Supplemental Information

Table S1.

N Vernacular Scientific Family Used plant Origin Voucher name name organ number 1 COMMON Fumaria officinalis L. Papaveraceae flowered top Macedonia BIOF26733T FUMITORY 2 OLIVE Olea europaea L. Oleacee leaves Italy BIOF42911T

3 BLACKCURRANT Ribes nigrum L. Grossulariacee leaves Italy BIOF52511T

4 SAGE Salvia officinalis L. Lamiaceae leaves Italy BIOF56111T

5 ELDERBERRY Sambucus nigra L. Adoxaceae flowers Bulgaria BIOF56322I

6 BOLDO Peumus boldus Molina Monimiaceae leaves Chile BIOU08511T 7 CARDUS Silybum marianum Asteraceae fruits Austria BIOU12155I MARIANUS Gaert. 8 COMMON Cichorium intybus L. Asteraceae root Italy BIOU15344C CHICORY 9 ROSELLE Hibiscus sabdariffa L. Malvaceae flowers Egypt BIOU31922T 10 COMMON Malva sylvestris L. Malvaceae leaves Italy BIOU37311T MALLOW 11 MACA Lepidium meyenii L. Brassicaceae powder root Peru BIOZ37044P

12 ASIAN GINSENG Panax ginseng Meyer Araliaceae root China PC29144T 13 GARDEN Angelica archangelica Apiaceae root China PFU03844C ANGELICA L. 14 BITTER ORANGE Citrus aurantium L. Rutaceae flowers Iran PFU04922I var. dulcis L. 15 BITTER ORANGE Citrus aurantium L. Rutaceae zests Albania PFU04967T var. dulcis L. 16 CHAMOMILE Chamomilla recutita Asteraceae o flowers Italy PFU10522I Rausch. Compositae 17 CHINESE Coriandrum sativum Apiaceae fruits Italy PFU17955I PARSLEY L. 18 WILLOWHERBS Epilobium Onagraceae summit Serbia PFU21933T angustifolium L. 19 HYSSOP Hyssopus officinalis L. Lamiaceae flowers and Italy PFU31322I leaves 20 LAVENDER Lavandula Lamiaceae flowers France PFU32722I angustifolia Miller 21 COMMON POPPY Papaver rhoeas L. Papaveraceae petals Albania PFU44708T 22 BROADLEAF Plantago major L. Plantaginaceae leaves Poland PFU46711T PLANTAIN 23 CHINESE Rheum officinale Polygonaceae rhizomes China PFU51799C RHUBARB Baill. 24 DOG ROSE Rosa canina L. Rosaceae cinorrodes/ Hungary PFU53310I seeds 25 RUSTYBACK Ceterach officinarum Aspleniaceae aerial parts Italy PFU59533T DC. 26 COMMON THYME Thymus vulgaris L. Lamiaceae leaves Turkey PFU62311T 27 KINNIKINNICK Arctostaphylos Ericaceae leaves Russia PFU63311T uva-ursi Spreng. 28 BLACKSAMSON Echinacea Asteraceae root Italy PFZ20544C ECHINACEA angustifolia DC. 29 OAT Avena sativa L. Poaceae aerial parts Hungary PS06309T 30 CREAT Andrographis Acanthaceae whole plant India PS16409T paniculata Nees 31 CACAO TREE Theobroma cacao Malvaceae beans Peru PS18677I

32 WILD YAM Dioscorea villosa Dioscoreaceae root PS20044P

33 COMMON HOP Humuluslu pulus L. Cannabaceae flowers China PS36722I 34 CHASTE TREE Vitex agnus castus L. Verbenaceae o fruits Morocco PU01355I Lamiaceae 35 BITTER ALOE Aloe ferox Miller Xanthorrhoeace juice Porth PU02561P ae Elisabeth 36 PINEAPPLE Ananas sativus L. Bromeliaceae stem China PU03555T 37 FEMALE Angelica sinesi Diels Apiaceae root Poland PU04044C GINSENG 38 GRAPPLE PLANT Harpagophytum Pedaliaceae root Namibia PU05544C procumbens DC. 39 MILKVETCH Astragalus Fabaceae/Legu root China PU06244C membranaceus Fisch. minosae 40 GREATER Arctium lappa L. Asteraceae root Poland PU06744C BURDOCK 41 COMMON Berberisvulgaris L. Berberidaceae bark India PU07188T BARBERRY 42 HAWTHORN Crataegus oxyacantha Rosaceae flowers and Poland PU08112T L. leaves 43 SHEPHERD'S Capsella bursa- Brassicaceae flowered tops Albania PU08933T BURSE pastorisMedicus 44 ROBUSTA Coffea robusta L. Rubiaceae grains India PU09603C COFFEA 45 CEYLON Cinnamomum Lauraceae bark Ceylon PU11188T CINNAMON zeylanicum Nees 46 FRENCH Cynarascolymus Asteraceae leaves Italy PU11511T ARTICHOKE Hayek 47 CENTELLA, Hydrocotyle asiatica Apiaceae aerial parts Madagascar ASIATIC L. PU14111T PENNYWORT 48 CHINCHONA, Cinchona succirubra Rubiaceae bark Indonesia PU15188C QUINA QUINA Pav. 49 TURMERIC Curcuma longa L. Zingiberaceae rhizomes India PU19344C 50 PALE PURPLE Echinacea pallida Asteraceae root Italy PU20444C CONEFLOWER Britton 51 EASTERN Echinacea purpurea Asteraceae root Poland PURPLE Moench. PU20644C CONEFLOWER 52 DEVIL'S BUSH Eleutherococcus Araliaceae root China PU21144C senticosus Maxim. 53 ITALIAN Helicrysum italicum Asteraceae flowered tops Italy PU21333T STRAWFLOWER G. Don 54 HOARY Epilobium parviflorum Onagraceae flowered tops Albania PU21833T WILLOWHERB Schreb. 55 COMMON Equisetum arvense L. Equisetaceae stems Poland PU22001T HORSETAIL 56 FENUGREEK Trigonella foenum- Leguminosae seeds India PU25377I graecum L. 57 FENNEL Foeniculum vulgare Apiaceae fruits India PU25677I Miller 58 GINKGO Ginkgo biloba L. Ginkgoaceae leaves Italy PU28911T 59 BERMUDA Cynodon dactylon L. Poaceae rhizomes China PU29499C GRASS 60 COMMON COUCH Agropyrum repens Poaceae rhizomes Serbia PU29999C Beauv. 61 GUARANA' Paullini asorbilis Sapindaceae seeds Brasil PU30577I Mart. 62 FRANKINCENSE Boswelia carterii Burseraceae grains Ethiopia PU30703I Birdwood 63 PERFORATE ST Hypericum perforatum Clusiaceae flowered tops Serbia PU31233T JOHN'S-WORT L. 64 LIQUORICE Glycyrrhiza glabra L. Fabaceae root Egypt PU34344C 65 YERBA MATE Ilex paraguariensis St. Aquifoliaceae flowered tops Brasil PU38533T Hil. 66 LEMON BALM Melissa officinalis L. Lamiaceae leaves Italy PU38911T

67 PEPPERMINT Mentha piperita L. Lamiaceae leaves Serbia PU39511T 68 COMMON Vaccinium myrtillus L Ericaceae leaves Hungary PU40511T BILBERRY 69 MORINGA Moringa oleifera Moringaceae leaves Burkina PU40711T Lamk. Faso 70 MUIRAPUAMA Ptychopetalum Olacaceae wood Brasil PU41104T olacoides Bentham 71 JAVA TEA Orthosiphon Lamiaceae leaves Indonesia PU43711T stamineus Benth. 72 COMMON Urtica dioica L. Urticaceae leaves Italy PU43911T NETTLE 73 BLACK PEPPER Piper nigrum L. Piperaceae grains Brasil PU46303I 74 CAYENNE Capsicum annuum L. Solanaceae fruits Uganda PU46555I PEPPER 75 SCOTS PINE Pinus sylvestris L. Pinaceae gems Albania PU47302I 76 POLLEN mix Spain PU48903I flower 77 GOLDEN ROOT Rhodiola rosea L. Crassulaceae root China PU53244T

78 RED RASPBERRY Rubus idaeus L. Rosaceae leaves Albania PU54711T 79 CATBRIERS Smilax medica Cham. Smilacaceae root Mexico PU55944C et Sch. 80 MOUNTAIN Satureja montana L. Lamiaceae leaves Albania PU56911I SAVORY 81 ALEXANDRIAN Cassia angustifolia Leguminosae leaves India PU58311T SENNA Vahl. 82 SAW PALMETTO Serenoa serrulata Arecaceae fruits USA PU58755T Hook. 83 PINK LAPACHO Tabebuia avellane Bignoniaceae bark Paraguay PU60244C daelorentz ex griseb 84 TEA PLANT Camellia sinesi Kuntze Theaceae leaves China PU61111I 85 LARGELEAF Tilia platyphyllos Malvaceae flowers and Serbia PU61533T LINDEN Scop. bracts 86 BOGBEAN Menyanthes trifoliata Menyanthaceae leaves North PU62711T L. Europe 87 RED CLOVER Trifolium pratense L. Leguminosae fruits Albania PU62822I 88 CAT'S CLAW Uncaria tomentosa Rubiaceae bark Peru PU63288T DC. 89 VALERIAN Valeriana officinalis Caprifoliaceae root Poland PU63744C L. 90 GREAT MULLEIN Verbascum thapsus L. Scrophulariacea flowers Hungary PU64122I e 91 EUROPEAN Viscum album L. Santalaceae leaves and Hungary PU65711I MISTLETOE twings 92 COMMON GRAPE Vitis vinifera L. Vitaceae leaves Tunisia PU66711T VINE 93 INDIAN GINSENG Withania somnifera Solanaceae root India PU67044C Dunal 94 GINGER Zingiber officinale Zingiberaceae rhizomes Nigeria PU67999T Roscoe 95 PUMPKINS Cucurbita pepo L. Cucurbitaceae seeds China PU68277I

96 WOLF'S BANE Arnica montana L. Asteraceae flowers Hungary PZ05222I

97 DAMIANA Turnera diffusa Willd Passifloraceae leaves Mexico PZ19711T 98 TARRAGON Artemisia dracunculus Asteraceae leaves Poland PZ19911T L. 99 MAGNOLIA VINE Schisandra chinensis Schisandraceae fruits China PZ57455I Turcz. Baill. 100 CALIFORNIA Eschscholzia Papaveraceae whole Italy BIOD3744I POPPY californica Cham. flowered plant

Table S1. Plants tested in this study, including their vernacular and botanical names, family, organ/s used, and voucher number.

Table S2. Molecular PrimaryAntibody weight Dilution Source (kDa) Mouse monoclonal anti-MyHC-II (MF20) 220 1:10000 eBiosciences Mouse monoclonal anti-MyHC developmental (RNMY2/9D2) 220 1:500 Monosan Mouse monoclonal anti-MyoD (5.8A) 45 1:500 Santa Cruz Biotech Mouse monoclonal anti-Myogenin (F5D) 34 1:1000 Santa Cruz Biotech Mouse monoclonal anti-α-Tubulin (DM1A) 55 1:2000 Santa Cruz Biotech Rabbit monoclonal anti-phospho-Akt (Ser473) (D9E) 60 1:2000 Cell Signaling Tech. Rabbit monoclonal anti-phospho-NF-kB p65 (Ser536) (93H1) 65 1:2000 Cell Signaling Tech. Rabbit monoclonal anti-phospho-p38 MAPK (Thr180/Tyr182) (D3F9) XP 43 1:2000 Cell Signaling Tech. Rabbit polyclonal anti-phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) 42/44 1:2000 Cell Signaling Tech. Rabbit polyclonal anti-phospho-mTOR (Ser2448) 289 1:1000 Cell Signaling Tech. Rabbit polyclonal anti-Akt (Thr308) (D25E6) 60 1:2000 Cell Signaling Tech. Rabbit polyclonal anti-NF-kB (p65) (C-20) 65 1:2000 Cell Signaling Tech. Rabbit polyclonal anti-p38 MAPK 40 1:1000 Cell Signaling Tech. Rabbit polyclonal anti-MAP Kinase (ERK-1, ERK-2) 42/44 1:10000 Cell Signaling Tech. Rabbit polyclonal anti-mTOR 289 1:1000 Cell Signaling Tech. Goat anti-mouse IgG/IgM-HRP conjugated Sigma-Aldrich Goat anti-rabbit IgG-HRP conjugated Sigma-Aldrich Table S2. List of primary and secondary antibodies used in WB.

Table S3. Gene Forward primer 5’-3’ Reverse primer 5’-3’ Fbxo32 GTCTTGGGAATGTACGACGC GCGCTCCTTCGTACTTCCTT Gapdh GCCTTCCGTGTTCCTACCC CAGTGGGCCCTCAGATGC Myh2 AAACAGAAGCAGGAGCGACC CACCGGCAGCCATTTGTAAG Table S3. List of primers used in real-time PCR.

Table S4

Change in Change in Change in myotube myotube myotube diameter, % diameter, % diameter, % TNFα/IFNγ -41.3 Dex -23.9 PBS -46.4 W. somnifera +51.3 P. ginseng. +20.8 A. repens -13.4 P. ginseng +16.3 W. somnifera +20.3 P. boldus -19.3 S. marianum +7.8 A. repens +5.9 W. somnifera. -21.6 R. officinale +6.1 S. marianum +3.1 T. foenum- -22.5 graecum P. boldus -2.1 S.chinensis -8.1 P. ginseng -24.3 G. biloba -6.4 T. foenum- -8.5 U. dioica -37.4 graecum S.chinensis -6.8 P. boldus -14.3 S. marianum -46 U. dioica -9.9 G. biloba -17 R. officinale -48 T. foenum- -15.6 R. officinale -30 S.chinensis -48.4 graecum A.repens -16.6 U. dioica -32 G. biloba -50.3

Table S4. C2C12 myotubes were treated with TNFα (tumor necrosis factor α)/IFNγ (interferon γ), Dex (dexamethasone) or PBS (phosphate buffered saline) in the absence or presence of the selected plant extracts for 48h (TNFα/IFNγ and Dex) or 16h (PBS) and IF for myosin heavy chain (MyHC)- II was performed. Reported are the percentages of myotube diameter changes in comparison to untreated myotube.

Supplementary Figure 1. C2C12 myotubes were treated with one-hundred different plant extract (100 µg/mL) for 48h. May-Grünwald/Giemsa staining was performed and total myotube area was measured by Image J software. The graph reports the percent changes in myotube area relative to untreated control.

Supplementary Figure 2. (A,B) C2C12 myotubes were treated with T (tumor necrosis factor α, 20 ng/mL)/I (interferon γ, 100 U/mL) (T/I) in the absence or presence of each selected 96 plant extracts (100 µg/mL) for 48h. May-Grünwald/Giemsa staining was performed and total myotube areas were measured by Image J software (A). The graph reports the percent changes in myotube area with respect to untreated control. Dotted line indicates the arbitrary cut off to select the extracts able to impair T/I-dependent myotube area reduction up to 10% (A). Reported are representative images of the 17 extracts selected for further investigation. Bars, 500 µm (B).

Supplementary Figure 3. C2C12 myotubes were untreated or treated with dexamethasone (Dex, 1 µM) for 48h (A) or starved with PBS (phosphate buffered saline) for 16h (B) in absence or presence of the selected 10 plant extracts. Immunofluorescence (IF) analysis for myosin heavy chain (MyHC)-II was performed and myotube diameters were measured by Image J software. Reported are representative images with average myotube diameters (µm)±SD (standard deviation). Bars, 100 µm.

Supplementary Figure 4. Full 1H NMR (Nuclear Magnetic Resonance) spectra of the most active extracts, with highlighted extended regions on top of the figure; diagnosis signals of: 1=alanine, 2=quinic acid, 3=aspartate, 4=malic acid, 5=citric acid, 6=sucrose, 7=β-glucose, 8=α-glucose, 9=caffeic acid, 10=shikim acid, 11=trigonelline.

Supplementary Figure 5. (A) C2C12 myotubes were treated with TNFα (tumor necrosis factor α, 20 ng/mL)/IFNγ (interferon γ, 100 U/mL) (T/I) in the absence or presence of ten selected plant extracts (100 µg/mL) for 48h and the expression of myosin heavy chain (MyHC)-II expression were analyzed by WB (western blotting). Reported are representative images. Reported are the relative densities with respect to tubulin. Statistical analysis was conducted using t-test *p<0.05, **p<0.01 significantly different from untreated control. (B) C2C12 myotubes were treated with T/I in the absence or presence of the 20 different herbal formulations (100 µg/mL) for 48h. May- Grünwald/Giemsa staining was performed and total myotube area was measured by Image J software. The graph reports the percent changes in myotube area relative to untreated control. Five formulations were able to counteract the reduction of the myotube area induced by T/I. Bars, 500 µm.

Supplementary Figure 6. C2C12 myotubes were treated with TNFα (tumor necrosis factor α, 20 ng/mL)/IFNγ (interferon γ, 100 U/mL) (T/I) (A,B) or dexamethasone (Dex, 1 µM) (C,D) in the absence or presence of WST (100 µg/mL). WB (western blotting) analysis was performed to verify p-ERKs (phospho-extracellular signal-regulated kinases), ERKs, p-p65 (phospho-NF-κB p65, nuclear factor kappa-light-chain-enhancer of activated B cells p65) and p65 levels after 6h, whereas p-mTOR (mammalian target of rapamycin), mTOR and MyoD (myoblast determination protein 1) expression were analyzed after 48h (A,C). Tubulin was used as protein loading control (A,C). Levels of Myh2 (Myosin heavy chain 2) and Fbxo32 (muscle atrophy F-box protein) were analyzed after 24h by real-time PCR. (E) Myotubes were treated with WST and analyzed after 48h by IF (immunofluorescence) for myosin heavy chain (MyHC)-II. Reported are representative images (A,C,E). Reported are the relative densities with respect to tubulin or total form of phosphorylated protein (A,C). Results are means±SD (standard deviation) (A-E). Statistical analysis was conducted using t-test *p<0.05, **p<0.01 significantly different from untreated control; #p<0.05 and ##p<0.01 significantly different from T/I (A,B,E) or Dex (C,D). C. sinensis R. ideaus V. myrtillus V. officinalis T. avellanedae

S. serrulata Polline G. glabra T. pratense R. rosea

S. montana P. olacoides V. album T. plathyphyllos D. villosa

F. officinalis W. somnifera M. trifoliata C. longa C. oxyacantha

R. nigrum C. pepo U. tomentosa E. purpurea C. robusta

S. nigra T. diffusa V. thapsus H. italicum C. scolymus

S. marianum S. chinensis V. vinifera E. arvense C. succirubra

H. sabdariffa O. europaea Z. officinale F. vulgare E. pallida

L. meyenii S. officinalis A. montana C. dactylon E. senticosus

A. archangelica P. boldus A. dracunculus P. sorbilis E. parviflorum

C. aurantium C. intybus Escolzia H. perforatum T. foenum-graecum C. sativum A. ferox M. sylvestris I. paraguariensis G. biloba

H. officinalis A. sinensis P. ginseng M. piperita A. repens

P. rhoeas A. membranaceus C. aurantium flower S. medica U. dioica

R. officinale B. vulgaris C. recutita M. oleifera B. carterii

C. officinarum C. bursa-pastoris E. angustifolium P. nigrum M. officinalis

A. uva-ursi C. zeylanicum L. angustifolia C. angustifolia C. anuum

A.sativa H. asiatica P. major O. stamineus V. agnus castus

T. cacao H. procumbens R. canina E. angustifolia A. sativus

H. lupulus A. lappa T. vulgaris A. paniculata P. sylvestris Change in myotube area, % area, myotube in Change

Supplementary Figure 1 A V. officinalis C. sinensis T. pratense

S. serrulata T. plathyphyllos

S. montana C. longa

F. officinalis E. purpurea

R. nigrum H. italicum

S. nigra E. arvense

S. marianum F. vulgare

H. sabdariffa C. dactylon

L. meyenii P. sorbilis

A. archangelica H. perforatum

C. aurantium I. paraguariensis C. sativum M. piperita

H. officinalis S. medica

P. rhoeas M. oleifera

R. officinale P. nigrum

C. officinarum C. angustifolia

A. uva-ursi O. stamineus

A.sativa E. angustifolia

T. cacao Change in myotube area, % area, myotube in Change

B Untreated T/I

6. 7. 8. 12. 13. 23. P. boldus S. marianum C. intybus P. ginseng A. archangelica R. officinale T/I

38. 39. 56. 58. 60. 72. H. procumbens A. membranaceus T. foenum-graecum G. biloba A. repens U. dioica T/I

83. 85. 92. 93. 99. T. avellanedae T. platyphyllos V. vinifera W. somnifera S. chinensis T/I

Supplementary Figure S2 A IF, MyHC-II Untreated Dex 29.6±0.7µm 22.9±0.6µm

Dex 7. 12. 56. 60. 93. 99. S. marianum P. ginseng T. foenum-graecum A. repens W. somnifera S. chinensis 30.5±2.6µm 35.8±2.2µm 27.1±1.7µm 31.4±2µm 35.6±2.5µm 27.2±1.3µm

B IF, MyHC-II Untreated PBS 29.8±0.9µm 15.9±0.6µm

PBS 6. 12. 56. 60. 93. P. boldus P. ginseng T. foenum-graecum A. repens W. somnifera 24.1±2.4µm 22.6±1.4µm 23.1±2µm 25.8±1µm 23.3±1.3µm

Supplementary Figure 3 6 8 7 6 4 4 3 2 9 9 9 1

11

11 10

5

TMSP G. biloba A. repens U. dioica W. somnifera T. foenum-graecum S. marianum S. chinensis R. officinale P. ginseng P. boldus

Supplementary Figure 4 A

T/I ₋ ₊ ₊ ₊ ₊ ₊ ₊ ₊ ₊ ₊ ₊ ₊

6. P. boldus 220 MyHC-II 7. S. marianum 55 tubulin 12 . P. ginseng 6 7 12 23 56 58 60 72 93 99 23 . R. officinale 1.2

56 . T. foenum-graecum 1 * * 58 . G. biloba 0.8 * * 60 . A. repens * 0.6 * 72 . U. dioica * 0.4 * * * ** 93 . W. somnifera ** Relative density, a.u. density, Relative 99 . S. chinensis 0.2 0 C T/I 6 7 12 23 56 58 60 72 93 99 T/I

B Untreated T/I

WGS WST WUT WBT GST

120 T-I 100 WGS WUT 80 WGB GSU 60 WSU GST 40 WST GUT 20 WGU SUB 0 -20 -40

Change Change myotube in area, % -60 -80 -100

Supplementary Figure 5 A WST 100µg/ml B

C T/I C T/I Ctrl T/I WST T/I+WST Ctrl T/I WST T/I+WST 42 3.5 p-ERK1/2 Myh2 44 3 *,# 42 ERK ** 2 *,# 44 2.5 p-p65 1.5 65 2 ** p65 * * 65 1.5 * ## 1 p-mTOR * 289 1 ** * 0.5 mTOR * Relative density, a.u. density, Relative 0.5 289 * **

** (dRn) quantity Relative 45 MyoD 0 0 p-ERK/ERK p-p65/p65 p-mTOR/mTOR MyoD/tubulin 55 tubulin

C D WST 100µg/ml Ctrl Dex WST Dex+WST 2 C Dex C Dex Ctrl Dex WST Dex+WST Myh2 3 42 p-ERK1/2 1.5 # 44 2.5 *,# *,# 42 ERK 1 44 2 p-p65 *,# * 65 1.5 0.5 65 p65 1 # 0

# (dRn) quantity Relative 289 p-mTOR *,# 0.5 * * * Fbxo32 Relative density, a.u. density, Relative 289 mTOR * 3 * 0 45 MyoD p-ERK/ERK p-p65/p65 p-mTOR/mTOR MyoD/tubulin 2.5 55 tubulin 2 # 1.5 #

1 E 0.5 MyHC, IF (dRn) quantity Relative 0 Untreated WST 160 30±2.7 µm 38.9±3.7 µm 140 * 120 100 80 60 40

Myotube diameter, % diameter, Myotube 20 0 Untreated WST

Supplementary Figure 6