ISSN 1346-7565 INSTRUCTIONS TO AUTHORSActa Phytotax. Geobot. 67 (2): 69–82 (2016) doi: 10.18942/apg.201516 Acta Phytotaxonomica et Geobotanica (Revised October, 2013)
Editor-in-Chief Members of the Japanese Society for Plant Systematics 55 (3), pp. 123–175. Science Press, Beijing (in Chinese). TAMURA, Minoru N. (Graduate School of Science, Kyoto University, Kyoto 606-8502, Japan) are encouragedNovel to Nuclearsubmit manuscripts Microsatellite pertinent to sys Markers- Matsumura, Reveal J. 1912. Genetic Index Plantarum Diversity Japonicarum, vol. tematic botany, phytogeography and closely related disci- 2. Maruzen, Tokyo. Editors plines for publicationand Structurein Acta Phytotaxonomica of Veronicastrum et Geobo- Ridder-Numan, sibiricum J. 1997. var. The zuccarinii continuing story of Spatho- tanica. Contribution from non-members abroad is also lobus (Leguminosae-Papilionoideae) and its allies. In: EBIHARA, Atsushi (Tsukuba, Japan) NAIKI, Akiyo (Taketomi, Japan) welcome, and if accepted, may be entitled free of charge Dransfield, J., M. J. E. Coode & D. A. Simpson (eds.), FUKUHARA, Tatsundo (Munakata, Japan) TAKAMIYA, Masayuki (Kumamoto, Japan) for publication. (Plantaginaceae) in the Aso Region,Plant Diversity Kyushu, in Malesia JapanIII, pp. 205–217. The Royal FUSE, Shizuka (Kyoto, Japan) TSUBOTA, Hiromi (Hiroshima, Japan) Botanic Gardens, Kew. IKEDA, Hiroshi (Tokyo, Japan) WATANO, Yasuyuki (Chiba, Japan) Manuscripts should be written in English and submitted Wain, R. P., W. T. Haller & D. F. Maktin. 1985. Isozymes KUROSAWA, Takahide (Fukushima, Japan) YONEKURA, Koji (Sendai, Japan) in triplicate. Online 1,*submission is also accepted. 1 in studies of aquatic 2plants. J. Aquatic Pl. Managem.1 FullNoriyuki original papers Fujii are, Slimitedatos tohi 20 T akaprintedsawa pages ,in M asa23:shi 42–45. Yokogawa , Takashi Yamasaki , 1 3 4 length including tablesKens anduke figures. Harada Short communi, Shin-go TablesKaneko should a ben dincluded Yuji theIs agiheading, a lucid legend to Editorial Board cations are limited to 4 printed pages. With the approv- explain the meaning of the content. AZUMA, Hiroshi (Kyoto, Japan) NISHIDA, Harufumi (Tokyo, Japan) 1 Graduateal of the Editorial School of Board, Science additional and Technology, pages may Kumamoto be pub- University,Figures shouldKurokami be prepared2-39-1, Chuo-ku, as follows: Kumamoto, (a) Photographs Kuma- motolished 860-8555, only at Japan. the author’s * [email protected] expense (3,000 Yen (author per for shouldcorrespondence); be mounted 2Osaka on hard Museum boards. of (b) Natural On the History, margin BOUFFORD, David E. (Boston, U.S.A.) NISHIDA, Sachiko (Nagoya, Japan) 3 FUJII, Shinji (Okazaki, Japan) OHMURA, Yoshihito (Tsukuba, Japan) page).Nagai ParkMonographs 1-23, Higashi-Sumiyoshi-ku, exceeding 30 printed Osaka, pages Osaka may 546-0034,or back Japan; of each Faculty figure, of indicate Symbiotic the Systems author(s) Science, name, fig- Fukushimabe compiled University, in supplementary Kanayagawa issues. 1, Fukushima, Reviews (notFukushima ure 960-1248, number andJapan; orientation 4Graduate with School soft pencil. of Agriculture, (c) Size for KAWAKUBO, Nobumitsu (Gifu, Japan) PAK, Jae-hong (Taegu, Korea) more than 20 printedKyoto University,pages) and Kitashirakawa-oiwake-cho, short reviews (not figures Sakyo-ku, as published Kyoto 606-8502, should beJapan less than 135 × 180 mm MURAKAMI, Noriaki (Hachioji, Japan) PENG, Ching-I (Taipei, Republic of China) more than 10 pages) are also considered for publication. for a whole page, and the size of figures submitted NAGAMASU, Hidetoshi (Kyoto, Japan) TAKAHASHI, Hideki (Sapporo, Japan) Preparation of Manuscripts: should be the same or bigger than that of the published NAKADA, Takashi (Tsuruoka, Japan) TAN, Benito C. (Berkeley, U.S.A.) Cover sheetVeronicastrum should contain sibiricum (a) full var. name(s) zuccarinii of author(s) (Plantaginaceae) page. is (d)an Legendsendangered for perennialfigures should herb nativebe grouped to on a and address,semi-natural (b) the grasslands corresponding in southern author’s Korea name, and unKyushu,- Japan.separate To elucidatesheet. Original the genetic figures status shouldof V. sibiri be- kept at Acta Phytotaxonomica et Geobotanica (APG) is published in one volume, comprising three issues per abbreviatedcum var. complete zuccarinii address, in the Aso phone region and of facsimileKyushu, in whichhand relatively until requested. large populations still remain, we numberanalyzed and e-mail seven address, populations (c) title, using (d) five numbers novel of microsatellitefig- Whether markers. or not Each the populationmanuscript of V.is sibiricumaccepted var.and the or- year, by the Japanese Society for Plant Systematics. It is sent to all members of the society. APG is the ures andzuccarinii tables, hasand a(e) maintained running title moderate including level author’s of genetic diversityder of publication (mean HE =is 0.596, to be mean decided NA =by 5.6, the and Editorial continuation journal of the Societas Phytogeographica Kyoto, Japan. The journal is open to the fields familymean name AR with = 4.7). less Pairwisethan 50 characters. FST indicated significant geneticCommittee. differentiation The positions between and all scalepopulation of figures pairs and ta- of systematic botany, phytogeography and closely related disciplines. The Instructions to Authors are Type in(0.065−0.309). double-space Theon one semi-natural side of A4 grasslandssize papers in with the Aso regionbles in have published decreased page in may area be over changed the past from de- the au- available at the cover page 3. All manuscripts should be sent to Editor-in-Chief. margincades. at least Thus, 2.5 habitat cm wide.fragmentation Each typewritten may be causing page geneticthor’s differentiation designation. among populations of V. sibiri- usuallycum consists var. zuccarinii of 25 lines.. Although the populations of this varietyGalley haveproof maintained will be sent a moderate to the corresponding degree of ge- author. Application of admission for membership of the society should be addressed to the Treasurer, Dr. Ha- Arrangenetic the diversity, manuscript the dynamicsin the order of gene listed flow below among and them shouldThe authors be continuously are responsible monitored. for reading the first galley number all pages consecutively, including tables and proof. No change of the content of the manuscript is jime Ikeda (Institute of Plant Science and Resources, Okayama University, Chuo 2-20-1, Kurashiki, figures.Key words: conservation genetics, endangered species, grassland,permitted habitaton the galleyfragmentation, proof. If microsatellite,the Editors recognize Okayama 710-0046, Japan) and other correspondences the Secretary, Dr. Takashi Shiga (Mathematical Title ofvegetative paper, name(s) reproduction, of author(s) Veronicastrum and affiliation sibiricum with var. zuccariniithe necessity for a change, this change may be made at and Natural Sciences, Faculty of Education, Niigata University, Ikarashi 2no-cho 8050, Niigata 950- addresses. the author’s expense. 2181, Japan). The annual fee is 5,000 Yen for Japanese members, 3,000 Yen for student members and Abstract should be a lucid digest of the paper, not ex- Offprints. The authors will receive free of charge 50 off- 3,000 Yen for foreign members resided in abroad. APG is available by subscription for 8,000 Yen per ceeding 200 words for a full paper. prints. Additional copies can be obtained at author’s KeyAnthropogenic words not more than disturbance 10 words are is arrangedthreatening in an the al- cost.Along with habitat destruction and commer- year by the Treasurer. survivalphabetical of manyorder. organisms globally (Pimm et al. cialCopyright. exploitation, The articles stochastic published processes, in APG are known subject asto Text1995), containing with many Introduction species (withouthaving heading),gone extinct Materi in- thecopyright. “extinction All rights vortex,” are reserved have contributedby the Japanese to Soci the- Reprographic Reproduction outside Japan als and Methods, Results, Discussion, and Acknowl- ety for Plant Systematics. The authors should submit Making a copy of this publication theedgments past decades is suggested. (Lawton Scientific & May names 1995, are Regan written et in destabilizingthe agreement effects that the of speciescopyright survival for their (Gilpin article &is Please obtain permission from the following Reproduction Rights Organizations (RROs) to which the copyright al.Italic 2001,. Scientific Smith etnames al. 1993). that appear Even firstly extant in specieseach para- Soulétransferred 1986). to Some the Japanese of these Society stochastic for Plant factors Systemat are- holder has consigned the management of the copyright regarding reprographic reproduction. aregraph facing should a reduction be unabbreviated. in population Voucher size specimens(Groom- genetic,ics when as the the article decline is accepted of genetic to publication. variation within Obtaining permission to quote, reproduce; translate, etc. bridgeshould 1992). be cited. It isAbbreviations estimated thatof herbaria without should aggres fol- populationsSubmit all manuscripts can cause byinbreeding a registered depression mail to Editor- and Please contact the Secretary of the society. sivelow conservation Index Herbariorum. measures, about two-thirds of increasein-Chief, the Dr. risk Minoru of extinction N. Tamura, (Frankham Graduate School 2005). of References cited in the text should be arranged alphabet- Science, Kyoto University, Sakyo, Kyoto 606-8502, Ja- Users in countries and regions where there is a local RRO under bilateral contact with Japan Academic Associa- all vascular plants may disappear by the end of In addition, genetic drift may reduce the genetic icallyst according to the name(s) of author(s). Text refer- pan. tion for Copyright Clearance (JAACC). theence 21 should century be made (Pitman by the & author’s Jørgensen names 2002). followed Ap by- variation E-mail: [email protected] isolated populations and result in Users in countries and regions of which RROs are listed on the following website are requested to contact the re- proximatelythe year of 7,000publication. vascular [for plant example: taxa areMatsumura recog- strong genetic differentiation among populations spective RROs directly to obtain permission. nized(1912), in orthe (Matsumura Japanese 1912)].flora, Ifone-quarter the number ofof authors which (Lienert 2004). In small or repeatedly bottle- is isthreatened three or more, by extinctionuse Takamiya (Ministry et al. (1997), of the or (TakaEnvi- necked populations, slightly deleterious muta- Japan Academic Association for Copyright Clearance (JAACC) miya et al. 1997). Each reference should be given in the ronment of Japan 2007, 2012, 2015). Conserva- tions are expected to accumulate because of ge- Address 9-6-41 Akasaka, Minato-ku, Tokyo 107-0052 Japan following form: Website http://www.jaacc.jp/ Sheh,tion effortsM.-L. 1992. are Peucedanum. therefore urgentlyIn: Shan, R.-H.needed & M.-L. for netic drift, resulting in mutational meltdown and E-mail [email protected] Fax: +81-3-3475-5619 theseSheh threatened (eds.), Flora plant Reipublicae species. Popularis Sinicae, vol. a rapid decline toward extinction (Lande 1995, 70 Acta Phytotax. Geobot. Vol. 67
tTABLEable 1. 1. The The materials materials and and theirtheir sourcessources analysed forfor microsatellitemicrosatellite variation variation ofof Veronicastrum Veronicastrum sibiricum var.var. zuccariniizuccarinii in in Kyushe Kyushu district, district, Japan. Japan. Altitude No. of Estimated Population Locality* (m) samples population size NA1 Namino, Aso, Kumamoto 760 35 ~100
NA2 Namino, Aso, Kumamoto 780 35 ~100
NA3 Namino, Aso, Kumamoto 770 16** ~100
NA4 Namino, Aso, Kumamoto 770 33 ~100
TA1 Takamori, Kumamoto 870 35 ~100
TA2 Takamori, Kumamoto 790 76 ~500
KO Kokonoe, Oita 800 4 ~10
Total 234 *From a view point of conservation, the approximate information of the localities is shown. **In NA3 population, many ramets grew densely relatively in a small area, therefore the collected number of samples were relatively small.
KO Mt. Kujyu
Aso Kumamoto Oita Pref. Japan Pref. NA2 NA1 32°N Aso NA4 Mountains NA3 Kyushu TA1 Mt. Sobo TA2 10km 130°E
Fig. 1. Sampling locations of Veronicastrum sibiricum var. zuccarinii in the Aso region, Kyushu, Japan.
Lynch & Gabriel 1990). In threatened plant spe- in the mountainous areas of southern Korea and cies, the reduction of genetic variation within northern Kyushu, Japan (Yamazaki 1993). Over populations may increase both the short-term risk the last few decades, changes in rural land use of extinction, by reducing reproductive success have greatly reduced and fragmented Japan’s FIG. 1.(caused by pollen limitation and inbreeding de- semi-natural grasslands, and many grassland pression) and the long-term risk of extinction by species have become endangered (Tsukada et al. reducing the genetic capacity to respond to envi- 2004), V. sibiricum var. zuccarinii being one of ronmental changes (Frankham et al. 2002, Kery them. This variety has experienced a rapid popu- et al. 2000). Thus, conservation planning must lation decline due to habitat loss resulting from take into account the genetic status of each popu- abandonment of traditional grassland manage- lation and individual (Neel & Cummings 2003). ment and conifer plantation establishment, with Veronicastrum sibiricum (L.) Pennell var. only an estimated seven hundred individuals re- zuccarinii (Koidz.) H. Hara (Plantaginaceae) is maining (Environment Agency of Japan 2000). an endangered perennial herb of sunny meadows Based on the observed rapid decline in habitat June 2016 Fujii & al.—Conservation genetics of Veronicastrum in Aso 71 remnants and population numbers, var. zuccari- er specimens used in the present study were de- nii (not the species as a whole) was categorized as posited in the herbarium of the Faculty of Sci- “endangered” (EN) in the Japanese Red Data ence, Kumamoto University (KUMA). Book and List (Environment Agency of Japan For the TA2 population, we established an 18 2000, Ministry of the Environment of Japan × 16 m quadrat containing 444 individuals (the 2007). Recently, its status has been revised to number of ramets). Of these, 66 ramets were ran- “vulnerable” (VU; Ministry of the Environment domly selected for collection and the location of of Japan 2012, 2015), because relatively large each was mapped (Fig. 2). The samples were pre- populations have been discovered recently in the served as above and used to evaluate the fine- Aso region. However, currently, population num- scale genetic structure (distribution of genets) of bers are still limited. the population of Veronicastrum sibiricum var. Although Veronicastrum sibiricum var. zuc- zuccarinii. carinii is at risk of extinction, the population ge- netics of this variety have not been studied. In the Isolation and characterization of microsatellite present study, we developed and used microsatel- markers lite markers to identify the genetic structure and The development of microsatellite markers in diversity of var. zuccarinii, including the fine- the present study was based on improved tech- scale genetic structure within population. Highly niques for isolating codominant compound mic- variable microsatellite markers, which allow for rosatellite markers (Kaneko et al. 2007, Lian et accurate estimates of inter- and intra-population- al. 2006, Lian & Hogetsu 2002). A restriction al differences, can detect populations with rare DNA library was constructed by digesting DNA alleles that may be candidates for targeted con- with SspI or EcoRV, a blunt-end restriction en- servation efforts, as well as populations with low zyme. The restriction fragments were then ligat- diversity that potentially require management as- ed using a DNA ligation kit (Takara Bio) with a sistance (Frankham et al. 2002). We sampled ex- specific blunt-end adaptor (consisting of the 48- tant populations from the Aso region. The data mer 5’-GTAATACGACTCACTATAGGGCAC- obtained will help inform the conservation and GCGTGGTCGACGGCCCGGGCTGGT-3’ along restoration of V. sibiricum var. zuccarinii. with the 8-mer 5’-ACCAGCCC-NH2-3’, in which the 3’-end was capped with an amino residue). Fragments were amplified from the SspI DNA li- Materials and Methods (m) Plant sampling In July and August 2009–2011, we collected 16 mature leaf tissues of Veronicastrum sibiricum Genet 1 var. zuccarinii from seven populations (NA1– 12 Genet 2 Genet 3 NA4, TA1, TA2, and KO) in the Aso region of Genet 4 Kumamoto and Oita prefectures, Kyushu, Japan 8 Genet 5 Genet 6 (Table 1, Fig. 1). The collections comprised al- Genet 7 Genet 8 most all known populations in this region, includ- 4 ing newly discovered populations (NA3 and NA4). Sampling was randomly performed throughout each population. A total of 234 indi- 0 4 8 12 16 20 (m) viduals was collected. All samples were dried Fig. 2. Distribution of 66 ramets within the quadrat estab- lished in the TA2 population of Veronicastrum sibiri- and preserved with silica gel. Population sizes cum var. zuccarinii (see, Fig. 1 and Table 1). Same char- were estimated for each population according to acter indicates plants with identical genotypes; we con- the number of flowering plants observed. Vouch- sidered these plants to be same individuals or clones.
FIG. 2. 72 Acta Phytotax. Geobot. Vol. 67
TTABLEableTABLE 2. 2. 2.Characteristics Characteristics Characteristics ofof of thethe the fivefive five compound compoundcompound microsatellite microsatellitemicrosatellite loci loci for for Veronicastrum VeronicastrumVeronicastrum sibiricum sibiricum var. var.var. zuccarinii zuccariniizuccarinii and and and their their their variability. variability. variability.
LocusLocus RepeatRepeat motif motif PrimerPrimer sequence sequence (5'-3') (5'-3') TTa a(ºC) (ºC)SizeSize range range (bp) (bp) AA HHOO HHE E AccessionAccession No. No.
Vsz011Vsz011 (AC)(AC)6(AG)6(AG)1515 ACACACACACACAGAGAGAGAGACACACACACACAGAGAGAGAG 5757 8080−−152152 2626 0.6040.604 0.7700.770 AB926409AB926409
TTTACCAGTCTTTATCCAACGATTTACCAGTCTTTATCCAACGA
Vsz016Vsz016 (AC)(AC)6(AG)6(AG)1111 ACACACACACACAGAGAGAGAGACACACACACACAGAGAGAGAG 5757 160160−−190190 77 0.5770.577 0.5140.514 AB926410AB926410
CATATCTTTGCAGTAGGAAGCACATATCTTTGCAGTAGGAAGCA
Vsz025Vsz025 (AC)(AC)6(AG)6(AG)1313 ACACACACACACAGAGAGAGAGACACACACACACAGAGAGAGAG 5757 148148−−208208 2424 0.8050.805 0.7750.775 AB926411AB926411
AGTTACAGATTTAGCGGCCTACAGTTACAGATTTAGCGGCCTAC
Vsz047Vsz047 (AC)(AC)6(AG)6(AG)8 8 ACACACACACACAGAGAGAGAGACACACACACACAGAGAGAGAG 5757 199199−−207207 55 0.4790.479 0.4070.407 AB926412AB926412
GTCCTGGCTTTGAGTAACCAGTCCTGGCTTTGAGTAACCA
Vsz226Vsz226 (AG)(AG)6(AC)6(AC)1010 AGAGAGAGAGAGACACACACACAGAGAGAGAGAGACACACACAC 5757 223223−−227227 77 0.5010.501 0.5160.516 AB926413AB926413
GAACAATGCTCTGTAACCACATGAACAATGCTCTGTAACCACAT
AverageAverage 13.213.2 0.5930.593 0.5960.596
TTa,a ,annealing annealing temperature; temperature; A A, ,the the number number of of allele; allele; H HOO, ,observed observed heterozygosity; heterozygosity; H HE,E ,expected expected heterozygosity heterozygosity brary using the compound microsatellite primer using 48 plants from four populations (NA1–
(AC)6(AG)5 or (TC)6(AC)5 and an adaptor primer NA4). The linkage disequilibrium test using (5’-CTATAGGGCACGCGTGGT-3’). The ampli- FSTAT version 2.9.3.2 (Goudet 1995) found sig- fied fragments, ranging from 400 bp to 800 bp, nificant genotypic disequilibrium between were then separated on a 1.5% LO3 agarose gel Vsz025 and Vsz205 (P<0.05); therefore, the (Takara Bio) and purified using the QIAquick Gel Vsz205 locus was excluded from the present anal- Extraction Kit (Qiagen). The purified DNA frag- ysis. Additionally, significant departure from ments were subsequently cloned using the QIA- Hardy–Weinberg equilibrium (HWE) after Bon- GEN PCR Cloning plus Kit (Qiagen) according ferroni correction was detected in Vsz011, Vsz025, to the manufacturer’s instructions. Briefly, poly- and Vsz226 in the NA1 population, as well as that merase chain reaction (PCR) products were ligat- of Vsz047 and Vsz205 in the NA4 population. ed into the pDrive vector and transformed into However, no locus showed significant departure QIAGEN EZ competent cells. Transformants from HWE in all populations. Thus, a total of five were identified by blue/white screening on LB loci (excluding Vsz205) was used to assess the ge- agar plates containing ampicillin, X-gal, and netic diversity of Veronicastrum sibiricum var.
IPTG. Cloned fragments containing (AC)6(AG)n zuccarinii (Table 2). or (TC)6(AC)n compound microsatellite sequenc- es were amplified from the plasmid DNA of the Microsatellite genotyping positive clones, using M13 forward and reverse Genomic DNA of all samples was extracted primers. Based on the sequences obtained, 13 from leaves using a modified version of the CTAB candidate primers were designed using Primer3 method (Doyle & Doyle 1987). The five afore- version 0.4.0 (Rozen & Skaletsky 2000). Six of mentioned microsatellite loci were amplified by the candidate loci (Vsz011, Vsz016, Vsz025, PCR using a QIAGEN Multiplex PCR Kit (Qia- Vsz047, Vsz205, and Vsz226) were amplified using gen) (Table 2). Each 5 µL PCR reaction mixture PCR and showed polymorphic band patterns contained 0.5 µL template DNA (approx. 1–5 ng), within and among the populations (Table 2). 1.0 µM primers, and 2.5 µL Master mix. The Next, we checked the efficiency of the primers PCR program included initial denaturation at June 2016 Fujii & al.—Conservation genetics of Veronicastrum in Aso 73
95°C for 15 min followed by 30 cycles of 30 s at distance (IBD) pattern, a Mantel test (Mantel 94°C, 1 min 30 s at 57°C, 1 min at 72°C; these 1967) was conducted using GenAlEx version 6.2. were followed by a final extension at 60°C for 30 In this test, the latitude and longitude data were min. PCR was performed with the Thermal Cy- used to determine geographic distance among cler 2720 (Applied Biosystems). Sizes of the PCR populations, and the formula FST/(1-FST) was products were estimated using the CEQTM 8000 used to determine the genetic distance. Relation- Analysis System with a DNA Size Standard Kit- ships among populations were inferred using a 400 (both from Beckman Coulter). neighbor joining (NJ) tree based on the genetic
distance among populations DA (Nei et al. 1983), Data analysis generated by Population 1.2.30 beta (Langella We sampled and genotyped 234 plants from 2007). The robustness of each branch was evalu- the seven populations (Table 1). In the following ated by bootstrap probability from 1,000 resam- analyses, the KO population data were added plings of the genotype dataset. To infer the ge- only in the Bayesian clustering analysis (see be- netic structure of the populations, Bayesian clus- low) because the sample size was small (four in- tering was implemented using STRUCTURE dividuals). To estimate genetic diversity within version 2.3.3 (Pritchard et al. 2000). This ap- each population, we calculated the mean number proach estimates the number of clusters (K) and of alleles per locus (NA), the expected and ob- assigns each individual to a cluster. The popula- served heterozygosities (HE and HO), the number tion structure was simulated with values of K = of private alleles (Pr) present only in a single pop- 1–9 under the LOCPRIOR model with admixture ulation, and the summed number of rare alleles model and correlated allele frequencies model (F- with frequencies less than 5% among the total model). The F-model assumes that all clusters di- population (RA), using GenAlEx version 6.2 verged from a common ancestral population and (Peakall & Smouse 2006). Also, allelic richness may have experienced different degrees of genet- (AR; El Mousadik & Petit 1996) and inbreeding ic drift (Falush et al. 2003). In this model, the coefficients F ( IS) were calculated using FSTAT amount of genetic drift for each cluster is de- version 2.9.3.2. The latter parameter, FIS, was scribed as the F-value. The LOCPRIOR model tested with 600 randomizations and by applying modifies the prior distribution for each individu- Bonferroni correction, to determine whether its al’s population assignment and allows the propor- value differed significantly from zero. tion of individuals assigned to a particular cluster Recent bottlenecks in the populations were to vary by location (Hubisz et al. 2009). A series evaluated using BOTTLENECK ver. 1.2.02 (Piry of 20 independent runs for each value of K rang- et al. 1999). We simulated equilibrium conditions ing from 1 to 9 was performed with 1×106 MCMC (1,000 replications) assuming the infinite allele iterations after 1×105 burn-in periods. To identify mutation model (IAM) and the two-phase model the appropriate value of K, we compared the (TPM) with parameters recommended by Piry et mean value of the log probability of data (Ln al. (1999) (95% single step mutations, variance P(D)) for each K, according to Pritchard et al. among multiple steps, 12). We used the Wilcoxon (2000). signed rank test to determine whether a signifi- cant excess of heterozygosity existed. Estimation of the fine-scale genetic structure of
Pairwise FST (Weir & Cockerham 1984) mea- V. sibiricum var. zuccarinii sures the degree of genetic differentiation among To estimate the fine-scale genetic structure populations and was computed using FSTAT ver- (distribution of genets) of Veronicastrum sibiri- sion 2.9.3.2. This was tested with 300 permuta- cum var. zuccarinii, we genotyped a part of indi- tions to determine whether it differed significant- viduals (66 ramets) collected from the 18×16 m ly from zero. To test whether genetic differentia- quadrat established within the TA2 population tion among populations followed an isolation-by- using the five microsatellite loci and methods de- 74 Acta Phytotax. Geobot. Vol. 67
TTableABLE 3. Genetic diversity measurements of each population of Veronicastrum sibiricum var. zuccarinii. P value of bottleneck analysis Population N NG NA AR RA Pr HO HE FIS IAM TPM
NA1 35 16 5.8 4.9 10 4 0.613 0.646 0.085 0.031 0.031
NA2 35 19 10.2 7.1 28 16 0.656 0.701 0.090 0.813 0.813
NA3 16 12 4.0 3.7 5 1 0.683 0.565 -0.168 0.156 1.000
NA4 33 10 4.2 4.1 8 2 0.489 0.563 0.185 0.156 0.625
TA1 35 13 4.4 4.1 8 1 0.600 0.549 -0.054 0.156 0.625
TA2 76 12 4.8 4.4 9 2 0.517 0.556 0.113 1.000 1.000
KO 4 2 * * * 3 * * * * *
Average** 13.7 5.6 4.7 10.0 4.3 0.593 0.596
N, number of samples; NG,number of genets; NA, mean number of alleles per locus; AR, allelic richness; RA, summed number of rare alleles; Pr, summed number of private alleles; HO, observed heterozygosity; HE, expected heterozygosity; FIS, inbreeding coefficient; IAM, infinite allele model; TPM, two phase model. *In the KO population, the values of genetic diversity within population were not caluculated because the sample size was small. **The averages were the value excluding the samples of KO population.
scribed above. We used GenAlEx version 6.2 to Results calculate the probability of identity, which esti- mates the average probability that two unrelated Marker loci polymorphisms individuals drawn from the same randomly mat- The number of alleles per locus ranged from 4 ing population will have the same multilocus for Vsz047 to 26 for Vsz011, with an average of genotype. Because the probability of identity es- 13.2 (Table 2); a total of 66 alleles were detected. −4 timated by all five loci was very small (3.28×10 ), Observed heterozygosity (HO) ranged from 0.479 plants with identical multilocus genotypes were for Vsz047 to 0.805 for Vsz025, with an average of regarded as clones or genets derived from vegeta- 0.593. Expected heterozygosity (HE) ranged from tive reproduction. We investigated genet distribu- 0.407 for Vsz047 to 0.775 for Vsz025, with an av- tion in terms of location within the quadrat and erage of 0.596. Nucleotide sequence data report- individual genotype. ed here are available in the DDBJ/EMBL/Gen- Bank databases under the accession numbers Observation of underground parts AB926409−926413. To characterize the mode of vegetative repro- duction, we observed the underground parts of Genetic diversity within populations Veronicastrum sibiricum var. zuccarinii. In a pri- We collected 16−76 individuals from each vate garden at Takamori-machi, Kumamoto Pref., population excluding the KO population. Howev- the variety was cultivated in the range of approx- er, the number of genets (NG) that shared geno- imately 1 m × 1 m, and the number of the ramets types at all five microsatellite loci ranged from 10 with inflorescence was approximately 10. We to 19 (Table 3). The same genets were not detect- carefully dug up the parts from the stock (approx- ed among different populations. In each popula- imately 30 cm × 40 cm). After the removal of tion, we excluded clones from subsequent calcu- loose soil and rinsing, the underground parts lations of genetic diversity (genet-level analyses). were stored in 70% ethanol. The mean number of alleles across loci (NA) ranged from 4.0 for NA3 to 10.2 for NA2, and al- lelic richness (AR) ranged from 3.7 for NA3 to 7.1 June 2016 Fujii & al.—Conservation genetics of Veronicastrum in Aso 75
TTABLEable 4. 4. Pairwise FST (below diagonal) and geographical distance (km; above diagonal) among six populations of Veronicastrum sibiricum var. zuccarinii. NA1 NA2 NA3 NA4 TA1 TA2
NA1 1.0 3.7 1.6 7.1 12.1
NA2 0.089* 3.7 2.2 6.8 12.3
NA3 0.240* 0.138* 2.3 3.6 8.6
NA4 0.171* 0.137* 0.218* 5.9 10.5
TA1 0.065* 0.105* 0.284* 0.275* 7.0
TA2 0.068* 0.142* 0.309* 0.188* 0.152* *Significant differences from zero are indicated (P < 0.05). for NA2; mean values were 5.6 and 4.7, respec- The analysis of genetic structure consistently tively (Table 3). Forty-two alleles (64%) were rare showed that genetic differentiation among popu- alleles (RA) with frequencies less than 5%. Out of lations did not correspond to geographical distri- a total of 66 alleles, 26 were private alleles (Pr), bution. The Mantel test did not indicate a positive which were observed only in a single population. correlation between geographic distance and ge- The mean number of private alleles per locus netic distance among populations (R2 = 0.005, P = ranged from 0.2 for NA3 and TA1 to 3.2 for NA2, 0.465) (Fig. 3). The neighbor-joining tree based with an average of 0.8. HO ranged from 0.489 for on genetic distances among populations (DA)
NA4 to 0.683 for NA3 (mean, 0.593), and HE showed that all branches had bootstrap probabili- ranged from 0.549 for TA1 to 0.701 for NA2 ties of 50% or less (Fig. 4), indicating that the re-
(mean, 0.596). FIS ranged from -0.168 for NA3 to lationships among the populations were unclear. 0.185 for NA4, and no inbreeding coefficient sig- In Bayesian clustering, the mean log probabil- nificantly differed from zero. In the KO popula- ity of the data (Ln P(D)) over 20 runs for each tion, two genets were detected in four samples cluster was highest at K = 7 (Fig. 5). The result of and three private alleles were detected. a single run at K = 7 is shown in Figure 6. In all BOTTLENECK (tested by Wilcoxon’s signed populations, the cluster with the highest propor- rank test) analysis indicated recent population tion of membership differed (Clusters 1–7). The bottlenecks in the NA1 population under the IAM F-value of each cluster ranged from 0 to 0.53, the and TPM (Table 3). There was no excess of het- highest value of which occurred in cluster 7. erozygosity in any of the other five populations under either model. Quadrat investigation in the TA2 population Analysis of 66 ramets collected from a quadrat Genetic differentiation and structure among pop- established in the TA2 population, based on mul- ulations tilocus genotypes of five microsatellite markers, Although the geographical distance among revealed that these ramets consisted of 8 genets populations was small (1.0–12.3 km), significant (Fig. 2). Among the ramets, 56 were members of genetic differentiation was observed in Veroni- Genet 1, three of Genet 6, and two of Genet 4. The castrum sibiricum var. zuccarinii. Pairwise FST remaining ramets were members of Genets 2, 3, 5, ranged from 0.065 between the NA1 and TA1 7, and 8. The longest distance between plants of populations to 0.309 between the NA3 and TA2 Genet 1 was 1,577 cm (black circles, Fig. 2). populations (Table 4). FST values between all pop- ulation pairs were significantly greater than zero Observation of underground parts (P < 0.05). The excavated parts included 20–30 ramets of 76 Acta Phytotax. Geobot. Vol. 67
0.500 TA1 ) 0.400 ST NA2 0.300 P=0.465 / (1– F 2 ST R =0.0005 0.200 24 NA3 NA1 30 50 Pairwise F 0.100
0 0.1 -0.500 0.000 0.500 1.000 1.500 2.000 2.500 3.000 Log geographic distance (km) TA2 NA4
Fig. 3. Relationship between log geographic distance and genetic distance Fig. 4. Neighbor joining (NJ) tree based on
between all pairs of populations of Veronicastrum sibiricum var. zucca- genetic distance (DA) among popula- rinii. tions of Veronicastrum sibiricum var. zuccarinii. Numbers along branches are bootstrap values (%) based on 1,000 replicates. For abbreviations of FIG. 3. population names, see Table 1. FIG. 4.
Veronicastrum sibiricum var. zuccarinii (Figs. E. Morren (Primulaceae), designated near threat- 7A, B). Rhizomes with horizontal spread were ened (NT) in Japan, the parameters of genetic di-
observed in the underground parts of these plants versity of the Aso population were NA= 9.1 and HE (Fig. 7C). New shoots for the next year were ob- = 0.786, based on eight microsatellite loci (Honjo served at the base of terrestrial stems (Fig. 7D). et al. 2009). In the vulnerable (VU) species Si- lene kiusiana (Makino) H. Ohashi & H. Nakai Discussion (Caryophyllaceae), fi ve microsatellite loci from seven populations in the Aso region revealed the
Moderate genetic diversity in Veronicastrum si- following values: NA= 12.0, AR = 10.4, and HE = biricum var. zuccarinii 0.791 (Yamasaki et al. 2013). Moreover, Nybom To evaluate whether the genetic diversity of (2004), using microsatellite marker data, report-
Veronicastrum sibiricum var. zuccarinii has been ed mean HE values in long-lived perennial, nar- lost, we compared the mean number of alleles per rowly distributed, and outcrossing plants to be
locus (NA), allelic richness (AR), and expected 0.68, 0.56, and 0.65, respectively. In the present
heterozygosity (HE) obtained from microsatellite study of V. sibiricum var. zuccarinii, we deter-
analyses of additional species of endangered mined the values of NA = 5.6, AR = 4.7, and HE = plants in the semi-natural grasslands of the Aso 0.596 (Table 3), indicating a moderate degree of region. For Echinops setifer Iljin (Asteraceae), genetic variation compared to other semi-natural designated as vulnerable (VU) in Japan (Minis- grassland species, although the populations of try of the Environment of Japan 2015), the values var. zuccarinii are currently decreasing in size
of NA = 2.1, AR = 1.9, HE = 0.33. Those values (Environmental Agency of Japan 2000). were determined using eight microsatellite loci Mode of reproduction is known to infl uence from 10 populations in the Aso region (Kaneko et genetic diversity in a species (Hamrick & Godt al. 2009). In Polemonium kiushianum Kitam. 1996, Nybom 2004, Duminil et al. 2007). For ex- (Polemoniaceae), also endangered (CR) in Japan, ample, Nybom (2004) suggested that the analyses
the values of NA = 3.3, AR = 2.68, HE = 0.40. based on microsatellite maker show that long- Those values were determined using 10 microsat- lived and outcrossing taxa retain most of their ge- ellite loci from seven populations in the Aso re- netic variability within populations. Veronicas- gion (Yokogawa et al. 2013). In Primula sieboldii trum sibiricum var. zuccarinii is considered to be June 2016 Fujii & al.—Conservation genetics of Veronicastrum in Aso 77
capable of outcrossing via insect pollination. of populations of V. sibiricum var. zuccarinii. In From July through August, V. sibiricum var. zuc- small, fragmented populations, random genetic carinii forms spike-form infl orescences with nu- drift will reduce genetic diversity (Frankham et merous, crowded fl owers (Kitamura et al. 1957, al. 2002). In fact, the evidence of genetic drift Yamazaki 1993). Although a detailed study of the was obtained in the Bayesian clustering analysis breeding system of this species has not been per- (Fig. 6), and recent bottlenecks were detected in formed, a related species, V. japonicum (Nakai) the NA1 population (Table 1). However, several T.Yamaz., has hermaphroditic and protandrous generations are required before genetic drift has a fl owers that are pollinated by bumblebees, fl ower signifi cant impact, especially in long-lived peren- fl ies, and butterfl ies (Tanaka 1997, 2009). Similar nial herbaceous plants (Ohara et al. 2006, Tomi- pollinators have also been reported in the related matsu & Ohara 2003). In our observations of the North American species, V. virginicum (L.) Farw underground parts of V. sibiricum var. zuccarinii, (Belt 2011, Levin & Kerster 1969, Vaudo et al. we found evidence of vegetative reproduction by 2014). Preliminary observations revealed that rhizomes (Figs. 2 & 7), suggesting that the indi- both bumblebees and fl ower fl ies visited fl owers viduals of V. sibiricum may persist for relatively among the populations of V. sibiricum var. zucca- long periods. Furthermore, such clonal reproduc- rinii. Therefore, var. zuccarinii is considered to tion may decrease the rate at which alleles are be outbreeding, although it also reproduces veg- lost, enhance heterozygosity, and thereby in- etatively (for a discussion of vegetative reproduc- tion, see below). The breeding systems of var. -1200 zuccarinii may therefore contribute to maintain- ing moderate genetic diversity within popula- tions. Another possible explanation for the moder- -1400 ate genetic diversity observed in Veronicastrum sibiricum var. zuccarinii involves demographic Ln P ( D )
processes (population size changes) in the Aso -1600 region. This semi-natural grassland area has de- creased from approximately 70,000 ha in 1900 to approximately 36,000 ha around 1990 (National Parks Association of Japan 1995, Shoji 2006). -1800 0 1 2 3 4 5 6 7 8 9 10 This loss in area has accelerated during the past K K two decades; the grassland area had been reduced Fig. 5. Distribution of values of log probability of data (Ln to 23,000 ha in 2010 (Takahashi 2010). We there- P(D)) for each cluster (K) ranging from 1 to 9 calculated fore surmise a corresponding decrease in the size by Bayesian clustering.
Cluster 1 F = 0.18 1.0
0.8 Cluster 2 F = 0 FIG. 5. 0.6 Cluster 3 F = 0.39 0.4 Cluster 4 F = 0.29
Proportion 0.2 Cluster 5 F = 0.30
0 NA1 NA2 NA3 NA4 TA1 TA2 KO Cluster 6 F = 0.26 Cluster 7 F = 0.53
Fig. 6. Proportion of membership of clusters in 234 individuals from seven populations of Veronicastrum sibiricum var. zuc- carinii estimated by Bayesian clustering.
FIG. 6. 78 Acta Phytotax. Geobot. Vol. 67
Fig. 7. Horizontally spreading rhizomes were observed below ground in Veronicastrum sibiricum var. zuccarinii. A: Habitat of observed individuals; B: Upside of stock; C: Closeup of rhizomes; D: New shoots for following year.
FIG. 7 crease the effective population size (Balloux et above, the habitat of Veronicastrum sibiricum al. 2003, Bengtsson 2003). Hence, despite severe var. zuccarinii (and other grassland plants) has habitat reduction, the genetic diversity of V. si- decreased due to the decline in semi-natural biricum var. zuccarinii may continue to be main- grassland areas in the Aso region (National Parks tained. Association of Japan 1995). In plants that cannot achieve long-distance gene flow, it is known that Genetic differentiation and habitat fragmenta- greater distances between populations because of tion habitat fragmentation decrease the likelihood of
The values of pairwise FST (indicating degrees gene flow (Primack & Miao 1992, van Dorpet al. of genetic differentiation among populations) 1997, Cain et al. 2000, Soons et al. 2005). Fur- were significantly greater than zero between all thermore, insect-pollinated species with gravity-
population pairs (mean FST = 0.17, Table 4). In ad- based seed dispersal are believed to have de- dition, Bayesian clustering, according to creased gene flow between populations when Pritchard et al. (2000), showed that the clusters of compared with wind-pollinated plants and those highest proportion of membership (Clusters 1–7) with animal- or wind-dispersed seeds (Loveless were different in all populations (Fig. 6). Further- & Hamrick 1984). As mentioned above, the spe- more, both private (Pr) and rare alleles (RA) were cies of Veronicastrum are presumed to be polli- detected in each population (Table 3). Therefore, nated by insects (bumblebees, flower flies, and we consider genetic differentiation to have oc- butterflies) (Tanaka 1997, 2009, Belt 2011, Vaudo curred among populations of Veronicastrum si- et al. 2014). Furthermore, V. sibiricum forms cap- biricum var. zuccarinii. sules with many small (approximately 0.6 mm Over the past several decades, as mentioned long), hemispherical seeds (Yamazaki 1993). We June 2016 Fujii & al.—Conservation genetics of Veronicastrum in Aso 79 surmise that the seeds are mainly dispersed by and we found individuals in the TA2 population gravity because the seeds and capsules lack to be actively capable of vegetative reproduction wind-dispersal appendages. Veronicastrum si- by rhizome (Figs. 2 & 7). By enhancing the vari- biricum var. zuccarinii is most likely pollinated ance in genet size and reducing the opportunities by insects and produces gravity-dispersed seeds, for recombination, such clonal reproduction may making it more susceptible to the effects of habi- also reduce the effective population size and con- tat fragmentation. sequently enhance the magnitude of genetic drift Although we inferred genetic differentiation (Orive 1993, Campbell & Husband 2005). There- among populations of Veronicastrum sibiricum fore, we recommend that continuous monitoring var. zuccarinii, the Mantel test did not reveal a be carried out on the population dynamics of V. pattern of isolation by distance (IBD) (Fig. 3). In sibiricum var. zuccarinii. the case of inter-population differentiation with- In the present analysis, the NA2 and NA1 out IBD, it is estimated that the effects of genetic populations showed higher genetic diversity (NA, drift in each population are greater than those of AR, RA, Pr, and HE) than the other populations gene flow (Hutchison and Templeton 1999). In (Table 3). Furthermore, the degree of genetic drift fact, the Bayesian structure analysis (Fig. 6), in- in the population was estimated to be relatively dicating the degree of genetic drift for each clus- small (F-values = 0 and 0.18) in the Bayesian ter (Falush et al. 2003), showed relatively high F- structure analysis (Fig. 6). Although we do not values, except for Cluster 2 (0.18−0.53), and re- know of any specific factors with respect to the cent bottlenecks were also detected in the NA1 genetic status of the populations, both popula- population (Table 1). Therefore, it is considered tions have been protected as a semi-natural grass- that populations of V. sibiricum var. zuccarinii land for many years. The grasslands have been are greatly affected by genetic drift because of managed by burning and mowing by the Aso habitat fragmentation and differences in genetic Green Stock Foundation, an organization devoted composition among the population are increas- to grassland regeneration (Yamauchi & Taka- ing. hashi 2002). Accordingly, in these populations, suitable genetic traits may be maintained longer Conservation perspective than in other populations. From the viewpoint of We investigated the genetic diversity of Ve- conservation genetics, the NA2 and NA1 popula- ronicastrum sibiricum var. zuccarinii from seven tions are very important and should be preferen- populations, which constitute nearly all the tially conserved, although we should conserve as known populations of this variety in the Aso re- many as possible of the populations, because our gion of Japan. Our study revealed that each popu- analyses showed V. sibiricum var. zuccarinii ex- lation has maintained moderate genetic diversity. hibits significant genetic differentiation among However, we found evidence of significant genet- populations (Tables 3 & 4, Fig. 6). ic differentiation among populations (Table 4). In We estimated the genetic diversity of Veroni- addition, populations of V. sibiricum var. zuccari- castrum sibiricum var. zuccarinii based on the nii in the Aso region are evidently small (estimat- five microsatellite markers used in the present ed roughly as 100–500 ramets/population) (Table study. In general, 10 or more markers are fre- 1). Small, fragmented populations are subject to quently used to evaluate the genetic diversity and extinction or substantial reductions in population structure of a population. It is known that esti- size due to stochastic events (Lande 1993, Mel- mates of average heterozygosity and genetic dis- bourne & Hastings 2008), which may lead to ge- tance are affected by the number of loci analyzed netic erosion depending on the degree to which (Gorman & Renzi 1979, Nei 1978, Nei & Roy- the effective population size is reduced. Further- choudhury 1974, Nybom 2004). Therefore, with more, in most populations, the number of genets respect to these parameters, the results should be is smaller than the number of ramets (Table 3) re-evaluated by increasing the number of markers 80 Acta Phytotax. Geobot. Vol. 67 that are analyzed. tions, Sunderland. Gorman, G. C. & J. Renzi Jr. 1979. Genetic distance and We express special thanks to Messrs Sumio Sei and Hiro- heterozygosity estimates in electrophoretic studies: humi Tsuji for their cooperation in the collection of mate- effects of sample size. Copeia 1979: 242–249. rials in the Aso region. Our hearty thanks are extended to Goudet, J. 1995. FSTAT (version 1.2): a computer pro- Drs. Masayuki Takamiya and Akiko Soejima for their gram to calculate F-statistics. J. Hered. 86: 485–486. valuable suggestions. This study was supported by a Groombridge, B. 1992. Global biodiversity: status of the Grant-in-Aid from the Ministry of Education, Science, earth's living resources. Chapman & Hall, London. and Culture, Japan (No. 20241056 to Y. Isagi). Hamrick, J. L. & M. J. W. Godt. 1996. Effects of life his- tory traits on genetic diversity in plant species. Phi- los. Trans., Ser. B 351: 1291–1298. References Honjo, M., N. Kitamoto, S. Ueno, Y. Tsumura, I. Washi- tani & R. Ohsawa. 2009. Management units of the Balloux, F., L. Lehmann & T. de Meeus. 2003. The popu- endangered herb Primula sieboldii based on micro- lation genetics of clonal and partially clonal diploids. satellite variation among and within populations Genetics 164: 1635–1644. throughout Japan. Conserv. Genet. 10: 257–267. Belt, S. 2011. Plant fact sheet for Culver’s root (Veronicas- Hubisz, M. J., D. Falush, M. Stephens & J. K. Pritchard. trum virginicum). USDA–Natural Resources Conser- 2009. Inferring weak population structure with the vation Service, Norman A. Berg National Plant Mate- assistance of sample group information. Molec. Ecol. rials Center, Beltsville. Resour. 9: 1322–1332. Bengtsson, B. O. 2003. Genetic variation in organisms Hutchison, D. W. & A. R. Templeton. 1999. Correlation of with sexual and asexual reproduction. J. Evol. Biol. pairwise genetic and geographic distance measures: 16: 189–199. inferring the relative influences of gene flow and drift Cain, M. L., B. G. Milligan & A. E. Strand. 2000. Long- on the distribution of genetic variability. Evolution distance seed dispersal in plant populations. Amer. J. 53: 1898–1914. Bot. 87: 1217–1227. Kaneko, S., Y. Isagi & N. Nakagoshi. 2007. Development Campbell, L. & B. Husband. 2005. Impact of clonal of microsatellite markers for Echinops setifer (As- growth on effective population size in Hymenoxys teraceae), an endangered grassland plant species in herbacea (Asteraceae). Heredity 94: 526–532. Japan. Conserv. Genet. 8: 1231–1233. Doyle, J. J. & J. L. Doyle. 1987. A rapid DNA isolation Kaneko, S., S. Sei, Y. Takahashi & Y. Isagi. 2009. The procedure for small quantities of fresh leaf tissue. current status of Echinops setifer Iljin (Asteraceae) Phytochem. Bull. 19: 11–15. on Aso Mountain and Chugoku Mountain regions. Duminil, J., S. Fineschi, A. Hampe, P. Jordano, D. Salvi- Jan. J. Conserv. Ecol. 14: 125–130 (in Japanese). ni, G. G. Vendramin & R. J. Petit. 2007. Can popula- Kery, M., D. Matthies, H. H. Spillman. 2000. Reduced tion genetic structure be predicted from life history fecundity and offspring performance in small popu- traits? Amer. Naturalist 169: 662–672. lations of the declining grassland plants Primula El Mousadik, A. & R. J. Petit. 1996. Chloroplast DNA veris and Gentiana lutea. J. Ecol. 88: 17–30. phylogeography of the argan tree of Morocco. Molec. Kitamura, S., G. Murata & M. Hori. 1957. Colored Illus- Ecol. 5: 547–555. trations of Herbaceous Plants of Japan vol. 1 (Sym- Environment Agency of Japan. 2000. Threatened wildlife petalae), rev. ed. Hoikusha, Osaka (in Japanese). of Japan–Red data book. In: Center JWR (ed.), Vas- Lande, R. 1993. Risks of population extinction from de- cular Plants, vol. 8. Japan Wildlife Research Center, mographic and environmental stochasticity and ran- Tokyo (in Japanese). dom catastrophes. Am. Nat. 142: 911–927. Falush, D., M. Stephens & J. K. Pritchard. 2003. Infer- Lande, R. 1995. Mutation and conservation. Conserv. ence of population structure using multilocus geno- Biol. 9: 782–791. type data: linked loci and correlated allele frequen- Langella, O. 2007. Populations 1.2.30: Population genetic cies. Genetics 164: 1567–1587. software (individuals or populations distances, phy- Frankham, R. 2005. Genetics and extinction. Biol. Con- logenetic trees). France.
using a dual-supression-PCR technique. Molec. Ecol. 1–12. Notes 2: 211–213. Orive, M. E. 1993. Effective population size in organisms Lian, C. L., M. Abdul Wadud, Q. Geng, K. Shimatani & with complex life-histories. Theor. Popul. Biol. 44: T. Hogetsu. 2006. An improved technique for isolat- 316–340. ing codominant compound microsatellite markers. J. Peakall, R. & P. E. Smouse. 2006. GENALEX 6: genetic Pl. Res. 119: 415–417. analysis in Excel. Population genetic software for Lienert, J. 2004. Habitat fragmentation effects on fitness teaching and research. Molec. Ecol. Notes 6: 288– of plant populations – a review. J. Nat. Conserv. 12: 295. 53–72. Pimm, S. L., G. J. Russell, J. L. Gittleman & T. M. Brooks. Loveless, M. D. & J. L. Hamrick. 1984. Ecological deter- 1995. The future of biodiversity. Science-AAAS- minants of genetic structure in plant populations. An- Weekly Paper Edition 269: 347–349. nual Rev. Ecol. Syst. 15: 65–95. Piry, S., G. Luikart & J.-M. Conrnuet. 1999. BOTTLE- Lynch, M. & W. Gabriel. 1990. Mutation load and the sur- NECK: a computer program for detecting recent re- vival of small populations. Evolution 44: 1725–1737. ductions in the effective population size using allele Mantel, N. 1967. The detection of disease clustering and a frequency data. J. Hered. 90: 502–503. generalized regression approach. Cancer Res. 27: Pitman, N. C. & P. M. Jørgensen. 2002. Estimating the 209–220. size of the world's threatened flora. Science 298: 989– Melbourne, B. A. & A. Hastings. 2008. Extinction risk 989. depends strongly on factors contributing to stochas- Primack, R. B. & S. Miao. 1992. Dispersal can limit local ticity. Nature 454: 100–103. plant distribution. Conserv. Biol. 6: 513–519. Ministry of the Environment of Japan. 2007. Red List of Pritchard, J. K., M. Stephens & P. Donnelly. 2000. Infer- threatened wildlife of Japan, Vascular Plants, revised ence of population structure using multilocus geno- edition. Ministry of the Environment of Japan. type data. Genetics 155: 945–959.
management of grassland biodiversity in east Asia. Yamasaki, T., K. Ozeki, N. Fujii, M. Takehara, M. Yok- In: Hong, S.-K., J. A. Lee, B.-S. Ihm, A. Farina, Y. ogawa, S. Kaneko & Y. Isagi. 2013. Genetic diversity Son, E.-S. Kim & J. C. Choe (eds.), Ecological issues and structure of Silene kiusiana (Caryophyllaceae) in in a changing world status, response and strategy II, the Aso region, Kyushu, Japan, revealed by novel nu- pp. 157–172. Kluwer Academic Publishers, Dor- clear microsatellite markers. Acta Phytotax. Geobot. drecht. 63: 107–120. van Dorp, D., P. Schippers & J. M. van Groenendael. Yamauchi, Y. & Y. Takahashi. 2002. Citizens' participa- 1997. Migration rates of grassland plants along cor- tion in conservation activities of Aso grassland. ridors in fragmented landscapes assessed with a cel- Grassland Science 48: 290–298 (in Japanese). lular automation model. Landsc. Ecology 12: 39–50. Yamazaki, T. 1993. Veronicastrum Heist. ex Fabr. In: Vaudo, A. D., H. M. Patch, D. A. Mortensen, C. M. Groz- Iwatsuki, K., T. Yamazaki, D. E. Boufford & H. Ohba inger & J. F. Tooker. 2014. Bumble bees exhibit daily (eds.), Flora of Japan IIIa, pp. 344–347. Kodansha, behavioral patterns in pollen foraging. Arthropod- Tokyo. Plant Interactions 8: 273–283. Yokogawa, M., S. Kaneko, Y. Takahashi & Y. Isagi. 2013. Weir, B. S. & C. C. Cockerham. 1984. Estimating F-sta- Genetic consequences of rapid population decline tistics for the analysis of population structure. Evolu- and restoration of the critically endangered herb Pol- tion 38: 1358–1370. emonium kiushianum. Biol. Conserv. 157: 401–408.
Received April 4, 2015; accepted December 17, 2015