sign in sign up
<<
Home , Taurine

Proc. Natl. Acad. Sci. USA Vol. 89, pp. 12145-12149, December 1992 Biochemistry Cloning and expression of a cDNA encoding the transporter of taurine and /8- in mouse brain (/membrane protein/moecular cloning) QING-RONG Liu, BEATRIZ L6PEZ-CORCUERA, HANNAH NELSON, SREEKALA MANDIYAN, AND NATHAN NELSON* Roche Institute of Molecular Biology, Roche Research Center, Nutley, NJ 07110 Communicated by Leon A. Heppel, September 8, 1992 (receivedfor review July 30, 1992)

ABSTRACT A taurine/fl-alanine transporter was cloned induced an increase in chloride permeability of from a mouse brain cDNA library by screening with a partial the cellular membranes (16, 17). Responses to all of those cDNA probe of the transporter at low stringency. The substances were blocked by external , indicating deduced sequence predicts 590 amino acids with that they interacted with the same system. However, no typical characteristics of the -dependent neurotrans- specific receptors for taurine or f-alanine could be identified. mitter transporters such as sequence homology and membrane Moreover, /3-alanine and taurine uptake systems could be topography. However, the calculated isoelectric point of the shared by other neurotransmitters. It was reported that a taurine/fi-alanine transporter is more acidic (pI = 5.98) than low-affinity GABA transporter accumulates taurine and those (pI > 8.0) ofother cloned transporters. f3-alanine (18). The taurine transporter takes up /3-alanine Xenopus oocytes Injected with cRNA of the cloned transporter with high efficiency in neuronal and astroglial cells in culture. expressed uptake activities with K. = 4.5 FM for taurine and In this communication we report on the cloning and expres- K. = 56 FM for (3-alanine. Northern hybridization showed a sion of a cDNA encoding a sodium-dependent high-affinity single transcript of 7.5 kil9bases that was highly enriched in taurine and (3-alanine transporter.t kidney and distributed evenly in various parts of the brain. In situ hybridization showed the mRNA of the taurine/(3-alanine transporter to be localized in the corpus callosum, , EXPERIMENTAL PROCEDURES and anterior commisure. Specific localization ofthe taurine/p- Cloning and Sequencing. A mouse neonatal brain cDNA alanine transporter in mouse brain suggests a- potential func- library in the Uni-Zap vector (Stratagene) was screened at tion for taurine and (3-alanine as neurotransmitters. low stringency with a 1-kilobase (kb) cDNA fragment starting at the N terminus of the clone (19, 20). Taurine is one of the most abundant amino acids in brain (1). Hybridization was performed at 420C with Denhardt's solu- Free taurine is found at millimolar concentrations in excitable tion containing 50% (vol/vol) formamide and 10% (wt/vol) tissues, especially those which generate oxidants (2). Taurine dextran sulfate, and washing was at 420C with standard saline is supplied to mammalian brain and other tissues by citrate containing 0.1% SDS (20). About 106 plaques yielded metabolism and diet. It was reported that taurine is taken up 56 positive clones from which the pBluescript plasmid (Strat- into cells by two transport systems: a low-affinity (Km of agene) was excised according to the manufacturer's instruc- about 2 mM) but high-capacity uptake system and a high- tions and sequenced with T3 primer by the dideoxynucleotide affinity system (Km of 50-80 AuM) having low capacity for termination method (22). Sequence analysis with the Univer- uptake (3-6). The physiological role of taurine in the central sity of Wisconsin Genetics Computer Group software indi- nervous system remains obscure (7-9). It has been proposed cated that most positive clones encoded either a partial or a that taurine plays a role in osmoregulation in certain brain full-length taurine/f3-alanine transporter. A positive clone cells (9-11). Intraperitoneal administration of distilled water with a 2.6-kb DNA insert was selected for sequencing ofboth elevated the concentration of taurine in dialysates from the strands, using oligonucleotide primers. rat pyriform cortex (12). This could be due to either increased RNA Isolation and Northern Blot Analysis. Total cellular release or inhibited uptake of taurine. Recent attempts to RNA was isolated from mouse liver, kidney, cerebellum, localize the sites of taurine biosynthesis in the brain demon- cerebral cortex, brainstem, and the rest of the brain by using strated immunostains of cysteine sulfonate decarboxylase in an RNA isolation kit from Stratagene. RNA samples (40 ,ug) rows like oligodendrocytes and cells around the Purkinje cells from the various tissues were loaded onto a formaldehyde/ in the cerebellum (7). Activity of the enzyme was also agarose gel. Equal loading of RNA was checked by the same detected in glial cell fractions enriched with oligodendrocytes intensity of ribosomal RNA after ethidium bromide staining and astrocytes. However, the high taurine concentrations in and hybridization with proteolipid cDNA of vacuolar proton brain suggest an important role for transport systems along- ATPase. Northern blot hybridization was carried out at high side the biosynthesis of taurine. Indeed a decreased Km and stringency as described (19, 20). Vmax oftaurine uptake was implicated in retinitis pigmentosa Expression of the Mouse Brain Taurine Transporter in (13, 14). Xenopus Oocytes. cRNA was synthesized from a linearized The function of 3-alanine in is also not NTT9 clone by phage T3 RNA polymerase. Microinjection of clear. It was shown that B3-alanine desensitizes glycine re- Xenopus oocytes and uptake measurement were performed sponses and partially reduces y-aminobutyrate (GABA)- as described (21). If not specified 1 ,uM nonradioactive evoked currents (15). Application of glycine, .3-alanine, or taurine was present in the uptake experiments. taurine onto isolated neurons from rat medulla oblongata and Abbreviation: GABA, -t-aminobutyrate. The publication costs of this article were defrayed in part by page charge *To whom reprint requests should be addressed. payment. This article must therefore be hereby marked "advertisement" tThe sequence reported in this paper has been deposited in the in accordance with 18 U.S.C. §1734 solely to indicate this fact. GenBank data base (accession no. L03292).

12145 Downloaded by guest on September 25, 2021 12146 Biochemistry: Liu et al. Proc. Natl. Acad. Sci. USA 89 (1992)

1 60 In Situ Hybridization. A Kpn I fragment at the 3' end of 61 120 121 CT 180 NTT9 was subcloned into pBluescript and the plasmid was 181 240 subsequently digested with Xho I. The linearized plasmid was A 241 C -7 ;cic 300 used as a template to synthesize the antisense C L K D F K P S P ( [a-35S~thioJ- 301 GGCACACGGCCTGAAGATGAGGCGGACGGGAAGCCCCCTCAGAGGGAGAAGTGGTCCAGC 360 UTP-labeled RNA probe by in vitro transcription from the G T R P E D E A D G X PP Q R E K N S S 361 AAGATCGACTTTGTGCTGTCTGTGGCCGGAGGCTSCGTGGGTTTGGGCAACGTCTGGCGT 420 phage T7 promoter. Paraffin sections of fixed mouse brain K I D F V L S V A G G F V G L G N V W R 421 TTCCCGTACCTCTGCTACAAAAATGGTGGAGGTGCGTTCCTCATACCGTATTTTATTTTC 480 divided into fore, mid, and hind thirds were obtained from F P Y L C Y K N G G G A F L I P Y F I F 481 CTGTTTGGGAGCGGCCTGCCTGTGTTTTTCTTGGAGGTCATCATAGGCCAGTACACATCA 540 Novagene (Madison, WI). Hybridization and autoradiogra- L F G S G L P V F F L E V I I G Q Y T S 541 GAAGGGGGCATCACCTGCTGGGAGAAGATCTGTCCTTTGTTCTCTGGCATTGCGTACGCA 600 phy of the slides were performed according to the manufac- E G G I T C W E K IC P L F S G I A Y A turer's instructions with the SureSite in situ hybridization kit 601 TCCATCGTCATTGTGTCCCTCCTGAACGTGTACTACATCGTCATCCTGGCCTGGGCCACA 660 S I V I V S L L N V Y Y I V I L A W A T (Novagene, Madison, WI). After the emulsion was devel- 661 TACTACCTATTCCACTCTTTCCAGAAGGATCTTCCCTGGGCCCACTGCAACCATAGCTGG 720 Y Y L F H S F Q R D L P W A H C N H S W oped, the hybridized slides were counterstained with hemo- 721 AACACACCACAGTGCATGGAGGACACCCTGCGTAGGAACGAGAGTCACTGGGTCTCCCTT 780 N T P Q C M E D T L R R N E S R W V S L toxylin and eosin. The positive and negative controls were 781 AGCACTGCCAACTTCACCTCACCCGTCATCGAGTTCTGGGAGCGCAATGTGCTCAGCCTG 840 S T A N F T S P V I E F W E RN V L S L performed by using testis-specific probe hybridized with 841 TCCTCCGGAATCGACAACCCAGGCAGTCTGAAATGGGACCTCGCGCTCTGCCTCCTCTTA 900 S S G I D N P G S L K W D L A L C L LL testis and brain slices, respectively. 901 GTCTGGCTCGTCTGTTTTTTCTGCATCTGGAAGGGTGTTCGATCCACAGGCAAGGTTGTC 960 V W L V C F F C I N K G V R S T G R V V 961 TACTTCACCGCTACTTTCCCGTTTGCCACGCTTCTGGTGCTGCTGGTCCGTGGACTGACC 1020 Y F T A T F P F A K L L V L L V R G L T 1021 CTGCCAGGTGCTGGTGAAGGCATCAAATTCTACCTGTACCCTGACATCAGCCGCCTTGGG 1080 RESULTS L P G A G E G I K F Y L Y P D I S R L G 1081 GACCCACAGGT TGGATCGACGCTGGAACTCAGATATTCTTTTCCTACGCAATCTGCCTG 1140 To clone the taurine transporter, a fetal mouse brain cDNA D P Q V W I D A G T Q I F F S Y A I C L 1141 GGGGCCATGACCTCACTGGGAAGCTATAACAAGTACAAGTATAACTcGTACAGGGACTGT 1200 library was screened at low stringency with 32P-labeled G A M S' S L G S Y N K Y K Y N S Y R D C 1201 ATGCTGCTGGGATGCCTGAACAGTGGTACCAGTTTTGTGTCTGGCTTCGCAATTTTTT CC 1260 cDNA encoding the glycine transporter (19). Numerous I L L G C L N S G T S F V S G F A I F S was 1261 ATCCTGGGCTTCATGGCACAAGAGCAAGGGGTGGACATTGCTGATGTGGCTGAGTCAGGT 1320 positive clones were isolated and the pBluescriptplasmid I L G F M A Q E' Q G V D I A -D V A 'E -S G excised and to DNA a T3- 1321 CCTGGCTTGGCCTTCATTGCCTACCCAAAAGCTGTAACCATGATGCCGCTGCCCACCTTT 1380 subjected sequencing using P G L A F I A Y P KA V T M P L P T F 1381 C 1440 promoter oligonucleotide as primer. Two of the clones, ITG.GTCTATTCSGTTTTTCATTASGCTCCTCTTGCTTOSACTGCAGCCAGTTTGTTGAAIG L NTT9 and NTT15, containing a cDNA fragment of 2.5 kb, 1441 GTCGAAGGA TGATCTTTACCCGTCCTTCCTAAGCACGGGTJAT 1500 1 D L Y P ST L R x G Y 1501 4 1560 had sequence homology with the known neurotransmitter GTGTAGCATCAGCTACCTGCTGGGCTG-'VTT C>'u ,TG Il r s Use t t a! T transmitters but were not identical to any of them (21). 1561 GTGRCGGaGGGTGGCATGTATGTGTTT TA 1620 1 Expression of these two clones in Xenopus oocytes revealed 1621 TGCCTTTTGTGI TATATGGCGGTG 1680 1 F v:3 AC that they encoded a high-affinity taurine transporter. Fig. 1681 ;TATTGAGGACATGATTGGCTA1CGGCCC 'AC 1740 N L Y D G I E D shows the nucleotide and deduced amino acid sequences of 1741 AGCTGGGCTGTCATCACTCCAGCI3 CIAG3 1800 The initiator V the taurine transporter (TAUT). predicted 1801 ACCCGATTGGGCAATTGGGCTGGG;CTr 1860 codon is the first codon in the sequence, v which 1861 :TTTCCTCCATGCTGTGTATCCCCTTGGTCATTGTCATCI :GG 1920 also exhibits a strong consensus site for translation initiation v- 1921 ACGGAGGGACCTCCGCGTGAGAATCAA TG3 1980 (23). The open reading frame encodes a protein of 590 amino T E G P P R E N Q TI 1981 GGCT1CTGGAGCGTGAAGGGGCCACACC TCCCGAGTAACCCTCATGAACGGCI'GCC 2040 acids with a calculated molecular mass of 65,878 Da. The GI 2041 ;TTT 2100 hydropathy plot predicts 12 transmembrane helices and a 2101 G 2160 2161 rGTT 2220 large hydrophilic loop between helices 3 and 4. This loop 2221 T 2280 2281 A 2340 contains three potential glycosylation sites. The predicted 2341 SACC 2400 with all other members of the 2401 ACA 2460 structure is superimposable 2461 A 2520 neurotransmitter transporter family (19,21,24-32). The most 2521 2547 unusual feature of the taurine transporter is its calculated FiG. 1. Nucleotide and deduced amino acid sequences of cDNA isoelectric point, estimated to be at pH 5.98. The calculated TAUT. The cDNA isoelectric points of all known of the are encoding the taurine and P-alanine transporter proteins family was cloned from the mouse brain library and both strands sequenced above pH 8. Alignment of the amino acid sequence of the exonuclease III digestion (22) and oligonucleotide primers. taurine transporter with other members of the family showed by using 40%o identity with the glycine transporter (19, 32), 42-46%o the affinity of GAT1 for GABA. The affinity of TAUT for identity with transporters (26-30), 48% iden- p-alanine is close to the published values observed for tity with transporter (31), and 52%6 and 62% identity (-alanine into isolated The effect and GAT2 uptake synaptosomes (34). with the GABA transporters GAT1 respectively of anions and cations on taurine and p-alanine transport is (21, 33). Similar amino acid homologies among taunne, in the that shown in Fig. 3. The presence of sodium ions external glycine, GABA, and catecholamine transporters suggest medium was for ofthe all from a common ancestor and from each necessary uptake activity transporter. evolved diverged Chloride was for taurine and other at approximately the same evolutionary time (21). The required optimal P-alanine uptake, and only bromide was found to be an efficient presence of homologous proteins in Drosophila melano- low that this event replacement for chloride. Nitrate supported relatively gaster and Caenorhabditis elegans suggests activity of the transporter, and the rest of the anions tested took place early in the evolution of the nervous system. with chloride. Since both The function of TAUT was determined by the expression gave 5-10%6 of control activity of its synthetic RNA in Xenopus oocytes. Oocytes injected taurine and (3-alanine are taken up by the same transporter and changes in medium composition similarly affect the with the synthetic RNA ofTAUT accumulated up to 500-fold of more [3H]taurine than control uninjected oocytes or those uptake of both substances, the tissue-specific expression injected with synthetic RNA of the glycine or GABA trans- the transporter should be important for regulating taunne porters. Except for ,-alanine, none of the other anmino acids activity in different locations of the brain. tested had any effect on taurine transport. Xenopus oocytes The pharmacology of TAUT was analyzed with the avail- injected with synthetic TAUT RNA accumulated [3H]- able substances reported to inhibit taurine uptake in brain alanine up to 50-fold over control uninjected oocytes. There- slices and isolated cells. Table 1 depicts the effect of these fore, TAUT transports both taurine and P-alanine. Fig. 2 chemicals and several other substances on taurine uptake shows the kinetics of taurine and ,-alanine transport into into oocytes injected with synthetic cRNA encoding mouse TAUT-injected oocytes. Eadie-Hofstee plots revealed an TAUT. In the presence of2 ,uM taurine, significant inhibition apparent Km of 4.5 ,uM for taurine and 56 p1M for 3-alanine was observed by 100 juM 3-guanidinopropionic acid, L-2,3- uptake. Thus, the affinity ofTAUT for taurine is greater than diaminopropionic acid, or (3-alanine and 5 ;&M . Downloaded by guest on September 25, 2021 Biochemistry: Liu et al. Proc. NatL. Acad. Sci. USA 89 (1992) 12147 Taurine

LU I..

0- Ea.C2 LU s sE E w-CD.-Z -L* = = s z f Iit Z 2 z,go o;0- _a A= - -a I U~~~~~b z z z z FIG. 3. Effect of various anions and cations on taurine and P-alanine uptake by TAUT mRNA-injected Xenopus oocytes. Cal- cium and were eliminated from the assay medium and 10 20 30 40 chloride and sodium were replaced by the indicated cations or anions. Taurine (AM) these transporters (19). Recently it has been reported that transcripts of the glycine transporter are not present in kidney and cerebellum (32). We readily detected high amounts of transcripts in these two tissues (19). These findings were substantiated by cloning and sequencing an identical glycine transporter from the kidney cDNA library b- (unpublished work). The functions ofneurotransmitter trans- e porters in the kidney are not clear, and specific antibodies are CD required to obtain a better understanding of their function. ca Localization of the taurine transporter in mouse brain was EU examined by in situ hybridization of its antisense probe in C= -U brain slices (Fig. 5). In the cerebellum TAUT was identified in the white matter where the Purkinje cell axons go to the E a. deep nuclei. The Purkinje cells were not stained for TAUT RNA. The brainstem and the pontine fibers were heavily stained. Ventral and dorsal cochlear nuclei were positive, as well as the cochlear nerve (data not shown). We also detected TAUT mRNA in the corpus callosum and the anterior commisure. Blood vessels were negative for TAUT RNA. In general, TAUT mRNA was confined to specific locations in 3-alanine (uM) Table 1. Pharmacology of the taurine transporter FIG. 2. Kinetics oftaurine (Upper) and P-alanine (Lower) uptake Addition Conc., AM % control intoXenopus oocytes injected with synthetic RNA ofTAUT. Uptake of [3H]taurine and [3H]P-alanine into cRNA-injected oocytes was None 100 + 13 assayed at indicated concentrations. The oocytes were incubated /3-Guanidinopropionic acid 100 62 ± 11 with the radioactive substances for 30 min at room temperature. Diaminopropionic acid 100 39± 5 Values obtained under similar conditions with uninjected oocytes 500 22 ± 1 were subtracted from corresponding injected samples. Eadie- DL- 100 90 ± 15 Hofstee analysis is depicted in Insets. 500 85 ± 17 Cysteinesulfinic acid 100 90 ± 12 All other substances tested at 100 AM, including GABA, 500 79 ± 10 cysteine, and the rest of the common amino acids, as well as Hypotaurine 2 83 ± 7 carnitine and other candidates for inhibition, had no effect on 10 35 ± 13 taurine uptake. This observation points out the remarkable 20 11 ± 10 specificity of the TAUT transporter, which can transport P-Alanine 50 64 ± 6 taurine, hypotaurine, and P-alanine but none of the other 100 31 ± 15 amino acids. P-tuamdinoethanesuiiomc aacid 10 80 ± 12 Northern blot analysis with RNA isolated from various 50 54 ± 6 parts of the brain revealed a ubiquitously distributed single 100 29 ± 1 transcript of about 7.5 kb (Fig. 4). As there is no polyade- Compounds were tested for their ability to inhibit taurine transport nylylation signal in this cDNA clone, we assume that the as described in the Experimental Procedures. Compounds that did poly(A) stretch is in the middle ofthe 3' nontranslated region not inhibit at a concentration of 100 uM included DL-y-amino-(- ofthe mRNA. Large amounts ofa similar-size transcript were hydroxybutyric acid, y-hydroxybutyric acid, DL-a-hydroxybutyric found in RNA isolated from the kidney. Liver contained a acid, e-aminocaproic acid, 2-mercaptoethylamine (cysteamine), ami- very small but detectable amount of transcript of the same noisobutyric acid, L-anserine, GABA, /3-alanine methyl ester, L-car- nosine, L-cysteic acid, , P-N-methylamino-L-alanine, size. Within the brain the TAUT transcript appeared to be nicotinic acid, 3-aminobenzoic acid ethyl ester, 3-aminocrotonic acid more abundant in the cerebellum and cerebral cortex. Tran- methyl ester, O-phosphoethanolamine, L-vinylglycine (2-amino-3- scripts of some neurotransmitter transporters are readily butenoic acid), L-homocarnosine, chlorpromazine, chloroquine, and detected in the kidney, suggesting additional functions for 3-amino-1-propanesulfonic acid (). Downloaded by guest on September 25, 2021 12148 Biochemistry: Liu et al. Proc. Natl. Acad. Sci. USA 89 (1992)

2 3 4 5 6 evolved from a common ancestor closely related to the current taurine transporter. Expression of TAUT synthetic RNA in Xenopus oocytes induced taurine uptake at relatively high affinity. The affinity of the taurine transporter was greater than that observed for GABA and glycine by their corresponding transporters (19, 21, 24). The Km of 5.6 juM observed with the expressed transporter is close to the value reported for the high-affinity taurine transport activity in brain slices, cultured neurons and astrocytes, and synaptosomes (2, 18, 35). The taurine trans- porter also transports /3-alanine at relatively high affinity, 0 -8 kb ;'m 40 N with a Km of 56 ,uM. This value is also close to the reported affinity for /3-alanine uptake into neurons or astrocytes and synaptosomal preparations (18, 34). Competition between GABA and f-alanine and between taurine and /3-alanine was reported. It was concluded that one of the GABA uptake systems, presumably the glial transporter, transports .3-ala- nine (34). The cloned high-affinity GABA transporter (GAT1) does not transport /-alanine, but the recently cloned GABA transporter (GAT2) transports (3-alanine at very low rates (33). Therefore, it can be concluded that P-alanine transport is shared by both GABA and taurine transport systems. Northern hybridization showed the presence ofTAUT in all brain parts tested and in the kidney. Similar distribution was observed for other amino acid transporters, including GAT1, GAT2, and the glycine transporter (19, 25, 33). In situ hybrid- ization revealed the presence of high levels of TAUT mRNA in specific locations in the brain. The significance of the localized high-affinity taurine transporter is not apparent. Taurine is present at millimolar concentrations in most of the FIG. 4. TAUT mRNA in various tissues. Total RNA was pre- brain. The presence of the transporter may have a dual pared from various mouse brain parts and tissues. About 40 ,ug of function, either to decrease its concentration in certain areas RNA was applied to each well in a standard formaldehyde/agarose or to accumulate taurine at high concentrations in particular gel (20). Relative amounts of RNA in each sample were monitored by cells. amounts of stained rRNA. Lanes: 1, liver; 2, kidney; 3, cerebellum; The physiological role of taurine in the central nervous 4, cerebral cortex; 5, brainstem; 6, the rest of the brain. system is not clear, mainly because it is present in all of the the white matter and was mostly glial. In contrast with the brain tissues at relatively high concentrations (2). Recently, ubiquitous distribution of taurine in the brain, the specific the sites of taurine production in various parts of the brain localization of the taurine transporter may reveal its specific were studied by immunocytochemistry with an antibody function in the various brain parts. Immunocytochemistry against cysteine sulfinate decarboxylase (7). In the cerebel- with specific antibodies against the taurine transporter should lum relatively high concentrations of the enzyme were found in help in the fine localization of the transporter and may reveal the white matter in typical structures of oligodendrocytes, its function in neurotransmission. a few cells in the granular layer, and around the Purkinje cells, presumably in Golgi epithelial cells. It was concluded DISCUSSION that the glial localization of the taurine biosynthetic enzyme does not support its involvement as a neurotransmitter. We have isolated a cDNA clone from a mouse brain library However, due to taurine's abundance in the brain, the sites encoding a high-affinity taurine transporter that also trans- of taurine biosynthesis might not reveal its function. A ports (3-alanine. Structural features of the taurine transporter conventional neurotransmission is based on the synthesis of are virtually identical to those of the other cloned sodium- the neurotransmitter in presynaptic cells, accumulation into dependent neurotransmitter transporters (24-32). A notable synaptic vesicles, quantal release following stimulation, difference is the low isoelectric point, pI = 6, that was binding to a specific in postsynaptic cells, and calculated from the predicted amino acid sequence of the reuptake into the presynaptic cells by a sodium-dependent taurine transporter. Amino acid identity among the various system. However, there may be alternatives for the conven- neurotransmitter transporters sequenced so far is 40-50%o, tional mechanism. For example, the neurotransmission by and among the predicted 12 transmembrane domains only lacks a specific membrane receptor and reuptake domains 1, 2, 5, and 6 are highly conserved. However, only system (36). The 6-sec half-life of nitric oxide presents a about 100 amino acids were totally conserved in all known problem in its function as a neurotransmitter. In its lifetime neurotransmitter transporters, and these residues are scat- nitric oxide may diffuse rapidly to relatively long distances, tered throughout the sequence of the proteins. The proposed in contrast with conventional neurotransmission operating at leucine zipper in the second membrane domain is not con- short distances. The combination of this property and the served in all transporters, and the function of such an amino potential toxicity of nitric oxide should be controlled by acid organization within membrane domains is not known. neutralizing substances in cells that are located near produc- Site-directed mutagenesis may shed light on the function of tion sites of nitric oxide but have to be protected from its the conserved domains in neurotransmitter transporters. toxicity. It was shown that taurine concentrations are high in Recently we isolated cDNA clones encoding four different cells and tissues that produce oxidants and radicals (2, 37, GABA transporters in mouse brain (refs. 21 and 33; and 38), and it protects against radiation damage (39). We propose unpublished work). Analysis of the percent identity of the that taurine may function as a scavenger of nitric oxide in the amino acid sequences of the various GABA transporters and brain, acting as an inhibitory neurotransmitter coupled to the taurine transporter suggested that all of these genes nitric oxide action. Downloaded by guest on September 25, 2021 Biochemistry: Liu et al. Proc. Natl. Acad. Sci. USA 89 (1992) 12149

J. I., it

A ., z,

B

FIG. 5. In situ localization of RNA hybridizing to TAUT syn- thetic antisense RNA of TAUT. Mouse brain sections were hybrid- ized with an 35-labeled synthetic RNA complementary to the 3' nontranslated region of TAUT cDNA. Hybridization with the corresponding "S-labeled sense RNA gave no positive signals. Pic- tures of bright (Left) and dark C A~~~~~A% (Right) fields were taken. (A) Coronal section of corpus cok.. sum. (B) Sagittal section of cere- bellar lobes. (C) Sagittal section of corpus collosum and caudate- putamen. (x45.)

We thank Dr. R. Huxtable for his generous gift of 3-guanidino- 20. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989) Molecular Harbor Lab., Cold ethanosulfonic acid. We thank Dr. Delia I. Lugo and Ms. Ying Qin Cloning: A Laboratory Manual (Cold Spring their with the in situ hybridization. B.L.-C. is a North Spring Harbor, NY), 2nd Ed. for help 21. Liu, Q.-R., Mandiyan, S., Nelson, H. & Nelson, N. (1992) Proc. Atlantic Treaty Organization fellowship recipient. Natl. Acad. Sci. USA 89, 6639-6643. 22. Henikoff, S. (1984) Gene 28, 351-359. 1. Jacobsen, J. G. & Smith, L. H. (1968) Physiol. Rev. 48, 424-511. 23. Kozak, M. (1987) Nucleic Acids Res. 15, 8125-8148. 2. Wright, C. E., Tallan, H. H. & Lin, Y. Y. (1986) Annu. Rev. 24. Gaustelia, J., Nelson, N., Nelson, H., Czyzyk, L., Keynan, S., Biochem. 55, 427-453. Miedel, M. C., Davidson, N., Lester, H. A. & Kanner, B. I. (1990) 3. Rozen, R. & Scriver, C. R. (1982) Proc. Natl. Acad. Sci. USA 79, Science 249, 1303-1306. 2101-2105. 25. Nelson, H., Mandiyan, S. & Nelson, N. (1990) FEBS Lett. 269, 4. Friedman, A., Albright, P. W. & Chesney, R. W. (1981) Life Sci. 181-184. 29, 2415-2419. 26. Pacholczyk, T., Blakely, R. D. & Amara, S. G. (1991) Nature 5. Vessey, D. A. (1978) Biochem. J. 174, 621-626. (London) 350, 350-354. 6. Chesney, R. W., Gusowski, N., Dabbagh, S., Theissen, M., Padilla, 27. Shimada, S., Kitayama, S., Lin, C.-L., Patel, A., Nanthakumar, E., M. & Diehl, A. (1985) Biochim. Biophys. Acta 812, 702-712. Gregor, P., Kuhar, M. & Uhl, G. (1991) Science 254, 576-578. A. & Tappaz, M. (1991) Neuroscience 43, 28. Kilty, J. E., Lorang, D. & Amara, S. G. (1991) Science 254, 7. Almarghini, K., Remy, 578-579. 111-119. 29. Hoffman, B. J., Mezey, E. & Brownstein, M. J. (1991) Science 254, 8. Li, Y.-P. & Lombardini, J. B. (1991) J. Neurochem. 56, 1747-1753. 579-580. 9. Lehmann, A., Carlstrom, C., Nagelhus, E. A. & Ottersen, 0. P. 30. Blakely, R. D., Berson, H. E., Fremeau, R. T., Jr., Caron, M. G., (1991) J. Neurochem. 56, 690-697. Peek, M. M., Prince, H. K. & Bradley, C. C. (1991) Nature (Lon- 10. Huxtable, R. J. & Sebring, L. A. (1986) Trends Pharmacol. Sci. 7, don) 354, 66-69. 481-485. 31. Fremeau, R. T., Jr., Caron, M. G. & Blakely, R. D. (1992) Neuron 11. Huxtable, R. J. (1989) Prog. Neurobiol. 32, 471-533. 8, 915-926. 12. Wade, J. V., Olson, J. P., Samson, F. E., Nelson, S. R. & 32. Smith, K. E., Borden, L. A., Hartig, P. R., Branchek, T. & Wein- Pazdernik, T. L. (1988) J. Neurochem. 51, 740-745. shank, R. L. (1992) Neuron 8, 927-935. 13. Berson, E. L., Schmidt, S. Y. & Rabin, A. R. (1976) Br. J. Oph- 33. L6pez-Corcuera, B., Liu, Q.-R., Mandiyan, S., Nelson, H. & thalmol. 60, 142-147. Nelson, N. (1992) J. Biol. Chem. 267, 17491-17493. 14. Airaksinen, E. M., Oja, S. S., Marnela, K. M. & Sihvola, P. (1980) 34. Kanner, B. I. & Bendahan, A. (1990) Proc. Natd. Acad. Sci. USA Ann. Clin. Res. 12, 52-54. 87, 2550-2554. 15. Choquet, D. & Korm, H. (1988) Neurosci. Lett. 84, 329-334. 35. Schmid, R., Sieghart, W. & Karobath, M. (1975) J. Neurochem. 25, 16. Krishtal, 0. A., Osipchuk, Y. V. & Vrublevsky, S. V. (1988) Neu- 5-9. rosci. Lett. 84, 271-276. 36. Bredt, D. S., Hwang, P. M. & Snyder, S. H. (1990) Nature (Lon- 17. Tremblay, N., Warren, R. & Dykes, R. W. (1988) Neuroscience 3, don) 347, 768-770. 745-762. 37. Pasantes-Morales, H., Klethi, J., Ledig, M. & Mandel, P. (1972) 18. Larsson, 0. M., Griffiths, R., Allen, I. C. & Schousboe, A. (1986) Brain Res. 41, 494-497. J. Neurochem. 47, 426-432. 38. Orr, H. T., Cohen, A. I. & Lowry, 0. H. (1976) J. Neurochem. 26, 19. Liu, Q.-R., Nelson, H., Mandiyan, S., LUpez-Corcuera, B. & 609-611. Nelson, N. (1992) FEBS Lett. 305, 110-114. 39. Dilley, J. V. (1972) Radiat. Res. 50, 191-1%. Downloaded by guest on September 25, 2021