•k Original paper•l Comparative mapping and structural analysis of a FOX gene cluster on bovine chromosome 18 Abdol Rahim ABBASI 1, 3, Maryam KHALAJ 1, GERILETUYA 1, Naoya IHARA 2, Yoshikazu SUGIMOTO 2 and Tetsuo KUNIEDA 1 1 Graduate School of Natural Science and Technology , Okayama University, Okayama, Japan. 2 Shirakawa Institute of Animal Genetics , Nishi-shirakawa, Fukushima, Japan. 3 Department of Animal Science , College of Agriculture, Isfahan university of Technology, Isfahan, Iran ABSTRACT FOX genes encode a family of transcription factors which play important roles during early development and in regulation of metabolic homeostasis in mammals. Some members of the gene family, including FOXC2, FOXF1, and FOXL1 genes comprise a gene cluster on particular regions of human and mouse chromosomes. In this paper, we report chromosomal localization and structure of bovine FOXC2, FOXF1 and FOXL1 gene cluster and comparative analysis of the gene cluster in cattle, human, and mouse, which were performed by a combination of in silico database searching and in vitro sequencing and mapping experiments. BLAST search of cattle database with cDNA sequences of human and mouse FOXC2, FOXF1 and FOXL1 genes identified several ESTs which represent cattle cDNAs of these genes. Radiation hybrid mapping of these cattle cDNAs revealed that the bovine FOXC2, FOXL1, and FOXF1 genes are localized on the proximal region of bovine chromosome 18 and form a gene cluster. A comparative map of the region including the FOX gene cluster between cattle and human indicated that the localization of these genes on cattle chromosome is in concordant with those in the corresponding human chromosome. Then, we identified a contig of BAC draft sequences containing genomic sequences of these genes by MEGABLAST search of a cattle genome database using the cattle cDNA sequences. Complete genomic sequences of these genes were determined by cloning and sequencing of a part of genomic region in which the nucleotide sequences could not be obtained from the published BAC draft sequences. A comparison of the nucleotide sequences of the cattle, human, and mouse FOX gene clusters showed highly conserved structure of the cluster in mammalian species and identified some potential regulatory regions which are conserved in mammalian species. Key words: FOX gene, RH mapping, comparative map, cattle, gene cluster Introduction clusters of the gene family have been reported. For Forkhead proteins belong to a large family of example, human FOXF1, FOXC2, and FOXL1 genes are transcription factors, characterized by an evolutionary closely linked each other and comprise a gene cluster on conserved DNA binding domain known as winged helix human chromosome (HSA) 16q24.1. This cluster is also (Kaestner et al. 1993). FOX (Forkhead box) has been conserved on mouse chromosome (MMU) 8 (Carlsson and adopted for all chordate winged helix/forkhead transcription Mahlapuu 2002; Keastner et al. 1996). factors, which are classified into A to Q subgroups according to phylogenetic analysis of the FOX genes (Keastner et al. 2000; http://www.biology.pomona.edu/fox. html). The members of the FOX gene family are distributed Correspondence: T. Kunieda, Graduate School of Natural Science and Technology, Okayama University, Tsushima-naka, Okayama 700- throughout the chromosomes and generally do not form 8530, Japan (e-mail: [email protected]) physically linked gene clusters, but some exceptional Received 16 March 2005; accepted for publication 13 April 2005. Journal of Animal Genetics (2005) 32(2),13-20 13 A. R. Abbasi et al. The FOX transcription factors have been reported to method to determine genomic structure of particular genes play important roles during early development of mammals of interest. In the present study, a combination of in silico by regulating growth, differentiation and apoptosis of cells and in vitro analyses was applied to investigate the (Carlsson and Mahlapuu 2002; Lehmann et al. 2003). On chromosomal localization and genomic structure of the the other hand, some of the FOX proteins play a role in FOX gene cluster. maintaining normal metabolic homeostasis of adult differentiated tissues, which is completely distinct from Materials and Methods those during development. Particularly, FOXC2 was Identification and comparison of bovine ESTs reported to be an important transcription factor as a key To identify ESTs for bovine FOXC2, FOXF1, and regulator of adipocyte metabolism (Cederberg et al. 2001). FOXL1 genes, we performed BLASTN search of bovine The expression of the FoxC2 gene in mouse is restricted in dbEST using the sequences of human and mouse FOXC2, adipose tissue and overexpression of the gene in adipose FOXF1, and FOXL1 genes. Alignments and comparison of tissue results in lean and insulin sensitive phenotype, amino acid sequences of the bovine ESTs with those of through attenuation of white adipose tissue and formation of human and mouse FOXC2 genes were performed using brown adipose tissue (Davis et al. 2004) with elevated GENETYX software (HITACHI Software). expression of the genes for insulin action of the adipocytes (Cederberg et al. 2001; Gronning et al. 2002; Flier 2004). RH mapping The functions of FOXC2 gene in development and A 7000-rad bovine-hamster whole genome radiation metabolism of adipose tissues makes it a potential candidate hybrid (RH) panel (Itoh et al. 2005) was used to localize the gene associated with obesity and diabetes in human (Kovacs FOX genes and microsatellite DNA on BAC sequence with et al. 2003; Ridderstrale et al. 2002). The function of the cattle specific primers for these sequences (FOXC2, 5'- GATGGCTGTGCTCACTGCTCC -3' and 5'-TGTACAG gene also suggests that the FOXC2 gene might be a candidate gene for economic traits of farm animals GGAAGGGAGGAAACC-3'; FOXL1, 5'- CTTCCACCA including beef marbling and fat deposition. In this paper, we CTGGGAAAGAAG-3' and 5'- GCGGTAGGAGGTCTGA report the chromosomal localization and structure of bovine GATGC-3'; FOXF1, 5'- CTTTCAACACCATGGCATCC FOXC2, FOXF1 and FOXL1 gene cluster, and comparative TCG-3' and 5'- GACCTCGATCGGTCTTTGCCTC -3'; analysis of the cluster in cattle, human, and mouse. and micorsatellite DNA, 5'- AGTCTCTCAGGGCAACA Recently, whole genome sequences of several CTTC -3' and 5'- TTCTTCGCTACATTTCCTACCA-3'). mammalian species including human and mouse have been Published mcrosatellite markers on BTA18 (UWCA28 and BMS2355) was also subjected to the RH mapping. PCR published and the sequence information is now available from genome databases. The availability of these genomic amplification was carried out in a 15 ƒÊl-reaction mixture sequences allow us to perform •gin silico•h analysis of the containing 20 ng DNA of each clone of the RH panel, 0.2 ƒÊ M each oligonucleotide primers, 0.2mM each of dNTPs, genes of these species by database searching. On the other hand, whole genome sequencing of cattle has still not yet 1.5mM MgCL2 and 0.375 unit of AmpliTaq Gold DNA been completed, but partial draft sequences of bacterial polymerase. After the initial deneturation at 94 •Ž for 10 artificial chromosome (BAC) contigs and sequences of min, 40 cycles of amplification were performed each various expressed sequence tags (ESTs) have been consisting of denaturation for 30 s at 94 t, annealing for published in this species. Although the complete in silico 30s at 55 - 60 •Ž , and extension for 30 s at 72 t followed analysis of cattle gene could not be achieved in the current by a final elongation step of 7 min at 72 •Ž . The PCR status of whole genome sequencing of the cattle, a products were electrophoresed through a 2 % agarose gel combination of in silico analysis by searching partial BAC and stained with ethidium bromide. PCR amplification and draft sequences and EST sequences in databases and in vitro gel electrophoresis were performed at least twice and the analysis by sequencing regions of the cattle geneome in results were scored for present, absent or ambiguous. The which sequence information has not yet been obtained from scored results were analyzed by RHMAPPER software to databases is likely to be the most effective and reliable determine ordering and localization of the genes. Journal of Animal Genetics (2005) 32(2),13-20 14 Comparative analysis of bovine FOX gene Identification of BAC clones FOXL1 (NM 005250 and NM 008024) genes identified a To identify BAC clones containing FOX genes, we bovine EST (CN435463) for FOXC2 gene, at least four performed MEGABLAST search of a genome database bovine ESTs (CN790798, CB454790, CB456366, and (Cow Genome Databesa) using the cattle EST sequences. CK836076) for FOXF1 gene, and three bovine ESTs All of repeat sequences within the sequences were masked (CB465507, CN440604, BE665899) for FOXL1 gene. To by RepeatMasker program (http://www.repeatmasker.org/) confirm the authenticity of the similarity between the before BLAST homology searches (Altschul et al. 1990) bovine ESTs and human or mouse cDNAs, we performed and pairwise BLAST analysis (Tatusova and Madden 1999) BLAST analysis using the sequence of the bovine ESTs for aligning the BAC sequences. against the human and mouse genome in the database. The The open reading frames of the bovine FOX genes results indicated highest similarity between the bovine ESTs were predicted by GrailEXP (http://compbio.ornl.gov) and and the corresponding human or mouse cDNAs. Therefore, GENSCAN (http://genes.mit.edu/GENSCAN.html) (Burg these ESTs were confirmed to be the cDNAs of bovine and Karlin 1997) on