnover. Science 308, 1599- 1603. Lange, S., Himmel, M., Auerbach, D., Agarkova, I., Hayess, K., F¨urst,D. O., Perriard, J. C., and Ehler, E. (2005b) Dimerisation of myomesin: implications for the structure of the sarcomeric M-band. J. Mol. Biol. 345, 289-298. Lapouge, K., Smith S. J., Groemping Y., and Rittinger K. (2002) Architecture of the p40-p47-p67phox complex in the resting state of the NADPH oxidase. A central role for p67phox. J. Biol. Chem. 277, 10121-10128. Laskowski, R. A., MacArthur, M. W., Moss, D. S., and Thornton, J. M. (1993) PROCHECK: a program to check the stereochemical quality of protein structures. J. Appl. Cryst. 26, 283-291. Laurin, N., Brown, J. P., Morisette, J., and Raymond, V. (2002) Recurrent mutation of the gene encoding sequestosome 1 (SQSTM1/p62) in Paget disease of bone. Am. J. Hum. Genet. 70, 1582-1588. Lavin, P. T., Knapp, R. C., Malkasian, G., Whitney, C. W., Berek, J. C., and Bast, R. C. Jr (1987) CA 125 for the monitoring of ovarian carcinoma during primary therapy. Obstet. Gynecol. 69, 223-227. 108 References

Lei, J., Tang, X., Chambers, T. C., Pohl, J., and Benian, G. M. (1994) Protein kinase domain of twitchin has protein kinase activity and an autoinhibitory region. J. Biol. Chem. 269, 21078-21085. Leitner, D., Wahl, M., Labudde, D., Krause, G., Diehl, A., Schmieder, P., Pires, J. R., Fossi, M., Wiedemann, U., Leidert, M., and Oschkinat, H. (2005) The solution structure of an N-terminally truncated version of the yeast cdc24p PB1 domain shows a different β-sheet topology. FEBS Lett. 579, 3534-3538. Lesk, A. M. and Chothia, C. (1982) Evolution of proteins formed by beta-sheets. II. The core of the immunoglobulin domains. J. Mol. Biol. 160, 325-342. Li, S., Czubryt, M. P., McAnally, J., Bassel-Duby, R., Richardson, J. A., Wiebel, F. F., Nordheim, A., and Olson, E. N. (2005) Requirement for serum response factor for skeletal muscle growth and maturation revealed by tissue-specific gene deletion in mice. Proc. Natl. Acad. Sci. USA 102, 1082-1087. Linke, W. A. and Granzier, H. (1998) A Spring Tale: New Facts on Titin Elasticity Biophys. J. 75, 2613-2614. Lo Conte, L., Chothia, C., and Janin, J. (1999) The atomic structure of protein- protein recognition sites. J. Mol. Biol. 285, 2177-2198. Lovering, R., Hanson, I. M., Borden, K. L., Martin, S., O’Reilly, N. J., Evan, G. I., Rahman, D., Pappin, D. J., Trowsdale, J., and Freemont, P. S. (1993) Identification and preliminary characterization of a protein motif related to the zinc finger. Proc. Natl. Acad. Sci. USA 90, 2112-2116. Predicting Coled Coils from Protein Sequences, Science 252, 1162-1164. Ma, K., Kan, L., and Wang, K. (2001) Polyproline II helix is a key structural motif of the elastic PEVK segment of titin. Biochemistry 40, 3427-3438. Machado, C. and Andrew, D. J. (2000) D-Titin: a giant protein with dual roles in chromosomes and muscles. J. Cell Biol. 151, 639-651. Marcus, S. L., Winrow, C. J., Capone, J. P., and Rachubinski, R. A. (1996) A p56lck ligand serves as a coactivator of an orphan nuclear hormone receptor. J. Biol. Chem. 271, 27197-27200. Maruyama, K., Matsubara, S., Natori, R., Nonomura, Y., Kimura, S., Ohashi, K., Murakami, F., Handa, S., and Eguchi, G. (1977) Connectin, an elastic protein of muscle: characterization and function. J. Biochem. 82, 317-337. Maruyama, K. (1997) Connectin/titin, giant elastic protein of muscle. FASEB J. 11, 341-345. Masato, T., Numata, T., Katoh, T., Morita, F., and Yazawa. M. (1997) Crosslinking of telokin to chicken gizzard smooth muscle myosin. J. Biochem. (Tokyo) 121, 225-230. Matthews, B. W. (1968) Solvent content of protein crystals. J. Mol. Biol. 33, 491-497. Mayans, O., van der Ven, P. F. M., Wilm, M., Mues, A., Young, P., Fürst,D., Wilmanns, M., and Gautel, M. (1998) Structural basis for the activation of the titin kinase domain during myofibrillogenesis. Nature, 395, 863-869. Mayans, O. and Wilmanns, M. (1999) X-ray analysis of protein crystals with thin-plate morphology. J. Synchrotron Rad. 6, 1016-1020. References 109

Mayans, O., Würges,J., Canela, S., Gautel, M., and Wilmanns, M. (2001) Structural evidence for a possible role of reversible disulphide bridge formation in the elasticity of the muscle protein titin. Structure (Camb). 9, 331-340. McCoy, A. J., Grosse-Kunstleve, R. W., Storoni, L. C., and Read, R. J. (2005) Likelihood-enhanced fast translation functions. Acta Cryst. D61, 458-464. McElhinny, A. S., Kakinuma, K., Sorimachi, H., Labeit, S., and Gregorio, C. C. (2002) Muscle-specific RING finger-1 interacts with titin to regulate sarcomeric M-line and thick filament structure and may have nuclear functions via its interaction with glucocorticoid modulatory element binding protein-1. J. Cell Biol. 157, 125-136. McElhinny, A. S., Perry, C. N., Witt, C. C., Labeit, S., and Gregorio, C. C. (2004) Muscle-specific RING finger-2 (MURF-2) is important for microtubule, intermediate filament and sarcomeric M-line maintenance in striated muscle development. J. Cell Sci. 117, 3175-3188. Meador, W. E., Means, A. R., and Quiocho, F. A. (1992) Target enzyme recognition by calmodulin: 2.4 A˚ structure of a calmodulin-peptide complex. Science 257, 1251-1255. Meador, W. E., Means, A. R., and Quiocho, F. A. (1993) Modulation of calmodulin plasticity in molecular recognition on the basis of X-ray structures. Science 262, 1718-1721. Merrit, E. A. and Bacon, D. J. (1997) Raster3D: Photorealistic molecular graphics. Meth. Enzymol. 277, 505524. Miller, M. K., Bang, M. L., Witt, C. C., Labeit, D., Trombitás,C., Watanabe, K., Granzier, H., McElhinny, A. S., Gregorio, C. C., and Labeit, S. (2003) The muscle ankyrin repeat proteins: CARP, ankrd2/Arpp and DARP as a family of titin filament-based stress response molecules. J. Mol. Biol. 333, 951-964. Miller, M. K., Granzier, H., Ehler, E., and Gregorio, C. C. (2004) The sensitive giant: the role of titin-based stretch sensing complexes in the heart. TiCB 14, 119-126. Moscat, J. and Diaz-Meco, M. T. (2000) The atypical portein kinase C’s. EMBO Reports 1, 399-403. Mues, A., van der Ven, P. F. M., Young, P., Fürst,D. O., and Gautel, M. (1998) Two immunoglobulin-like domains of the Z-disc portion of titin interact in a conformation-dependent way with telethonin. FEBS Lett. 428, 111-114. Muhle-Goll, C., Pastore, A., and Nilges, M. (1998) The three-dimensional structure of a type I module from titin: a prototype of intracellular fibronectin type III domains. Structure 6, 1291-1302. Murshudov, G. N., Vagin, A. A., and Dodson, E. J. (1997) Refinement of macromolecular structures by the maximum-likelihood method. Acta Cryst. D53, 240-255. Nakamura, R., Sumimoto, H., Mizuki, K., Hata, K., Ago, T., Kitajima, S., Takeshige, K., Sakaki, Y., and Ito, T. (1998) The PC motif: a novel and evolutionarily conserved sequence involved in interaction between p40phox and p67phox, SH3 domain-containing cytosolic factors of the phagocyte NADPH oxidase. Eur. J. Biochem. 251, 583-589. 110 References

Nakamura, K. and Johnson, G. L. (2003) PB1 domains of MEKK2 and MEKK3 interact with the MEK5 PB1 domain for activation of the ERK5 pathway. J. Biol. Chem. 278, 36989-36992. Navaza, J. (2001) Implementation of molecular replacement in AMoRe. Acta Cryst. D57, 1367-1372. Nave, R., Fürst,D. O., and Weber, K. (1989) Visualization of the polarity of isolated titin molecules: a single globular head on a long thin rod as the M band anchoring domain? J. Cell Biol. 109, 2177-2187. Nicholls, A., Sharp, K. and Honig, B. (1991) Protein folding and association: insights from the interfacial and thermodynamic properties of hydrocarbons. Proteins 11, 281-296. Noda, Y., Kohjima, M., Izaki, T., Ota, K., Yoshinaga, S., Inagaki, F., Ito, T., and Sumimoto, H. (2003) Molecular recognition in dimerization between PB1 domains. J. Biol. Chem. 278, 43516-43524. Nomura, N., Nagase, T., Miyajima, N., Sazuka, T., Tanaka, A., Sato, S., Seki, N., Kawarabayashi, Y., Ishikawa, K., and Tabata, S. (1994) Prediction of the coding sequences of the unidentified human genes. II. The coding sequences of 40 new genes (KIAA0041-KIAA0080) deduced by analysis of cDNA clones from human cell line KG-1. DNA Res. 1, 223-229. Notredame, C., Higgins, D., and Heringa, J. (2000) T-Coffee: a novel method for fast and accurate multiple sequence alignment. J. Mol. Biol. 302, 205- 217. Obermann, W. M. J., Gautel, M., Steiner, F., van der Ven, P. F. M., Weber, K., and Fürst,D. O. (1996) The structure of the sarcomeric M band: localization of defined domains of myomesin, M-protein, and the 250-kD carboxy-terminal region of titin by immunoelectron microscopy. J. Cell Biol. 134, 1441-1453. Obermann, W. M. J., Gautel, M., Weber, K., and Fürst,D. O. (1997) Molecular structure of the sarcomeric M band: mapping of titin and myosin binding domains in myomesin and the identification of a potential regulatory phosphorylation site in myomesin. EMBO J. 16, 211-220. Ohno, S. (2001) Intercellular junctions and cellular polarity: the PAR-aPKC complex, a conserved core cassette playing fundamental roles in cell polarity. Curr. Opin. Cell Biol. 13, 641-648. Okazaki, M., Ito, S., Kawakita, K., Takeshita, S., Kawai, S., Makishima, F., Oda, H., and Kakinuma, A. (1999) Cloning, Expression Profile, and ge- nomic organization of the mouse STAP/A170 gene. Genomics 60, 87-95. Olson, N. J., Pearson, R. B., Needleman, D. S., Hurwitz, M. Y., Kemp, B. E., and Means, A. R. (1990) Regulatory and structural motifs of chicken gizzard myosin light chain kinase. Proc. Natl. Acad. Sci. USA 87, 2284- 2288. Otwinowski, Z. and Minor, W. (1997) Processing of X-ray diffraction data collected in oscillation mode. Methods Enzymol. 276, 307-326. Park, I., Chung, J., Walsh, C. T., Yun, Y., Strominger, J. L., and Shin, J. (1995) Phosphotyrosine-independent binding of a 62-kDa protein to the src homology 2 (SH2) domain of p56lck and its regulation by phosphorylation of Ser-59 in the lck unique N-terminal region. Proc. Natl. Acad. Sci. USA 92, 12338-12342. References 111

Perrakis, A., Morris, R., and Lamzin, V. S. (1999) Automated protein model building combined with iterative structure refinement. Nat. Struct. Biol. 6, 458-463. Pfuhl, M. and Pastore, A. (1995) Tertiary structure of an immunoglobulin-like domain from the giant muscle protein titin: a new member of the I set. Structure 3, 391-401. Pizon, V., Iakovenko, A., van der Ven, P. F. M., Kelly, R., Fatu, C., Fürst,D. O., Karsenti, E., and Gautel, M. (2002) Transient association of titin and myosin with microtubules in nascent myofibrils directed by the MURF2 RING-finger protein. J. Cell Sci. 115, 4469-4482. Politou, A. S., Gautel, M., Improta, S., Vangelista, L., and Pastore, A. (1996) The elastic I-band region of titin is assembled in a ”modular” fashion by weakly interacting Ig-like domains. J. Mol. Biol. 255, 604-616. Ponting, C. (1996) Novel domains in NADPH oxidase subunits, sorting nexins, and PtdIns 3-kinases: Binding partners of SH3 domains? Protein Science 5, 2352-2357. Ponting, C. P., Blake, D. J., Davies, K. E., Kendrick-Jones, J., and Winder, S. J. (1996) ZZ and TAZ: new pupative zinc fingers in dystrophin and other proteins. Trends Biochem. Sci. 21, 11-13. Ponting, C. P., Ito, T., Moscat, J., Diaz-Meco, M.T., Inagaki, F., and Sumi- moto, H. (2002) OPR, PC, AID: all in the PB1 family. Trends Biochem. Sci. 27, 10. Pridgeon, J. W., Geetha, T., and Wooten, M. W. (2003) A method to identify p62’s UBA domain interacting proteins. Biol. Proc. Online 5, 228-237. Puls, A., Schmidt, S., Grawe, F., and Stabel, S. (1997) Interaction of the protein kinase Cζ with ZIP, a novel protein kinase C-binding protein. Proc. Natl. Acad. Sci. USA 94, 6191-6196. Ramachandran, G. N., Ramakrishnan, C. and Sasisekharan, V. (1963) Stereo- chemistry of polypeptide chain configurations. J. Mol. Biol. 7, 95-99. Rechsteiner, M. and Rogers, S. W. (1996) PEST sequences and regulation by proteolysis. Trends Biochem. Sci. 21, 267-271. Richardson, J. S. (1981) The anatomy and taxonomy of protein structures. Adv. Protein Chem. 34, 176-339. Rost, B. and Sander, C. (1993) Prediction of protein secondary structure at better than 70% accuracy. J. Mol. Biol. 232, 584-599. Ryu, S.-E., Kwong, P. D., Truneh, A., Porter, T. G., Arthos, J., Rosenberg, M., Dai, X., Xuong, N.-H., Axel, R., Sweet, R. W., and Hendrickson, W. A. (1990) Crystal structure of an HIV-binding recombinant fragment of human CD4. Nature 348, 419-426. Sali, A. and Blundell, T. L. (1993) Comparative protein modelling by satisfac- tion of spatial restraints. J. Mol. Biol., 234, 779-815. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular cloning: A laboratory manual. Cold Spring Harbor Laboratory Press. 112 References

Sanz, L., Sanchez, P., Lallena, M.-J., Diaz-Meco, M. T., and Moscat, J. (1999) The interaction of p62 with RIP links the atypical PKCs to NF-κB activation. EMBO J. 18, 3044-3053. Sanz, L., Diaz-Meco, M. T., Nakano, H., and Moscat, J. (2000) The atypical PKC-interacting protein p62 channels NF-κB activation by the IL-1- TRAF6 pathway. EMBO J. 19, 1576-1586. Saurin, A. J., Borden, K. L. B., Boddy, M. N., and Freemont, P. S. (1996) Does this have a familiar RING? Trends Biochem. Sci. 21, 208-214. Schultz, J., Milpetz F., Bork P., and Ponting C. P. (1998) SMART, a simple modular architecture research tool: identification of signaling domains. Proc. Natl. Acad. Sci. USA 95, 5857-5864. Schumacher, M. A., Rivard, A. F., Bachinger, H. P., and Adelman, J. P. (2001) Structure of the gating domain of a Ca2+-activated K+ channel complexed with Ca2+/calmodulin. Nature 410, 1120-1124. Schroeter, J. P., Bretaudiere, J. P., Sass, R. L., and Goldstein, M. A. (1996) Three-dimensional structure of the Z band in a normal mammalian skeletal muscle. J. Cell Biol. 133, 571-583. Seibenhener, M. L., Babu, J. R., Geetha, T., Wong, H. C., Krishna, N. R., and Wooten, M. W. (2004) Sequestosome 1/p62 is a polyubiquitin chain binding protein involved in ubiquitin proteasome degradation. Mol. Cell. Biol. 24, 8055-8068. Shin, J. (1998) P62 and the sequestosome, a novel mechanism for protein metabolism. Arch. Pharm. Res. 21, 629-33. Shirinsky, V. P., Vorotnikov, A. V., Birukov, K. G., Nanaev, A. K., Collinge, M., Lukas, T. J., Sellers, J. R., Watterson, D. M. (1993) A kinase-related protein stabilizes unphosphorylated smooth muscle myosin minifilaments in the presence of ATP. J. Biol. Chem. 268, 16578-16583. Smith, D. K. and Xue, H. (1997) Sequence Profiles of Immunoglobulin and Immunoglobulin-like Domains. J. Mol. Biol. 274, 530-545. Sobieszek, A., Andruchov, O. Y., Grabarek, Z., Kulikova, N., Liebetrau, C., and Matusovsky, O. S. (2005) Modulation of myosin filament activation by telokin in smooth muscle Liberation of myosin kinase and phosphatase from supramolecular complexes. Biophys. Chem., 113, 25-40. Sorimachi, H., Freiburg, A., Kolmerer, B., Ishiura, S., Stier, G., Gregorio, C. C., Labeit, D., Linke, W. A., Suzuki, K., and Labeit, S. (1997) Tissue- specific expression and alpha-actinin binding properties of the Z-disc titin: implications for the nature of vertebrate Z-discs. J. Mol. Biol. 270, 688- 695. Spencer, J. A., Eliazer, S., Ilaria, R. L., Richardson, J. A., and Olson, E. N. (2000) Regulation of microtubule dynamics and myogenic differentiation by MURF, a striated muscle RING-finger protein. J. Cell Biol. 150, 771-784. Spitzfaden, C., Grant, R. P., Mardon, H. J., and Campbell, I. D. (1997) Module- module interactions in the cell binding region of fibronectin: stability, flexibility and specificity. J. Mol. Biol. 265, 565-579. Squire, J. M. (1997) Architecture and function in the muscle sarcomere. Curr. Opin. Struct. Biol. 7, 247-257. References 113

Srinivasan, M. and Roeske, R. W. (2005) Immunomodulatory peptides from IgSF proteins: a review. Curr. Protein and Peptide Science 6, 185-196. Starovasnik, M. A., Christinger, H. W., Wiesmann, C., Champe, M. A., de Vos, A. M., and Skelton, N. J. (1999) Solution structure of the VEGF-binding domain of flt-1: comparison of its free and bound state J. Mol. Biol. 293, 531-544. Storoni, L. C., McCoy, A. J. and Read, R. J. (2004) Likelihood-enhanced fast- rotation functions. Acta Cryst. D60, 432-438. Stryer, L. Biochemie (1996) Heidelberg, Berlin: Spektrum Akademischer Ver- lag. Sudo, T., Maruyama, M., and Osada, H. (2000) p62 functions as a p38 MAP kinase regulator. Biochem. Biophys. Res. Commun. 269, 521-525. Terasawa, H., Noda, Y., Ito, T., Hatanaka, H., Ichikawa, S., Ogura, K., Sum- imoto, H., and Inagaki, F. (2001) Structure and ligand recognition of the PB1 domain: a novel protein module binding to the PC motif. EMBO J. 20, 3947-3956. Terwilliger, T. C. and Berendzen, J. (1999) Automated structure solution for MIR and MAD. Acta Cryst. D55 849-861. Terwilliger, T. C. (2003) SOLVE and RESOLVE: automated structure solution and density modification. Methods Enzymol. 374, 22-37. Trakhanov, S., and Quiocho, F. A. (1995) Influence of divalent cations in protein crystallization. Protein Science 4, 1914-1919. Trakhanov, S., Kreimer, D. I., Parkin, S., Ferro-Luzzi Ames, G., and Rupp, B. (1998) Cadmium-induced crystallization of proteins: II. Crystallization of the Salmonella typhimurium histidine-binding protein in complex with L-histidine, L-arginine, or L-lysine. Protein Science 7, 600-604. Trinick, J., Knight, P., and Whiting, A. (1984) Purification and properties of native titin. J. Mol. Biol. 180, 331-356. Trinick, J. (1996) Cytoskeleton: titin as a scaffold and spring. Curr. Biol. 6, 258-260. Trinick, J. and Tskhorebova, L. (1999) Titin: a molecular control freak. Trends Cell Biol. 9, 377-380. Trombitás,K., Wu, Y., Labeit, D., Labeit, S., and Granzier, H. (2001) Cardiac titin isoforms are coexpressed in the half-sarcomere and extend independently. Am. J. Physiol. Heart Circ. Physiol. 281, H1793-1799. Tskhovrebova, L. and Trinick, J. (2003) Titin: properties and family relation- ships. Nat. Rev. Mol. Cell. Biol. 4, 679-689. Tskhovrebova, L. and Trinick, J. (2004) Porperties of titin immunoglobulin and fibronectin-3 domains. J. Biol. Chem. 279, 46351-46354. Vadlamudi, R. K., Joung I., Strominger J. L., and Shin J. (1996) p62, a phosphotyrosine-independent ligand of the SH2 domain of p56lck, belongs to a new class of ubiquitin-binding proteins. J. Biol. Chem. 271, 20235- 20237. 114 References

Van Duyne, G. D., Standaert, R. F., Karplus, P. A., Schreiber, S. L., and Clardy, J. (1993) Atomic structures of the human immunophilin FKBP-12 complexes with FK506 and rapamycin. J. Mol. Biol. 229, 105-124. Vagin, A. and Teplyakov, A. (1997) MOLREP: an automated program for molecular replacement. J. Appl. Cryst. 30, 1022-1025. Vetter, S. and Leclerc, E. (2003) Novel aspects of calmodulin target recognition and activation. Eur. J. Biochem. 270, 404-414. Walker, L. A., MacDonald, J. A., Liu, X., Nakamoto, R. K., Haystead, T. A., Somlyo, A. V., and Somlyo, A. P. (2001) Site-specific phosphorylation and point mutations of telokin modulate its Ca2+-desensitizing effect in smooth muscle. J. Biol. Chem. 276, 24519-24524. Wang, K., McClure, J., and Tu, A. (1979) Titin: major myofibrillar components of striated muscle. Proc. Natl. Acad. Sci. USA 76, 3698-3702. Wang, J., Yan, Y., Garrett, T. P. J., Liu, J., Rodgers, D. W., Garlick, R. L., Tarr, G. E., Husain, Y., Reinherz, E. L., and Harrison, S. C. (1990) Atomic structure of a fragment of human CD4 containing two immunoglobulin-like domains. Nature 348, 411-418. Whitehouse, C., Chambers, J., Howe, K., Cobourne, M., Sharpe, P., and Solomon, E. (2002) NBR1 interacts with fasciculation and elongation protein zeta-1 (FEZ-1) and calcium and integrin binding protein (CIB) and shows developmentally restricted expression in the neural tube. Eur. J. Biochem. 269, 538-545. Whiting, A., Wardale, J., and Trinick, J. (1989) Does titin regulate the length of muscle thick filaments? J. Mol. Biol. 205,263-268. Wiesmann, C., Fuh, G., Christinger, H. W., Eigenbrot, C., Wells, J. A., and de Vos, A. M. (1997) Crystal structure at 1.7 A˚ resolution of VEGF in complex with domain 2 of the flt-1 receptor Cell 91, 695-704. Williams, A. F., and Barclay, A. N. (1988) The immunoglobulin superfamily- domains for cell surface recognition. Ann. Rev. Immunol. 6, 381-405. Wilmanns, M., Gautel, M., and Mayans, O. (2000) Activation of calcium/calmodulin regulated kinases. Cell. Mol. Biol. 46, 883-894. Wilson, M. I., Gill, D. J., Perisic, O., Quinn, M. T., and Williams, R. L. (2003) PB1 Domain-Mediated Heterodimerization in NADPH Oxidase and Signaling Complexes of Atypical Protein Kinase C with Par6 and p62. Mol. Cell 12, 39-50. Witt, C. C., Olivieri, N., Centner, T., Kolmerer, B., Millevoi, S., Morell, J., Labeit, D., Labeit, S., Jockusch, H., and Pastore A. (1998) A survey of the primary structure and the interspecies conservation of I-band titin’s elastic elements in vertebrates. J. Struct. Biol. 122, 206-215. Witt, S. H., Granzier, H., Witt, C. C., and Labeit, S. (2005) MURF-1 and MURF-2 target a specific subset of myofibrillar proteins redundantly: towards understanding MURF-dependent muscle ubiquitination. J. Mol. Biol. 350, 713-722. Xia, H., Winokur, S. T., Kuo, W. L., Altherr, M. R. and Bredt, D. S. (1997) Actinin-associated LIM protein: identification of a domain interaction between PDZ and spectrin-like repeat motifs. J. Cell Biol. 139, 507-515. References 115

Yin, B. W., and Lloyd, K. O. (2001) Molecular cloning of the CA125 ovarian cancer antigen: identiﬁcation as a new mucin, MUC16. J. Biol. Chem. 276, 27371-27375. Yoshinaga, S., Kohjima, M., Ogura, K., Yokochi, M., Takeya, R., Ito, T., Sum- imoto, H., and Inagaki, F. (2003) The PB1 domain and the PC motif- containing region are structurally similar protein binding modules. EMBO J. 22, 4888-4897. Zhang, Y., Featherstone, D., Davis, W., Rushton, E., and Broadie, K. (2000) Drosophila D-titin is required for myoblast fusion and skeletal muscle striation. J. Cell Sci. 113, 3103-3115. Zou, P., Pinotsis, N., Lange, S., Song, Y.-H., Popov, A., Mavridis, I., Mayans, O., Gautel, M., and Wilmanns, M. (2006) Palindromic assembly of the giant muscle protein titin in the sarcomeric Z-disk. Nature 439, 229-233.

117

Acknowledgements

I thank Matthias Wilmanns for giving me the chance to work on this project in such a stimulating research atmosphere and for providing the opportunity to attend excellent conferences and courses.

I would like to thank Wolfram Welte for accompanying me all the years, and particularly for his enthusiasm to discuss problems and his great interest towards my work.

I thank Manfred Weiss and Angel Nebreda for joining my thesis advisory com- mittee and for providing helpful advice.

My collaboration partners Stephan Lange and Mathias Gautel triggered the work on the signalling pathway by sharing their exciting results prior to publi- cation with me. Many thanks also for the stimulating cooperation on MURF-1 and titin!

I owe many thanks to Inari Kursula and Santosh Panjikar who both taught me a lot about data collection and crystallography. Fortunately, they always had a solution for my urgent problems.

I am very grateful to Katja Schirwitz, Ela Nowak and Orsolya Barab´asfor their friendship, encouragement, discussions and very valuable day-to-day help in the lab. Thanks a lot also for the nice time we spent together on trips and conferences!

Many thanks to all colleagues and members of the lab who supported this work with advice and discussion, and with always providing new ideas. Especially, I would like to thank Peijian Zou, Anni Linden, Rajesh Singh, Arie Geerlof, Matthew Groves, Simon Holton, and Larissa Textor-Consani for their help and their constructive suggestions to improve this thesis.

Nikos Pinotsis and Cris Vega are acknowledged for kindly providing their unpublished structures.

I am very grateful to my good friend Nicole Jenczmionka, not only for a very careful revision of the language but also for many nice activities together with Volker.

In particular, my parents, my sister and brother are thanked for their continuous support and care. 118

I owe my greatest thanks to Sven for his love, his encouragements and last but not least, his patient support to considerably improve this thesis.