DOCSLIB.ORG

Comparative Mapping and Structural Analysis of a FOX Gene Cluster on Bovine Chromosome 18

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Comparative Mapping and Structural Analysis of a FOX Gene Cluster on Bovine Chromosome 18 •k Original paper•l Comparative mapping and structural analysis of a FOX gene cluster on bovine chromosome 18 Abdol Rahim ABBASI 1, 3, Maryam KHALAJ 1, GERILETUYA 1, Naoya IHARA 2, Yoshikazu SUGIMOTO 2 and Tetsuo KUNIEDA 1 1 Graduate School of Natural Science and Technology , Okayama University, Okayama, Japan. 2 Shirakawa Institute of Animal Genetics , Nishi-shirakawa, Fukushima, Japan. 3 Department of Animal Science , College of Agriculture, Isfahan university of Technology, Isfahan, Iran ABSTRACT FOX genes encode a family of transcription factors which play important roles during early development and in regulation of metabolic homeostasis in mammals. Some members of the gene family, including FOXC2, FOXF1, and FOXL1 genes comprise a gene cluster on particular regions of human and mouse chromosomes. In this paper, we report chromosomal localization and structure of bovine FOXC2, FOXF1 and FOXL1 gene cluster and comparative analysis of the gene cluster in cattle, human, and mouse, which were performed by a combination of in silico database searching and in vitro sequencing and mapping experiments. BLAST search of cattle database with cDNA sequences of human and mouse FOXC2, FOXF1 and FOXL1 genes identified several ESTs which represent cattle cDNAs of these genes. Radiation hybrid mapping of these cattle cDNAs revealed that the bovine FOXC2, FOXL1, and FOXF1 genes are localized on the proximal region of bovine chromosome 18 and form a gene cluster. A comparative map of the region including the FOX gene cluster between cattle and human indicated that the localization of these genes on cattle chromosome is in concordant with those in the corresponding human chromosome. Then, we identified a contig of BAC draft sequences containing genomic sequences of these genes by MEGABLAST search of a cattle genome database using the cattle cDNA sequences. Complete genomic sequences of these genes were determined by cloning and sequencing of a part of genomic region in which the nucleotide sequences could not be obtained from the published BAC draft sequences. A comparison of the nucleotide sequences of the cattle, human, and mouse FOX gene clusters showed highly conserved structure of the cluster in mammalian species and identified some potential regulatory regions which are conserved in mammalian species. Key words: FOX gene, RH mapping, comparative map, cattle, gene cluster Introduction clusters of the gene family have been reported. For Forkhead proteins belong to a large family of example, human FOXF1, FOXC2, and FOXL1 genes are transcription factors, characterized by an evolutionary closely linked each other and comprise a gene cluster on conserved DNA binding domain known as winged helix human chromosome (HSA) 16q24.1. This cluster is also (Kaestner et al. 1993). FOX (Forkhead box) has been conserved on mouse chromosome (MMU) 8 (Carlsson and adopted for all chordate winged helix/forkhead transcription Mahlapuu 2002; Keastner et al. 1996). factors, which are classified into A to Q subgroups according to phylogenetic analysis of the FOX genes (Keastner et al. 2000; http://www.biology.pomona.edu/fox. html). The members of the FOX gene family are distributed Correspondence: T. Kunieda, Graduate School of Natural Science and Technology, Okayama University, Tsushima-naka, Okayama 700- throughout the chromosomes and generally do not form 8530, Japan (e-mail: [email protected]) physically linked gene clusters, but some exceptional Received 16 March 2005; accepted for publication 13 April 2005. Journal of Animal Genetics (2005) 32(2),13-20 13 A. R. Abbasi et al. The FOX transcription factors have been reported to method to determine genomic structure of particular genes play important roles during early development of mammals of interest. In the present study, a combination of in silico by regulating growth, differentiation and apoptosis of cells and in vitro analyses was applied to investigate the (Carlsson and Mahlapuu 2002; Lehmann et al. 2003). On chromosomal localization and genomic structure of the the other hand, some of the FOX proteins play a role in FOX gene cluster. maintaining normal metabolic homeostasis of adult differentiated tissues, which is completely distinct from Materials and Methods those during development. Particularly, FOXC2 was Identification and comparison of bovine ESTs reported to be an important transcription factor as a key To identify ESTs for bovine FOXC2, FOXF1, and regulator of adipocyte metabolism (Cederberg et al. 2001). FOXL1 genes, we performed BLASTN search of bovine The expression of the FoxC2 gene in mouse is restricted in dbEST using the sequences of human and mouse FOXC2, adipose tissue and overexpression of the gene in adipose FOXF1, and FOXL1 genes. Alignments and comparison of tissue results in lean and insulin sensitive phenotype, amino acid sequences of the bovine ESTs with those of through attenuation of white adipose tissue and formation of human and mouse FOXC2 genes were performed using brown adipose tissue (Davis et al. 2004) with elevated GENETYX software (HITACHI Software). expression of the genes for insulin action of the adipocytes (Cederberg et al. 2001; Gronning et al. 2002; Flier 2004). RH mapping The functions of FOXC2 gene in development and A 7000-rad bovine-hamster whole genome radiation metabolism of adipose tissues makes it a potential candidate hybrid (RH) panel (Itoh et al. 2005) was used to localize the gene associated with obesity and diabetes in human (Kovacs FOX genes and microsatellite DNA on BAC sequence with et al. 2003; Ridderstrale et al. 2002). The function of the cattle specific primers for these sequences (FOXC2, 5'- GATGGCTGTGCTCACTGCTCC -3' and 5'-TGTACAG gene also suggests that the FOXC2 gene might be a candidate gene for economic traits of farm animals GGAAGGGAGGAAACC-3'; FOXL1, 5'- CTTCCACCA including beef marbling and fat deposition. In this paper, we CTGGGAAAGAAG-3' and 5'- GCGGTAGGAGGTCTGA report the chromosomal localization and structure of bovine GATGC-3'; FOXF1, 5'- CTTTCAACACCATGGCATCC FOXC2, FOXF1 and FOXL1 gene cluster, and comparative TCG-3' and 5'- GACCTCGATCGGTCTTTGCCTC -3'; analysis of the cluster in cattle, human, and mouse. and micorsatellite DNA, 5'- AGTCTCTCAGGGCAACA Recently, whole genome sequences of several CTTC -3' and 5'- TTCTTCGCTACATTTCCTACCA-3'). mammalian species including human and mouse have been Published mcrosatellite markers on BTA18 (UWCA28 and BMS2355) was also subjected to the RH mapping. PCR published and the sequence information is now available from genome databases. The availability of these genomic amplification was carried out in a 15 ƒÊl-reaction mixture sequences allow us to perform •gin silico•h analysis of the containing 20 ng DNA of each clone of the RH panel, 0.2 ƒÊ M each oligonucleotide primers, 0.2mM each of dNTPs, genes of these species by database searching. On the other hand, whole genome sequencing of cattle has still not yet 1.5mM MgCL2 and 0.375 unit of AmpliTaq Gold DNA been completed, but partial draft sequences of bacterial polymerase. After the initial deneturation at 94 •Ž for 10 artificial chromosome (BAC) contigs and sequences of min, 40 cycles of amplification were performed each various expressed sequence tags (ESTs) have been consisting of denaturation for 30 s at 94 t, annealing for published in this species. Although the complete in silico 30s at 55 - 60 •Ž , and extension for 30 s at 72 t followed analysis of cattle gene could not be achieved in the current by a final elongation step of 7 min at 72 •Ž . The PCR status of whole genome sequencing of the cattle, a products were electrophoresed through a 2 % agarose gel combination of in silico analysis by searching partial BAC and stained with ethidium bromide. PCR amplification and draft sequences and EST sequences in databases and in vitro gel electrophoresis were performed at least twice and the analysis by sequencing regions of the cattle geneome in results were scored for present, absent or ambiguous. The which sequence information has not yet been obtained from scored results were analyzed by RHMAPPER software to databases is likely to be the most effective and reliable determine ordering and localization of the genes. Journal of Animal Genetics (2005) 32(2),13-20 14 Comparative analysis of bovine FOX gene Identification of BAC clones FOXL1 (NM 005250 and NM 008024) genes identified a To identify BAC clones containing FOX genes, we bovine EST (CN435463) for FOXC2 gene, at least four performed MEGABLAST search of a genome database bovine ESTs (CN790798, CB454790, CB456366, and (Cow Genome Databesa) using the cattle EST sequences. CK836076) for FOXF1 gene, and three bovine ESTs All of repeat sequences within the sequences were masked (CB465507, CN440604, BE665899) for FOXL1 gene. To by RepeatMasker program (http://www.repeatmasker.org/) confirm the authenticity of the similarity between the before BLAST homology searches (Altschul et al. 1990) bovine ESTs and human or mouse cDNAs, we performed and pairwise BLAST analysis (Tatusova and Madden 1999) BLAST analysis using the sequence of the bovine ESTs for aligning the BAC sequences. against the human and mouse genome in the database. The The open reading frames of the bovine FOX genes results indicated highest similarity between the bovine ESTs were predicted by GrailEXP (http://compbio.ornl.gov) and and the corresponding human or mouse cDNAs. Therefore, GENSCAN (http://genes.mit.edu/GENSCAN.html) (Burg these ESTs were confirmed to be the cDNAs of bovine and Karlin 1997) on
Load more

Recommended publications
  • RESEARCH ARTICLES Gene Cluster Statistics with Gene Families
    RESEARCH ARTICLES Gene Cluster Statistics with Gene Families Narayanan Raghupathy*1 and Dannie Durand* *Department of Biological Sciences, Carnegie Mellon University, Pittsburgh, PA; and Department of Computer Science, Carnegie Mellon University, Pittsburgh, PA Identifying genomic regions that descended from a common ancestor is important for understanding the function and evolution of genomes. In distantly related genomes, clusters of homologous gene pairs are evidence of candidate homologous regions. Demonstrating the statistical significance of such ‘‘gene clusters’’ is an essential component of comparative genomic analyses. However, currently there are no practical statistical tests for gene clusters that model the influence of the number of homologs in each gene family on cluster significance. In this work, we demonstrate empirically that failure to incorporate gene family size in gene cluster statistics results in overestimation of significance, leading to incorrect conclusions. We further present novel analytical methods for estimating gene cluster significance that take gene family size into account. Our methods do not require complete genome data and are suitable for testing individual clusters found in local regions, such as contigs in an unfinished assembly. We consider pairs of regions drawn from the same genome (paralogous clusters), as well as regions drawn from two different genomes (orthologous clusters). Determining cluster significance under general models of gene family size is computationally intractable. By assuming that all gene families are of equal size, we obtain analytical expressions that allow fast approximation of cluster probabilities. We evaluate the accuracy of this approximation by comparing the resulting gene cluster probabilities with cluster probabilities obtained by simulating a realistic, power-law distributed model of gene family size, with parameters inferred from genomic data.
    [Show full text]
  • Evolution of Orthologous Tandemly Arrayed Gene Clusters
    Tremblay Savard et al. BMC Bioinformatics 2011, 12(Suppl 9):S2 http://www.biomedcentral.com/1471-2105/12/S9/S2 PROCEEDINGS Open Access Evolution of orthologous tandemly arrayed gene clusters Olivier Tremblay Savard1*, Denis Bertrand2*, Nadia El-Mabrouk1* From Ninth Annual Research in Computational Molecular Biology (RECOMB) Satellite Workshop on Com- parative Genomics Galway, Ireland. 8-10 October 2011 Abstract Background: Tandemly Arrayed Gene (TAG) clusters are groups of paralogous genes that are found adjacent on a chromosome. TAGs represent an important repertoire of genes in eukaryotes. In addition to tandem duplication events, TAG clusters are affected during their evolution by other mechanisms, such as inversion and deletion events, that affect the order and orientation of genes. The DILTAG algorithm developed in [1] makes it possible to infer a set of optimal evolutionary histories explaining the evolution of a single TAG cluster, from an ancestral single gene, through tandem duplications (simple or multiple, direct or inverted), deletions and inversion events. Results: We present a general methodology, which is an extension of DILTAG, for the study of the evolutionary history of a set of orthologous TAG clusters in multiple species. In addition to the speciation events reflected by the phylogenetic tree of the considered species, the evolutionary events that are taken into account are simple or multiple tandem duplications, direct or inverted, simple or multiple deletions, and inversions. We analysed the performance of our algorithm on simulated data sets and we applied it to the protocadherin gene clusters of human, chimpanzee, mouse and rat. Conclusions: Our results obtained on simulated data sets showed a good performance in inferring the total number and size distribution of duplication events.
    [Show full text]
  • Nematostella Genome
    Sea anemone genome reveals the gene repertoire and genomic organization of the eumetazoan ancestor Nicholas H. Putnam[1], Mansi Srivastava[2], Uffe Hellsten[1], Bill Dirks[2], Jarrod Chapman[1], Asaf Salamov[1], Astrid Terry[1], Harris Shapiro[1], Erika Lindquist[1], Vladimir V. Kapitonov[3], Jerzy Jurka[3], Grigory Genikhovich[4], Igor Grigoriev[1], JGI Sequencing Team[1], Robert E. Steele[5], John Finnerty[6], Ulrich Technau[4], Mark Q. Martindale[7], Daniel S. Rokhsar[1,2] [1] Department of Energy Joint Genome Institute, Walnut Creek, CA 94598 [2] Center for Integrative Genomics and Department of Molecular and Cell Biology, University of California, Berkeley CA 94720 [3] Genetic Information Research Institute, 1925 Landings Drive, Mountain View, CA 94043 [4] Sars International Centre for Marine Molecular Biology, University of Bergen, Thormoeøhlensgt 55; 5008, Bergen, Norway [5] Department of Biological Chemistry and the Developmental Biology Center, University of California, Irvine, CA 92697 [6] Department of Biology, Boston University, Boston, MA 02215 [7] Kewalo Marine Laboratory, University of Hawaii, Honolulu, HI 96813 Abstract Sea anemones are seemingly primitive animals that, along with corals, jellyfish, and hydras, constitute the Cnidaria, the oldest eumetazoan phylum. Here we report a comparative analysis of the draft genome of an emerging cnidarian model, the starlet anemone Nematostella vectensis. The anemone genome is surprisingly complex, with a gene repertoire, exon-intron structure, and large-scale gene linkage more similar to vertebrates than to flies or nematodes. These results imply that the genome of the eumetazoan ancestor was similarly complex, and that fly and nematode genomes have been modified via sequence divergence, gene and intron loss, and genomic rearrangement.
    [Show full text]
  • Partial Retrotransposon-Like DNA Sequence in the Genomic Clone of Aspergillus flavus, Paf28
    Mycol. Res. 107 (7): 841–846 (July 2003). f The British Mycological Society 841 DOI: 10.1017/S0953756203008116 Printed in the United Kingdom. Partial retrotransposon-like DNA sequence in the genomic clone of Aspergillus flavus, pAF28 1 1 1 2 Patricia A. OKUBARA #, Brian K. TIBBOT , Alice S. TARUN , Cesaria E. MCALPIN and Sui-Sheng T. HUA1* 1 USDA, Agricultural Research Service, Western Regional Research Center, 800 Buchanan Street, Albany, CA 94710, USA. 2 USDA, Agricultural Research Service, National Center for Agricultural Utilization Research, Peoria, IL, USA. E-mail : [email protected] Received 18 February 2003; accepted 21 May 2003. A genomic clone of the aflatoxin-producing fungus Aspergillus flavus, designated pAF28, has been used as a probe for Southern blot fingerprinting of fungal strains. A large number of A. flavus strains isolated from corn fields and tree-nut orchards can be distinguished because the DNA fingerprint patterns are highly polymorphic. We have completed the sequencing of a 6355 bp insert in pAF28. The sequence features motifs and open reading frames characteristic of transposable elements of the gypsy class. We have named this new element AfRTL-1, for A. flavus retrotransposon-like DNA. INTRODUCTION characterized vegetative compatibility groups (Papa 1986, McAlpin & Mannarelli 1995, McAlpin et al. Aspergillus flavus is the most common aflatoxin-pro- 2002) indicates its further utility. In this study, we ducing species on corn, cotton, peanuts and tree nuts demonstrate that the genomic insert of pAF28 carries (Diener et al. 1987). Aflatoxin is a potent hepatoxin and a partial retrotransposon-like element homologous to carcinogen that poses a serious food safety hazard to the gypsy-class retrotransposon MAGGY, originally both humans and animals.
    [Show full text]
  • The Evolutionary Life History of P Transposons: from Horizontal Invaders to Domesticated Neogenes
    Chromosoma (2001) 110:148–158 DOI 10.1007/s004120100144 CHROMOSOMA FOCUS Wilhelm Pinsker · Elisabeth Haring Sylvia Hagemann · Wolfgang J. Miller The evolutionary life history of P transposons: from horizontal invaders to domesticated neogenes Received: 5 February 2001 / In revised form: 15 March 2001 / Accepted: 15 March 2001 / Published online: 3 May 2001 © Springer-Verlag 2001 Abstract P elements, a family of DNA transposons, are uct of their self-propagating lifestyle. One of the most known as aggressive intruders into the hitherto uninfected intensively studied examples is the P element of Dro- gene pool of Drosophila melanogaster. Invading through sophila, a family of DNA transposons that has proved horizontal transmission from an external source they useful not only as a genetic tool (e.g., transposon tag- managed to spread rapidly through natural populations ging, germline transformation vector), but also as a model within a few decades. Owing to their propensity for rapid system for investigating general features of the evolu- propagation within genomes as well as within popula- tionary behavior of mobile DNA (Kidwell 1994). P ele- tions, they are considered as the classic example of self- ments were first discovered as the causative agent of hy- ish DNA, causing havoc in a genomic environment per- brid dysgenesis in Drosophila melanogaster (Kidwell et missive for transpositional activity. Tracing the fate of P al. 1977) and were later characterized as a family of transposons on an evolutionary scale we describe differ- DNA transposons
    [Show full text]
  • Transposable Element Insertions Shape Gene Regulation and Melanin
    Krishnan et al. BMC Biology (2018) 16:78 https://doi.org/10.1186/s12915-018-0543-2 RESEARCH ARTICLE Open Access Transposable element insertions shape gene regulation and melanin production in a fungal pathogen of wheat Parvathy Krishnan1, Lukas Meile1, Clémence Plissonneau1,2, Xin Ma1, Fanny E. Hartmann1,3, Daniel Croll1,4, Bruce A. McDonald1 and Andrea Sánchez-Vallet1* Abstract Background: Fungal plant pathogens pose major threats to crop yield and sustainable food production if they are highly adapted to their host and the local environment. Variation in gene expression contributes to phenotypic diversity within fungal species and affects adaptation. However, very few cases of adaptive regulatory changes have been reported in fungi and the underlying mechanisms remain largely unexplored. Fungal pathogen genomes are highly plastic and harbor numerous insertions of transposable elements, which can potentially contribute to gene expression regulation. In this work, we elucidated how transposable elements contribute to variation in melanin accumulation, a quantitative trait in fungi that affects survival under stressful conditions. Results: We demonstrated that differential transcriptional regulation of the gene encoding the transcription factor Zmr1, which controls expression of the genes in the melanin biosynthetic gene cluster, is responsible for variation in melanin accumulation in the fungal plant pathogen Zymoseptoria tritici. We show that differences in melanin levels between two strains of Z. tritici are due to two levels of transcriptional regulation: (1) variation in the promoter sequence of Zmr1 and (2) an insertion of transposable elements upstream of the Zmr1 promoter. Remarkably, independent insertions of transposable elements upstream of Zmr1 occurred in 9% of Z.
    [Show full text]
  • A CRISPR/Cas9 Cleavage System for Capturing Fungal Secondary Metabolite Gene Clusters
    J. Microbiol. Biotechnol. 2021. 31(1): 8–15 https://doi.org/10.4014/jmb.2008.08040 Review A CRISPR/Cas9 Cleavage System for Capturing Fungal Secondary Metabolite Gene Clusters Xinran Xu1,2, Jin Feng1, Peng Zhang1, Jie Fan1, and Wen-Bing Yin1,2* 1State Key Laboratory of Mycology and CAS Key Laboratory of Microbial Physiological and Metabolic Engineering, Institute of Microbiology, Chinese Academy of Sciences, Beijing 100101, P.R. China 2Savaid Medical School, University of Chinese Academy of Sciences, Beijing 100049, P.R. China More and more available fungal genome sequence data reveal a large amount of secondary metabolite (SM) biosynthetic ‘dark matter’ to be discovered. Heterogeneous expression is one of the most effective approaches to exploit these novel natural products, but it is limited by having to clone entire biosynthetic gene clusters (BGCs) without errors. So far, few effective technologies have been developed to manipulate the specific large DNA fragments in filamentous fungi. Here, we developed a fungal BGC-capturing system based on CRISPR/Cas9 cleavage in vitro. In our system, Cas9 protein was purified and CRISPR guide sequences in combination with in vivo yeast assembly were rationally designed. Using targeted cleavages of plasmid DNAs with linear (8.5 kb) or circular (8.5 kb and 28 kb) states, we were able to cleave the plasmids precisely, demonstrating the high efficiency of this system. Furthermore, we successfully captured the entire Nrc gene cluster from the genomic DNA of Neosartorya fischeri. Our results provide an easy and efficient approach to manipulate fungal genomic DNA based on the in vitro application of Cas9 endonuclease.
    [Show full text]
  • Density-Based Binning of Gene Clusters to Infer Function Or
    bioRxiv preprint doi: https://doi.org/10.1101/2021.05.27.446007; this version posted May 28, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Density-based binning of gene clusters to infer function or evolutionary history using GeneGrouper Alexander G. McFarland1, Nolan W. Kennedy2, Carolyn E. Mills2, Danielle Tullman-Ercek2, Curtis Huttenhower3,4, *Erica M. Hartmann1 1Northwestern University, Department of Civil and Environmental Engineering, 2Northwestern University, Department of Chemical and Biological Engineering, 3Harvard University, Department of Biostatistics, 4Harvard University, Department of Immunology and Infectious Diseases *Corresponding author Abstract Motivation Identifying gene clusters of interest in phylogenetically proximate and distant taxa can help to infer phenotypes of interest. Conserved gene clusters may differ by only a few genes, which can be biologically meaningful, such as the formation of pseudogenes or insertions interrupting regulation. These qualities may allow for unsupervised clustering of similar gene clusters into bins that provide a population-level understanding of the genetic variation in similar gene clusters. Results We developed GeneGrouper, a command-line tool that uses a density-based clustering method to group gene clusters into bins. GeneGrouper demonstrated high recall and precision in benchmarks for the detection of the 23-gene Salmonella enterica LT2 Pdu gene cluster and 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.05.27.446007; this version posted May 28, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • Mus Musculus) Was Subject to Repeated Introgression Including the Rescue of a Pseudogene Miriam Linnenbrink†, Kristian K
    Linnenbrink et al. BMC Evolutionary Biology (2020) 20:56 https://doi.org/10.1186/s12862-020-01624-5 RESEARCH ARTICLE Open Access The amylase gene cluster in house mice (Mus musculus) was subject to repeated introgression including the rescue of a pseudogene Miriam Linnenbrink†, Kristian K. Ullrich†, Ellen McConnell and Diethard Tautz* Abstract Background: Amylase gene clusters have been implicated in adaptive copy number changes in response to the amount of starch in the diet of humans and mammals. However, this interpretation has been questioned for humans and for mammals there is a paucity of information from natural populations. Results: Using optical mapping and genome read information, we show here that the amylase cluster in natural house mouse populations is indeed copy-number variable for Amy2b paralogous gene copies (called Amy2a1 - Amy2a5), but a direct connection to starch diet is not evident. However, we find that the amylase cluster was subject to introgression of haplotypes between Mus musculus sub-species. A very recent introgression can be traced in the Western European populations and this leads also to the rescue of an Amy2b pseudogene. Some populations and inbred lines derived from the Western house mouse (Mus musculus domesticus) harbor a copy of the pancreatic amylase (Amy2b) with a stop codon in the first exon, making it non-functional. But populations in France harbor a haplotype introgressed from the Eastern house mouse (M. m. musculus) with an intact reading frame. Detailed analysis of phylogenetic patterns along the amylase cluster suggest an additional history of previous introgressions. Conclusions: Our results show that the amylase gene cluster is a hotspot of introgression in the mouse genome, making it an evolutionary active region beyond the previously observed copy number changes.
    [Show full text]
  • Natural Products and the Gene Cluster Revolution
    UC San Diego UC San Diego Previously Published Works Title Natural Products and the Gene Cluster Revolution. Permalink https://escholarship.org/uc/item/2qf7q9sc Journal Trends in microbiology, 24(12) ISSN 0966-842X Author Jensen, Paul R Publication Date 2016-12-01 DOI 10.1016/j.tim.2016.07.006 Peer reviewed eScholarship.org Powered by the California Digital Library University of California TIMI 1360 No. of Pages 10 Review Natural Products and the Gene Cluster Revolution Paul R. Jensen1,* Genome sequencing has created unprecedented opportunities for natural- Trends product discovery and new insight into the diversity and distributions of natu- Genome sequencing is providing ral-product biosynthetic gene clusters (BGCs). These gene collectives are highly unprecedented opportunities to evolved for horizontal exchange, thus providing immediate opportunities to test explore the diversity and distributions the effects of small molecules on fitness. The marine actinomycete genus of natural-product biosynthetic gene clusters (BGCs) among bacteria. Salinispora maintains extraordinary levels of BGC diversity and has become a useful model for studies of secondary metabolism. Most Salinispora BGCs are Genomic surveys reveal extensive BGC diversity among closely related observed infrequently, resulting in high population-level diversity while con- strains, suggesting a strategy to max- forming to constraints associated with maximum genome size. Comparative imize the population-level secondary genomics is providing a mechanism to assess secondary metabolism in the metabolome while minimizing the num- fi ber of gene clusters carried by any one context of evolution and evidence that some products represent ecotype-de n- strain. ing traits while others appear selectively neutral.
    [Show full text]
  • Complex Evolutionary Origins of Specialized Metabolite Gene Cluster Diversity
    bioRxiv preprint doi: https://doi.org/10.1101/639641; this version posted May 17, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Complex evolutionary origins of specialized metabolite gene cluster diversity 2 among the plant pathogenic fungi of the Fusarium graminearum species complex 3 4 Sabina Moser Tralamazza1,3,*, Liliana Oliveira Rocha2, Ursula Oggenfuss3, Benedito Corrêa1, Daniel 5 Croll3,* 6 7 1 Department of Microbiology, Institute of Biomedical Sciences, University of São Paulo, São Paulo, 8 Brazil. 9 2 Department of Food Science, Food Engineering Faculty, University of Campinas, Av. Monteiro Lobato, 10 80, Brazil 11 3 Laboratory of Evolutionary Genetics, Institute of Biology, University of Neuchatel, Neuchâtel, 12 Switzerland. 13 14 * Authors for correspondance: [email protected], [email protected] 15 16 17 Author contributions: SMT, LOR, BC and DC conceived the study; SMT, LOR and BC provided samples 18 and datasets; SMT, UO analyzed the data; SMT and DC wrote the manuscript; LOR, UO and BC edited 19 the manuscript 20 21 Data availability: All raw sequence data was uploaded to the NCBI Short Read Archive (PRJNA542165). 22 23 Keywords: head blight, wheat, fungus, pathogen, secondary metabolism 24 1 bioRxiv preprint doi: https://doi.org/10.1101/639641; this version posted May 17, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • Histone Genes Are Clustered but Not Tandemly Repeated in the Chicken Genome (Recombinant DNA/DNA Sequence Analysis/Development) JAMES DOUGLAS ENGEL* and JERRY B
    Proc. NatI. Acad. Sci. USA Vol. 78, No. 5, pp. 2856-2860, May 1981 Biochemistry Histone genes are clustered but not tandemly repeated in the chicken genome (recombinant DNA/DNA sequence analysis/development) JAMES DOUGLAS ENGEL* AND JERRY B. DODGSONt *Department of Biochemistry and Molecular Biology, Northwestern University, Evanston, Illinois 60201; and tDepartment of Microbiology and Public Health and Department of Biochemistry, Michigan State University, East Lansing, Michigan 48824 Communicated by Emanuel Margoliash, February 5, 1981 ABSTRACT: The recombinant chicken DNA library was MATERIALS AND METHODS screened for histone genes by using pSpl7, a recombinant sea urchin DNA probe containing the H2a and H3 genes of Stron- Isolation and Characterization of Histone Gene Recombi- gylocentrotus purpuratus. Three of the isolated A recombinants nants. Isolation of histone-encoding recombinants was accom- have been analyzed by restriction enzyme mapping and Southern plished by screening the previously described A Charon 4A/ blotting; one histone H3 gene-encoding recombinant was further chicken recombinant DNA library (14) by hybridization to the analyzed by DNA sequence determination. These studies reveal 1.9-kilobase pair (kbp) EcoRI fragment of the Strongylocentro- that the chicken histone genes are not tandemly reiterated, but tus purpuratus pSpl7 histone recombinant, which contains the that, atthe least, several histone genes are physically closely linked coding information for the H2a and H3 histone genes (15). in a nonrepetitive arrangement within the chicken genome. The Hybridization was done as described below for nitrocellulose evolutionary implications of this arrangement versus that seen in filters except that the NaCl concentration was 0.75 M, 10% Drosophila and sea urchins is discussed.
    [Show full text]