Proc. Natl. Acad. Sci. USA Vol. 89, pp. 12145-12149, December 1992 Biochemistry Cloning and expression of a cDNA encoding the transporter of taurine and /8-alanine in mouse brain (neurotransmitters/membrane protein/moecular cloning) QING-RONG Liu, BEATRIZ L6PEZ-CORCUERA, HANNAH NELSON, SREEKALA MANDIYAN, AND NATHAN NELSON* Roche Institute of Molecular Biology, Roche Research Center, Nutley, NJ 07110 Communicated by Leon A. Heppel, September 8, 1992 (receivedfor review July 30, 1992) ABSTRACT A taurine/fl-alanine transporter was cloned hippocampus induced an increase in chloride permeability of from a mouse brain cDNA library by screening with a partial the cellular membranes (16, 17). Responses to all of those cDNA probe of the glycine transporter at low stringency. The substances were blocked by external strychnine, indicating deduced amino acid sequence predicts 590 amino acids with that they interacted with the same system. However, no typical characteristics of the sodium-dependent neurotrans- specific receptors for taurine or f-alanine could be identified. mitter transporters such as sequence homology and membrane Moreover, /3-alanine and taurine uptake systems could be topography. However, the calculated isoelectric point of the shared by other neurotransmitters. It was reported that a taurine/fi-alanine transporter is more acidic (pI = 5.98) than low-affinity GABA transporter accumulates taurine and those (pI > 8.0) ofother cloned neurotransmitter transporters. f3-alanine (18). The taurine transporter takes up /3-alanine Xenopus oocytes Injected with cRNA of the cloned transporter with high efficiency in neuronal and astroglial cells in culture. expressed uptake activities with K. = 4.5 FM for taurine and In this communication we report on the cloning and expres- K. = 56 FM for (3-alanine. Northern hybridization showed a sion of a cDNA encoding a sodium-dependent high-affinity single transcript of 7.5 kil9bases that was highly enriched in taurine and (3-alanine transporter.t kidney and distributed evenly in various parts of the brain. In situ hybridization showed the mRNA of the taurine/(3-alanine transporter to be localized in the corpus callosum, striatum, EXPERIMENTAL PROCEDURES and anterior commisure. Specific localization ofthe taurine/p- Cloning and Sequencing. A mouse neonatal brain cDNA alanine transporter in mouse brain suggests a- potential func- library in the Uni-Zap vector (Stratagene) was screened at tion for taurine and (3-alanine as neurotransmitters. low stringency with a 1-kilobase (kb) cDNA fragment starting at the N terminus of the glycine transporter clone (19, 20). Taurine is one of the most abundant amino acids in brain (1). Hybridization was performed at 420C with Denhardt's solu- Free taurine is found at millimolar concentrations in excitable tion containing 50% (vol/vol) formamide and 10% (wt/vol) tissues, especially those which generate oxidants (2). Taurine dextran sulfate, and washing was at 420C with standard saline is supplied to mammalian brain and other tissues by cysteine citrate containing 0.1% SDS (20). About 106 plaques yielded metabolism and diet. It was reported that taurine is taken up 56 positive clones from which the pBluescript plasmid (Strat- into cells by two transport systems: a low-affinity (Km of agene) was excised according to the manufacturer's instruc- about 2 mM) but high-capacity uptake system and a high- tions and sequenced with T3 primer by the dideoxynucleotide affinity system (Km of 50-80 AuM) having low capacity for termination method (22). Sequence analysis with the Univer- uptake (3-6). The physiological role of taurine in the central sity of Wisconsin Genetics Computer Group software indi- nervous system remains obscure (7-9). It has been proposed cated that most positive clones encoded either a partial or a that taurine plays a role in osmoregulation in certain brain full-length taurine/f3-alanine transporter. A positive clone cells (9-11). Intraperitoneal administration of distilled water with a 2.6-kb DNA insert was selected for sequencing ofboth elevated the concentration of taurine in dialysates from the strands, using oligonucleotide primers. rat pyriform cortex (12). This could be due to either increased RNA Isolation and Northern Blot Analysis. Total cellular release or inhibited uptake of taurine. Recent attempts to RNA was isolated from mouse liver, kidney, cerebellum, localize the sites of taurine biosynthesis in the brain demon- cerebral cortex, brainstem, and the rest of the brain by using strated immunostains of cysteine sulfonate decarboxylase in an RNA isolation kit from Stratagene. RNA samples (40 ,ug) rows like oligodendrocytes and cells around the Purkinje cells from the various tissues were loaded onto a formaldehyde/ in the cerebellum (7). Activity of the enzyme was also agarose gel. Equal loading of RNA was checked by the same detected in glial cell fractions enriched with oligodendrocytes intensity of ribosomal RNA after ethidium bromide staining and astrocytes. However, the high taurine concentrations in and hybridization with proteolipid cDNA of vacuolar proton brain suggest an important role for transport systems along- ATPase. Northern blot hybridization was carried out at high side the biosynthesis of taurine. Indeed a decreased Km and stringency as described (19, 20). Vmax oftaurine uptake was implicated in retinitis pigmentosa Expression of the Mouse Brain Taurine Transporter in (13, 14). Xenopus Oocytes. cRNA was synthesized from a linearized The function of 3-alanine in neurotransmission is also not NTT9 clone by phage T3 RNA polymerase. Microinjection of clear. It was shown that B3-alanine desensitizes glycine re- Xenopus oocytes and uptake measurement were performed sponses and partially reduces y-aminobutyrate (GABA)- as described (21). If not specified 1 ,uM nonradioactive evoked currents (15). Application of glycine, .3-alanine, or taurine was present in the uptake experiments. taurine onto isolated neurons from rat medulla oblongata and Abbreviation: GABA, -t-aminobutyrate. The publication costs of this article were defrayed in part by page charge *To whom reprint requests should be addressed. payment. This article must therefore be hereby marked "advertisement" tThe sequence reported in this paper has been deposited in the in accordance with 18 U.S.C. §1734 solely to indicate this fact. GenBank data base (accession no. L03292). 12145 Downloaded by guest on September 25, 2021 12146 Biochemistry: Liu et al. Proc. Natl. Acad. Sci. USA 89 (1992) 1 60 In Situ Hybridization. A Kpn I fragment at the 3' end of 61 120 121 CT 180 NTT9 was subcloned into pBluescript and the plasmid was 181 240 subsequently digested with Xho I. The linearized plasmid was A 241 C -7 ;cic 300 used as a template to synthesize the antisense C L K D F K P S P ( [a-35S~thioJ- 301 GGCACACGGCCTGAAGATGAGGCGGACGGGAAGCCCCCTCAGAGGGAGAAGTGGTCCAGC 360 UTP-labeled RNA probe by in vitro transcription from the G T R P E D E A D G X PP Q R E K N S S 361 AAGATCGACTTTGTGCTGTCTGTGGCCGGAGGCTSCGTGGGTTTGGGCAACGTCTGGCGT 420 phage T7 promoter. Paraffin sections of fixed mouse brain K I D F V L S V A G G F V G L G N V W R 421 TTCCCGTACCTCTGCTACAAAAATGGTGGAGGTGCGTTCCTCATACCGTATTTTATTTTC 480 divided into fore, mid, and hind thirds were obtained from F P Y L C Y K N G G G A F L I P Y F I F 481 CTGTTTGGGAGCGGCCTGCCTGTGTTTTTCTTGGAGGTCATCATAGGCCAGTACACATCA 540 Novagene (Madison, WI). Hybridization and autoradiogra- L F G S G L P V F F L E V I I G Q Y T S 541 GAAGGGGGCATCACCTGCTGGGAGAAGATCTGTCCTTTGTTCTCTGGCATTGCGTACGCA 600 phy of the slides were performed according to the manufac- E G G I T C W E K IC P L F S G I A Y A turer's instructions with the SureSite in situ hybridization kit 601 TCCATCGTCATTGTGTCCCTCCTGAACGTGTACTACATCGTCATCCTGGCCTGGGCCACA 660 S I V I V S L L N V Y Y I V I L A W A T (Novagene, Madison, WI). After the emulsion was devel- 661 TACTACCTATTCCACTCTTTCCAGAAGGATCTTCCCTGGGCCCACTGCAACCATAGCTGG 720 Y Y L F H S F Q R D L P W A H C N H S W oped, the hybridized slides were counterstained with hemo- 721 AACACACCACAGTGCATGGAGGACACCCTGCGTAGGAACGAGAGTCACTGGGTCTCCCTT 780 N T P Q C M E D T L R R N E S R W V S L toxylin and eosin. The positive and negative controls were 781 AGCACTGCCAACTTCACCTCACCCGTCATCGAGTTCTGGGAGCGCAATGTGCTCAGCCTG 840 S T A N F T S P V I E F W E RN V L S L performed by using testis-specific probe hybridized with 841 TCCTCCGGAATCGACAACCCAGGCAGTCTGAAATGGGACCTCGCGCTCTGCCTCCTCTTA 900 S S G I D N P G S L K W D L A L C L LL testis and brain slices, respectively. 901 GTCTGGCTCGTCTGTTTTTTCTGCATCTGGAAGGGTGTTCGATCCACAGGCAAGGTTGTC 960 V W L V C F F C I N K G V R S T G R V V 961 TACTTCACCGCTACTTTCCCGTTTGCCACGCTTCTGGTGCTGCTGGTCCGTGGACTGACC 1020 Y F T A T F P F A K L L V L L V R G L T 1021 CTGCCAGGTGCTGGTGAAGGCATCAAATTCTACCTGTACCCTGACATCAGCCGCCTTGGG 1080 RESULTS L P G A G E G I K F Y L Y P D I S R L G 1081 GACCCACAGGT TGGATCGACGCTGGAACTCAGATATTCTTTTCCTACGCAATCTGCCTG 1140 To clone the taurine transporter, a fetal mouse brain cDNA D P Q V W I D A G T Q I F F S Y A I C L 1141 GGGGCCATGACCTCACTGGGAAGCTATAACAAGTACAAGTATAACTcGTACAGGGACTGT 1200 library was screened at low stringency with 32P-labeled G A M S' S L G S Y N K Y K Y N S Y R D C 1201 ATGCTGCTGGGATGCCTGAACAGTGGTACCAGTTTTGTGTCTGGCTTCGCAATTTTTT CC 1260 cDNA encoding the glycine transporter (19). Numerous I L L G C L N S G T S F V S G F A I F S was 1261 ATCCTGGGCTTCATGGCACAAGAGCAAGGGGTGGACATTGCTGATGTGGCTGAGTCAGGT 1320 positive clones were isolated and the pBluescriptplasmid I L G F M A Q E' Q G V D I A -D V A 'E -S G excised and to DNA a T3- 1321 CCTGGCTTGGCCTTCATTGCCTACCCAAAAGCTGTAACCATGATGCCGCTGCCCACCTTT 1380 subjected sequencing using P G L A F I A Y P KA V T M P L P T F 1381 C 1440 promoter oligonucleotide as primer.