•k Original paper•l

Comparative mapping and structural analysis of a FOX gene cluster on bovine chromosome 18

Abdol Rahim ABBASI 1, 3, Maryam KHALAJ 1, GERILETUYA 1, Naoya IHARA 2, Yoshikazu SUGIMOTO 2 and Tetsuo KUNIEDA 1

1 Graduate School of Natural Science and Technology , Okayama University, Okayama, Japan. 2 Shirakawa Institute of Animal Genetics , Nishi-shirakawa, Fukushima, Japan. 3 Department of Animal Science , College of Agriculture, Isfahan university of Technology, Isfahan, Iran

ABSTRACT FOX genes encode a family of transcription factors which play important roles during early development and in

regulation of metabolic homeostasis in mammals. Some members of the gene family, including FOXC2, FOXF1, and FOXL1

genes comprise a gene cluster on particular regions of human and mouse chromosomes. In this paper, we report chromosomal localization and structure of bovine FOXC2, FOXF1 and FOXL1 gene cluster and comparative analysis of the gene cluster in

cattle, human, and mouse, which were performed by a combination of in silico database searching and in vitro sequencing and

mapping experiments. BLAST search of cattle database with cDNA sequences of human and mouse FOXC2, FOXF1 and

FOXL1 genes identified several ESTs which represent cattle cDNAs of these genes. Radiation hybrid mapping of these cattle

cDNAs revealed that the bovine FOXC2, FOXL1, and FOXF1 genes are localized on the proximal region of bovine

chromosome 18 and form a gene cluster. A comparative map of the region including the FOX gene cluster between cattle and

human indicated that the localization of these genes on cattle chromosome is in concordant with those in the corresponding

human chromosome. Then, we identified a contig of BAC draft sequences containing genomic sequences of these genes by

MEGABLAST search of a cattle genome database using the cattle cDNA sequences. Complete genomic sequences of these

genes were determined by cloning and sequencing of a part of genomic region in which the nucleotide sequences could not be obtained from the published BAC draft sequences. A comparison of the nucleotide sequences of the cattle, human, and mouse

FOX gene clusters showed highly conserved structure of the cluster in mammalian species and identified some potential

regulatory regions which are conserved in mammalian species.

Key words: FOX gene, RH mapping, comparative map, cattle, gene cluster

Introduction clusters of the gene family have been reported. For Forkhead proteins belong to a large family of example, human FOXF1, FOXC2, and FOXL1 genes are transcription factors, characterized by an evolutionary closely linked each other and comprise a gene cluster on conserved DNA binding domain known as winged helix human chromosome (HSA) 16q24.1. This cluster is also (Kaestner et al. 1993). FOX (Forkhead box) has been conserved on mouse chromosome (MMU) 8 (Carlsson and adopted for all chordate winged helix/forkhead transcription Mahlapuu 2002; Keastner et al. 1996). factors, which are classified into A to Q subgroups according to phylogenetic analysis of the FOX genes (Keastner et al. 2000; http://www.biology.pomona.edu/fox. html). The members of the FOX gene family are distributed Correspondence: T. Kunieda, Graduate School of Natural Science and Technology, Okayama University, Tsushima-naka, Okayama 700- throughout the chromosomes and generally do not form 8530, Japan (e-mail: [email protected]) physically linked gene clusters, but some exceptional Received 16 March 2005; accepted for publication 13 April 2005.

Journal of Animal Genetics (2005) 32(2),13-20 13 A. R. Abbasi et al.

The FOX transcription factors have been reported to method to determine genomic structure of particular genes play important roles during early development of mammals of interest. In the present study, a combination of in silico by regulating growth, differentiation and apoptosis of cells and in vitro analyses was applied to investigate the

(Carlsson and Mahlapuu 2002; Lehmann et al. 2003). On chromosomal localization and genomic structure of the the other hand, some of the FOX proteins play a role in FOX gene cluster. maintaining normal metabolic homeostasis of adult

differentiated tissues, which is completely distinct from Materials and Methods those during development. Particularly, FOXC2 was Identification and comparison of bovine ESTs reported to be an important transcription factor as a key To identify ESTs for bovine FOXC2, FOXF1, and regulator of adipocyte metabolism (Cederberg et al. 2001). FOXL1 genes, we performed BLASTN search of bovine

The expression of the FoxC2 gene in mouse is restricted in dbEST using the sequences of human and mouse FOXC2,

adipose tissue and overexpression of the gene in adipose FOXF1, and FOXL1 genes. Alignments and comparison of

tissue results in lean and insulin sensitive phenotype, amino acid sequences of the bovine ESTs with those of

through attenuation of white adipose tissue and formation of human and mouse FOXC2 genes were performed using

brown adipose tissue (Davis et al. 2004) with elevated GENETYX software (HITACHI Software).

expression of the genes for insulin action of the adipocytes

(Cederberg et al. 2001; Gronning et al. 2002; Flier 2004). RH mapping

The functions of FOXC2 gene in development and A 7000-rad bovine-hamster whole genome radiation

metabolism of adipose tissues makes it a potential candidate hybrid (RH) panel (Itoh et al. 2005) was used to localize the

gene associated with obesity and diabetes in human (Kovacs FOX genes and microsatellite DNA on BAC sequence with

et al. 2003; Ridderstrale et al. 2002). The function of the cattle specific primers for these sequences (FOXC2, 5'-

GATGGCTGTGCTCACTGCTCC -3' and 5'-TGTACAG gene also suggests that the FOXC2 gene might be a

candidate gene for economic traits of farm animals GGAAGGGAGGAAACC-3'; FOXL1, 5'- CTTCCACCA

including beef marbling and fat deposition. In this paper, we CTGGGAAAGAAG-3' and 5'- GCGGTAGGAGGTCTGA

report the chromosomal localization and structure of bovine GATGC-3'; FOXF1, 5'- CTTTCAACACCATGGCATCC

FOXC2, FOXF1 and FOXL1 gene cluster, and comparative TCG-3' and 5'- GACCTCGATCGGTCTTTGCCTC -3';

analysis of the cluster in cattle, human, and mouse. and micorsatellite DNA, 5'- AGTCTCTCAGGGCAACA

Recently, whole genome sequences of several CTTC -3' and 5'- TTCTTCGCTACATTTCCTACCA-3').

mammalian species including human and mouse have been Published mcrosatellite markers on BTA18 (UWCA28 and

BMS2355) was also subjected to the RH mapping. PCR published and the sequence information is now available

from genome databases. The availability of these genomic amplification was carried out in a 15 ƒÊl-reaction mixture

sequences allow us to perform •gin silico•h analysis of the containing 20 ng DNA of each clone of the RH panel, 0.2

ƒÊ M each oligonucleotide primers, 0.2mM each of dNTPs, genes of these species by database searching. On the other

hand, whole genome sequencing of cattle has still not yet 1.5mM MgCL2 and 0.375 unit of AmpliTaq Gold DNA

been completed, but partial draft sequences of bacterial polymerase. After the initial deneturation at 94 •Ž for 10

artificial chromosome (BAC) contigs and sequences of min, 40 cycles of amplification were performed each

various expressed sequence tags (ESTs) have been consisting of denaturation for 30 s at 94 t, annealing for

published in this species. Although the complete in silico 30s at 55 - 60 •Ž , and extension for 30 s at 72 t followed

analysis of cattle gene could not be achieved in the current by a final elongation step of 7 min at 72 •Ž . The PCR

status of whole genome sequencing of the cattle, a products were electrophoresed through a 2 % agarose gel

combination of in silico analysis by searching partial BAC and stained with ethidium bromide. PCR amplification and

draft sequences and EST sequences in databases and in vitro gel electrophoresis were performed at least twice and the

analysis by sequencing regions of the cattle geneome in results were scored for present, absent or ambiguous. The

which sequence information has not yet been obtained from scored results were analyzed by RHMAPPER software to

databases is likely to be the most effective and reliable determine ordering and localization of the genes.

Journal of Animal Genetics (2005) 32(2),13-20 14 Comparative analysis of bovine FOX gene

Identification of BAC clones FOXL1 (NM 005250 and NM 008024) genes identified a To identify BAC clones containing FOX genes, we bovine EST (CN435463) for FOXC2 gene, at least four performed MEGABLAST search of a genome database bovine ESTs (CN790798, CB454790, CB456366, and (Cow Genome Databesa) using the cattle EST sequences. CK836076) for FOXF1 gene, and three bovine ESTs All of repeat sequences within the sequences were masked (CB465507, CN440604, BE665899) for FOXL1 gene. To by RepeatMasker program (http://www.repeatmasker.org/) confirm the authenticity of the similarity between the before BLAST homology searches (Altschul et al. 1990) bovine ESTs and human or mouse cDNAs, we performed and pairwise BLAST analysis (Tatusova and Madden 1999) BLAST analysis using the sequence of the bovine ESTs for aligning the BAC sequences. against the human and mouse genome in the database. The The open reading frames of the bovine FOX genes results indicated highest similarity between the bovine ESTs were predicted by GrailEXP (http://compbio.ornl.gov) and and the corresponding human or mouse cDNAs. Therefore, GENSCAN (http://genes.mit.edu/GENSCAN.html) (Burg these ESTs were confirmed to be the cDNAs of bovine and Karlin 1997) on bovine BAC sequence. Alignments and FOXC2, FOXL1, and FOXF1 genes. comparison of genomic sequences of the cattle, human and The cDNAs of bovine FOXC2, FOXL1, and FOXF1 mouse FOX gene cluster were performed using VISTA genes contained 1509, 1041, and 1065-bp open reading program (Dubchak et al. 2000). frames, respectively. The predicted amino acid sequences of these bovine genes demonstrated high sequence similarity

Sequencing a gap region with their mammalian orthologs. As shown in Fig. 1, an

To determine the nucleotide sequence of a gap in the alignment of amino acid sequences of FOXC2 showed high

BAC draft sequence, we designed a pair of primers flanking sequence similarity among the FOXC2 genes of these the gap region (5 ' -TCAGGCTGCCTGGAAGTGGAG-3' species. In particular, the amino acid sequences of the and 5' -AAAACTGCTGAGGGAGTGGTG-3') to amplify forkhead box domain were completely identical among the fragment containing the gap region. PCR amplification these species indicating functional importance of the

was carried out in a 30 jl-reaction mixture containing 30 ng forkhead box domain in the proteins. The similar results

genomic DNA of Japanese black cattle, 0.2 ƒÊM each were also obtained in the FOXL1 and FOXF1 genes (data oligonucleotide primers, 0.2 mM each of dNTPs, 1.5 mM not shown). MgCl2 and 0.75 unit of Taq DNA polymerase. After the Next, we performed RH mapping of these bovine

initial deneturation at 94 •Ž for 5 min, 35 cycles of ESTs to determine the chromosomal localization of the

amplification were performed each consisting of bovine FOX genes. The published comparative maps of

denaturation for 30 s at 94 •Ž , annealing for 30s at 60 •Ž cattle, human and mouse indicated that the proximal region

and extension for 30 s at 72 •Ž followed by a final of BTA18 is the evolutionally conserved ortholog of the

elongation step of 7 min at 72 •Ž . The PCR product was regions of HSA16 and MMU8 (Everts-van der Wind et al.

purified by gel electrophoresis and cloned into pGEM Easy 2004; Goldammer et al. 2002) on which the FOXC2,

vector (Promega) according to manufacture's instruction. FOXL1, and FOXF1 genes have been localized. Therefore,

Sequencing was performed on the ABI310 DNA sequencer two microsatelite markers (UWCA28 and BMS2355) on the

(Applied Biosystems) by dye-terminator method. proximal region of BTA18 (Ihara et al. 2004; Kappes et al. 1997), were also subjected to the RH mapping. Screening of Results and Discussion a 7000-rad bovine-hamster whole genome RH panel using In the first step of this study, we searched ESTs specific primers for these bovine ESTs (CN435463, encoding cDNAs of bovine FOXC2, FOXLJ, and FOXFJ CN790798, and CB465507) and the microsatellite markers genes by in silico database search using human and mouse assigned these ESTs on the same location on bovine sequences. BLASTN search of bovine dbEST database genome and the genes were flanked by two microsatellite using complete cDNA sequences of human and mouse markers with 5.88 cR and 11.33 cR apart from UWCA28 FOXC2 (GenBank accession numbers: NM_005251 and and BMS2355, respectively. These findings clearly NM_013519), FOXF1 (NM_001451 and NM_010426), and indicated that the bovine FOXC2, FOXL1, and FOXF1

Journal of Animal Genetics (2005) 32(2),13-20 15 A. R. Abbasi et al.

Fig. 1. Comparision of predicted amino acid sequences of cattle, human and mouse FOXC2. The alignment was obtained using GENETYX software. The conserved residues are shown by dots and blanks are indicated by bar. The fokhead box domain is boxed. The domain is identical in mouse, cattle and human FOXC2.

genes were localized on the proximal region of BTA18 and working draft sequence (AC 150991) containing these comprise a gene cluster like human and mouse. As shown in cDNA sequences was identified. Then, we searched the Fig. 2, a comparison of the obtained RH map with database again with approximately 2000-bp end sequences published linkage (Ihara et al. 2004; Kappes et al. 1997) of the BAC clone and identified other two BAC draft and RH (Everts-van der Wind et al. 2004; Goldammer et al. sequences. Therefore, we obtained a BAC contig comprised 2002; Itoh et al. 2005) maps of BTA18 and human genome of three overlapping BAC sequences, CH240-196n10 map revealed that the localization of these genes on the (AC 150991), CH240-248M 16 (AC 151427) and CH240- BTA18 is in concordant with those on HSA16. 109B14 (AC150514). To confirm the localization of these Next, we searched bovine BAC clones containing BAC sequences on BTA18, we performed RH mapping of FOXC2, FOXF1, and FOXL1 genes by A MEGABLAST BAC clones using primers for a microsatellite DNA in one search of Cow Genome Database using the nucleotide of the BAC sequences (AC 150514). The results confirmed sequences of the bovine cDNAs to reveal the genomic the localization of the BAC contig on BTA18 at the same structure of these genes. Consequently, a bovine BAC clone position as these cDNAs. Therefore, the contig appeared to

Journal of Animal Genetics (2005) 32(2), 13-20 16 Comparative analysis of bovine FOX gene

(A) FOXgene cluster (B) BTA18 (C) BTA18RH map (D) HSA16q on BTA18 linkage map

Fig. 2. Comparative map of the regions containing the FOX gene cluster on BTA18 and the corresponding region of HSA16 . (A) The RH map showing the positions of the FOX gene cluster with relative position with microsatellite markers on BTA18 (BMS1322 and UWCA28) obtained in the present study. (B) A partial linkage map of the proximal region of BTA18 (Ihara et al. 2004; Kappes et al. 1997). (C) A partial RH map showing the relation between the microsatellite markers and functional genes on BTA18 (Goldammer et al. 2002, Everts-van der Wind et al . 2004). (D) Localization of functional gene including FOX genes on HSA16 (http://www.ncbi.nlm.nih.gov/). Comparison of these maps indicates that the region of BTA18, in which the FOX genes were mapped, corresponds to that of HSA16.

cover approximately 560-kb region of the proximal region determined. The obtained sequence of the gap contained a of BTA18. 365-bp sequence identical to that of a 3' part of bovine These draft sequence of the BAC contig contained FOXF1 cDNA sequence. Therefore, entire sequence of the entire coding region of the FOXC2 and FOXL1 genes and FOXF1 gene including exon 1, intron 1, and exon 2 was exon 1 of the FOXF1 gene, but did not contain exon 2 of identified by the combined in silico and in vitro analyses in the gene. The BAC draft sequences had several gaps, in this study. A comparison of the cDNA sequence of the which the nucleotide sequence have not yet been bovine FOXC2, FOXL1, and FOXF1 genes with the BAC determined, and exon 2 of the FOXFI gene was likely to be sequence revealed the exon-intron structure, order, and involved in one of these gaps. Therefore, we determined the relative position of these genes. The bovine FOXC2 and nucleotide sequence of a gap located at the 3' region of the FOXL1 genes are GC-rich intronless genes while the exon 1 of FOXF1 gene to identify exon 2 of the gene. The FOXF1 gene contains two exons with an intron downstream PCR amplification using primers flanking the gap region of the forkhead domain. The splice donor and acceptor sites amplified a 631-bp fragment. The amplified fragment was of bovine FOXF1 gene agree with the GT/AG rule. These cloned into pGEM vector and their nucleotide sequence was structure and sizes of the FOX genes are the same as those

Journal of Animal Genetics (2005) 32(2),13-20 17 A. R. Abbasi et al.

of the human and mouse genes. sequences playing an important role in the regulation of the

Then we compared and aligned the nucleotide genes, such as enhancers or silencers. The results of the sequences of the bovine BAC contig with the genomic alignment also showed higher similarity of the nucleotide sequence of human or mouse FOX gene cluster. As shown sequences between cattle and human than those between in Fig. 3, the relative position, orientation, and exon-intron human and mouse. This result was in concordant with

structure of the genes and distances between genes were generally accepted phylogenetic relation of primate, rodent conserved among these mammalian species. It is to be noted and, ungulate. that a series of sequences, which are likely to be a In the present study, we identified the genomic functional gene, has been reported in the FOX gene clusters structure of the cluster of the bovine FOX genes and of human and mouse. As shown in Fig. 3, seven stretches of compared the structure with those of human and mouse. Our sequence which are identical to parts of a human results indicated that the cluster is highly conserved among hypothetical protein with unknown function, FLJ 12998 mammalian species and there are some conserved regions (Strausberg et al. 2002), have been identified in the region beside the exons, which could be common regulatory between the FOXF1 and FOXC2 genes. These sequences regions of the genes. As the FOX genes plays an important were also conserved in the cattle sequence. These sequences role in development and metabolism of adipose tissues and of cattle are, therefore, likely to be exons of bovine could be candidate genes for the economical traits of farm homolog of FLJ 12998. Furthermore, there were several animals, further investigation of these potential regulatory regions other than the exons of these genes, which were regions will provide useful information on the function of highly conserved among these mammalian species. these genes on the economical traits. Particularly, the 5' and 3' adjacent regions of FOXC2 gene As demonstrated in this study, the combination of were highly conserved between cattle and human. These the in silico and in vitro analysis of the FOX gene cluster conserved regions were predicted to be some functional was effective to determine the genomic structure of the

Fig. 3. Pairwise comparative analysis of the cattle/ human (upper) and human/mouse (lower) genomic sequences of the FOX gene clusters. The alignment and comparison of the sequences were performed by VISTA program. The Y-axis shows the %identity in a 100-bp window. Arrows indicate the regions and orientations of the genes and gray boxes on the arrows denote exons. Numbers at the bottom indicate positions in human genome sequence.

Journal of Animal Genetics (2005) 32(2),13-20 18 Comparative analysis of bovine FOX gene

cluster. The whole genome sequencing of the cattle is now Gronning LM, Cederberg A, Miura N, Enerback S, Tasken

underway and will be completed in near future. After K. 2002. Insulin and TNF alpha induce expression of

completing whole genome sequencing and being published the forkhead transcription factor gene Foxc2 in 3T3-L1

the genome database of cattle with reliable annotation, adipocytes via P13K and ERK 1/2-dependent pathways.

sequencing genomic regions of particular cattle genes will Mol. Endocrinol.,16: 873-883.

be unnecessary as in the cases of human and mouse, but the Ihara N, Takasuga A, Mizoshita K,Takeda H, Sugimoto M,

combination of in silico and in vitro analysis should be Mizoguchi Y, Hirano T, Itoh T, Watanabe T, Reed

currently the most effective and reliable method for KM, Snelling WM, Kappes SM, Beattie CW, Bennett analyzing genomic sequences of cattle genes. GL, Sugimoto Y. 2004. A comprehensive genetic map

of the cattle genome based on 3802 microsatellites.

References Genome Res.,14: 1987-1998.

Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Itoh T, Watanabe T, Ihara N, Mariani P, Beattie CW,

1990. Basic local alignment search tool. J. Mol. Bio., Sugimoto Y, Takasuga A. 2005. A comprehensive

215: 403-410. radiation hybrid map of the bovine genome comprising

Burge C, Karlin S. 1997. Prediction of complete gene 5593 loci. Genomics. 85: 413-424.

structures in human genomic DNA. J. Mol. Biol., 268: Kaestner KH, Lee KH, Schlondorff J, Hiemisch H,

78-94. Monaghan AP, Schutz G. 1993. Six members of the

Carlsson P, Mahlapuu M. 2002. Forkhead transcription mouse forkhead gene family are developmentally

factors: key players in development and metabolism. regulated. Proc Natl Acad Sci U S A., 90: 7628-7631.

Dev. Biol., 250: 1-23. Kaestner KH, Bleckmann SC, Monaghan AP, Schlondorff

Cederberg A, Gronning LM, Ahren B, Tasken K, Carlson P, J, Mincheva A, Lichter P, Schutz G. 1996. Clustered

Enerback S. 2001. FOXC2 is a winged helix gene that arrangement of winged helix genes fkh-6 and MFH-1:

counteracts obesity, hypertriglyceridemia, and diet possible implications for mesoderm development. induced insulin resistance. Cell, 106: 563-573. Development, 122: 1751-1758.

Dubchak I, Brudno M, Loots GG, Pachter L, Mayor C, Kaestner KH, Knochel W, Martinez DE. 2000. Unified

Rubin EM, Frazer KA. 2000. Active conservation of nomenclature for the winged helix/forkhead

noncoding sequences revealed by three-way species transcription factors. Genes Dev., 14: 142-146.

comparisons. Genome Res., 10: 1304-1306. Kappes SM, Keele JW, Stone RT, McGraw RA, Son

Davis K, Molds M, Farmer SR. 2004. The forkhead stegard TS, Smith TP, Lopez-Corrales NL, Beattie CW.

transcription factor FoxC2 inhibits white adipocyte 1997. A second-generation linkage map of the bovine

differentiation. J. Biol. Chem., 279, 42453-42461. genome. Genome Res., 7: 235-249. Everts-van der Wind A, Kata SR, Band MR, Rebeiz M, Kovacs P, Lehn-Stefan A, Stumvoll M, Bogardus C, Baier Larkin DM, Everts RE, Green CA, Liu L, Nataraj an S, LJ. 2003. Genetic variation in the human winged

Goldammer T, Lee JH, McKay S, Womack JE, Lewin helixlforkhead transcription factor gene FOXC2 in

HA. 2004. A 1,463 gene cattle-human comparative Pima Indians. Diabetes, 52:1292-1295.

map with anchor points defined by human genome Lehmann, OJ, Sowden JC, Carlsson P, Jordan T,

sequence coordinates. Genome Res., 14: 1424-1437. Bhattacharya SS. 2003. Foxs in development and

Flier JS. 2004. Obesity wars: molecular progress confronts disease. Trends Genet., 19: 339-344.

an expanding epidemic. Cell, 116: 337-350. Ridderstrale M, Carlson E, Klannemark M, Cederberg A,

Goldammer T, Kata SR, Brunner RM, Dorroch U, Kosters C, Tornqvist H, Storgaard H, Vaag A,

Sanftleben H, Schwerin M, Womack JE. 2002. A Enerback S, Groop L. 2002. FOXC2 mRNA

comparative radiation hybrid map of bovine expression and a 5' untranslated region polymorphism

chromosome 18 and homologous chromosomes in of the gene are associated with insulin resistance.

human and mice. Proc. Natl. Acad. Sci. U. S. A.. 99: Diabetes, 51: 3554-3559.

2106-2111. Strausberg RL, Feingold EA, Grouse LH, Derge JG,

Journal of Animal Genetics (2005) 32(2),13-20 19 A. R. Abbasi et al.

Klausner RD, Collins FS, Wagner L, Shenmen CM,

Schuler GD, Altschul SF, Zeeberg B, Buetow KH,

Schaefer CF, Bhat NK, Hopkins RF, Jordan H, Moore

T, Max SI, Wang J, Hsieh F, Diatchenko L, Marusina K, Farmer AA, Rubin GM, Hong L, Stapleton M,

Soares MB, Bonaldo MF, Casavant TL, Scheetz TE,

Brownstein MJ, Usdin TB, Toshiyuki S, Carninci P,

Prange C, Raha SS, Loquellano NA, Peters GJ,

Abramson RD, Mullahy SJ, Bosak SA, McEwan PJ, McKernan KJ, Malek JA, Gunaratne PH, Richards S,

Worley KC, Hale S, Garcia AM, Gay LJ, Hulyk SW,

Villalon DK, Muzny DM, Sodergren EJ, Lu X, Gibbs

RA, Fahey J, Helton E, Ketteman M, Madan A,

Rodrigues S, Sanchez A, Whiting M, Madan A, Young

AC, Shevchenko Y, Bouffard GG, Blakesley RW,

Touchman JW, Green ED, Dickson MC, Rodriguez

AC, Grimwood J, Schmutz J, Myers RM, Butterfield

YS, Krzywinski MI, Skalska U, Smailus DE, Schnerch

A, Schein JE, Jones SJ, Marra MA; Mammalian Gene

Collection Program Team. 2002. Generation and initial analysis of more than 15,000 full-length human

and mouse cDNA sequences. Proc. Natl. Acad. Sci.

U.S.A. 99: 16899-16903.

Tatusova TA, Madden TL. 1999. Blast 2 sequences - a

new tool for comparing protein and nucleotide

sequences. FEMS Microbiol Lett.,174: 247-250.

Journal of Animal Genetics (2005) 32(2),13-20 20