DOCSLIB.ORG

Use of Vectorette and Subvectorette PCR to Isolate Transgene Flanking DNA

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Use of Vectorette and Subvectorette PCR to Isolate Transgene Flanking DNA Downloaded from genome.cshlp.org on October 2, 2021 - Published by Cold Spring Harbor Laboratory Press Use of Vectorette and Subvectorette PCR to Isolate Transgene Flanking DNA Maxine J. Allen, Andrew Collick, and Alec J. Jeffreys Department of Genetics, University of Leicester, Leicester LE1 7RH, UK Vectorette PCR permits the specific PCR allows specific amplification of structures and in the recovery of un- amplification of DNA segments flank- DNA fragments between two regions of known bacterial sequences. ~4-6~ In this ing a known DNA sequence. It en- known sequence to which primers can paper we detail its use in the systematic ables the application of the PCR be directed. Often, however, molecular isolation of 5'- and 3'-flanking junction where sequence information is only biological techniques require the isola- sequences around mouse transgenes of available for one primer site. We now tion and subsequent sequence analysis the minisatellite MS32. MS32 is a hu- show that vectorette PCR can be used of unknown regions of DNA. PCR can be man minisatellite composed of a tan- for the systematic mapping and re- used to retrieve this unknown sequence dem array of 29-bp repeat-unit sequence trieval of transgene flanking DNA. if it is flanking a region of known se- variants. The interspersion of these We also show that the sequence of quence. In this case, a primer can be de- sequence variants can be assayed in large vectorette PCR fragments can signed in either orientation from the the minisatellite variant repeat (MVR)- be obtained without cloning, by the known sequence. Such techniques as in- PCR ~7~, which utilizes repeat-unit-spe- production of subvectorette frag- verse PCR, panhandle PCR, capture PCR, cific primers. MS32 has a high muta- ments. and vectorette PCR have all been de- tion rate in humans, and knowledge of scribed as PCR methods for genome the flanking mouse sequences around walking.~ 1-4~ transgenes of this locus is important in The basic vectorette PCR strategy has ascertaining any positional effects on been described previously. ~s~ Briefly, a transgene mutation rate and process. vectorette-linker library is constructed It was therefore necessary to isolate at from digested DNA for use in the PCR. least one flanking sequence junction The duplex vectorette linker consists of around each of eight transgenes of the two annealed oligonucleotides of com- MS32 locus. Vectorette PCR was chosen plementary sequence flanking a nonho- as a swift method for isolating transgene mologous region resulting in a "bubble" flanking sequence products, obviating in the DNA. The vectorette primer has an the need for cloning of the junction identical sequence to the nonhomolo- regions. The double-stranded products gous region of the lower oligonucleotide obtained were sequenced using PCR- and therefore cannot anneal directly to based double-stranded sequencing the linker. The specificity of the PCR is methods. Most double-stranded PCR se- achieved by performing primer exten- quencing methods will only give 200- sion reactions from a sequence-specific 300 bp from each end of a fragment. primer to a vectorette linker in the adja- Therefore, to access full sequence infor- cent unsequenced DNA. This results in mation for the original vectorette frag- the synthesis of a strand complementary ment, subvectoretting procedures were to the vectorette linker, thus generating developed to provide a series of overlap- a target sequence for the vectorette-spe- ping contigs for sequencing. We also cific primer in subsequent PCR cycles. In show how the specificity of the vector- this way, a specific DNA fragment can be ette library can be increased by the use of amplified from a complex fragment mix- size-selected fragments and how par- ture and recovered for use in sequencing tially digested DNA can be used to give a reactions. series of flanking products, aiding struc- Previously, vectorette technology has tural analysis. In this paper vectorette been used to isolate terminal sequences analysis of three MS32 transgenic loci, from yeast artificial chromosome (YAC) called 110D, 102B, and 110A, is de- inserts, in the determination of exon scribed. 4:71-759 by Cold Spring Harbor Laboratory Press ISSN 1054-9803/94 $5.00 PCR Methods and Applications 71 Downloaded from genome.cshlp.org on October 2, 2021 - Published by Cold Spring Harbor Laboratory Press MATERIALS AND METHODS Vectorette PCR Amplification Winship (8) using either the vectorette or transgene primer. Vectorette Production Hot start PCR was performed to prevent the annealing of the top- and bottom- The sequences of the vectorette top and strand vectorette oligonucleotides and Subvectoretting of Vectorette PCR bottom strands are detailed in Figure 1. any subsequent template-directed exten- Products Oligonucleotides were synthesized in sion from the free 5' end of the top vec- the Department of Biochemistry, Uni- The full sequence of vectorette PCR torette strand, which would not have li- versity of Leicester, on an Applied Bio- products >500 bp in length was ob- gated to the 3' end of the template top systems 380B DNA synthesizer, using re- tained by the production of subvector- strand. This obviated the need for 5' agents supplied by Cruachem. Ten ette fragments. Full or partial digestions phosphorylation of the top strand of the micrograms of vectorette top strand and with enzymes cleaving within the initial vectorette oligonucleotide. Ten nano- 10 I~g of vectorette bottom strand were vectorette product were performed on grams of vectorette genomic DNA was annealed at 60~ for 30 min in 20 I~l of 200-300 ng of initial product. The di- diluted to 10 I~l with water, denatured at 0.1 M NaC1, 10 mM MgC12, and 10 mM gested DNA was phenol-extracted and 96~ for 3 min, and then held at 80~ Tris-HC1 (pH 7.6) to produce a complete recovered by ethanol precipitation. Ten microliters of 2x concentrated PCR vectorette linker. Neither vectorette oli- Twenty nanograms of blunt-ended vec- buffer, primers, and Taq poymerase gonucleotide was 5' phosphorylated. torette linker was annealed to 10- to 15- (Perkin-Elmer Cetus AmpliTaq) were ng DNA fragments in a 20-1~1 reaction us- added, to give a final concentration of 1 ing the previous ligation conditions. ~l.M transgene primer, 1 ~M vectorette DNA Digestion, Preparation, and Reamplifications were performed on 1 i~l primer, and 0.06 U/l~l of Taq polymerase. Ligation of a 1:20 dilution of this subvectorette PCR buffer was as described previ- library for 25 cycles using the second Approximately 2 t~g of genomic DNA di- ously. (7) Amplification was at 96~ for vectorette primer plus either the trans- gested with a six-cutter restriction en- 1.2 min, 68~ for 1 min, 70~ for 3 min gene primer or the first vectorette zyme was ligated to 0.2 p.g of annealed for 30 cycles on a Perkin-Elmer Cetus primer. PCR products were repurified by vectorette linker in 20 t~l of 50 mM NaC1, thermal cycler. Vectorette PCR products agarose gel electrophoresis and electroe- 20 mM Tris-HCl (pH 7.6), 5 mM DTT, and were detected by agarose gel elec- lution followed by ethanol precipitation. 0.1 mM ATP, with 2 units of T4 ligase trophoresis followed by Southern blot (GIBCO BRL) overnight at 15~ for sticky hybridization or ethidium bromide end ligations and 4~ for blunt-ended li- staining and visualisation by long-wave- RESULTS gations. The amount of vectorette linker length UV. Appropriate DNA fragments The structure of the MS32 allele used in in the reaction was increased to 2 I~g for were recovered by electroelution onto transgenesis is detailed in Fig. 2. It has 71 total genomic DNA ligations cleaved dialysis membrane and reamplified with repeat units of a- or t-type, each repeat with a restriction endonuclease recog- vectorette and transgene primers for 25- being 29 bp long. Standard restriction di- nizing a 4-bp cleavage site. Control liga- 30 cycles depending on yield. PCR prod- gestion and Southern blot analysis were tions without DNA were also prepared, ucts were repurified by agarose gel elec- performed on mice positive for trans- and ligation was monitored by removal trophoresis and electroelution followed gene insertion. This identified appropri- of a 3-1~1 aliquot and addition of 0.5 I~g by ethanol precipitation. of k DNA cleaved with HindIII and then ate restriction sites around the transgene agarose electrophoresis after ligation. Li- for use in vectorette PCR to recover gations ("vectorette libraries") were di- mouse flanking DNA sequences. Sequencing luted with 5 mM Tris-HC1 (pH 7.6) to 5 i~g/ml of genomic DNA and stored at Fifty to 150 ng of double-stranded PCR Transgene 1 IOD - 20oc. product was sequenced by the method of Restriction mapping showed this to be a single-copy insertion of the transgene construct with the loss of 10 repeat units Vecl top -64nt - AvaII degenerate but with full 5' and 3' MS32 flanking 5'-ga/tcaggctggagatgtagcagattgagatattcgttatagtttacctatcccgaccgagcatg-3 ' sequences. There was a lack of common four- and six-cutter restriction sites in Vecl top -64nt - Mbo I the flanking mouse DNA, but the en- 5'-gatcaggctggagatgtagcagattgagatattcgttatagtttacctatcccgaccgagcatg-3' llllIlllllllllllIl llllillllllllIIflll zyme AvaII cleaved frequently and was Vecl bottom -60nt 3'-....tccgacctctacatcgtccttggattgggagatctggtcacggatagggctggctcgtac-5' utilized in the preparation of a vectorette Vecl primer -26nt 3' -cttggattgggagatctggtcacgga- 5' library. A size fraction of AvaII-digested Vec3 top - 64nt - Blunt ended 110D positive mouse genomic DNA, known to contain the transgene frag- 5 ' -gatcatgccctgacccaggctaagtat tttaact t taaccact t tgct ccgacagtcccattgc-3 ' lllIlllflllltllllllJllll llllIJJfllllJllill ment, was recovered by electroelution Vec3 bottom -64nt 3 ' -ctagtacgggactgggtccgattctcggttcgaaaccgggagtcaggaggctgtcagggtaacg-5 ' Vec3 primer -24nt 3 ' -tcggttcgaaaccgggagtcagg- 5 ' from agarose and used in the prepara- FIGURE 1 The oligonucleotides used in production of the vectorette units.
Load more

Recommended publications
  • Download At: Amplification May Be Performed During Library Con- Fenyolab/Tipseqhunter (See Table 6)
    Steranka et al. Mobile DNA (2019) 10:8 https://doi.org/10.1186/s13100-019-0148-5 METHODOLOGY Open Access Transposon insertion profiling by sequencing (TIPseq) for mapping LINE-1 insertions in the human genome Jared P. Steranka1,2, Zuojian Tang3,4, Mark Grivainis3,4, Cheng Ran Lisa Huang2, Lindsay M. Payer1, Fernanda O. R. Rego5, Thiago Luiz Araujo Miller5,6, Pedro A. F. Galante5, Sitharam Ramaswami7, Adriana Heguy7, David Fenyö3,4, Jef D. Boeke4* and Kathleen H. Burns1,2* Abstract Background: Transposable elements make up a significant portion of the human genome. Accurately locating these mobile DNAs is vital to understand their role as a source of structural variation and somatic mutation. To this end, laboratories have developed strategies to selectively amplify or otherwise enrich transposable element insertion sites in genomic DNA. Results: Here we describe a technique, Transposon Insertion Profiling by sequencing (TIPseq), to map Long INterspersed Element 1 (LINE-1, L1) retrotransposon insertions in the human genome. This method uses vectorette PCR to amplify species-specific L1 (L1PA1) insertion sites followed by paired-end Illumina sequencing. In addition to providing a step-by-step molecular biology protocol, we offer users a guide to our pipeline for data analysis, TIPseqHunter. Our recent studies in pancreatic and ovarian cancer demonstrate the ability of TIPseq to identify invariant (fixed), polymorphic (inherited variants),aswellassomatically-acquiredL1insertionsthat distinguish cancer genomes from a patient’s constitutional make-up. Conclusions: TIPseq provides an approach for amplifying evolutionarily young, active transposable element insertion sites from genomic DNA. Our rationale and variations on this protocol may be useful to those mapping L1 and other mobile elements in complex genomes.
    [Show full text]
  • Loop-Mediated Isothermal Amplification (LAMP)
    cells Review Loop-Mediated Isothermal Amplification (LAMP): The Better Sibling of PCR? Marianna Soroka, Barbara Wasowicz * and Anna Rymaszewska Department of Genetics and Genomics, Institute of Biology, University of Szczecin, 3c Felczaka St., 71-412 Szczecin, Poland; [email protected] (M.S.); [email protected] (A.R.) * Correspondence: [email protected] Abstract: In 1998, when the PCR technique was already popular, a Japanese company called Eiken Chemical Co., Ltd. designed a method known as the loop-mediated isothermal amplification of DNA (LAMP). The method can produce up to 109 copies of the amplified DNA within less than an hour. It is also highly specific due to the use of two to three pairs of primers (internal, external, and loop), which recognise up to eight specific locations on the DNA or RNA targets. Furthermore, the Bst DNA polymerase most used in LAMP shows a high strand displacement activity, which eliminates the DNA denaturation stage. One of the most significant advantages of LAMP is that it can be conducted at a stable temperature, for instance, in a dry block heater or an incubator. The products of LAMP can be detected much faster than in standard techniques, sometimes only requiring analysis with the naked eye. The following overview highlights the usefulness of LAMP and its effectiveness in various fields; it also considers the superiority of LAMP over PCR and presents RT-LAMP as a rapid diagnostic tool for SARS-CoV-2. Keywords: LAMP method; isothermal amplification; SARS-CoV-2 detection Citation: Soroka, M.; Wasowicz, B.; Rymaszewska, A.
    [Show full text]
  • Are Molecular Tools Solving the Challenges Posed by Detection Of
    Curr. Issues Mol. Biol. 11: 13-46. Molecular Tools for DetectionOnline journal of Plant at http://www.cimb.org Pathogens 13 Are Molecular Tools Solving the Challenges Posed by Detection of Plant Pathogenic Bacteria and Viruses? María M. López*, Pablo Llop, Antonio Olmos, Ester plant pathogens due to their low titre in the plants, their Marco-Noales, Mariano Cambra and Edson Bertolini uneven distribution, the existence of latent infections and the lack of validated sampling protocols. Research Centro de Protección Vegetal y Biotecnología, Instituto based on genomic advances and innovative detection Valenciano de Investigaciones Agrarias (IVIA). Carretera methods as well as better knowledge of the pathogens’ de Moncada a Náquera km 4.5, 46113 Moncada, lifecycle, will facilitate their early and accurate detection, Valencia, Spain thus improving the sanitary status of cultivated plants in the near future. *For correspondence: [email protected] Introduction Abstract Plant pathogenic bacteria, phytoplasmas, viruses and Plant pathogenic bacteria, phytoplasmas, viruses and viroids cause harmful, widespread and economically viroids are difficult to control, and preventive measures important diseases in a very broad range of plant are essential to minimize the losses they cause each species worldwide (Agrios, 2001; Janse, 2007). Damage year in different crops. In this context, rapid and accurate is often sufficient to cause significant yield losses in methods for detection and diagnosis of these plant cultivated plants (Schaad, 1988; Scortichini, 1995; pathogens are required to apply treatments, undertake Cambra et al., 2006b). The two main effects on agronomic measures or proceed with eradication agriculture are decreased production and, in a less direct practices, particularly for quarantine pathogens.
    [Show full text]
  • (12) United States Patent (10) Patent No.: US 9,546,389 B2 Li (45) Date of Patent: Jan
    USOO9546,389 B2 (12) United States Patent (10) Patent No.: US 9,546,389 B2 Li (45) Date of Patent: Jan. 17, 2017 (54) METHODS AND SYSTEMS FOR NUCLEIC (56) References Cited ACIDAMPLIFICATION U.S. PATENT DOCUMENTS (71) Applicant: Coyote Bioscience Co., Ltd., Beijing 5,759,821. A * 6/1998 Teasdale .............. C12O 1/6806 (CN) 435,912 2004/0209331 A1* 10, 2004 Ririe ....................... BO1L 3,505 435,912 (72) Inventor: Xiang Li, Beijing (CN) 2008/0085541 A1 4/2008 Spangler 2012/0308990 A1* 12/2012 TeMaat ..................... BO1L, 7,52 (73) Assignee: COYOTE BIOSCIENCE CO.,LTD., 435/3 Beijing (CN) 2013/0022963 A1 1/2013 Exner et al. FOREIGN PATENT DOCUMENTS (*) Notice: Subject to any disclaimer, the term of this patent is extended or adjusted under 35 CN 101597652. A 12/2009 U.S.C. 154(b) by 0 days. CN 103074349 A 5, 2013 JP EP 1069 190 A2 * 1 2001 ............. C12O 1/686 WO WO-2012109604 A1 8, 2012 (21) Appl. No.: 14/963,986 OTHER PUBLICATIONS (22) Filed: Dec. 9, 2015 Callahan et al. Use of a portable real-time reverse transcriptase (65) Prior Publication Data polymerase chain reaction assay for rapid detection of foot-and mouth disease virus. JAVMA 220: 1636-1642 (2002).* US 2016/O115513 A1 Apr. 28, 2016 Gilbert et al. Typing of bovine viral diarrhea viruses directly from blood of persistently infected cattle by multiplex PCR. Journal of Clinical Microbiology 37:2020-2023 (1999).* International search report and written opinion dated Feb. 26, 2015 Related U.S. Application Data for PCT Application No. CN2014/094914.
    [Show full text]
  • Biochemistry 24 Polymerase Chain Reaction
    Biochemical Techniques Biochemistry 24 Polymerase Chain Reaction Description of Module Subject Name Biochemistry Paper Name 12 Biochemical Techniques Module Name/Title 24 Polymerase Chain Reaction Biochemical Techniques Biochemistry 24 Polymerase Chain Reaction 1. Objectives 1.1 To understand principle of Polymerase chain reaction (PCR) technique. 1.2 To explain how this techniques is performed. 1.3 What are helpful hints which help in successful performance of PCR technique? 1.4 What are potential applications of PCR? 1.5 What are different variants of PCR? 2.0 Introduction and principle Polymerase chain reaction (PCR) can be recognized as a revolutionary technology for which the inventor Kary B. Mullis was awarded with the prestigious Nobel Prize in 1993 for chemistry along with Michael Smith. The secret story of any living organism which gives it unique characteristics is coded within the large and complexed DNA of that individual. To understand the story, it was needed to bring the DNA outside the living cell into the laboratory, this gave birth to the concept of PCR. Kary Mullis conceptualized of a machine through which from a single molecule of DNA we can get multiples of its copy after the end, like a Xerox machine does. With this in 1983 Kary Mullis developed PCR which is now a most generalized technique used in medical or biological science research labs for a range of applications. Examples are its use in DNA cloning, phylogeny, functional analysis of genes, diagnosis of diseases, genetic fingerprints for forensic sciences as paternity test where the aim is to amplify a single or a few copies of a specific DNA segment in generating thousands to millions of copies of that specific DNA sequence.
    [Show full text]
  • M.Sc. (MICROBIOLOGY)
    SAURASHTRA UNIVERSITY RAJKOT (ACCREDITED GRADE “A” BY NAAC) FACULTY OF SCIENCE Syllabus for M. Sc. (MICROBIOLOGY) Choice Based Credit System With Effect From: 2016-17 Department of Microbiology Course Structure and Scheme of Examination For Choice Based Credit System (CBCS) (Total 96 credits) Effective from June 2016 M. Sc. Microbiology Program Outcomes (PO) PO1: Academic Competence Understanding of the subject with respect to structure, diversity, metabolisms and applications of the microorganisms is extensively developed. It also involves structure and function of biological molecules. At the end, the students gain depth of scientific knowledge regarding microorganisms. PO2: Critical thinking Students are expected to develop skills in conducting practical, designing experiments and analyzing the data reaching to conclusions. The theoretical base is developed on the various aspects of microorganisms and ability to solve the problems. PO3: Research and development Students gain ideas and competence regarding research and data analysis which will be highly useful to them in higher studies and exploring job opportunities. They acquire abilities for self direction and originality in tackling and solving problems and implementing tasks at professional levels. PO4: Personal and Behavioural Competence Professional skills concerning biochemical analysis, carrying out experiments and developing ability in specific areas of microorganisms are also developed. PO5: Effective Communication 1 During this programme, the students develop the ability for articulation of ideas, scientific writing and report reporting, conference presentations and delivering seminars. They also develop conversational competence and effective verbal and written. PO6: Social Competence The students will develop abilities to manage projects in order to achieve objectives and ability to work in team.
    [Show full text]
  • Lecture 37: Polymerase Chain Reaction
    Proteomics & Genomics Dr. Vikash Kumar Dubey Lecture 37: Polymerase Chain Reaction We have already studied basics of DNA/RNA structure and recombinant DNA technology in previous classes. Polymerase Chain Reaction (PCR) is another revolutionary method developed by Kary Mullis and Michael Smith. Both shared Nobel Prize in Chemistry for the work in 1993. PCR is based on ability of DNA polymerase to synthesize complementary strand to the template strand. As DNA polymerase can add a nucleotide only onto a 3'-OH group, it needs an artificial DNA strand (called DNA primer) of about 18 to 25 nucleotides complementary to 3’ end of the DNA template. As shown below, each polynucleotide has a free 3’ –OH group and 5’ phosphate group. Moreover, a DNA strand has complimentary sequence, already paired by hydrogen IIT Guwahati Page 1 of 9 Proteomics & Genomics Dr. Vikash Kumar Dubey bonding. Thus, primer can bind only when DNA strands are separated. This is generally done by heating. The primers anneal to the single-stranded DNA template at specific temperature (depends on primer sequence) and then DNA-Polymerase binds to this double stranded DNA produced. The again reaction mixture is heated to 72°C (extension); a temperature optimum for DNA- polymerase functions. This starts synthesis of the new DNA strand. Than reaction mixture is cooled to lower temperature for short term storage, if required. This completes one cycle. After first cycle, one DNA molecule has become two. After multiple cycle of the PCR reaction, the specific sequence will be accumulated in billions of copies. The PCR reaction requires the following components: DNA template: DNA template is DNA target sequence.
    [Show full text]
  • Polymerase Chain Reaction. Wikipedia. Last Modified on 13
    Polymerase chain reaction - Wikipedia, the free encyclopedia Create account Log in Article Talk Read Edit View Polymerase chain reaction From Wikipedia, the free encyclopedia Main page Contents "PCR" redirects here. For other uses, see PCR (disambiguation). Featured content It has been suggested that Applications of PCR be merged into Current events this article. (Discuss) Proposed since June 2013. Random article Donate to Wikipedia The polymerase chain reaction (PCR) is a biochemical technology in molecular Interaction biology to amplify a single or a few copies Help of a piece of DNA across several orders About Wikipedia of magnitude, generating thousands to Community portal millions of copies of a particular DNA Recent changes sequence. Contact page Developed in 1983 by Kary Mullis,[1][2] Tools PCR is now a common and often Print/export indispensable technique used in medical and biological research labs for a variety Languages of applications.[3][4] These include DNA Afrikaans cloning for sequencing, DNA-based phylogeny, or functional analysis of A strip of eight PCR tubes, each containing a 100 μl Azərbaycanca genes; the diagnosis of hereditary reaction mixture Български diseases; the identification of genetic Català fingerprints (used in forensic sciences and paternity testing); and the detection and diagnosis of Česky infectious diseases. In 1993, Mullis was awarded the Nobel Prize in Chemistry along with Michael Dansk Smith for his work on PCR.[5] Deutsch The method relies on thermal cycling, consisting of cycles of repeated heating and cooling of the Eesti reaction for DNA melting and enzymatic replication of the DNA. Primers (short DNA fragments) Ελληνικά containing sequences complementary to the target region along with a DNA polymerase (after Español which the method is named) are key components to enable selective and repeated amplification.
    [Show full text]
  • (PCR-RFLP) and Gel Electrophoresis – Valuable Tool for Genotyping and Genetic Fingerprinting
    18 Restriction Fragment Length Polymorphism Analysis of PCR-Amplified Fragments (PCR-RFLP) and Gel Electrophoresis – Valuable Tool for Genotyping and Genetic Fingerprinting Henrik Berg Rasmussen Institute of Biological Psychiatry, Mental Health Centre Sct. Hans, Copenhagen University Hospitals, Roskilde, Denmark 1. Introrduction PCR-restriction fragment length polymorphism (RFLP)-based analysis, also known as cleaved amplified polymorphic sequence (CAPS), is a popular technique for genetic analysis. It has been applied for the detection of intraspecies as well as interspecies variation. There exist several techniques that are related with PCR-RFLP and also involve gel electrophoresis including techniques for DNA fingerprinting and expression profiling. This chapter describes PCR-RFLP and related techniques. 1.1 Genetic variation There are different types of genetic variations. The so-called small-scale genetic variation includes single nucleotide polymorphisms (SNPs), multi-nucleotide polymorphisms (MNPs) and microindels. MNPs are multiple, consecutive nucleotide variations of a single common length such as double nucleotide polymorphisms (DNPs) and triple nucleotide polymorphisms (TNPs) with two and three variable nucleotides, respectively (Figure 1). Microindels are deletions, duplications and combinations thereof involving the gain or loss of 1 to 50 nucleotides (Gonzalez et al., 2007). The human genome contains more than 3 million SNPs located with an average distance of approximately 1000 bp (International HapMap Consortium 2005, Levy et al., 2007). The frequency of DNPs and TNPs, the most common forms of MNPs, amounts to ∼1% of the total number of SNPs (Rosenfeld et al., 2010). Most likely, the genome-wide occurrence of small insertions and deletions has been underestimated, probably reflecting an inaccuracy of the current sequencing techniques (Krawitz et al., 2010).
    [Show full text]
  • Magdalena Sztyler Phd 2014
    MOLECULAR ANALYSIS OF MICROBIAL COMMUNITIES FROM OIL INDUSTRY ENVIRONMENTS Magdalena K. Sztyler A thesis submitted in partial fulfilment of the requirements for the award of the degree of Doctor of Philosophy of the University of Portsmouth Institute of Biomedical and Biomolecular Sciences School of Pharmacy and Biomedical Sciences May 2014 “Więcej się można nauczyć podróżując...” Olga A. Jackowska Rodzicom AUTHORS’ DECLARATION Whilst registered as a candidate for the above degree, I have not been registered for any other research award. The results and conclusions embodied in this thesis are the work of the named candidate and have not been submitted for any other academic award. Magdalena K. Sztyler I ABSTRACT The effects of microbiologically influenced corrosion (MIC) can be very expensive to correct, dangerous to workers and its mechanisms are poorly understood. Understanding these processes is important so that they can be monitored and mitigated (Koch et al., 2001). It is now accepted that for the assessment of biocorrosion risks, the most powerful approach is to detect functional genes encoding the enzymes that play an important part in material deterioration (Schadt et al., 2004). The main aim of this study was to identify the microbial community present in corroded and non-corroded systems, and to detect genes that might be implicated in corrosion processes, particularly iron corrosion, so that a biochip could be designed for risk assessment of oil environments. In this thesis the microbial populations and their actives were assessed using sequencing and hybridisation techniques for three oil field sites, generating information that can help identify MIC risk. The final section of the thesis describes the development and design of functional gene probes, identified from hybridisation studies that might be included in a biochip for risk assessment in oil field environments.
    [Show full text]
  • Review Article Loop Mediated Isothermal Amplification (LAMP) Test– a Novel Nucleic Acid Based Assay for Disease Diagnosis
    Advances in Animal and Veterinary Sciences 2 (6): 344 – 350 http://dx.doi.org/10.14737/journal.aavs/2014/2.6.344.350 Review Article Loop Mediated Isothermal Amplification (LAMP) Test– a Novel Nucleic Acid Based Assay for Disease Diagnosis Valsala Rekha 1*, Rajneesh Rana1, Thachappully Remesh Arun1, Plantharayil Bharathan Aswathi2, Jeny Kalluvila John1, Devi Gopinath1, Gurupriya Vijayasaraswathy Sadanandan1, Aron Jacob 1 1Indian Veterinary Research Institute, Izatnagar, Bareilly, UP; 2Central Avian Research Institute, Izatnagar, Bareilly, UP; *Corresponding author: [email protected] ARTICLE HISTORY ABSTRACT Received: 2014–05–26 Disease diagnosis is of crucial importance in making appropriate therapeutic decisions. Revised: 2014–07–14 Conventionally, diagnosis was based on isolation and identification of the causative agent. Accepted: 2014–07–15 This was followed in timeline by the development of serological tests. Nowadays, molecular tests credited with high sensitivity like polymerase chain reaction and its variants are replacing the older diagnostic techniques. Major obstacle in adoption of PCR based Key Words: LAMP, PCR, technique is the need for thermocycler, which precludes its use in low resource setting areas. Isothermal amplification, Isothermal amplification system like Loop mediated isothermal amplification (LAMP) test is Visual detection a good alternative. It is a novel nucleic acid amplification assay developed in 2000. Amplification of nucleic acid is carried out under isothermal condition, usually at temperature ranging from 60–65℃. Comparatively higher sensitivity, visual detection, lower reaction time, and dispensable use of thermocycler make LAMP an attractive option for field diagnosis. As the test is not susceptible to inhibitory effect of biological substances, it can be very well applied for direct detection from clinical samples without processing.
    [Show full text]
  • Single-Cell Sequencing-Based Technologies Will Revolutionize Whole-Organism Science
    REVIEWS APPLICATIONS OF NEXT-GENERATION SEQUENCING Single-cell sequencing-based technologies will revolutionize whole-organism science Ehud Shapiro1,2, Tamir Biezuner1,2 and Sten Linnarsson3 Abstract | The unabated progress in next-generation sequencing technologies is fostering a wave of new genomics, epigenomics, transcriptomics and proteomics technologies. These sequencing-based technologies are increasingly being targeted to individual cells, which will allow many new and longstanding questions to be addressed. For example, single-cell genomics will help to uncover cell lineage relationships; single-cell transcriptomics will supplant the coarse notion of marker-based cell types; and single-cell epigenomics and proteomics will allow the functional states of individual cells to be analysed. These technologies will become integrated within a decade or so, enabling high-throughput, multi-dimensional analyses of individual cells that will produce detailed knowledge of the cell lineage trees of higher organisms, including humans. Such studies will have important implications for both basic biological research and medicine. Next-generation sequencing DNA sequencing has undergone constant improvement Single cells can be studied and tracked using many (NGS). High-throughput DNA since its inception in the 1970s. Today, next-generation detection technologies, including quantitative imaging sequencing of a large number sequencing (NGS) approaches are accelerating in speed and mass spectrometry. However, our Review focuses on of DNA molecules in parallel. and decreasing in cost more quickly than Moore’s law1. single-cell analysis using DNA-sequencing-based tech- There is a trade-off between read length and throughput DNA sequencing technologies have improved in preci- nologies. Although single-cell sequencing-based analysis 14 that depends on the sion and throughput, and have enabled the sequenc- has been applied to both unicellular and multicellular sequencing technology, ing of entire genomes of species2,3 and individuals4.
    [Show full text]