EGFR Signaling in the HGG-02 Glioblastoma Cell Line with an Unusual Loss of EGFR Gene Copy

480 ONCOLOGY REPORTS 31: 480-487, 2014 EGFR signaling in the HGG-02 glioblastoma cell line with an unusual loss of EGFR gene copy JAN SKODA1,2, JAKUB NERADIL1,3, KAREL ZITTERBART2, JAROSLAV STERBA2,3 and RENATA VESELSKA1,2 1Laboratory of Tumor Biology, Department of Experimental Biology, Faculty of Science, Masaryk University, Brno; 2Department of Pediatric Oncology, University Hospital Brno and Faculty of Medicine, Masaryk University, Brno; 3Masaryk Memorial Cancer Institute, Brno, Czech Republic Received September 11, 2013; Accepted October 24, 2013 DOI: 10.3892/or.2013.2864 Abstract. Epidermal growth factor receptor (EGFR) gene Introduction amplification and the overexpression of EGFR are described as common features of glioblastoma multiforme (GBM). The epidermal growth factor receptor (EGFR) is a member Nevertheless, we previously reported the loss of EGFR gene of the EGFR receptor tyrosine kinase (RTK) family, together copy in a GBM specimen from a patient with an unusually with ErB2/Neu/HER2, Erb3/HER3 and ErbB4/HER4 (1). favorable course of the disease, and the HGG‑02 cell line with Activating ligands of these receptors include epidermal growth this aberration was successfully derived from this tumor. Here, factor (EGF), transforming growth factor α (TGF‑α), epireg- we present a detailed analysis of changes in gene expression and ulin, neuregulins and amphiregulin. Binding of the ligands to cell signaling in the HGG‑02 cell line; the GM7 reference cell the extracellular domain of EGFR RTKs causes the formation line with a standard EGFR gene copy number derived from a of homodimers or heterodimers, cross‑activation of tyrosine very aggressive GBM was used as a control. We confirmed the kinase domains and autophosphorylation. These events downregulation of EGFR expression and signaling in HGG‑02 result in the stimulation of intracellular signaling cascades, cells using different methods (RTK analysis, gene profiling including the phosphatidylinositol‑3 kinase (PI3K)/Akt and and RT‑PCR). Other changes that may have contributed to the mitogen‑activated protein kinase (MAPK) cascades. Although non‑aggressive phenotype of the primary tumor were identi- EGFR signaling is essential for normal tissue development and fied, including the downregulated phosphorylation of the Axl homeostasis, the abnormal activity of EGFR RTK members and Trk receptors, as well as increased activity of JNK and plays a key role in tumor initiation and progression (2). p38 kinases. Notably, differences in PDGF signaling were Glioblastoma multiforme (GBM) is the most frequent and detected in both of these cell lines; HGG‑02 cells preferen- malignant neoplasm of the human nervous system. Despite tially expressed and signaled through PDGFRα, and PDGFRβ current therapies, the prognosis for patients with GBMs was strongly overexpressed and phosphorylated in the GM7 remains poor, with a median survival time that ranges from reference cell line. Using expression profiling of cancer‑related 8.8 months (patients <50 years of age) to 1.8 months (patients genes, we revealed the specific profile of HGG‑02 cells that >80 years of age) (3,4). EGFR gene amplification and EGFR included upregulated tumor‑suppressors as well as downregu- overexpression are common features of GBM; however, they lated genes associated with the extracellular matrix. This study are rare in low‑grade gliomas, which suggests a causal role of represents the first comprehensive analysis of gene expression aberrant EGFR signaling in the pathogenesis of GBM (5). The and cell signaling in glioblastoma cells with lower EGFR gene amplification ofEGFR is present in 35‑70% of cases, typically dosage. As indicated by our results, the TAM receptors, Trk in primary de novo GBM (4,6,7). receptors and PDGFRs need to be investigated further since In our previous study, we reported the unusual loss of EGFR their regulation appears to be important for glioblastoma gene copy in GBM obtained from a patient with an unusually biological features as well as the clinical course of the disease. favorable course of the disease who experienced a survival of 5.5 years between diagnosis and death (8). Here, we present further detailed analysis of the HGG‑02 cell line derived from this tumor when compared with the GM7 reference cell line that contains a standard EGFR gene copy number (9). Correspondence to: Professor Renata Veselska, Laboratory of Tumor Biology, Department of Experimental Biology, Faculty of Science, Masaryk University, Kotlarska 2, 611 37 Brno, Czech Republic Materials and methods E‑mail: [email protected] Cell lines and cell culture. The HGG‑02 (8) and GM7 (9) Key words: glioblastoma multiforme, epidermal growth factor established glioblastoma cell lines were used in the present receptor signaling, PDGFR, TAM receptors, receptor tyrosine kinase, study. Cell cultures were maintained in DMEM supplemented mitogen‑activated protein kinase with 20% fetal calf serum, 2 mM glutamine and antibiotics (100 IU/ml of penicillin and 100 µg/ml of streptomycin) (PAA we examined the presence of the most common mutant form of of form mutant common most the of presence the examined we GM7 were 0.38 and respectively 0.85, of levels EGFRexpression Relative number. in HGG standarda with from glioblastoma a derived of expression EGFRlower when compared to the GM7 cells cell lines. HGG the EGFR status in at the mRNAHGG level sponding primary tumor tissue. Using RT signaling in pathways HGG cell of dysregulation and expression EGFR of detailedanalysis patient contributed to the unusually prolonged survival in a GBM suggested that the loss of the EGFRand EGFRvIIImRNA status. Results data used for analyses. was GEArrayExpression Analysis Suite The software USA). (SABiosciences) MD, Frederick, (SABiosciences, instructionsturer's 440 Oligo GEArray GEArray biotin‑labeled cRNA was generated using the samples Oligo were assessed spectrophotometrically. Purified GenElute™ Mammalian Total RNA Miniprep kit, and the Expression profiling. normalized spots. were control phosphorylation of to positive arrays were analyzed using ImageJ software, and the levels and 250 was used Systems) according to the manufacturer's protocol, nine kinases, the Human Phospho phosphorylation status of MAPKs and other serine/threo Phospho-MAPK array analysis. normalized positive to phosphotyrosine software and ImageJ quantifiedusing were phosphorylation of 450 with incubated were arrays 42 to determine of tyrosine of phosphorylation thelevels relative Array kit (R&D Minneapolis, Systems, was MN, used USA) Phospho-RTK array analysis. used as described were and GAPDH in Table HSP90AB1 NRG TGF priming. USA) PrimersCA, ErbB4, EGFR, for ErbB3, ErbB2, oligo and Republic) Czech Prague, were reverse transcribed into using cDNA M (25 RNA amountsof For allSt. Louis, (Sigma‑Aldrich, USA). MO, samples, equal the GenElute™ Mammalian Total RNA Miniprep RT-PCR. kit starved in serum‑free media. subcultivated once a week. Where indicated, the cells were in an atmosphere of 95% air and 5% CO 37˚C at standardunder conditions Austria) Linz, Laboratories, EGFR, i.e., EGFRvIII. HGG EGFRvIII. i.e., EGFR, distinct RTKs according to the manufacturer's protocol. The protocol. manufacturer's the to according RTKs distinct genes genes related to incancer, accordance with the manufac ‑ ‑ α 1, NRG , EGF, epiregulin (EREG), neuroglycan (8), we (8), continued a study of this case with a more µg µg of protein lysate was used for each array. The ® Reagent kit and was hybridized to the OHS the to hybridized was and kit Reagent For For RT ‑ SKODA 2, PDGFR ® ‑ Human Cancer Microarray, which profiles profiles which Microarray, Cancer Human 02 02 cells showed significantly (2.24‑fold) ‑ PCR, total RNA was extracted with ng of RNA/1 of ng et al Total Total RNA was extracted with the : EGFR SIGNALING IN THE GLIOBLASTOMA CELL LINE WITH LOWER α ‑ ‑ , PDGFR 02 and GM7 cells did not express express not did cells GM7 and 02 02 02 cells derived from the corre µg of protein lysate. The levels levels The lysate. protein of µg EGFR The Human Phospho µl of total reaction content) totalcontent) reaction of µl dT (Qiagen Inc., Valencia, Valencia, Inc., (Qiagen dT ‑ For For the detection of the MAPK Array kit (R&D As our previous findings ‑ gene copy may have have may copy gene β ‑ (Fig. control spots. control , PDGFA, PDGFB, ‑ PCR, we assessed 2 . The cells were EGFR 1). Furthermore, 1). ‑ MLV (Top MLV ‑ 02 02 and GM7 gene copy copy gene C (NGC), ‑ 02 02 and ‑ RTK RTK ‑ ‑ Bio, Bio, 802 802 I. - - - Table I. Primer sequences used for RT‑PCR. Gene symbol Gene full name Forward primer Reverse primer Size (bp) EGFR Epidermal growth factor receptor 5'‑AGAAAGGCAGCCACCAAATTAGCC‑3' 5'‑TTCCTGGCTAGTCGGTGTAAACGT‑3' 304 ErbB2 V‑erb‑b2 erythroblastic leukemia viral oncogene homolog 2 5'‑CCTGAATATGTGAACCAGC‑3' 5'‑ACCTCTTGATGCCAGCAGAA‑3' 440 ErbB3 V‑erb‑b2 erythroblastic leukemia viral oncogene homolog 3 5'‑GGGTATGAAGAGATGAGAGC‑3' 5'‑TCAAGAGCCTGAGAGGAA‑3' 496 ErbB4 V‑erb‑b2 erythroblastic leukemia viral oncogene homolog 4 5'‑TACCGAGATGGAGGTTTTGC‑3' 5'‑GTTGGCAAAGGTGTTGAGGT‑3' 447 TGF‑α Transforming growth factor α 5'‑CCTGCTGCCCGCCCGCCCGT‑3' 5'‑GCTGGCAGCCACCACGGCCA‑3' 305 EGFR EGF Epidermal growth factor 5'‑TGCCAACTGGGGGTGCACAG‑3' 5'‑CTGCCCGTGGCCAGCGTGGC‑3' 339 EREG Epiregulin 5'‑TCCAGTGTCAGAGGGACACA‑3' 5'‑GGTTGGTGGACGGTTAAAAA‑3' 488 GENE DOSAGE NGC Neuroglycan C 5'‑CCCCACCACATCCTTTTATG‑3' 5'‑GGGGAGCACTAGGATCATCA‑3' 680 NRG‑1 Neuregulin 1 5'‑GACCTCTACTTCTCGTGACA‑3' 5'‑TCCAATCTGTTAGCAATGTG‑3' 256 NRG‑2 Neuregulin 2

Load more