Assembly of Phi29 Prna Nanoparticles for Gene Or Drug

Assembly of Phi29 pRNA Nanoparticles for Gene or Drug

Delivery and for Application

in Nanotechnology and Nanomedicine

A dissertation submitted to

The Division of Research and Advanced Studies, University of Cincinnati

In partial fulfillment of the requirements for the degree of

Doctor of Philosophy

In the Biomedical Engineering Program

School of Energy, Environmental, Biological and Medical Engineering

College of Engineering and Applied Science

2012

by Yi Shu

M.S. Chinese Center for Disease Control and Prevention (CCDC), China, 2007

B.S. Lanzhou University, China, 2004

Committee Chair: Jing-Hui Lee, Ph.D

Co-chair: Peixuan Guo, Ph.D ABSTRACT

RNA nanotechnology is to extract defined RNA structure motifs and tertiary interactions, apply them as the building blocks to self-assemble nano-scaled scaffolds with rational designs, and incorporate functional molecules such as siRNA, ribozyme, aptamer and therapeutical compounds to form functionalized RNA nanoparticles.

Bacteriophage phi29 packaging RNA (pRNA) has two defined domains: the 5’/3’-end helical domain and the interlocking loop region which is located at the central part of the pRNA sequence. pRNA dimer is formed by hand-in-hand interaction via 4-bp interlocking base pairing.

The dimeric pRNA nanoparticle has been shown to be an efficient vector for the specific delivery of small interfering RNA (siRNA) into specific cancer or viral infected cells. However, there are several problems hindering the therapeutic applications of pRNA nanoparticles. In this thesis, I will try to address: 1) The problem of large-scale synthesis of longer RNA molecules.

Industrial scale production of RNA by chemical synthesis is limited to ~ 80nt. In order to chemically synthesize pRNA and its functionalized chimeric constructs (generally > 120 nt) in large scales, pRNA nanoparticles were constructed using two synthetic RNA fragments within the size limit for chemical synthesis. The resulting bipartite pRNAs were competent to form dimers, package DNA via the nanomotor, and assemble phi29 phage in vitro. The pRNA subunit assembled from bipartite fragments harboring siRNA or receptor-binding ligands were equally competent in binding cancer cells specifically, entering the cell, and silencing specific genes of interest as the intact constructs. 2) The problem of RNA degradation. 2’-fluorine (2’-F) modification was introduced into the RNA sugar ring and the modified RNAs were resistant to

RNase degradation and suitable for in vivo delivery. 3) The dissociation problem of pRNA nanoparticles. The lack of covalent linkage or crosslinking in nanoparticles causes dissociation

ii of pRNA nanoparticles while present in diluted condition in vivo. Chemical crosslinking

methods such as psoralen crosslink were adapted to stabilize the tertiary structure of the pRNA nanoparticles.

To further improve pRNA nano-deliver systems, we constructed novel pRNA delivery platform based either on enhanced loop-loop interactions or branched RNA three-way junction

(3WJ) or derived X-shaped motifs. The wild-type pRNA loop-loop interaction was extended from 4bp to 7bp. The correct folding of the loop-extended pRNAs was predicted by Mfold and further confirmed by efficient dimer formation in native PAGE. Stronger loop-loop interaction was observed as indicated by observation of higher ordered structure formation in native gel. Via this stronger loop-loop interaction and end-palindrome sequence, varieties of pRNA nanoparticles, including hexamer with six functionalities were constructed. Meanwhile, functionalities were also conjugated into pRNA 3WJ or 3WJ derived X-shaped scaffold and self- assembled into thermodynamically stable and multifunctional nanoparticles. This novel nano- delivery system was proved to be capable of delivering siRNA into cancer cells specifically. Due to its multi-valence, multiple copies of siRNAs for same target or siRNAs for different targets were conjugated into one particle to enhance gene silencing effects, which paves a new way to apply RNA nanotechnology and nanomedicine for cancer therapy and viral disease treatment.

iii

iv ACKNOWLEDGMENTS

I would like to express my deepest gratitude to my thesis advisor, Dr. Peixuan Guo, for his guidance and support which make this thesis possible. I am very grateful that I was offered this great opportunity to work on these challenging projects for my PhD studies at University of

Cincinnati and University of Kentucky.

My sincerest gratitude also goes to my co-advisor and committee chair, Dr. Jing-Huei Lee, committee members, Dr. Malak Kotb and Dr. Andrew Herr, for their helpful advice and support; my Ph.D qualifying exam committee, Dr. Carlo Montemagno, Dr. Jarek Meller, Dr. Marepalli

Rao for providing invaluable suggestions on my written proposal and oral defense.

The members of the Dr. Guo’s laboratory have been a source of informative instruction, collaboration as well as friendships. I would like to give my sincere thanks especially to Dr. Dan

Shu, Dr. Hui Zhang, and Dr. Feng Xiao for their immense help to my personal and professional life during my PhD study and I am also grateful to many of past and present lab colleagues: Dr.

Farzin Haque, Dr. Randall Rief, Dr. Zhanxi Hao, Dr. Oana Coban, Dr. Faqing Yuan, Dr.

Wenjuan Wang, Dr. Tae Jin Lee, Dr. Matthieu Cinier, Dr. Peng Jing, Dr. Anne Vonderheide, Dr.

Gianmarco De Donatis, Shuhui Wan, Jing Liu, Wei Li, Jia Geng, Huaming Fang, Chad Schwartz,

Daniel Binzel, Le Zhang, Fengmei Pi, Zhengyi Zhao, Hui Li, Shaoying Wang, and Nayeem

Hossain for their kind help and support. I am also thankful to all the work-study students in

Guo’s laboratory.

I would like to thank my collaborators: Dr. Jiehua Zhou and Dr. John Rossi from City of

Hope for the collaboration on the HIV project; Dr. Zhenqi Zhu and Dr. Malak Kotb from College of Medicine at University of Cincinnati for the collaboration on Leukemia project; Dr. Pheruza

Tarapore and Dr. Shuk-Mei Ho from College of Medicine at University of Cincinnati for the

v collaboration on Ovarian Cancer project; Dr. Piotr Rychahou and Dr. B. Mark Evers from

Markey Cancer Center at University of Kentucky for the collaboration on Colon Cancer project;

Jing Hu and Dr. Jiukuan Hao from College of Pharmacy at University of Cincinnati for the

collaboration on Liver Cancer project; Dr. Dingxiao Zhang and Dr. Xiaoting Zhang from

College of Medicine at University of Cincinnati for the collaboration on Breast Cancer project.

Their kind help and hard work make projects moving forward and greatly enrich my learning experience.

Many thanks to Dr. Matthieu Cinier and Shuhui Wan for their help with the synthesis of folate-DNA strand; Dr. Nourtan Abdeltawab and Dr. Zhenqi Zhu from Dr. Malak Kotb’s laboratory at the University of Cincinnati for the help with qRT–PCR assays; Sejal Fox from Dr.

Nira Ben-Jonathan’s laboratory at the University of Cincinnati for help handling flow cytometer

and data analysis; and Birgit Ehmer from University of Cincinnati for the assistance on Confocal

Microscopy.

I would like to thank all the staff members and our faculties, especially the graduate coordinators Julie Muenchen and Barbara Carters, in College of Engineering and Applied

Sciences at University of Cincinnati for their kind help.

Finally, I would like to express my deepest love and appreciation to my family, my mother

Xiaoli Fan and my farther Zhaoyuan Shu. Their encouragement and support are my motivations

all the time.

My Ph.D projects were supported by National Institutes of Healthy grants R01-GM59944,

EB003730, EY018230 “NIH Nanomedicine Development Center: Phi29 DNA packaging Motor

for Nanomedicine”, and National Cancer Institute funding U01-CA151648 to Dr. Peixuan Guo.

vi TABLE OF CONTENTS

Abstract ...... ii

Acknowledgements ...... v

Table of Contents ...... vii

List of Tables ...... x

List of Figures ...... xi

Chapter 1 Introduction and Literature Review ...... 1

Lipid based nanoparticles ...... 2

Polymer based nanoparticles ...... 5

Carbohydrate based nanoparticles……………...... 7

Virus based nanoparticles (VPNs)...... 8

Protein and peptide based nanoparticles ...... 9

Inorganic nanoparticles ...... 10

DNA nanotechnology ...... 11

RNA nanotechnology ...... 13

Chapter 2 Optimization of Dimeric pRNA Nano-delivery System for In Vivo

Applications...... 31

Part I Scale-up Chemical Synthesis of pRNA Nanoparticles by Bipartite Approach...... 31

Part II Generate Chemically Stable pRNA Nanoparticles for In Vivo Delivery...... 40

Introduction...... 41

Materials and Methods...... 42

Results ...... 43

Conclusion and Discussion...... 44

vii Part III Stabilize the tertiary structures of pRNA nanoparticles by chemical crosslinking...49

Introduction...... 50

Materials and Methods...... 51

Results ...... 54

Conclusion and Discussion...... 55

Chapter 3 Develop Novel pRNA Nano-delivery System Based on Different Mechanisms

...... 61

Part I Design of Novel pRNA Nanoparticles Based on Three-way Junction (3WJ) or 3WJ

Derived X-shaped Motif of pRNA to Generate Thermodynamically and Chemically Stable

pRNA Nanoparticles for In Vivo Delivery...... 61

Introduction...... 62

Materials and Methods...... 63

Results ...... 71

Conclusion and Discussion...... 78

Part II Design of Novel pRNA Nanoparticles Based on reengineered pRNA loop-loop

interaction to construct self-assembled and polyvalent pRNA nanoparticles...... 92

Introduction...... 93

Materials and Methods...... 94

Results ...... 102

Conclusion and Discussion...... 108

Chapter 4 Application of pRNA Nanoparticles for Disease Treatment...... 124

Collaboration with Dr. John Rossi group...... 125

Collaboration with Dr. Shukmei Ho group...... 125

viii Collaboration with Dr. Malak Kotb group...... 126

Collaboration with Dr. B. Mark Evers group...... 127

Bibliography ...... 129

Appendices ...... 146

ix LIST OF TABLES

Tabel 1.1 Resource for RNA nanoparticle computation design……...... 16

Tabel 2.1 Assayed pRNA loop-loop interactions for psoralen crosslinking...... 51

Table 3.1 Sequence of loop extended pRNA homo-dimers and hetero-monomers...... 95

Table 3.2 Sequences of hexamer with six functionalities...... 97

x LIST OF FIGURES

Figure 2.1 Y639F mutant T7 RNAP………………………………………...... 46

Figure 2.2 The transcription of chemical modified RNA by mutant T7 RNAP...... 47

Figure 2.3 Urea-PAGE denatured gel showing the stability between nonmodified pRNA Aa’ and

2’F-C/U pRNA Aa’...... 48

Figure 2.4 Psoralen crosslinking of pRNA dimers…...... 58

Figure 2.5 Design and procedures of RNA SELEX for potential psoralen crosslinkable pRNA

loop sequence. …...... 59

Figure 2.6 Improved targeting delivery efficacy of pRNA dimer constructs by psoralen

crosslinking...... 60

Figure 3.1 Sequence and secondary structure of phi29 DNA-packaging RNA...... 80

Figure 3.2 Construction of multi-module RNA nanoparticles harboring siRNA, ribozyme and

aptamer...... 81

Figure 3.3 In vitro binding and entry of 3WJ-pRNA nanoparticles into targeted cells and target

gene knock-down effects...... 83

Figure 3.4 Construction of multi-module RNA nanoparticles harboring MG (malachite green)

aptamer, Folate, Luciferase siRNA, and Survivin siRNA…………………………...... 85

Figure 3.5 Binding and entry of tetravalent pRNA-X nanoparticles into targeted cells…...... 87

Figure 3.6 Construction of tetravalent pRNA-X nanoparticles harboring multiple siRNA for

enhanced gene silencing effects...... 88

Figure 3.7 Comparison of gene silencing effects for a single vs. multiple siRNAs incorporated in

the pRNA-X motif...... 90

Figure 3.8 The illustration of constructing loop extended pRNA...... 111

xi Figure 3.9 Assay homo-dimer formations of loop extended pRNAs by native PAGE...... 112

Figure 3.10 Assay of pRNA homo-dimer and hetero-dimer assembly patterns by 6% native

PAGE...... 113

Figure 3.11 Stepwise assembly of loop extended pRNA polyvalent nanoparticles...... 114

Figure 3.12 AFM images of assembled pRNA nanoparticles...... 115

Figure 3.13 Assay the formation of pRNA foot-to-foot assemblies via 3’-end palindrome

sequence...... 116

Figure 3.14 Formation of pRNA hexamer ring harboring MG binding aptamer as folding and

function indicator...... 117

Figure 3.15 Assay formation of pRNA hexamer ring harboring functionalities including folate,

siRNA, [3H] or Cy3 labeling, HBV ribozyme, MG binding aptamer, and STV

binding aptamer by 6% native PAGE ...... 118

Figure 3.16 Assay of MG binding aptamer function within the pRNA hexamer ring...... 119

Figure 3.17 Assay of STV binding aptamer function within the pRNA hexamer ring ...... 120

Figure 3.18 Assay HBV ribozyme catalytic function within the pRNA hexamer...... 121

Figure 3.19 Assay cell binding of FA-pRNA hexamer by flow cytometry...... 122

Figure 3.20 Assay of firefly luciferase siRNA function within pRNA hexamer ring...... 123

xii

CHAPTER 1. Introduction and Literature Review

1 An ideal delivery system for therapy would “be specific against cell clusters with the

malignant phenotype; and endow the agent(s) comprising the therapeutic formulation with the

means to overcome the biological barriers that prevent it from reaching its target.” 1, 2. To realize

such a system faces challenges such as the construction of the delivery system with sufficient

ability to administer therapeutic moieties to the desired targets, and the marginal or no collateral

damage to the normal tissue. Nanotechnology, integrated with well established medical research,

paves novel ways to meet these challenges.

Nanotechnology involves the creation and application of materials in the nanometer scale

using either top-down or bottom-up assembly approaches 3, 4. Several established nano-delivery

systems for cancer or viral infection treatment were well studied in the last several decades.

There are various classes of nanoparticles in development including liposome based

nanoparticles 5, polymer based nanoparticles 6, protein or peptide based nanoparticles 7-9, quantum dots 10, nano-gold shells 11, to name just a few. The constructed nanoparticles are

intended to be applied for clinical diagnosis and treatments for cancer or viral infectious diseases.

In this chapter, several noteworthy nano-deliver systems for anti-cancer or anti-viral therapy are discussed. The emerging field of RNA nanotechnology will then be thoroughly introduced and explained.

Lipid based nanoparticles

Among lipid based nano-delivery systems, liposome is the first reported system for drug delivery 12 and one of the most thoroughly studied and successfully developed delivery systems.

Currently, a growing number of liposome formulations are in clinical uses or under clinical trials

against cancer and infectious diseases. Doxil®/caylex (Ben Venue Laboratories for Johnson &

2 Johnson) was the first Federal Drug Administration (FDA) approved liposome formulation for

treatment of metastatic breast cancer, advanced ovarian cancer, multiple myeloma, and AIDS-

13-15 related Kaposi’s sarcoma . Marqib-Vincristine sulfate liposome (Hana Biosciences) and

DaunoXome (NeXstar Pharmaceuticals) are also FDA approved for treatment of acute

lymphoblastic Leukemia 16 and advanced HIV-associated Kaposi’s sarcoma respectively 17.

A typical liposome is formed by amphipathic lipid bilayer enclosing an aqueous interior

space. There are several different kinds of liposome formulations. The cationic lipid based

liposome is suitable to encapsulate and deliver nucleic acids. The lipid-DNA/RNA complex is

self-assembled by interaction between polyanionic nucleic acid and cationic polar head of the

lipids. The composition of the hydrophobic tail of the cationic lipids determines the physical

properties of the liposome 18. The fusogenicity and/or stability of the liposome can be adjusted by altering the composition of lipid components 19. Targeted delivery of liposome can be

achieved by modifications of liposome with targeting molecules such as antibodies 20-22, vitamins

23, peptides 24, 25, aptamers 26, and affibodies 27, 28.

The advantages of using liposome for gene or drug delivery are: noninvasiveness for

tissues and individual cells 29, 30, easy preparation, and relatively nontoxicity compared to

polymeric nanoparticles 31. However, liposome is thermodynamically unstable 31, which leads to

the fuse of the particle and early release of the therapeutic agents. Another disadvantage is that

liposome has the limited reproducibility, drug encapsulation ability and retention due to vesicle

size and properties 32. In many cases, systematic injections of liposome are rapidly cleared from

the body and only limited amount of liposome reaches target sites 33.

Many efforts have been devoted for optimizing the liposome delivery system. Chemical

modifications in the phospholipid structure can improve the stability of liposome. Modification

3 on head-group of phospholipid with polymerizable moieties can reduce fusion and produce

stable liposome 34. Modification on glycerol backbone of phospholipid with either ether 35 or

carbamyl esters 35, 36 could result in modulation of stability and in vivo circulation of these

liposomes. Altering fatty acyl chain length and degree of instauration could also adjust the

packing properties of liposome.

Other nonconventional lipid based nano-delivery systems are also developed and studied

for potential clinical applications.

Bolaamphiphiles (also called bolalipids) are a unique class of lipids which have two

hydrophilic head groups at both ends of a hydrophobic domain. Unlike single-hydrophilic head

phospholipids, bolaamphiphiles can form monolayer membranes with less permeability and

more durability than lipid bilayer membrane 37. Bolaamphiphiles are expected to form more

stable vesicles and alteration of the number of the aliphatic chains within the amphiphiles and the

presence of symmetrical versus non-symmetrical head groups have been shown to form various

shaped nanostructures 38, 39. Vesicles made from bolaamphiphiles, characterized by reduced lipid

exchange, may be superior to pass biological barrier and reach target sites. However, only a few

attempts have been made to obtain bolaamphiphiles based vesicles for targeted drug delivery

because the structural requirements for the formation of stable bolaamphiphiles vesicles are not

well understood 5.

Emulsions are composed of a hydrophobic oil phase surrounded by the cationic lipid and

surfactants. The emulsion based delivery system has more favorable physical stability and

biological activities than traditional cationic liposome as gene delivery carrier 40. The nanosized emulsion system is biocompatible, biodegradable and physically stable with low toxicity 41, 42, and potential of large-scale production with low production cost and easy processibility 41.

4 However, emulsions are thermodynamically unstable and emulsion-based gene delivery systems must be optimized for future applications.

Other recently developed lipid based nano-delivery systems including solid lipid nanoparticle (SLN) and nano-structured lipid carrier (NLC) hold great potential for application in drug or gene delivery 43-45. SLN is composed of a solid lipid core covered by surfactants 46. The solid lipid core might contain triglycerides, glyceride mixtures, fatty acids, or steroids that are solid at both room temperature and body temperature 47. The drugs to be delivered are loaded into the SLN lipid crystal matrix. NLC is the second generation of SLN. NLC composed of solid- and liquid-phase lipids shows enhanced drug loading and reduced drug expulsion due to the imperfection of lipid crystal matrix, amorphous or structureless features 46. SLN and NLC maintain the advantages over other lipid based nano-carrier systems by overcoming some of the disadvantages: 1) The lipid components of SLN and NLC are either physiological lipids or lipid molecules with good biocompatibility. 2) The solid lipid matrix of SLN and NLC also decreases the mobility of encapsulated drugs, resulting in their controlled and extended release. 3) SLN and NLC have extended blood circulation time and are shown to be capable of entering neurons and crossing the blood–brain barrier 48, 49. 4) And finally, manufacturing SLN and NLC is less costly with higher homogeneity 5.

Polymer based nanoparticles

Polymer-based nano-delivery systems have been widely developed to encapsulate drug molecules with higher dose applied capability and improved drug releasing rates 50. Polymers, both natural adapted and synthesized, can be used to construct nanoparticles. Typical natural polymers for the preparation of polymer nanoparticles include starch, polypeptides, albumin,

5 sodium alginate, chitin, gelatin, cellulose, and polyhydroxyalkanoates (PHAs) 51. Recently, Lee

JB et. al developed a self-assembled RNA based polymers which overcome the inefficient drug encapsulation problem and pave a new routes for siRNA delivery. The sponge-like microspheres consist of purely condensed cleavable hairpin RNA, which were transcribed using RNA rolling-

cycle transcription and could be processed by RNAi machinery after entering cells and deliver

more than half a million copies of siRNA by a single particle 52. Synthetic polymer materials such as polyethylene glycol (PEG), poly-lactic-acid-co-glycolic-acid (PLGA), polyvinyl alcohol

(PVA), polyvinyl pyrrolidone (PVP), polyethylene (PE), polyanhydrides, and polyorthoesters are

also commonly used for construct polymer nanoparticles 6, 53. There are two general types of

polymer-based nano-delivery system: polymer nano-spheres and nano-capsules. Polymer

nanospheres are solid matrix particles. Functional molecules such as drugs or therapeutic nucleic

acids could be either adsorbed at the sphere surface or encapsulated within the particles. Polymer

nanocapsules are vesicular systems in which the bioactive agents are confined to an aqueous core

and surrounded by the polymeric shell. The surface of polymer nanoparticles may be

functionalized with metal ions, small molecules, surfactants, or other polymer functional groups,

for better targeting, binding, and avoiding immunological reactions.

The advantages of polymer based nanoparticles include higher stability of the structure,

higher drug encapsulation efficiency, higher cellular uptake, and easy modification to achieve

multifunctional and targeting delivery. The drawbacks of these types of polymers include non-

biodegradability, difficulty of synthesizing uniform nanoparticles, insufficient biocompatibility,

fragileness, higher manufacturing costs, toxicity and the immunogenic reactions from the body,

resulting in restricted application of such kind of delivery systems 54. Polymer based nano-

6 delivery system need to be optimized to design advanced polymer nanocarriers to improve biocompatibility, in vivo pharmacokinetics, targeting efficacy, and cost-effectiveness.

As a relative new class of nano-delivery systems, dendritic polymer, so called dendrimer, provides an alternative route to construct well-defined, uniformed and biocompatible nanostructures 55-58. Dendrimers are synthesized based on a core surrounded by layers of branched polymers which are able to encapsulate drugs or biomolecules. However, dendrimers have similar cytotoxicity problems. Eliminating the toxic effects of dendrimers requires further investigation 55-58.

Carbohydrate based nanoparticles

Carbohydrates (glycoproteins and glycolipids) are present at the cell surfaces as signal transduction molecules, serving an important role in recognition and mediating a number of biological and pathological processes 59. Natural carbohydrates such as polysaccharide are potential materials for nanocarrier assembly.

There are two kinds of carbohydrate based nanoparticles: one is nonmetallic polysaccharide-based nanoparticles which are assembled by hydrophilic polysaccharides.

Chitosan is a natural cationic polysaccharide consisting of N-acetylglucosamine and glucosamine units. Chitosan based nanoparticles are widely used for their biocompatibility, biodegradability, and nontoxicity 60. Chitosan based nanoparticles are mainly used as drug delivery vehicles and are good bioadhesive materials which allow higher drug encapsulation capability and slower drug releasing rate 61-63. The Chitosan nanoparticles can adhere to a mucosal surface and facilitate the transportation of drugs cross biological barriers. As alternative formulations for nano-delivery carrier construction, the pure polysaccharide-based nanoparticles are promising

7 alternatives to conventional formulations for disease treatment, especially via mucosal delivery 64.

Other carbohydrate based nanoparticles are metal-based glyconanoparticles (GNPs). GNPs are formed by covalently coating metallic nucleus (usually magnetic or fluorescent particles for imaging purpose) with carbohydrates. GNPs have unique physical, chemical and optical properties and research is focused on using GNPs for disease diagnosis or as potential anti- adhesion agents against pathogens. Coating metallic core with carbohydrates increases its water solubility and biocompatibility, lowers its toxicity and increases its stability 65-67. Magnetic metal

cores, fluorescent quantum dots, and other fluorophores are used to enhance imaging contrast

and diagnose the disease lesions 68. Carbohydrates provide better coatings for the optical core

and suitable carbohydrates can be selected for specifically targeting biomarkers. However, the in

vivo application of metallic GNPs in humans still requires further study.

Virus based nanoparticles (VNPs)

Viral particles are robust protein cages exhibiting well-defined geometry and homogeneity,

which are ideal for nanostructure fabrication. Viral Genome is easy for genetic manipulation, and

viral capsid is versatile and relatively rigid for modifications and conjugation with active

biomolecules or chemical groups. Using a virus as the base platform, a variety of tissue-specific ligands or other molecules such as drugs, fluorophores, antibodies, metals and short peptides may be attached or genetically displayed on the particle surface 69, 70. Additionally, whole protein

and antibodies can be arrayed on the viral particle and their functions are retained 69. These properties make viral particles potential scaffolds for generating varieties of nanoparticles for

disease diagnosis and/or therapy.

8 Most VNPs are based on plant viruses (cowpea mosaic virus (CPMV), cowpea chlorotic

mottle virus (CCMV), tobacco mosaic virus (TMV), tomato bushy stunt virus (TBSV)) and

bacteriophages (MS2 bacteriophage and M13 bacteriophage) because they are supposed to be harmless for human. Several viruses such as the insect flock house virus (FHV), canine parvovirus (CPV), murine polyomaviruses, and hepatitis B-virus (HBV) core along with several protein cages 69-73 and virus like particles (VLPs) are also being explored for nanostructure

construction 74, 75.

Although most of the VNPs are typically not human pathogens and are less likely to infect

human cells and cause diseases, there are still several issues to be considered before using VPNs

for clinical application. First, reliable methods to inactivate replicating viruses, or convert

replicating viruses to VLPs are needed to be standardized to ensure the safety of the in vivo

application of VPNs. Second, further studies of the toxicity, immunogenicity, and biodistribution

of virus particles in vivo must be performed. These studies will provide important information

regarding the safety and potential efficacy of the particles in therapeutic applications.

Protein or peptide based nanoparticles

Antibodies or antibody fragments can act as nanocarriers for targeting delivery of therapeutics to target tumor-associated antigens by conjugating with drugs, cytotoxin, radioisotope, enzyme, or therapeutic RNAs via cleavable or uncleavable linkers. The antibody- drug conjugates, also known as "immunoconjugates", can reach high concentrations in tumor tissues while stay in low concentration in normal tissues 9, 76, 77. The disadvantages of using

immunoconjugates are their short half-life and potential immunogenicity. Modifications of

antibody-therapeutics conjugates such as glycosylation and PEGylation greatly alter the

pharmacokinetics of immunoconjugates and make them more suitable for clinical use 9.

9 Cell-penetrating peptides (CPPs) are short peptides (usually less than 30 amino acids)

containing cationic (histidine, lysine, and arginine) and/or amphipathic amino acids, which have

net positive charge 78. The uptaking mechanisms of CPPs into cells are diverse: CPPs can be

internalized into cells by different endocytic pathways including clathrin-mediated endocytosis,

caveolae-mediated endocytosis, macropinocytosis, and clathrin- and caveolae-independent

endocytosis. Acidic endosome environments cause conformational changes of the amphiphilicity

of peptides which help escaping from endosome/lysosome 79. Direct translocation is another

possible mechanism for CPPs internalization.

There are two different approaches to couple therapeutic cargos with CPPs: one is covalent

conjugation of therapeutics with peptides through chemical bond, and the other is noncovalent

nanoparticle formation strategy. These short cationic peptides can interact with the negatively charged phosphate backbone of nucleic acid through electrostatic interactions and condense nucleic acids to form peptide/nucleic acid complexes 80. In 1997, Heitz and Divita reported for the first time that using MPG peptide to construct noncovalent nanoparticles for cargo delivery 81.

After that, more and more CPPs such as polyarginines, TAT, Transportans (TPs), Pep, and

CADY peptides were discovered and used for constructing CPPs-based delivery system to achieve target delivery 82, 83. Kumar et al. reported a targeted siRNA delivery across the blood- brain barrier via rabies virus glycoprotein (RVG) peptide 84. Moreover, modifications of the

CPPs based nanoparticles such as acetylation, cysteamidation, PEGylation, and cholesterol are

introduced into CPPs based nanoparticles to increase the in vivo stability and deliver efficiency 82.

Inorganic nanoparticles

10 Inorganic nanoparticles include carbon-based nanoparticles (carbon nanoparticles, single-

wall carbon nanotubes, and multi-wall carbon nanotubes), metal-based nanoparticles (gold

nanoparticles, gold nanorods, gold nanoshells, silver nanoparticles, super-paramagnetic iron

oxide nanoparticles) and semiconductor-based nanoparticles (cadmium selenide quantum dots,

cadmium telluride, quantum dots) 85. Most of inorganic nanoparticles are developed for medical

imaging because of their brightness and photostability 86. Some of them have great potentials for

photothermal therapy because of their high photothermal conversion rate. However, the

biocapacity, toxicity and liver, lung and kidney trap of the inorganic nanoparticles are the major

disadvantages for clinical applications. The ease of surface functionalization with targeting

molecules might help reducing the toxicity by specific directing the drug delivery and

eliminating the harm to normal tissue and organs. Coating with polymers or carbohydrates might

improve the biocapacity and biodistribution of the inorganic nanoparticles 87, 88.

DNA nanotechnology

Deoxyribonucleic acid (DNA) is the genetic material in nature for coding the life pattern of

living organisms. The iconic anti-parallel double helical structure is formed by Watson-Crick

base pairing between the complementary nucleotides sequences.

DNA nanotechnology was first proposed by Nadrian in the early 1980s 89. DNA nanotechnology uses the complementary nature of four bases in DNA molecules to construct nanomaterials. The development of DNA nanotechnology relies on the control of DNA hybridization, self-assembly of stable branched DNA, programmability of DNA and convenient synthesis of designed DNA sequences. The rational design of the DNA nanostructures generally follows three steps: first step is to specify the desired structures or functionalities, second step is

11 to determine DNA strand arrangements by computation, and final step is to design the primary

sequence of each DNA strand 90.

The constructed DNA nanoparticles including individual folding structures (such as DNA

branches, DNA polygons, DNA bundles and DNA tubes 91-94), tile-shaped structures (such as

DNA origami, and DNA 2D- and 3D- arrays 95-97), and dynamic assemblies (such as DNA

nanomachine, DNA walker, and DNA robot 98-102).

Although DNA nanotechnology is a fast growing field in recent years, most of DNA-based nanostructures are still structure-based. Using pure DNA nanoparticles for clinical application are limited by the simplicity of DNA. The function of DNA nanoparticles relies on introducing

other function molecules. One example is using DNA nanostructure to cage enzyme which might

release and induce cell apoptosis upon delivery 103.

In summary, there are many kinds of widely studied and developed nano-delivery systems:

lipid based nanoparticles, polymer based nanoparticles, immunoconjugates, peptide conjugates,

carbohydrates based nanoparticles, nucleic acids based nanoparticles and inorganic nanoparticles.

Each is based on unique properties of fabrication materials while accommodating the

therapeutics or imaging agents as well as the targeting ligands. However, only a limited number

of the nanoparticles are FDA approved for their clinical applications 104.

The clinical application of nanoparticles requires the consideration of important

parameters including particle size, efficiency of drug loading, batch-to-batch variations, stability

in circulation, target specificity, toxicity, etc. 104. The nanoparticles generally range from

100nm~400nm, which are capable for passive targeting to diseased tissue via enhanced

permeation and retention (EPR) effects. The homogeneity and stability of the nanoparticles

12 ensures the better biodistribution and deliver efficiency 104. Main concern of using nanoparticles

in nanomedicine is the therapeutical potential for living systems 105. Therefore, nanoparticles

based on natural biomolecules such as lipids, proteins, and carbohydrates are expected to be

more capable and less toxicity. Meanwhile, involving targeting delivery mechanisms will help

with the specific accumulation at malignancy without harming the normal tissues and organs. In

addition, immunogenicity of the nanoparticles is another concern for in vivo application.

Changing the surface chemistry of nanoparticles might suppress immunological response and ensure the repeat treatments. To make nanoparticles practical for clinical applications, the

advantages from different nano-delivery systems can be combined to construct optimized

“smart” nanoparticles. For example, the liposome can conjugate peptide or antibody for targeting

delivery and can also be coated with polymer to increase the in vivo stability. The other way is to

continue developing novel delivery system such as the emerging field of RNA nanotechnology.

RNA nanotechnology

Ribonucleic acid (RNA) molecules can be easily manipulated with the simplicity of DNA,

while possessing versatile structures and functions similar to proteins. This property makes RNA

a suitable candidate for applications in Nanotechnology and Nanomedicine 106-109. RNA is made

up of a sugar-phosphate backbone chain with combination of four ribonucleobases: adenine (A),

guanine (G), cytosine(C), and uracil (U). Most RNA molecules are single-stranded. Like DNA,

RNA can be synthesized both enzymatically and chemically in vitro. Unlike DNA, RNA

contains complicated three-dimensional structures which can play more specific functions.

The primary sequences of the RNA determine the folding of RNA structures. Secondary

structure elements such as bulges, hairpin loops, internal loops, and junctions are formed through

13 Watson-Crick and/or non-canonical base-pairing. The inter- and intra-molecule interactions such

as loop-loop interaction and base stacking ensure the formation of RNA tertiary structures by

hydrogen bonds within the RNA molecules. In addition, since RNA is charged, metal ions such

as Mg2+ are needed to stabilize many secondary and tertiary structures 110.

In addition to encoding genetic information, RNA molecules also play active roles in cells

by catalyzing biological reactions 111, regulating gene expression 112-115, or sensing and

communicating responses to cellular signals116-118. In recent years, more and more functional

RNA molecules, naturally or artificially engineered, have been discovered. Like antibodies,

RNA aptamers selected from systematic evolution of ligands by exponential enrichment (SELEX)

119-123 are able to bind to specific targets, including proteins, organic compounds, and nucleic

acids 124-126. The ability to recognize specific cell surface markers through the formation of

binding pockets and the capability of internalization by the targeted cells paves a new way for

targeted delivery 127-130. In the early 1980s, Thomas Cech 131 and Sydney Altman 132 found RNA molecules had the ability to catalyze chemical reactions. In 1998, Andrew Fire and Craig Mello discovered RNAi (RNA interference), a mechanism which regulates gene expression on a post- transcriptional level 133. The discovery of RNAi has heightened interests in RNA therapeutics 133.

Several RNA based therapeutic approaches using small interfering RNAs (siRNAs) 134-140, ribozymes 141-144, and anti-sense RNAs 145, 146 have been shown to down-regulate specific gene

expression by intercepting and cleaving mRNA or the genome of RNA viruses in cancerous or

viral-infected cells.

The concept of RNA nanotechnology has been proposed for more than a decade 106, 108, 147-

153. Elucidation of the structural and folding mechanisms of RNA motif and junctions has laid a

foundation for the further development of RNA nanotechnology. The structure motifs and

14 tertiary interactions can be extracted from RNA molecules as the building blocks to self-

assemble nano-scaled scaffolds 154, 155, and the intra- and inter-molecular interaction can be

computed and rationally designed. Meanwhile, functional RNA molecules such as siRNA, ribozyme, and riboswitch can be incorporated into the scaffold and further form functionalized

RNA nanoparticles. The field of RNA nanotechnology is becoming popular because the potential of RNA nanoparticles in the treatment of cancer, viral infection, or genetics diseases is recognized 106. RNA nanotechnology holds great potential because: 1) Homogeneous RNA

nanoparticles can be manufactured with high reproducibility and known stoichiometry, thus

avoiding unpredictable side effects or nonspecific toxicity associated with heterogeneous

structures. 2) Using the bottom-up approach, RNA nanoparticles can be assembled harboring

multiple therapeutic, reporters and/or targeting payloads for synergetic effects 156, 157. 3) Cell type-specific gene targeting can be achieved via simultaneous delivery and detection modules which reduces off-target toxicity and lowers the concentration of the drug administered, thus reducing the side effects of the therapeutics. 4) RNA nanoparticle size typically ranges from 10–

50 nm, an optimal size for a non-viral vector as they are large enough to be retained by the body yet small enough to pass through the cell membrane via the cell surface receptors mediated endocytosis. The advantageous size has the potential to greatly improve the pharmacokinetics, pharmacodynamics, biodistribution, and toxicology profiles by avoiding non-specific cell penetration 158. 5) Protein-free RNA nanoparticles with RNA aptamers as anti-receptors can

yield superior specificity compared to protein anti-receptors while displaying lowest antibody-

inducing activity, thus providing an opportunity for repeated administration and treatment of

chronic diseases. 6) RNA nanoparticles are treated as chemical drugs rather than biological

entities, which will facilitate FDA approval.

15 RNA nanoparticles construction is generally following three steps: RNA building block

extraction, rational computational design, and RNA nanoparticle fabrication. RNA structural

motifs can be extracted from the known RNA structures as the building blocks and rational

designed to apply for RNA nanoparticle construction. Significant contributions on the

fundamental studies of RNA structural motifs were made by group of scientists from Eric

Westhof 154, 159-161, Neocles Leontis 150, 154, 155, 162, 163, and David Lilley’s laboratory 164-167.

RNA folding and structural computation is essential for using RNA motifs for RNA

nanoparticle assembly. The computational design of nanostructures is relatively inexpensive and

provides a faster examination of new structural designs. Advances of RNA 3D computation was

promoted by Bruce Shapiro and co-workers, which brought new energy into the RNA

nanotechnology field 168-173. For the available RNA structure information and computation program, please refer to Tab. 1.1.

Tab 1.1 Resource for RNA nanoparticle computation design

name description reference Atomic structure information derived from X- Protein Data Bank ray crystallography or NMR 174-176 (PDB) (http://www.wwpdb.org/) Nucleic acid structures derived from X-ray Nucleic Acid crystallography or NMR and classified by type 177 Database (NDB) (http://ndbserver.rutgers.edu/) Structure Classification of RNA internal loop and hairpin Classification of RNA 178, 179 loop structures (http://scor.lbl.gov.) Database (SCOR) Non-Canonical Structure information about noncanonical RNA Interactions in RNA 180 base pairs (http://prion.bchs.uh.edu/bp_type/) database (NCIR) Contains “over 12,000 extracted three- RNA structure database dimensional junction and kissing loop RNAjunction database structures as well as detailed annotations for 181 each motif” (http://rnajunction.abcc.ncifcrf.gov/).

The fullpaperisreprintedwithpermission from Elsevier. and methods forpRNAnanoparticleconstructionwaspublishedin leukemia, lung,breast,ovarian,prostate,among others showed thatpRNAcouldescort the siRNAto cells hasbeenachievedusing RNA nanoparticlesviainterlocking tectosquares, Jigsawpuzzles as ribosome RNAorHIVkissingloopscanbuiltupvarietiesofnanostructuressuchas from designedbuildingblocks.TectoRNAs RNA structure predication Bacteriophage phi29packagingRNA(pRNA)is scaffoldwhichare built Luc Jaeger’sgrouphasshownthatRNAcanbeusedasefficient RNAstructure RNA-Puzzles RNAshapes tmTae Comparative RNAstructureanalysis Stem Trace RNA2D3D RNA2D3D MPGAfold Nanotiler UNAfold AA webserverfor RNAda RADAR MANIP MANIP Mfold Sfold NAB NAB , nanocubes,andnanorings pRNA nano-deliverysystem Design ofRNAnanoscalestructuresfrom RNA secondarystructure predictionand loop-loop interactions.Specificde RNA 3Dstructuremodeling 150 17 , whichweredesignedfrom building blocks

determination silence genesandtode anotheramazing systemforassemblyof ta analysis and research 151, 169, 172, 194, 195 156, 157, 196-201 156, 196, 197 . Previousextensivestudies Method, 2011,54:204-14. . The detailed introduction livery ofsiRNAtotarget . stroy cancer cellsof structure motifsuch 193 171 192 191 190 189 188 187 186 185 184 183 182

Methods 54 (2011) 204–214

Contents lists available at ScienceDirect

Methods

journal homepage: www.elsevier.com/locate/ymeth

Review Article Assembly of multifunctional phi29 pRNA nanoparticles for speciﬁc delivery of siRNA and other therapeutics to targeted cells ⇑ Yi Shu, Mathieu Cinier, Dan Shu, Peixuan Guo

Nanobiomedical Center, University of Cincinnati, Cincinnati, OH 45267, USA article info abstract

Article history: Recent advances in RNA nanotechnology have led to the emergence of a new field and brought vitality to Available online 12 February 2011 the area of therapeutics [P. Guo, The emerging field of RNA nanotechnology, Nat. Nanotechnol., 2010]. Due to the complementary nature of the four nucleotides and its special catalytic activity, RNA can be Keywords: manipulated with simplicity characteristic of DNA, while possessing versatile structure and diverse func- Bacteriophage phi29 tion similar to proteins. Loops and tertiary architecture serve as mounting dovetails or wedges to elim- Nanomotors inate external linking dowels. Unique features in transcription, termination, self-assembly, self- Nanotechnology processing, and acid-resistance enable in vivo production of nanoparticles harboring aptamer, siRNA, Nanobiotechnology ribozyme, riboswitch, or other regulators for therapy, detection, regulation, and intracellular computa- Bottom-up assembly DNA packaging tion. The unique property of noncanonical base-pairing and stacking enables RNA to fold into well- pRNA nanoparticle defined structures for constructing nanoparticles with special functionalities. RNAi Bacteriophage phi29 DNA packaging motor is geared by a ring consisting of six packaging RNA (pRNA) Cell-type specific delivery molecules. pRNA is able to form a multimeric complex via the interaction of two reengineered interlock- Viral assembly ing loops. This unique feature makes it an ideal polyvalent vehicle for nanomachine fabrication, pathogen detection, and delivery of siRNA or other therapeutics. This review describes methods in using pRNA as a building block for the construction of RNA dimers, trimers, and hexamers as nanoparticles in medical applications. Methods for industrial-scale production of large and stable RNA nanoparticles will be intro-

duced. The unique favorable PK (pharmacokinetics) proﬁle with a half life (T1/2) of 5–10 h comparing to 0.25 of conventional 20-F siRNA, and advantageous in vivo features such as non-toxicity, non-induction of interferons or non-stimulating of cytokine response in animals will also be reviewed. Ó 2011 Elsevier Inc. All rights reserved.

1. Introduction proteins [5,12–18]. This property makes RNA an attractive candidate for nanotechnological applications [4]. Building-blocks are Nanotechnology involves modification, engineering, and/or first synthesized after computing intra- and inter-molecular fold- assembly of organized materials at the nanometer scale [1–4]. ing [19–24]. Nanoparticles are then built via spontaneous tem- RNA molecules can be designed and manipulated at a level of sim- plated [5,14,15] or nontemplated self-assembly as planned [6,7]. plicity similar to DNA [5–11], while possessing the versatility in In recent years, more and more functional RNA molecules, nat- structure, function, and even enzymatic activity similar to that of urally or artificially engineered, have been discovered. Like antibodies, RNA aptamers selected from systematic evolution of ligands by exponential enrichment (SELEX) [25–29] are able to Abbreviations: pRNA, phi29 motor packaging RNA; RNAi, RNA interference; bind to specific targets, including proteins, organic compounds, SELEX, systematic evolution of ligands by exponential enrichment; HBV, hepatitis B and nucleic acids [30–32]. The ability to recognize specific cell sur- virus; CVB3, coxsackievirus B3; MT-IIA, Metallothionein-IIA; HDA, AMP-hexanedi- face markers through the formation of binding pockets and the 0 0 0 amine; GSMP, 5 -deoxy-5 -thioguanosine-5 -monophosphorothioate; EDC, 1-ethyl- capability of internalization by the targeted cells pave a new way 3-[3-dimethylaminopropyl]carbodiimide hydrochloride; NHS, N-hydroxysuccinimide; DCC, N,N0-dicyclohexylcarbodiimide; TEA, triethylamine; DMSO, for targeted delivery [33–37]. In the early 1980s, Cech [13] and Alt- dimethylsulfoxide; BMPS, N-[b-maleimidopropyloxy]succinimide ester; RES, retic- man [38] found RNA molecules had the ability to catalyze chemical uloendothelial system; Cl, clearance value; Vd, volume of distribution; PK, reactions. In 1998, Fire and Mello discovered RNAi (RNA interfer- pharmacokinetics. ence), which can regulate gene expression on a post-transcrip- ⇑ Corresponding author. Address: Rm. 1436, ML #0508, Vontz Center for tional level [39]. These RNA molecules have significant Molecular Studies, 3125 Eden Avenue, University of Cincinnati, Cincinnati, OH 45267, USA. Fax: +1 (513) 558 6079. therapeutic potential and are capable of regulating gene function E-mail addresses: [email protected], [email protected] (P. Guo). by intercepting and cleaving mRNA or the genome of RNA viruses.

The discovery of RNAi has heightened interest in RNA therapeutics binding and transportation of the chimeric pRNA/siRNA, pRNA/ [39], since several RNA based therapeutic approaches using small ribozyme into cells, subsequently silencing the targeted genes interfering RNAs (siRNAs) [4,40–45], ribozymes [46–49], and and modulating programmed cell death [53–55]. anti-sense RNAs [50,51,51] have been shown to down-regulate pRNA can be chemically synthesized and modified starting from specific gene expression in cancerous or viral-infected cells. The small RNA fragments. The resulting nanoparticle can be assembled successful application of RNA-based therapeutics for the treatment through the bottom-up assembly approach [91]. The structural and of cancer and infectious diseases requires several features: (1) molecular features of phi29 pRNA allow its easy manipulation, delivery to desired cells; (2) capability of entering cells; (3) making it possible to redesign its components as gene targeting surviving degradation by nucleases; (4) trafficking into the and delivery vehicles (Fig. 1D). appropriate cell compartments; (5) correct folding of siRNA or ribozyme in the cell, if fused to a carrier; (6) the release from endosome and incorporation of siRNA into RISC once siRNA is 2. The biological function of pRNA on phi29 DNA packaging delivered into cells. In addition, the RNA particle should have low motor toxicity and high retention times in the body. Hence, the development of a safe, efficient, specific, and nonpathogenic system for the All linear double-stranded DNA viruses including bacteriophage delivery of therapeutic RNA is highly desirable. phi29 [56] possess a common feature that their genome is Bacterial virus phi29 DNA packaging RNA (pRNA) molecule con- packaged into a preformed procapsid during the maturation of tains an intermolecular interaction central domain and a helical the virion. This process is accomplished by an ATP-driven packaging domain as the 50/30 paired region (Fig. 1A). Via the interaction of motor (Fig. 1C) [57]. However, the most exciting aspect of the two interlocking loops, the pRNA molecules form dimers, trimers, phi29 DNA packaging process is the discovery of a small viral hexamers, and patterned superstructures [7]. This property of RNA, called pRNA(Fig. 1A) [12], which is 120 bases and transcribed forming self-assembled nanostructure makes pRNA ideal building from the left end of the phi29 genome. It has also been revealed blocks for bottom-up assembly. The pRNA interlocking central do- that pRNA contains two functional domains [58,59], one facilitates main is a nucleation core with very low free energy, which folds the formation of pRNA hexameric ring (Fig. 1B) and binds to the independently of the newly incorporated moieties [52]. Thus, connector while the other binds to the DNA-packaging enzyme pRNA can be engineered and fabricated as a polyvalent and nano- gp16 [60]. By using the energy from gp16 hydrolyzing ATP, this scale delivery system capable of delivering multiple therapeutics very powerful DNA packaging motor then gears the viral genome into specific cells. Incubation of the pRNA containing receptor- into the preformed procapsid. After the complete packaging, it is binding moieties and gene-silencing subunits, resulted in cell possible that pRNA leaves the connector before the collar protein

Fig. 1. The illustration of phi29 pRNA structure, function, and application. (A) Primary sequence and the folding structure of the pRNA. (B) The assembled hexamer ring via hand-in-hand interaction (adapted from [15] with permission from the authors and the publisher). (C) The phi29 pRNA packaging motor is geared by pRNA rings to package DNA into procapsid [12] (adapted from [107] with permission from the authors and the publisher). (D) pRNA has the potential to be used as a building block for assembly of therapeutic RNA nanoparticles. 19 206 Y. Shu et al. / Methods 54 (2011) 204–214 gp11 and tail knob gp9 protein block the connector channel and interlocking interaction or interfere with the function of inserted assemble the intact viral particles [61]. moieties (Fig. 1D). Then, the engineered monomeric pRNA chimera (Fig. 2) can be further assembled as various nanoparticles including 3. Structure of phi29 motor pRNA dimers, trimers and tetramers through different strategies (Figs. 5 and 6). pRNA is a crucial component in the phi29 DNA packaging motor and contains two functional domains (Fig. 1A). The intermolecular 5.1. Construction of monomeric building block of pRNA chimera with interaction domain is located at the central region (bases 23–97) biological and pharmaceutical functionalities and within this domain there are two loops (right hand loop and left hand loop) which are responsible for the hand-in-hand interac- 5.1.1. Monomeric pRNA chimera harboring therapeutic RNAs tion through the four complementary base sequences within these pRNA chimera harboring siRNA (Fig. 2). The pRNA double- two loops. The other domain is a DNA translocation domain which stranded 50/30 end helical domain and intermolecular binding do- 0 0 is located at the 5 /3 paired ends for the binding of gp16 [60]. The main fold independently of each other. Complementary modifica- right hand loop (bases 45–48) and the left hand loop (bases 82–85) tion studies have revealed that altering the primary sequences of allow for the formation of pRNA dimers, trimers, and hexamer any nucleotide of the helical region does not affect pRNA structure rings via intermolecular base-pairing [5,62]. and folding as long as the two strands are paired [65]. Extensive Nucleotides 23–97 are the key components in the formation of studies revealed that siRNA was a 21–23 nt RNA duplex pRNA multimers. This pRNA interlocking central domain consti- [41,42,45,66]. Thus, it was possible to replace the helical region tutes a nucleation core with very low free energy. As mentioned in pRNA with double-stranded siRNA. A variety of chimeric pRNAs before, pRNA is constituted with two domains and both of them with different targets were constructed to carry siRNA connected can fold independently. The ability to form pRNA multimers is to nt# 29 and 91 of the pRNA (Fig. 1A). Such a pRNA/siRNA chimera 0 0 not affected by 5 or 3 -end truncation before residue #23 and after was proven to be the building block which successfully inhibited residue #97 [52]. Thus, end conjugation of pRNA with chemical targeting gene expression. A pRNA/siRNA chimera harboring siRNA moiety of fusing pRNA with a receptor-binding RNA aptamer, siR- targeting coxsackievirus B3 (CVB3) protease gene was constructed NA, or ribozyme would not disturb pRNA dimer formation or inter- and was able to knock down gene expression specifically and inhi- fere with the function of inserted moieties [53–55,63,64]. bit viral replication in vitro [67]. We also selected a model involving the Metallothionein-IIA (MT-IIA) gene as a proof of concept. 4. Nomenclature The specific knock-down of the MT-IIA gene by constructed chimera pRNA/siRNA (MT-IIA) can reduce ovarian cancer cells viabil- To simplify the description of RNA construction and multimer ity significantly [68]. Pre-clinical study also showed that pRNA/ assembly, uppercase letters will be used to represent the right siRNA chimera targeting anti-apoptotic factor survivin gene can hand loop of pRNA and lowercase letters to represent the left hand drive cancer cells undergo apoptosis and prevent tumorigenesis loop (Fig. 1A). The same letters in upper and lower cases indicate in xenograft mice models [53,54]. complementary sequences for loop/loop interaction, while differ- pRNA chimera harboring ribozyme (Fig. 2). Using the circular per- ent letters indicate non-complementary loops. For example, pRNA mutation approach [69–71], almost any nucleotide of the entire A–b0 represents pRNA with a non-complementary right loop A pRNA can serves as either the new 50-or30-end of the RNA monomer. 50 0 30 ( G45G46A47C48) and a left loop b ( U85G84C83G82). Dimer forma- Connecting the pRNA 50/30 ends with variable sequences did not dis- 50 0 tion requires a right loop B ( A45C46G47C48) and left loop a turb its folding and function [53–55,63,64]. These unique features, 50 0 ( C45C46U47G48) of pRNA B–a [5,52]. which help prevent two common problems: exonuclease degradation and misfolding in the cell, make pRNA an ideal vector to carry 5. Bottom-up assembly of pRNA nanoparticles therapeutic RNA such as ribozyme. A pRNA-based vector was designed to carry hammerhead ribozymes that cleave the hepatitis B Taking advantages of the folding independence of pRNA0s two virus (HBV) polyA signal [63]. The pRNA/ribozyme (survivin), which functional domains, end conjugation of pRNA with chemical moi- targeted the anti-apoptosis factor survivin to down-regulate genes ety, fusing pRNA with a receptor-binding RNA aptamer, siRNA, involved in tumor development and progression, was also shown ribozyme, or other chemical groups generally do not disturb the to suppress survivin expression and initiate apoptosis [55].

Fig. 2. The construction of pRNA chimeras including therapeutic portion like pRNA/siRNA and pRNA/ribozyme as well as delivery portion such as pRNA/aptamer and pRNA conjugated with chemical ligands. 20 Y. Shu et al. / Methods 54 (2011) 204–214 207

5.1.2. Construction of monomeric pRNA chimera for cell targeting in vivo (Fig. 3B). Synthetic DNA oligos functionalized with different pRNA chimera harboring aptamer (Fig. 2). In vitro SELEX [31,32] chemical groups, such as folate, were used for therapeutic pRNA of RNA aptamers which bind to specific targets has become a pow- construction (Fig. 2). Details of the pRNA labeling strategies are erful tool for selecting RNA molecules that target specific cell sur- discussed below (Section 5.1.3). face receptor. Aptamers were linked to the 30 and 50 end of pRNA. To facilitate independent folding, poly U or poly A linkers were placed between the pRNA and the aptamer. The nascent 50/30 end 5.1.3. Chemical strategies for pRNA conjugation with ligands, of the pRNA were relocated to nt 71 and 75 (Fig. 1A) using the cir- fluorophores, and other chemical moieties cular permutation approach [69,72]. The tightly folded nt 71 and Unlike most of the other nanodelivery system, pRNA technology 75 region protected the 50/30 end from exonuclease digestion. offers the possibility to form multivalent nanoparticles with accu- One of the pRNA/aptamer constructs harboring anti-HIV gp120 rate control of the stoichiometry of the different functional ele- aptamer was proved to bind to and are internalized into cells ments. Detection, ligand targeting, and drug or gene delivery expressing HIV gp120. Moreover, the pRNA–aptamer chimeras elements can be conjugated to pRNA and then assembled into alone also provide HIV inhibitory function by blocking viral infec- one nanoparticle through the bottom-up approach. Although, syn- tivity in an acute in vitro challenge assay [73]. thetic RNA can be modified with a wide variety of reactive moieties pRNA chimera harboring chemical ligands (Fig. 2). Chemical li- for chemical conjugation, they will not be discussed in this paper. gands like folate which can recognize specific cell surface markers Readers can refer to a previous review [74]. Alternatively, many can also be conjugated to pRNA for specific targeting [64,67,68,92]. different strategies have been developed for post-transcriptional A complementary DNA oligo can be annealed to the end of the or co-transcriptional functionalization of RNA molecules. These pRNA which has the 30-end extension with 14–26 nucleotides. labeling strategies have been demonstrated to be highly efficient The assembled folate–pRNA nanoparticles are able to bind and for long chain RNA, such as pRNA (120 bases), and can be distin- internalize into cancer cells specifically and efficiently (Fig. 3A) guished following single molecule labeling or random labeling of and were applied for systematic target delivery of therapeutics the whole chain of the RNA [75].

Fig. 3. Target delivery of folate labeled pRNA nanoparticles in vitro [91] and in vivo [92]. (A) (a) Flow cytometry data showed the specific and efficient binding of the folate– pRNA nanoparticles to cancer cells. (b) Confocal images showed the internalization of folate–pRNA nanoparticles after binding. (B) (a) Target delivery of pRNA nanoparticles in vivo. (b) The pRNA nanoparticles were delivered and accumulated into FR positive tumor specifically compared to normal tissues and organs. Lv, liver; K, kidney; H, heart; L, lung; S, spleen; I, intestine; M, muscle; T, tumor. (Figures are adapted from [91] and [92] with permission from the authors and the publisher.) 21 208 Y. Shu et al. / Methods 54 (2011) 204–214

Whole chain labeling of pRNA. Bifunctional alkylating agents are propyloxy] succinimide ester (BMPS) or any common chemicals that known to promote crosslinking of DNA or RNA molecules. Using contain maleimide, vinyl sulfone or pyridyl disulfide. Using similar a similar strategy, post-transcriptional fluorescent labeling of the approaches, it was possible to efficiently synthesize RNA directly pRNA molecule was readily achieved using functionalized fluoro- and incorporate traditional coupling reactive groups, such as amino phores, harboring a mono-alkylating reactive group, developed –NH2, –COOH, maleimide, or NHS for constructing polyvalent RNA by Mirus (Label IT labeling reagent, Mirus). More recently, it was nanoparticles. The NH2-group was used to link any particles with a demonstrated that T7 RNA polymerase can be used for in vitro COOH-group with the help of EDC. NH2/NH2 interactions can be enzymatic fluorescent labeling of the RNA molecule using the achieved via heterobifunctional crosslinkers. new reagent tCTP [76]. Different T7 RNA polymerase mutants were constructed to recognize and permit the incorporation of 20-modi- 5.1.4. Two-piece assembly and enzymatic ligation of pRNA 0 0 0 0 fied triphosphate ribonucleotide such as 2 -oMe, 2 -F, 2 -NH2,2-N3 nanoparticles into the RNA chain [77–80]. Reactive functions (amino or azido) One problem in RNAi therapy is the requirement for the genera- can be imagined to further conjugate to the RNA molecules. Alter- tion of relatively large quantities of RNA. Industrial scale of chemi- natively, 20-F pRNA molecules were constructed and shown to cally synthesized RNA is one of the approaches to scale up the RNA present an improved resistance to RNase degradation compared synthesis. However, each pRNA nanoparticle is over the size limit to unmodified RNA, when both pyrimidines were substituted by of commercial RNA synthesis (80 nucleotides). To produce polyva- their 20-F counterparts [81]. lent therapeutic pRNA nanoparticles in a large scale quantity, the Single labeling of pRNA with fluorescent molecules or other chemical phi29 pRNA can be assembled from pRNA bipartite modules [90]. reactive groups. Although it is not difficult to incorporate a single A similar principle in using bipartite modules can be applied to the label during solid phase synthesis of short RNA, synthesis of long assembly of therapeutic pRNA chimeras. Besides the bipartite mod- RNAs greater than about 80 nts only rely on the enzymatic meth- ules reported recently [90], other modules from different locations ods and the single labeling of the RNA is hard to achieve with high and regions of the pRNA template were designed and tested. labeling efficiency. To overcome this challenge and label the longer Different kinds of bipartite modules were constructed by open- RNA with a single functional group, AMP and GMP derivatives ing at the different positions of the pRNA. After chemical or enzy- which have been demonstrated to be efficient initiators in RNA matic synthesis of each fragment, the two RNA fragments are transcription by T7 RNA polymerase but cannot be used in the annealed to form the intact particle, simply by mixing them to- elongation step, were designed (Fig. 4). Efficient labeling of RNA gether, heating up to 80 °C and slowly cooling down to room tem- molecules at the specific 50 position can be readily achieved by perature. The assembled bipartite pRNA modules maintain the either one-step transcription initiation or a two-step procedure folding characteristics of the intact pRNA and are able to form a di- of transcription and post-transcriptional modification. Various mer with its partner. Preliminary data also demonstrated that the kinds of AMP and GMP derivatives were synthesized by conjugat- chimeric pRNA bipartite modules can be processed and silence the ing different chemical groups with AMP or GMP through linker target gene in the same manner as the intact particle [91]. molecules through established chemistry [64,82–85]. The amino- Enzymatic ligation of the RNAs into one intact particle is not and thiol-reactive derivatives, AMP-hexanediamine (HDA) [82,86] necessary, but is found to be an efficient strategy to face the disso- and 50-deoxy-50-thioguanosine-50-monophosphorothioate (GSMP) ciation problem observed in some bipartite RNAs. Within the pRNA [83] respectively, present both reactive moieties for further conju- structure, we have already found one high-yielding ligation site in gation with ligands or detection markers for the production of the pRNA interlocking domain [92]. After synthesizing the small deliverable polyvalent therapeutic particles. Whereas the synthesis RNA fragments separately, the additional RNA ligation used to of GSMP requires a more complicated chemical process [83],an assemble the longer RNA fragments is realized using T4 RNA ligase AMP-HDA derivative was synthesized in one-step through the [93]. The ligation of the fragments will ensure the stability and the direct coupling of HDA to AMP at pH 6.5 in the presence of correct folding of the entire particle. 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) [86]. AMP-HDA can then be purified either simply by remov- 5.2. Construction of multimeric pRNA nanoparticles based on pRNA ing the excess of HDA using ion exchange chromatography [86] or structure reverse-phase chromatography [82]. The reactive aliphatic amine of AMP-HDA can be used for fur- The self-assembly of pRNA nanoparticles is a prominent bot- ther functionalization by common coupling reactions with N- tom-up approach and represents an important idea that biomole- hydroxysuccinimide (NHS) activated compounds. Fluorescent dyes cules can be successfully integrated into nanotechnology (FITC, Cy5, Cy3), targeting moieties (folic acid) [87], or also biotin [7,53,54,94,95]. Such an approach relies on the cooperative interac- can be coupled to AMP-HDA and the resulting derivatives are tion of individual RNA molecules that spontaneously assemble in a shown to be efficient for the construction of single labeled pRNA predefined manner and form larger 2D- or 3D-structures. molecule [88]. Alternatively, these NHS activated compounds can There are two main categories of self-assembly: non-templated be directly coupled to the end NH2 group of single labeled RNA and templated nanoparticle assembly. Non-templated assembly in- fragments as a post-transcriptional labeling approach. volves the formation of a larger structure by individual components Unlike most of the common dyes and biotin, folic acid is not com- without influence from external forces. The formation of pRNA di- mercially available through its NHS ester activated form. Reaction of mers, trimers and tetramers falls into this category. On the contrary, folic acid in the presence of N,N0-dicyclohexylcarbodiimide (DCC), template nanoparticle assembly involves the interaction of RNAs NHS, and triethylamine (TEA) in dimethylsulfoxide (DMSO) lead to under the influence of a specific external force, structure, or spatial its conversion into its NHS ester derivatives, which can be purified constraint. In the phi29 bacteriophage, pRNA dimers serve as the from the reaction mixture by precipitation [89]. Alternatively, folate building blocks to form a hexameric ring through the binding to labeling of pRNA was also achieved through a two-step procedure the connector embedded in the viral procapsid which serves as the involving primarily the coupling of the folate-NHS ester with a 50- template for hexameric ring assembly [5,15].

NH2-DNA oligo. HPLC puriﬁcation of the coupling product, followed by the annealing with pRNA has led to pRNA–folate conjugates. 5.2.1. Construction of dimeric pRNA nanoparticles [5]

SH-groups, provided by GSMP, can be used to link either a NH2- Hand-in-hand dimers are formed by the intermolecular group via a hetero-bifunctional crosslinker such as N-[b-maleimido- interaction of interlocking right and left loops that are 22 Y. Shu et al. / Methods 54 (2011) 204–214 209

Fig. 4. The chemical structure of the synthesized AMP and GMP derivatives. trans-complementary (Fig. 5A). For example, pRNA Ab0 molecule tem which is able to specifically recognize and target specific interacts quantitatively with an equal mole ratio of pRNA Ba0 mol- cells. The strength of using phi29 pRNA as a delivery vehicle relies ecule, forming a dimer in the presence of at least 5 mM Mg2+ [61]. on its ability to easily form stable multimers which could be Dimers of an extended configuration (twins) can also be efficiently manipulated and sequence-controlled [5,6,61]. This particular sys- self-assembled in solution by introducing a palindrome sequence tem provides unprecedented versatility in constructing polyvalent (50GCUAGC30) into the 30-end of the RNA chimera (Fig. 5C). The delivery vehicles by separately constructing individual pRNA sub- assembled foot-to-foot dimer (twin) is formed by annealing such units with various cargos and mixing them together in any desired a30-end overhanged sequence by simply heating up to 80 °C and combination [3]. slowly cooling down to room temperature. These nanoparticles can carry multiple components, including molecules for specific cell recognition, image detection, endosome 5.2.2. Construction of trimeric pRNA nanoparticles [5] disruption, and therapeutic treatment (Fig. 6). One subunit of the A similar mechanism is utilized to construct chimeric pRNA tri- deliverable RNA nanoparticles (dimer, trimer, or tetramer) can be mers. When molecules of pRNA Ab0,Bc0, and Ca0 are mixed together modified to carry a RNA aptamer that binds to a specific cell-surface at equal mole concentrations (Fig. 5B), stable pRNA trimers are receptor, thereby inducing receptor-mediated endocytosis. The sec- formed with very high efficiency (up to 100%) via the interlocking ond subunit of the multimer can carry reporting molecules such as loops of the three pRNAs [5–7] in the presence of 5 mM Mg2+. gold particles or fluorescent beads for the evaluation of cell binding and entry. The third subunit can be re-engineered to carry compo- 5.2.3. Construction of multivalent pRNA nanoparticles for detection nents that can be used to enhance endosome disruption so that the and therapeutic application therapeutic molecules are released. The fourth (or fifth and sixth, if The use of small RNA in gene therapy was significantly ham- needed) subunit of the RNA nanoparticles can carry therapeutic siR- pered due to the difficulties of producing a safe and efficient sys- NA, ribozyme RNAs, antisense RNA, or other drugs to be delivered. 23 210 Y. Shu et al. / Methods 54 (2011) 204–214

units with various cargos and mixing them together in any desired combination. For example, the deliverable pRNA nanoparticles can be re-engineered to carry therapeutic siRNAs, ribozyme RNAs, antisense RNAs against multiple targets or different regions of one target gene, and RNA aptamers or folic acid for delivery. The other subunits of the pRNA nanoparticles may carry anti-cancer drugs to enhance the therapeutic effect or to overcome the drug resistance by combination therapy. The therapeutics or detection molecules may also be combined into one nanoparticle, making the concomitant therapy and detection of the therapeutics possible with only one administration.

6.2. Controllable structure and precise stoichiometry

The homogeneity in size of the pRNA nanoparticles is of ex- treme importance. Highly efﬁcient and controlled bottom-up self-assembly yields nanoparticles with well deﬁned structures and stoichiometry. This characteristic is highly valuable for the reproducible manufacturing of drugs for increased safety and will facilitate the US Food and Drug Administration (FDA) approval of the therapeutic reagents.

6.3. Nanoscale size

It is commonly accepted that the size of a nanoparticles is par- amount for effective delivery to diseased tissues. Many studies suggest that particles ranging from 10 to 100 nm [96–98] are the optimal size for a nonviral vector: large enough to be retained by the body, yet small enough to pass through the cell membrane [97] and access the cell surface receptors. During the development of solid tumors, angiogenesis occurs to supply enough oxygen and nutrients to the fast growing tumor cells. The angiogenic blood vessels, unlike the tight blood vessels in most normal tissues, have Fig. 5. Methods for constructing pRNA nanoparticles [5] including (A) hand-in- gaps between adjacent endothelial cells. This allows the particles hand dimer, (B) trimer, (C) foot-to-foot dimer and (D). Tetramer (adapted from [6] that are usually excluded from the normal tissue to extravagate with permission from the authors and the publisher). through these gaps into the tumor interstitial space and concen- trate in the tumor, in a size-dependent manner. The pRNA nano- 6. The advantages of using pRNA nanoparticles for therapeutics particles (dimers, trimers, or tetramers) have optimal sizes ranging between 20 and 40 nm which improves the biodistribution Phi29 pRNA-derived carriers act as an innovative and versatile of the therapeutic pRNA nanoparticles in the blood circulation sys- targeted delivery system for cancer treatment. Therapeutic options tem while the average size of a normal single siRNA molecule is for patients with cancer are extremely limited. A high percentage well below 10 nm, which represents a major challenge for the siR- of late-stage cancers are also resistant toward current conventional NA delivery in vivo. In addition, the polyanionic nature of RNA chemo- or radio-therapies. Thus, there is an urgent need to develop makes it difficult to penetrate the cell membrane, and non-formu- a new treatment regime for patients suffering from cancers. Our lated siRNAs have been reported to be easily excreted by the body work using pRNA as a vector to specifically deliver therapeutics [99–102]. Nanoparticle delivery of siRNA or other therapeutics has to targeted tumor cells serves both as a model to prove the concept the potential to improve the PK, pharmacodynamics, and biodistri- of using RNA nanotechnology for cancer treatment and will pave a bution, as well as to provide a lower toxicity in treatment, as dis- way toward clinical trials for noninvasive treatment of cancer. One cussed in Section 8 [92]. might ask why use phi29 pRNA nanoparticles over the numerous Furthermore, the PK and pharmacodynamics of the pRNA nano- other anti-cancer delivery platforms under development. The particles has been improved by introducing chemical modifications phi29 pRNA system is unique and offers the following numerous to the RNA backbone. The chemically modified RNA can be resis- advantages: (1) polyvalent delivery; (2) controllable structure tant to RNase, which makes RNA nanoparticles more stable and in- and precise stoichiometry; (3) nanoscale size; (4) targeted deliv- creases their retention time during blood circulation. The specific ery; and (5) non-induction of antibody to ensure repeated treat- delivery and longer retention time of pRNA nanoparticles also as- ments; (6) minimum toxicity; (7) minimum induction of cytokin sures the usage of a lower dose for the treatment. and interferon response and (8) favorable PK with 510 hours in vivo retention time [4,10,12]. 6.4. Targeted delivery

6.1. Polyvalent delivery pRNA nanoparticles can carry both a therapeutic agent and a recognition ligand for targeted delivery to specific cells. The incorpora- The polyvalent pRNA nanoparticles can deliver up to six kinds of tion of a receptor binding aptamer, folate, or other ligands to the molecules to specific cells including therapeutics, detection mole- pRNA complex with simple procedures ensures the specific binding cules, drugs, or other functionalities [3]. This particular system and targeted delivery to cells. In combination with the advantage of provides unprecedented versatility in constructing polyvalent nano-scale size, the system provides the both advantages of higher delivery vehicles by separately constructing individual pRNA sub- delivery efficiency and reduced off-target toxicity [92]. 24 Y. Shu et al. / Methods 54 (2011) 204–214 211

Fig. 6. Illustration of constructed therapeutic pRNA multimers [5,6,7,54,64]. (A) pRNA chimeric monomer with 30-end annealed oligo which conjugates the detection molecule and chemical ligand at the same time. (B) (a) Twin dimer formed through palindrome sequence; (b) dimer formation through loop-loop interaction. (C) Trimeric RNA chimera. (D) Tetrameric pRNA chimera and (E) hexameric pRNA particle (adapted from [103] with permission from the authors and the publisher).

6.5. Non-induction of an antibody response to ensure repeated toxicological properties. It is generally believed that the optimal treatments particle size for nanodelivery is 10–100 nm. This size range is large enough to avoid kidney filtration of particles less than 10 nm, but Using such protein-free RNA nanoparticles with RNA aptamers small enough to penetrate tissues and enter cells via receptor- as anti-receptors will yield specificity as compared with protein mediated endocytosis, and facilitate intracellular trafficking, while anti-receptors and a lower antibody-inducing activity, thus provid- also minimizing reticuloendothelial system (RES) mediated clear- ing an opportunity for repeated administration and treatment of ance [4]. The commonly used lipid and polymer based nanoparti- chronic diseases. cles with larger particle sizes and being hydrophobic cause accumulation in the liver kupffer cells and spleen macrophages, as well as lung macrophages [4]. In addition, the induction of in- 7. The broad medical applications of the pRNA nanodelivery nate immunity and certain organ toxicity has been a major concern platform in siRNA therapeutics [105]. Recently, it has been demonstrated that 20-F-modified pRNA nanoparticles were chemically and meta- The potential of the pRNA platform [3,103] for the construction of bolically stable in mice and demonstrated a favorable PK profile of RNA nanoparticles to carry receptor-binding ligands for specific plasma half-life (T ) of 5–10 h, in contrast to T of 0.25 h re- delivery of siRNA to target and silence particular genes have been ex- 1/2 1/2 ported for siRNAs with similar chemical modifications, a clearance plored for a variety of cancer and viral infected cells, including breast value (Cl) smaller than 0.13 L/kg/h, and a volume of distribution cancer [104], prostate cancer [53], cervical cancer [104], nasopha- (V ) of 1.2 L/kg (Fig. 7A) [92]. With fluorescent and folate labeling, ryngeal carcinoma [64], leukemia [53,54], and ovarian cancer [68], d the pRNA nanoparticles were found to be specifically self-delivered as well as coxsackievirus infected cells [67] (Table 1). The data dem- to folate receptor positive xenograft tumor in mice upon systemic onstrated that the pRNA nanoparticle is a nanodelivery platform that administration, with minimal accumulation in normal organs or can be applied broadly to diverse medical applications. tissues. These particles, composed of pure RNA, did not provoke interferon response, nor did they stimulate cytokine production 8. Pharmacokinetics and toxicity studies in animal trials in mice (Fig. 7B) [92]. Repeated intravenous administrations at doses up to 30 mg per kilogram did not cause toxicity in mice Many factors affect the utility and effectiveness of a nanodeliv- [92]. The result of this and other pharmacological studies suggest ery system. These include metabolic stability, induction of both in- that pRNA nanoparticles carry all the preferred pharmacological nate and adaptive immunity, pharmacokinetic (PK) behavior and features to serve as safe drugs with broad clinical applications. 25 212 Y. Shu et al. / Methods 54 (2011) 204–214

Table 1 Application of pRNA platform for the treatment of diseases.

Name of the disease Receptors for delivery Genes as target References Ovarian cancer Folate receptor Metallothionein-IIA and survivin [68] Breast cancer Folate receptor Survivin [55,104] Cervical cancer Folate receptor Survivin [104] Nasopharyngeal carcinoma Folate receptor Survivin [64] Leukemia CD4 receptor Survivin, BAD and BIM [53,54] Coxsackievirus infection Folate receptor CVB3 protease 2A gene [67] HIV infection gp120 Tat/Rev or TNPO3 [73]

9. Industry scale production of pRNA nanoparticles

RNA can be manipulated with simplicity characteristic of DNA and bears versatile structure and catalytic function similar to proteins. It is an ideal building block in nanotechnology and nanomedicine. However, standing in awe of its sensitivity to RNase degradation has made many scientists hesitant to apply RNA nanotechnology. Recently, it has been reported that 20-F modified pRNA retained its natural property for correct folding in dimer formation, appropriate structure in binding to the phi29 procapsid, as well as authentic function in driving the DNA packaging nanomotor, and producing infectious viral particles (Fig. 8) [106]. The data reveals that it is possible to manufacture RNase-resistant, biologically active and chemically stable RNA building blocks for application in nanotechnology. pRNA is a 120-nucleotide molecule. Currently, chemical synthesis of RNA with 120 nucleotides in large quantities is very challenging. In addition, labeling of specific locations of pRNA requires the understanding of its modular organization. For in vivo trials or clinical applications, one technical hurdle is the lack of a scalable industry process to produce sufficient quantities of RNA. Recently, a bipartite approach has been reported for the construction of a func- Fig. 7. Pharmacological features of pRNA nanoparticles. (A) The PK profile of pRNA nanoparticles compared to siRNA in vivo. (B) The pRNA nanoparticle did not induce tional 117-nucleotide pRNA using two synthetic RNA fragments an interferon response in vitro. KB cells were transfected with 50 nM pRNA (2’-F with modifications at different locations. The resulting bipartite modified vs. non-modified), 50 nM siRNA, and 1 lg/mL poly I:C using Fugene-HD. pRNA was fully competent in pRNA dimer formation, in the packag- The cells were harvested 24 hours later and semi-quantitative RT-PCR was ing of DNA via the nanomotor and in the in vitro assembly of phi29 conducted to test for the expression of the IFN responsive genes (OAS1, OAS2, MX1 and IFITM1). (adapted from [92] with permission from the authors and the virions [91]. The pRNA subunit assembled from two-piece fragments publisher). harboring siRNAs or receptor-binding ligands were also able to

Fig. 8. Atomic force microscopy images showing hand-in-hand and foot-to-foot dimer nanoparticles of non-modified pRNA and 20-F C/U pRNA, respectively (adapted from [106] with permission from the authors and the publisher). 26 Y. Shu et al. / Methods 54 (2011) 204–214 213 assemble into dimers. Dimers carrying different functionalities were [27] S. Clark, V. Remcho, Electrophoresis 23 (2002) 1335–1340. able to bind cancer cells specifically, enter the cells and silence spe- [28] E. Kraus, W. James, A.N. Barclay, J. Immunol. 160 (1998) 5209–5212. [29] D. Shu, P. Guo, J. Biol. Chem. 278 (9) (2003) 7119–7125. cific genes of interest. The pRNA nanoparticles were processed by Di- [30] L. Gold, Harvey Lect. 91 (1995) 47–57. cer to release the siRNA embedded in the nanoparticles. This two [31] A.D. Ellington, J.W. Szostak, Nature 346 (1990) 818–822. piece approach has also been demonstrated to be adapted for total [32] C. Tuerk, L. Gold, Science 249 (1990) 505–510. [33] J.O. McNamara, E.R. Andrechek, Y. Wang, K.D. Viles, R.E. Rempel, E. Gilboa, chemical synthesis [92], enabling industrial scale manufacturing. B.A. Sullenger, P.H. Giangrande, Nat. Biotechnol. 24 (2006) 1005–1015. The results pave a way toward the treatment of diseases using syn- [34] J.P. Dassie, X.Y. Liu, G.S. Thomas, R.M. Whitaker, K.W. Thiel, K.R. Stockdale, thetic pRNA/siRNA chimeric nanoparticles. D.K. Meyerholz, A.P. McCaffrey, J.O. McNamara, P.H. Giangrande, Nat. Biotechnol. 27 (2009) 839–849. [35] J. Zhou, P. Swiderski, H. Li, J. Zhang, C.P. Neff, R. Akkina, J.J. Rossi, Nucleic Acids Res. 37 (2009) 3094–3109. 10. Concluding remarks [36] J. Zhou, H. Li, J. Zaia, J.J. Rossi, Mol. Ther. 16 (2008) 1481–1489. [37] L. Cerchia, V. de Franciscis, Trends Biotechnol. 28 (2010) 517–525. [38] C. Guerrier-Takada, K. Gardiner, T. Marsh, N. Pace, S. Altman, Cell 35 (1983) The phi29 pRNA system is a unique delivery system, which 849–857. takes advantage of the structural features of pRNA including the [39] A. Fire, S. Xu, M.K. Montgomery, S.A. Kostas, S.E. Driver, C.C. Mello, Nature 391 presence of two domains which fold independently and the facility (1998) 806–811. [40] M. Ghildiyal, P.D. Zamore, Nat. Rev. Genet. 10 (2009) 94–108. of re-engineering to form different kinds of desired particles [41] H. Li, W.X. Li, S.W. Ding, Science 296 (2002) 1319–1321. through interlocking loop–loop interactions or end palindrome se- [42] T.R. Brummelkamp, R. Bernards, R. Agami, Science 296 (2002) 550–553. quences. The assembled nano-scale particles harboring functional [43] J.M. Jacque, K. Triques, M. Stevenson, Nature 418 (2002) 435–438. moieties offer many advantages over the numerous other anti-can- [44] S. Varambally, S.M. Dhanasekaran, M. Zhou, T.R. Barrette, C. Kumar-Sinha, M.G. Sanda, D. Ghosh, K.J. Pienta, R.G. Sewalt, A.P. Otte, M.A. Rubin, A.M. cer delivery platforms under development such as polyvalent Chinnaiyan, Nature 419 (2002) 624–629. delivery, controllable structure, and precise stoichiometry, nano- [45] G.G. Carmichael, Nature 418 (2002) 379–380. scale size, targeted delivery, long haft life in vivo, no induction of [46] N.A. Sarver, E.M. Cantin, P.S. Chang, J.A. Zaia, P.A. Ladne, D.A. Stephens, J.J. Rossi, Science 247 (1990) 1222–1225. interferon and toll-like immunity, low or no toxicity, and non- [47] B.M. Chowrira, A. Berzal-Herranz, J.M. Burke, Nature 354 (1991) 320–322. induction of an antibody response to ensure repeated treatments. [48] A.C. Forster, R.H. Symons, Cell 50 (1987) 9–16. Consequently, pRNA nanoparticles delivery will potentially lead [49] N. Sarver, E.M. Cantin, P.S. Chang, J.A. Zaia, P.A. Ladne, D.A. Stephens, J.J. Rossi, Science 24 (1990) 1222–1225. to an innovative therapeutic strategy for developing an effective [50] J. Coleman, A. Hirashima, Y. Inocuchi, P.J. Green, M. Inouye, Nature 315 (1985) and safe treatment for cancer and other diseases. 601–603. [51] D.A. Knecht, W.F. Loomis, Science 236 (1987) 1081–1086. [52] C. Chen, C. Zhang, P. Guo, RNA 5 (1999) 805–818. Acknowledgments [53] S. Guo, N. Tschammer, S. Mohammed, P. Guo, Hum. Gene Ther. 16 (2005) 1097–1109. [54] A. Khaled, S. Guo, F. Li, P. Guo, Nano Lett. 5 (2005) 1797–1808. This work was supported by NIH Grants EB003730, GM059944, [55] H. Liu, S. Guo, R. Roll, J. Li, Z. Diao, N. Shao, M.R. Riley, A.M. Cole, J.P. Robinson, and CA151648 to P.G. We thank Bruce Shapiro, Qi-Xiang Li, Dong- N.M. Snead, G. Shen, P. Guo, Cancer Biol. Ther. 6 (2007) 697–704. ki Lee, Randall Reif, Daniel Binzel, and Wei Li for their helpful com- [56] P. Guo, M. Trottier, Semin. Virol. 5 (1994) 27–37. [57] W.C. Earnshaw, S.R. Casjens, Cell 21 (1980) 319–331. ments and discussion. We also thank Molecular Therapy journal for [58] R.J.D. Reid, J.W. Bodley, D. Anderson, J. Biol. Chem. 269 (1994) 9084–9089. allowing us using the figures. P.G. is the co-founder of Kylin Ther- [59] C.L. Zhang, T. Tellinghuisen, P. Guo, RNA 1 (1995) 1041–1050. apeutics, Inc. [60] T.J. Lee, P. Guo, J. Mol. Biol. 356 (2006) 589–599. [61] C. Chen, S. Sheng, Z. Shao, P. Guo, J. Biol. Chem. 275 (23) (2000) 17510–17516. [62] F. Zhang, S. Lemieux, X. Wu, Mol. Cell 2 (1998) 141–147. [63] S. Hoeprich, Q. Zhou, S. Guo, G. Qi, Y. Wang, P. Guo, Gene Ther. 10 (2003) References 1258–1267. [64] S. Guo, F. Huang, P. Guo, Gene Ther. 13 (2006) 814–820. [1] P. Guo, Nat. Nanotechnol. 5 (2011) 833–842. [65] C.L. Zhang, C.-S. Lee, P. Guo, Virology 201 (1994) 77–85. [2] C.M. Niemeyer, Trends Biotechnol. 20 (2002) 395–401. [66] S.M. Elbashir, J. Harborth, W. Lendeckel, A. Yalcin, K. Weber, T. Tuschl, Nature [3] O.G. Schmidt, K. Eberl, Nature 410 (2001) 168. 411 (2001) 494–498. [4] P. Guo, J. Nanosci. Nanotechnol. 5 (12) (2005) 1964–1982. [67] H.M. Zhang, Y. Su, S. Guo, J. Yuan, T. Lim, J. Liu, P. Guo, D. Yang, Antiviral Res. [5] P. Guo, C. Zhang, C. Chen, M. Trottier, K. Garver, Mol. Cell 2 (1998) 149–155. 83 (2009) 307–316. [6] D. Shu, L. Huang, S. Hoeprich, P. Guo, J. Nanosci. Nanotechnol. 3 (2003) 295– [68] P. Tarapore, Y. Shu, P. Guo, S.M. Ho, Mol. Ther. 19 (2011) 386–394. 302. [69] C.L. Zhang, T. Tellinghuisen, P. Guo, RNA 3 (1997) 315–322. [7] D. Shu, W.D. Moll, Z. Deng, C. Mao, P. Guo, Nano Lett. 4 (2004) 1717–1723. [70] J.M. Nolan, D.H. Burke, N.R. Pace, Science 261 (1993) 762–765. [8] L. Jaeger, E. Westhof, N.B. Leontis, Nucleic Acids Res. 29 (2001) 455–463. [71] T. Pan, O.C. Uhlenbeck, Gene 125 (1993) 111–114. [9] L. Jaeger, N.B. Leontis, Angew. Chem. Int. Ed. Engl. 39 (2000) 2521–2524. [72] C.L. Zhang, M. Trottier, P.X. Guo, Virology 207 (1995) 442–451. [10] P. Guo, O. Coban, N.M. Snead, J. Trebley, S. Hoeprich, S. Guo, Y. Shu, Adv. Drug [73] J. Zhou, Y. Shu, P. Guo, D.D. Smith, J.J. Rossi, Methods 54 (2011) 284–294. Deliv. Rev. 62 (2010) 650–666. [74] Y. Singh, P. Murat, E. Defrancq, Chem. Soc. Rev. 39 (2010) 2054–2070. [11] K.A. Afonin, E. Bindewald, A.J. Yaghoubian, N. Voss, E. Jacovetty, B.A. Shapiro, [75] D. Shu, H. Zhang, R. Petrenko, J. Meller, P. Guo, Nucleic Acid Res. 4 (2010) L. Jaeger, Nat. Nanotechnol. 5 (2010) 676–682. 6843–6853. [12] P. Guo, S. Erickson, D. Anderson, Science 236 (1987) 690–694. [76] G. Stengel, M. Urban, B.W. Purse, R.D. Kuchta, Anal. Chem. 82 (2010) 1082– [13] T.R. Cech, A.J. Zaug, P.J. Grabowski, Cell 27 (1981) 487–496. 1089. [14] D. Shu, H. Zhang, J. Jin, P. Guo, EMBO J. 26 (2007) 527–537. [77] Y. Huang, F. Eckstein, R. Padilla, R. Sousa, Biochemistry 36 (1997) 8231– [15] F. Xiao, H. Zhang, P. Guo, Nucleic Acids Res. 36 (20) (2008) 6620–6632. 8242. [16] K. Kruger, P.J. Grabowski, A.J. Zaug, J. Sands, D.E. Gottschling, T.R. Cech, Cell 31 [78] R. Padilla, R. Sousa, Nucleic Acids Res. 27 (1999) 1561–1563. (1982) 147–157. [79] R. Sousa, R. Padilla, EMBO J. 14 (1995) 4609–4621. [17] T.R. Cech, N.K. Tanner, I. Tinoco, B.R. Weir, M. Zuker, P.S. Perlman, Proc. Natl. [80] R. Padilla, R. Sousa, Nucelic Acids Res. 30 (2002) e138. Acad. Sci. USA 80 (1983) 3903–3907. [81] A.M. Kawasaki, M.D. Casper, S.M. Freier, E.A. Lesnik, M.C. Zounes, L.L. [18] A.J. Zaug, P.J. Grabowski, T.R. Cech, Nature 301 (1983) 578–583. Cummins, C. Gonzalez, P.D. Cook, J. Med. Chem. 36 (1993) 831–841. [19] S. Hoeprich, P. Guo, J. Biol. Chem. 277 (23) (2002) 20794–20803. [82] F. Huang, G. Wang, T. Coleman, N. Li, RNA 9 (2003) 1562–1570. [20] N.B. Leontis, E. Westhof, Curr. Opin. Struct. Biol. 13 (2003) 300–308. [83] L. Zhang, L. Sun, Z. Cui, R.L. Gottlieb, B. Zhang, Bioconjug. Chem. 12 (2001) [21] W. Kasprzak, E. Bindewald, T.J. Kim, L. Jaeger, B.A. Shapiro, Methods 54 (2011) 939–948. 239–250. [84] J.F. Milligan, D.R. Groebe, G.W. Witherell, O.C. Uhlenbeck, Nucleic Acids Res. [22] Y.G. Yingling, B.A. Shapiro, Nano Lett. 7 (2007) 2328–2334. 15 (1987) 8783–8798. [23] E. Bindewald, R. Hayes, Y.G. Yingling, W. Kasprzak, B.A. Shapiro, Nucleic Acids [85] A.G. Bruce, O.C. Uhlenbeck, Nucleic Acids Res. 5 (1978) 3665–3677. Res. 36 (2008) D392–D397. [86] F. Huang, J. He, Y. Zhang, Y. Guo, Nat. Protoc. 3 (2008) 1848–1861. [24] E. Bindewald, C. Grunewald, B. Boyle, M. O’Connor, B.A. Shapiro, J. Mol. Graph. [87] B.M. Laing, P. Guo, D.E. Bergstrom, Methods 54 (2011) 260–266. Model. 27 (2008) 299–308. [88] F. Huang, Nucleic Acids Res. 31 (2003) e8. [25] P. Bouvet, Methods Mol. Biol. 148 (2001) 603–610. [89] P. Zhang, Z. Zhang, Y. Yang, Y. Li, Int. J. Pharm. 392 (2010) 241–248. [26] J. Ciesiolka, J. Gorski, M. Yarus, RNA 1 (1995) 538–550. 27 214 Y. Shu et al. / Methods 54 (2011) 204–214

[90] Y. Fang, D. Shu, F. Xiao, P. Guo, P.Z. Qin, Biochem. Biophys. Res. Commun. 372 [100] D.H. Kim, J.J. Rossi, Nat. Rev. Genet. 8 (2007) 173–184. (2008) 589–594. [101] D.B. Rozema, D.L. Lewis, D.H. Wakeﬁeld, S.C. Wong, J.J. Klein, P.L. Roesch, S.L. [91] Y. Shu, M. Cinier, S.R. Fox, N. Ben-Johnathan, P. Guo, Mol. Ther. (2001), in Bertin, T.W. Reppen, Q. Chu, A.V. Blokhin, J.E. Hagstrom, J.A. Wolff, Proc. Natl. press, doi:10.1038/mt.2011.23. Acad. Sci. 104 (2007) 12982–12987. [92] S. Abdelmawla, S. Guo, L. Zhang, S. Pulukuri, P. Patankar, P. Conley, J. Trebley, [102] D. De Paula, M.V. Bentley, R.I. Mahato, RNA 13 (2007) 431–450. P. Guo, Q.X. Li, Mol. Ther. (2011), in press, doi:10.1038/mt.2011.35. [103] Y. Shu, D. Shu, Z. Diao, G. Shen, P. Guo, Fabrication of Polyvalent Therapeutic [93] O.C. Uhlenbeck, T.E. England, Biochemistry 17 (1978) 2069–2076. RNA Nanoparticles for Speciﬁc Delivery of siRNA, Ribozyme and Drugs to [94] S.C. Glotzer, Science 306 (2004) 419–420. Targeted Cells for Cancer Therapy. IEEE/NIH Life Science Systems and [95] B.D. Gates, Q. Xu, M. Stewart, D. Ryan, C.G. Willson, G.M. Whitesides, Chem. Applications Workshop, 2009, pp. 9–12. Rev. 105 (2005) 1171–1196. [104] L. Li, J. Liu, Z. Diao, P. Guo, G. Shen, Mol. BioSyst. 5 (2009) 1361–1368. [96] K.K. Jain, Drug Discov. Today 10 (2005) 1435–1442. [105] M. Robbins, A. Judge, I. Maclachlan, Oligonucleotides 19 (2009) 89–101. [97] W. Li, F. Szoka, Pharm. Res. 24 (2007) 438–449. [106] J. Liu, S. Guo, M. Cinier, L. Shlyakhtenko, Y. Shu, C. Chen, G. Shen, P. Guo, ACS [98] H. Gao, W. Shi, L.B. Freund, Proc. Natl. Acad. Sci. USA 102 (2005) 9469– Nano (2011), in press, doi:10.1021/nn1024658. 9474. [107] D. Shu, L. Huang, P. Guo, A simple mathematical formula for stoichiometry [99] A. de Fougerolles, H.P. Vornlocher, J. Maraganore, J. Lieberman, Nat. Rev. Drug quantitation of viral and nanobiological assemblage using slopes of log/log Discov. 6 (2007) 443–453. plot curves, J. Virol. Methods 115 (1) (2003) 19–30.

28 The pRNA system has several advantages including defined structure, controllable stoichiometry, ideal nanoscale size (~20–40 nm), multivalency, and targeted delivery 106. One recent study also showed that pRNA nanoparticles could be delivered specifically to tumor in vivo with favorable PK (pharmacokinetics) profile and other advantageous in vivo features such as non-toxicity, non-induction of interferon or non-stimulating of cytokine response in animals.

The half life (T(1/2)) of pRNA nanoparticles is about 5-10hrs; conventional 2’-fluorine labeled siRNA is only 0.25hrs 158. These unique features make pRNA to be applied not only for gene delivery but also for nanomachine fabrication and pathogen detection. However, the clinical application of pRNA delivery platform was hindered by several major problems: 1) Synthesis of therapeutic RNA nanoparticles at industrial scale is costly and low yield due to the length limit of the chemical synthesis. 2) The RNA is sensitive to RNase degradation and 3) is the dissociation of RNA nanoparticles at low concentration. In Chapter 2, I set out to overcome these shortcomings and make pRNA nano-delivery platform more feasible for in vivo applications. The study in Part I of Chapter 2 is to shorten the length of the pRNA by using bipartite approach and make pRNA nanoparticles more suitable for chemical synthesis. The study in Part II of Chapter 2 is to introduce 2’-Fluorine modified ribonucleotides into RNA chain to increase the chemical stability of the RNA molecules in serum. The study in Part III of

Chapter 2 is focused on stabilizing the RNA tertiary structures and avoiding dissociation of

RNA structures at diluted condition in vivo by introducing crosslinking intermolecularly.

Furthermore, my research also aims at optimizing the current pRNA nano-delivery platform and developing novel RNA nanoparticles based on pRNA structure which will be described and discussed in detail in Chapter 3. The three-way junction (3WJ) motif of the motor pRNA was found to be assembled from 3–6 pieces of RNA oligomers without the use of metal 3WJ core is

29 resistant to 8M urea denaturation, stable in serum, and remains intact at extremely low concentrations. The Part I of Chapter 3 is to apply the pRNA 3WJ as a platform for building a variety of multifunctional pRNA nanoparticles. In addition, an X-shaped core derived from pRNA 3WJ core will be also utilized for construction of multifunctional pRNA nanoparticles.

Furthermore, stronger pRNA loop-loop interaction will be studied. Different pRNA polyvalent nanoparticles will be constructed based on enhanced interlocking interactions with varieties of functionalities. Meanwhile, a tool-like pRNA nanoparticle assembly method will be also described and discussed in Part II of Chapter 3.

The pRNA nano-delivery system is applied to treat different cancers and viral infectious diseases. By collaborating with experts in related fields, we were able to expand our pRNA nano-delivery system to deliver therapeutics into ovarian cancer, leukemia, breast cancer and

HIV infected cells, which will be described briefly in Chapter 4.

CHAPTER 2. Optimization of Dimeric pRNA Nano-delivery System

for In Vivo Applications

PART I. Scale-up Chemical Synthesis of pRNA Nanoparticles

by Bipartite Approach.

Part I of Chapter 1 was published in Molecular Therapy, 2011. 19:1304-11

The full paper is reprinted with permission from Nature Publishing Group

31 © The American Society of Gene & Cell Therapy original article

Assembly of Therapeutic pRNA-siRNA Nanoparticles Using Bipartite Approach

Yi Shu1, Mathieu Cinier1, Sejal R Fox2, Nira Ben-Johnathan2 and Peixuan Guo1

1Nanobiomedical Center, SEEBME, College of Engineering and Applied Sciences, University of Cincinnati, Cincinnati, Ohio, USA; 2Department of Cell and Cancer Biology, College of Medicine, University of Cincinnati, Cincinnati, Ohio, USA

The 117-nucleotide (nt) RNA, called the packaging RNA more and more popular due to the recognition of the potential (pRNA) of bacteriophage phi29 DNA packaging motor, of RNA nanoparticles in the treatment of cancer, viral infection, has been shown to be an efficient vector for the con- genetics diseases, and other human ailments.1 struction of RNA nanoparticles for the delivery of small Several RNA-based therapeutic approaches using small inter- interfering RNA (siRNA) into specific cancer or viral- fering RNA (siRNA)12–15 and ribozymes16–20 have been shown infected cells. Currently, chemical synthesis of 117-nt to downregulate specific gene expression in cancerous or viral- RNA is not feasible commercially. In addition, labeling infected cells. RNA aptamer has been shown to bear functions at specific locations on pRNA requires the understand- similar to that of antibodies in their ability to recognize specific ing of its modular organization. Here, we report mul- ligands (organic compounds, nucleotides, or peptides) for tar- tiple approaches for the construction of a functional geted delivery through the formation of binding pockets.21,22 This 117-base pRNA using two synthetic RNA fragments with has led to heightened interest in the scientific community and variable modifications. The resulting bipartite pRNA was the rapid development of RNA-based therapeutics. Although the fully competent in associating with other interacting methods for gene silencing with high efficacy and specificity have pRNAs to form dimers, as demonstrated by the pack- been achieved in vitro, the effective delivery of RNA to specific aging of DNA via the nanomotor and the assembly of cells in vivo still remains challenging. Specific delivery of siRNA to phi29 viruses in vitro. The pRNA subunit assembled from target cells has been achieved using the packaging RNA (pRNA) 23–25 bipartite fragments harboring siRNA or receptor-binding of bacteriophage phi29, which forms dimers and trimers via ligands were equally competent in assembling into dim- the interaction of the left (L-loop) and right (R-loop) interlocking 2,26,27 ers. The subunits carrying different functionalities were loops. able to bind cancer cells specifically, enter the cell, and Phi29 DNA packaging motor uses six pRNAs that form a ring 2,27–30 silence specific genes of interest. The pRNA nanoparti- to gear the DNA packaging motor. Each pRNA molecule cles were subsequently processed by Dicer to release the contains two domains (Figure 1a). One of the domains, bases siRNA embedded within the nanoparticles. The results 23–97, located at the central region of pRNA, is for intermolecu- 27,28,31,32 will pave the way toward the treatment of diseases using lar interactions. The two interlocking loops reside within synthetic pRNA/siRNA chimeric nanoparticles. this domain. The second domain is for the binding of the DNA packaging enzyme gp16.33 This domain is located at the 5′/3′ ends Received 31 October 2010; accepted 26 January 2011; advance online that pair to form a double-stranded helical region.34 Removal publication 5 April 2011. doi:10.1038/mt.2011.23 of this domain does not affect the formation of dimer, trimer, and hexamer.27,32 Therefore, the pRNA 5′/3′ proximate double- Introduction stranded helical end34 can be replaced by a therapeutic siRNA Research in nanotechnology involves modification, engineer- (Figure 1a).23,24 Using this chimera technology, pRNA can escort ing, and/or assembly of organized materials on the nanometer the siRNA to silence genes and to destroy cancer cells of leukemia, scale. RNA molecules can be designed and manipulated at a level lung, breast, as well as others.23–25,35–38 of simplicity characteristic of DNA, while possessing the flex- The pRNA system has several advantages including defined ibility in structure and function or enzymatic activity similar to structure, controllable stoichiometry, multivalency, targeted deliv- that of proteins. Thus, RNA is a suitable candidate for nanotech- ery, ideal nanoscale size (~20–40 nm), and minimal induction of nological applications.1–5 The concept of RNA nanotechnology antibody response to enable repeated treatments of chronic dis- has been proposed for more than a decade2,4,6–9 (for review, see eases.1 In addition, the pRNA is remarkably stable in a wide range refs. 1,10,11). The first evidence was reported in 1998 showing of pH (~4–9), temperature, and organic solvents.3 These unique that dimeric, trimeric, and hexameric RNA nanoparticles can be features of pRNA have great potential to be applied not only for assembled through self-assembly of multiple reengineered natu- gene delivery but also for nanomachine fabrication and pathogen ral RNA molecules.2 The field of RNA nanotechnology becomes detection. However, one bottle neck in the RNA therapy and RNA

Correspondence: Peixuan Guo, Nanobiomedical Center, Vontz Center for Molecular Studies, Room No. 2308, 3125 Eden Avenue, University of Cincinnati, Cincinnati, Ohio 45267, USA. E-mail: [email protected] or [email protected]

Molecular Therapy 32 1 © The American Society of Gene & Cell Therapy Bipartite Assembly of Therapeutic pRNA Nanoparticle

nanotechnology is the requirement of relatively large quantities a Wide type pRNA pRNA/siRNA R-loop of RNA. The pRNA subunit is about 117 nucleotides, which is siRNA beyond the limit of currently available commercial chemical RNA synthesis technologies (maximum of 80 nucleotides with low yield). At this time, most of the pRNA or pRNA-related chimeras are synthesized enzymatically using RNA polymerase. L′-loop It has been previously reported that the pRNA can be assem- b (1–28)/(30–117)pRNA (1–55)/(56–117)pRNA (1–71)/(75–117)pRNA bled from two individual RNA oligonucleotides, one encompass- Assembly of bipartite ing the R-loop and the other the L-loop, by annealing via a 6-nt pRNA 39 for duplex. However, one of these pieces is located in the middle DNA packaging of the pRNA; this made the resulting RNA not suitable for the Assembly of bipartite construction of therapeutic RNA nanoparticles harboring siRNA chimeric pRNA or other modules, and also not feasible for applications in drug for delivery. In this study, we further develop the bipartite chimeric therapy constructs to generate full-length functional pRNAs that are not cd 28 30 28 30 only competent for driving the phi29 DNA packaging motor but 5′ D 5′ D M M also proficient for therapeutic and diagnostic purposes. 3′ 3′

Results 5′ D 5′ Nomenclatures M D 3′ 56 55 3′ M The pRNA constructs used in this work are identified by: (i) the 56 55 R-loop and/or L-loop sequence(s); and (ii) the started/ended nucleotide (nt) number. A particular R-loop sequence is assigned 5′ D 5 71 ′ D M 71 M 3′ 3 an upper case letter (i.e., A, B,..), and a particular L-loop sequence 75 ′ 75 is assigned a lower case letter with a prime (i.e., a′, b′,..). The same set of letters (i.e., Aa′) designates complementary sequences in the R/L loop, while different letters indicate lack of sequence comple- Figure 1 construction of bipartite RNA assemblies. (a) The structure of packaging RNA (pRNA) molecules and pRNA/siRNA chimera. (b) The mentarities. For example, Ab′ indicates that the pRNA assemblies design and sequence of three different bipartite modules for pRNA or contain a right-hand loop A and the left hand loop b′ for inter- pRNA/siRNA chimera. (c) 8% native polyacrylamide gel electrophore- RNA interaction with Ba′ in the assembly of the pRNA dimer. sis (PAGE) showing the self-assembly of two RNA fragments into the Following the above rules, the 117-nt intact pRNA with vari- pRNA monomer and dimer formation of resulting bipartite RNA assemblies [lane 1, upper piece (P1); lane 2, lower piece (P2); lane 3, bipartite ous R-loop and L-loop is designated as (1–117) Rl′ (i.e., (1–117) monomer; lanes 4 and 5, monomer control; lane 6, bipartite dimer; lane Ab′). Three bipartite pRNA assemblages (Figure 1b) are designated 7, dimer control]. The monomer control including (1–117) Ab′ pRNA as (1–28)/(30–117) Ab′, (1–55)/(56–117) Ab′, and (1–71)/(75–117) and its dimer partner (1–117) Ba′ pRNA. The dimer control is the dimer Ab′. Three bipartite pRNA chimeras (Figure 1b) are designated as formed by (1–117) Ab′ pRNA and Ba′ pRNA (D, dimer; M, monomer). (d) 8% native PAGE showing the self-assembly of two RNA fragments (1–28)/(30–117) Ab′ pRNA/siRNA (eGFP), (1–55)/(56–117) Ab′ into the pRNA/siRNA chimera and dimer formation of resulting bipartite pRNA/siRNA (eGFP), and (1–71)/(75–117) Ab′ pRNA/siRNA RNA assemblies [lane 1, upper piece (P1); lane 2, lower piece (P2); lane (eGFP). pRNA/siRNA (eGFP) represents a pRNA chimera that 3, bipartite monomer; lanes 4 and 5, monomer control; lane 6, bipartite harbors a siRNA targeting the enhanced green fluorescent protein dimer; lane 7, dimer control]. The monomer control including (1–117) Ab′ pRNA/ siRNA chimera and its dimer partner (1–117) Ba′ pRNA. The (eGFP) gene while pRNA/siRNA (luciferase) and pRNA/siRNA dimer control is the dimer formed by (1–117) Ab′ pRNA/siRNA chimera (survivin) represent pRNA chimeras that harbor siRNAs targeting and Ba′ pRNA (D, dimer; M, monomer). the firefly luciferase gene and survivin gene, respectively. (1–28) and (30–117) refer to start and stop of the RNA fragment one and frag- bipartite approaches including Ab′(1–28)/(30–117), (1–55)/ ment two, respectively, using phi29 pRNA sequence number as a (56–117), and (1–71)/(75–117). The six assemblies were catego- reference. rized into two classes: three with wild-type pRNA sequences, and three with siRNA sequences replaced 5′/3′ helical regions Construction of pRNA assemblies by bottom-up (Figure 1b). These three outlined bipartite approaches in pRNA approach using synthetic pRNA fragments construction overcome the size obstacle in RNA chemical synthe- The goal of the construction of pRNA assemblies is twofold: driv- sis, while maintaining the same bioactivity as the intact pRNA/ ing the DNA packaging motor of phi29 and harboring RNA moi- siRNA particles. The design criteria for the bipartite assemblies eties, functionalities, or chemical groups for therapeutic purposes. were: (i) Each fragment of the bipartite RNAs should be <100 nt In each RNA chimera, there are two important elements: the first and suitable for chemical synthesis. (ii) The breaks on the pRNA one serves as the directing core to guide the folding and assembly chain to form functional bipartite particles basically followed the of the resulting pRNA chimeras, whereas the second one functions circular permutated pRNA design which closes the proximity of to deliver these particles for medical applications. We constructed the wild-type pRNA 5′/3′ end and has a new 5′/3′ end opened at six pRNA assemblies using sets of RNA fragment pairs (P1 and the different position along the pRNA chain. We adopted those P2) as building blocks shown in Figure 1b by three different new opening sites of functional circular permutated pRNAs which

2 33 www.moleculartherapy.org © The American Society of Gene & Cell Therapy Bipartite Assembly of Therapeutic pRNA Nanoparticle

have viral DNA packaging ability and viral assembly activity40 as a the selected breaks for bipartite design to ensure the assembled bipartite pRNAs maintain their biological activities. (iii) All the selected breaks are located at the less structural constraint and more flexible region. And the breaks should avoid the sequences involved in the intermolecular interaction, some important bulges responsible for viral packaging or the region which is for holding functional moieties such as siRNA insertion.

Assay for dimer formation to confirm the folding of the resulting bipartite RNA complex Phi29 DNA packaging motor uses six pRNAs that form a ring to b 1.00 108 gear the DNA packaging motor.2,27–30 It has been reported previ- × 1.00 × 107 ously that dimers are the building blocks in the assembly of the 1.00 × 106 28 phi29 DNA packaging motor. Also, this self-assembling prop- 1.00 × 105 erty can be used for the fabrication of reengineered dimeric pRNA 1.00 × 104 3 chimeras that can serve as polyvalent vehicles for specific target- PFU/ml 1.00 × 10 2 ing and delivery of siRNA or ribozyme to cancer cells.10,23–25,36 1.00 × 10 1.00 × 101 Thus, it is crucial to find out whether pRNA constructs can form 1.00 × 100 dimers, which would provide direct evidence that pRNA mono- P meric subunits constructed by the bipartite approach retain the No RNANo AT self-assembling property of the intact pRNA. (1–117)(1–117) Ab′ only Ba′ only 1–55/56–117 Ab′ As shown in the 8% native polyacrylamide gel electrophoresis (1–28)/(30–117)(1–71)/(75–117) Ab′ Ab′ (PAGE) (Figure 1c), three sets of RNA fragments annealed to form (1–117) Ab′ + (1–117) Ba′ three types of bipartite Ab′ pRNA monomers, which migrated (1–28)/(30–117)(1–55)/(56–117)(1–71)/(75–117) Ab′ + (1–117) Ab′ + (1–117) AbBa′ + (1–117) Ba′ Ba′ into the same position as wild-type monomer control [(1–117) Ab′ and (1–117)Ba′]. The bipartite monomeric Ab′ pRNA subse- Figure 2 dnA packaging activity and viral assembly activity of quently formed dimer, in the presence of its interacting partner bipartite packaging RNA (pRNA). (a) 0.8% agarose gel showing the procapsid protected viral DNA after packaging which indicated the (1–117)Ba′ pRNA and migrated into the upper dimer band which active pRNA components. Lane1 is 1-kb DNA ladder; lane 2 indicated was at the same position as wild-type pRNA dimer Ab′-Ba′. The the total amount of input viral genome DNA for the packaging assay; formation of dimers indicated that the bipartite pRNA assemblies lane 4 is the active packaging served as positive control. Lane 3 and folded into a conformation similar to that of the wild-type pRNA. lanes 5–9 served as negative control for background check, which only add monomeric (1–117) Ab′. (1–117) Ba′ or bipartite pRNA assemblies Moreover, when the 5′/3′ paired helical region was replaced with without presence of dimer partner. Lanes 10–12 showing the active a double-stranded siRNA, as with the three types of the bipartite packaging activity of all three bipartite pRNA assemblies. (b) Viral pRNA/siRNA assemblies, the dimer formation pattern did not assembly activity is reflected by the plaque formation unit per milliliter change, as revealed by an 8% native PAGE gel (Figure 1d) which (PFU/ml). The no RNA, no ATP, monomeric pRNA (Ab′ and Ba′ pRNA) or bipartite pRNA assemblies served as negative controls for checking also indicated the correct folding structure of the bipartite pRNA/ the background plaque formation. All three bipartite pRNA assemblies siRNA assemblies. together with their dimer partner (1–117) Ba′ pRNA can assemble mature virions to infect the host bacteria and form plaque which is DNA packaging and viral assembly activities comparable to the wild-type dimer (1–117) Ab′ pRNA plus (1–117) Ba′ which served as positive control. of the bipartite pRNA assemblies We used the phi29 system, with the known DNA packaging and the viral assembly assays, to further investigate the biological all three bipartite Ab′ pRNA assemblies were proficient in driving activity of the bipartite assemblies. Considering that the retention the viral DNA packaging motor for packaging the viral genomic of the biological activity can be directly correlated with the reten- double-stranded DNA (Figure 2a), suggesting that bipartite pRNA tion of the structure, we used these two assays to confirm whether maintained the structure and functions of wild-type pRNA. the bipartite assemblies can fold as the wild-type pRNA. The viral assembly assay also carried out by replacing one of The phi29 DNA packaging assay41,42 was carried out by replac- the subunits of the dimer with the bipartite pRNA assemblies, the ing one of the subunits of the pRNA dimer with the bipartite pRNA functional dimer will drive the DNA packaging motor to gear the assemblies. After in vitro assembly of the functional DNA packag- viral genome into the procapsid and subsequently form the mature ing motor, the double-stranded viral genome was packaged into virions to infect the host bacteria and form plaques. The plaque- the viral prohead. The mixture was then treated by DNase I and forming units (PFU)/ml was used to reflect the RNA activity during separated by 0.8% agarose gel. The DNA successfully packaged was the phi29 viral assembly. As shown in Figure 2b, the control pRNA protected from DNase digestion and can be observed on the gel dimer showed 107 PFU/ml viral assembly activity whereas all three (Figure 2a). Although the bipartite assemblies showed less amount types of the bipartite Ab′ pRNA assembled from two RNA fragments of packaged viral genome in the gel (Figure 2a, lane 10–12) as still exhibited around 106 PFU/ml viral assembly activity, thereby compared to intact pRNA (Figure 2a, lane 4), we still found that demonstrating that the chimeric dimers were indeed functional.

34 Molecular Therapy 3 © The American Society of Gene & Cell Therapy Bipartite Assembly of Therapeutic pRNA Nanoparticle

a 18 Mock Plasmid only 16 14 (1–28)/(30–117) (1–55)/(56–117) (1–71)/(75–117) Bipartite pRNA chimera Bipartite pRNA chimera Bipartite pRNA chimera 12

3′5′ 10 5′ A 5′ A 5′ A U U U 3′ 3′ 3′ 5 3′ 5′ 3′ ′ 8 6 3′5′ 5 5′ U 5′ U ′ U 3′

U activity luciferase Relative U U 3′ 3′ 5′ 4 3′ 3′ 5′ 2

5′ A 3′5′ 5′ A 5′ A 3′ 0 A A 3′ A t 3′ 3′ 3′ 5′ 5′ rase)

rase) muAb′ pRNA 3′5′ 5′ U 5′ U 5′ U DNA1 + DNA2 3 A A A ′ No RNA, no DNA 3′ 5′ 3′ 3′ 5′ 3′ DNA1 (firefly luciferase) DNA2 (Renilla luciferase) b Ab′ pRNA/siRNA (firefly lucife Ab′ pRNA/siRNA (firefly lucife

(1–28)/(30–117)(1–55)/(56–117) Ab(1–71)/(75–117)′ pRNA/siRNA Ab′ pRNA/siRNA (fireflyAb′ pRNA/siRNA luciferase) (firefly luciferase) (firefly luciferase)

Figure 3 Gene silencing assay for bipartite pRNA/siRNA (eGFP). (a) Figure 4 dual-luciferase assay for bipartite pRNA/siRNA (firefly The enhanced green fluorescent protein (eGFP) gene silencing knock- luciferase) chimera. The no RNA, no plasmid DNA control served as down effects by bipartite pRNA/siRNA (eGFP) chimera and its mutant the system blank for the assay. DNA1 is the plasmid pGL3 harboring controls. Nucleotides in gray indicate the mutation. (b) 8% native poly- firefly luciferase gene and DNA2 is the plasmid pRL-TK harboring renilla acrylamide gel electrophoresis (PAGE) showing the self-assembly of two luciferase. The relative firefly luciferase activity is to normalize firefly RNA fragments into the pRNA/siRNA chimera and its mutant controls luciferase activity using the internal control renilla luciferase activity, [lane 1, monomer control; lane 2, pRNA/siRNA (eGFP); lane 3, pRNA/ which reflected the level of luciferase gene expression. siRNA (eGFP) with sense strand mutant; lane 4, pRNA/siRNA (eGFP) with antisense strand mutant; lane 5, pRNA/siRNA (eGFP) with both sense (55–56)Ab′ pRNA/siRNA (firefly luciferase), and (1–71)/(75–117) strand and antisense strand mutant as well as dimer formation of result- Ab′ pRNA/siRNA (firefly luciferase). Compared to the eGFP gene ing bipartite RNA assemblies accordingly; lane 6, pRNA/siRNA (eGFP) dimer; lane 7, dimer of pRNA/siRNA (eGFP) with sense strand mutant; knockdown assay, the dual-Luciferase report system can quanti- lane 8, dimer of pRNA/siRNA (eGFP) with antisense strand mutant; lane tatively measure the gene silencing effects of these three bipartite 9, dimer of pRNA/siRNA (eGFP) with both sense strand and antisense pRNA/siRNA assemblies. The relative luciferase activity was used strand mutant; and lane 10, dimer control.]. to reflect the expression level of firefly luciferase gene by normalizing the firefly luciferase activity with the internal control, renilla The gene silencing effect of the pRNA assemblies luciferase activity. The results indicated that all three constructs of constructed by the bipartite approach the bipartite pRNA/siRNA (firefly luciferase) displayed a dramatic Three RNA complexes, which include (1–28)/(30–117) Ab′ decrease in firefly luciferase gene expression which is comparable to pRNA/siRNA(eGFP), (1–55)/(55–56) Ab′ pRNA/siRNA(eGFP), the intact pRNA/siRNA (firefly luciferase) after transfection. and (1–71)/(75–117) Ab′ pRNA/siRNA (eGFP) containing a Furthermore, the bipartite (1–28)/(30–117) pRNA/siRNA siRNA functionality targeting eGFP, were constructed (Figure 3b) (survivin) assembly showed similar silencing effects on the sur- and shown competent in knocking down eGFP gene expression vivin gene expression as the intact pRNA/siRNA (survivin) which (Figure 3a). To verify the specificity in gene silencing, these bipar- is demonstrated by reverse transcription-PCR (RT-PCR) assayed tite pRNA assemblies have been also constructed with a single on mRNA level and western blot assayed on protein expression mutation either in the sense strand, the antisense strand or both level; a bipartite pRNA/siRNA assembly harboring scrambled sur- strands. Although the incorporation of a single mutation at the vivin siRNA served as negative control (Figure 5). This bipartite sense strand is not sufficient to inhibit the gene silencing function pRNA/siRNA was processed efficiently by Dicerin vitro to release of the constructions (Figure 3a), a single mutation on the comple- the end RNA fragment (23–27 nt), as shown in Supplementary mentary antisense strand resulted in a significant lost of the gene Figure S1. For details on Dicer processing of the two-piece pRNA/ knockdown effects (Figure 3a). As expected, the incorporation of siRNA complex, see Supplementary Materials and Methods. The the mutation on both strands also resulted in the lost of the gene processed small RNA fragments were confirmed to harbor the knockdown effects. siRNA sequence by northern blot assay (data not shown). To further investigate the ability of the bipartite pRNA to be used as a therapeutic module in the construction of multivalent Cell binding and entry of the bipartite pRNA/folate nanoparticle, we constructed another set of three RNA complexes therapeutic RNA nanoparticles containing a siRNA functionality targeting the experimental Many cancer cell lines, especially those of epithelial or myelocytic reporter, firefly luciferase gene (Figure 4). This include the construc- origin, overexpress the folate receptor (FR) on their surface.43 tions (1–28)/(30–117)Ab′ pRNA/siRNA (firefly luciferase), (1–55)/ Folate has been used extensively as cancer cell delivery agent via

4 35 www.moleculartherapy.org © The American Society of Gene & Cell Therapy Bipartite Assembly of Therapeutic pRNA Nanoparticle

25,37,44 FR-mediated endocytosis. Human nasopharyngeal epider- fluorescent bipartite pRNA/NH2 that did not contain folate group mal carcinoma KB cells which have overexpressed FR on the cell was used as the negative control. Flow cytometry data showed that surface37 were used as the cell model and the fluorescently labeled the binding efficiency of the fluorescent bipartite pRNA/folate was bipartite pRNA/folate was used to test its cell binding efficiency. A close to 100% (Figure 6a). The binding specificity was also proved by free-folate competitive assay. Free folate can competitively bind to the FR positive KB cells and reduce the fluorescent signal from a bipartite pRNA/folate binding. Confocal microscopy revealed strong binding of the fluorescent bipartite pRNA/folate complex,

Bipartite Bipartite as well as efficient entry of the RNA into the targeted cells. The entry was demonstrated by excellent colocalization and overlap NontemplatedUntreated control pRNA/siRNA (survivin)pRNA/siRNA (scramble)pRNA/siRNA (survivin)pRNA/siRNA (scramble) of the fluorescent bipartite pRNA/folate assembly (red) and cyto-

Survivin plasma (green) (Figure 6b). GADPH Discussion b Unlike DNA, RNA molecules are diverse in structures due to numerous inter- and intramolecular interactions in RNA folding 45 Bipartite process. A single base change in RNA primary sequences could Bipartite Bipartite result in unpredictable folding alteration and function loss.46 It

UntreatedUntreated pRNA/siRNA (survivin)pRNA/siRNA (survivin)UntreatedpRNA/siRNA pRNA/siRNA(survivin) (scramble)pRNA/siRNA (survivin)pRNA/siRNAUntreated (scramble)UntreatedsiRNA (survivin) is also challenging to predict the RNA behavioral change upon changes within its primary sequence by current available tools. β-Actin Thus, for rational design of our bipartite RNA assemblies, we fol- Survivin lowed multiple circular permutated pRNA designs.40 All these Figure 5 the survivin silencing effects of bipartite pRNA/siRNA (sur- circular permutated pRNAs showed comparable DNA packaging vivin) chimera assayed by RT-PCR and western blot assay. (a) Cells and viral assembly activity which indicated the new opening/break were treated with different concentration of RNAs (5 and 20 nmol/l). The along the pRNA chain have no or less affects on the correct folding reduced survivin gene expression on mRNA level was displayed as the as well as the function of pRNA. Other criteria were also considered lighter band and GADPH served as loading control. (b) Cells were treated with different concentration of RNAs (5, 20, and 40 nmol/l), respectively as mentioned in Result section. The final assemblies generated by including bipartite pRNA/siRNA (survivin), bipartite pRNA/scramble con- bipartite designs should: (i) still maintain the correct structure fold- trol as well as according intact pRNA/siRNA (survivin) and its scramble ing; and (ii) maintain the similar function as intact particles. We control. Column 2 of the figure only included two concentration of RNA demonstrated that phi29 bacteriophage pRNA can be engineered to treatment (5 and 20 nmol/l). The reduced survivin gene expression on protein level was displayed as the lighter band after blotting and β-actin harbor therapeutic modules and efficiently assembled into higher served as loading control. order structures with defined stoichiometry using a bipartite construction approach. This method overcomes the current limitations

Bipartite Cell only Bipartite abNH -pRNA 2 NH2-pRNA (Gate 1) (Gate 1) 18 µ Cy3 pos. = 0.28% 18 µ Cy3 pos. = 0.57%

16 µ 16 µ

14 µ 14 µ EV-volume 12 µ EV-volume 12 µ 10 µ 10 µ 8 µ 8 µ 0 µ 0 µ 100 101 102 103 104 100 101 102 103 104 FL2 FL2

Bipartite Bipartite pRNA/FA Bipartite folate-pRNA +free FA folate-pRNA (Gate 1) (Gate 1) 18 18 µ Cy3 pos. = 95.27% µ Cy3 pos. = 15.15%

16 µ 16 µ

14 µ 14 µ EV-volume 12 µ EV-volume 12 µ 10 µ 10 µ 8 µ 8 µ 0 µ 0 µ 100 101 102 103 104 100 101 102 103 104 FL2 FL2

Figure 6 Flow cytometry and confocal microscopy imaging of KB cells showing the binding and entry of the bipartite pRNA/folate chimera.

(a) The shifted cells in blue color indicated the strong binding of the bipartite pRNA/folate compared to the bipartite pRNA/NH2 control. (b) The green color indicated the region of the cell cytoplasmatic portion and blue color indicated the nucleus. The fluorescent labeled bipartite pRNA/folate shown in red.

36 Molecular Therapy 5 © The American Society of Gene & Cell Therapy Bipartite Assembly of Therapeutic pRNA Nanoparticle

in chemical synthesis of long RNA molecules, while retaining the fragments in TMS through heating at 75 °C for 5 minutes, followed by slow structural and functional integrity and chemical stability of both cooling to room temperature. Bipartite RNA complexes were then purified 28 wild-type pRNAs and the therapeutic pRNA chimeras. from 10% native polyacrylamide gel. The bipartite pRNA constructs were structurally competent, Assay for pRNA dimer formation. The potential of dimer formation is evidenced by efficient dimer formation. However, the bipartite one way to verify the correct folding of the bipartite pRNA. The pRNA modules showed lower DNA packaging and viral assembly activity construct Ab′ monomer was mixed with their interacting partner pRNA (approximately 10-fold) while comparing to the wild-type pRNA. Ba′ in TBM buffer [89 mmol/l Tris–HCl (pH 7.6), 0.2 mol/l boric acid, and The reason might be due to the fact that the assembly of two RNA 5 mmol/l MgCl2] at equal mole ratio, and incubated at room temperature fragments resulted in unligated pRNA molecules and generated a for 30 minutes. The dimer formation was then assayed, followed by purification in 10% native polyacrylamide gel. nick that might interfere with pRNA function in gearing the DNA packaging motor. Assay for DNA packaging and virion assembly using the bipartite pRNA The multivalent chimeric constructs harboring targeting, detec- assemblies. Methods for the assay of pRNA activity in DNA-packaging47 41,42 tion, and therapeutic moieties were functionally proficient, as dem- and in vitro virion assembly have been reported previously. onstrated by gene knockdown, and dual-luciferase assays. Moreover, For DNA packaging assay, briefly, the synthesized and purified 100 ng bipartite pRNA assemblies and their dimer partner (1–117) pRNA Ba′, the (1–28)/(30–117) bipartite pRNA/siRNA chimera produced bet- viral procapsid, gp16, and viral DNA-gp3, as well as the 10 mmol/l ATP ter silencing effects compared to the intact modules and the siRNA (pH 7.0) were mixed and incubated for 1 hour at ambient temperature itself (Figure 5). Dicer in vitro processing results proved that the to let viral DNA translocate into preformed procapsid. Then the mixture bipartite (1–28)/(30–117) pRNA/siRNA can be processed by Dicer was firstly treated with DNase I and followed by Protease K treatment. more efficiently and precisely than intact pRNA/siRNA chimera. The treated mixture was separated by 0.8% agarose gel and the procapsid The intact pRNA/siRNA can only be processed to generate the RNA protected DNA could be observed after ethidium bromide staining. fragment larger than 23 nt, while the bipartite module could be pro- For in vitro virion assembly assay, the mature viral particles could be cessed to generate ~23 nt RNA fragment because the single nucle- obtained by mixing bipartite pRNA Ab′ monomer, (1–117) pRNA Ba′, viral procapsid, gp16, and DNA-gp3, 10 mmol/l ATP as well as other otide gap between nt 28 and 30 within the bipartite pRNA/siRNA two components gp9 and gp11–14 were incubated at room temperature. molecule might facilitate the siRNA processing by Dicer. Meanwhile, The mixture was plated on host Bacillus subtilis su+44. After 12–14 hours siRNA alone might be unstable in cytoplasm compared to the bipar- incubation at 37 °C, the plaque formation per plate was counted and the tite pRNA/siRNA chimera which folded into the strong secondary/ viral assembly activity was calculated by PFU/ml. tertiary structure resistant to various conditions3 and might protect Cell culture. the embedded siRNA from fast degradation and resulting in an Human nasopharyngeal carcinoma KB cells [American Type Culture Collection (ATCC), Manassas, VA] are routinely maintained in enhanced RNA interference function inside the cells. RPMI-1640 medium (Invitrogen, Carlsbad, CA) and supplemented with Furthermore, flow cytometry and confocal images demon- 10% fetal bovine serum. Cultures were incubated at 37 °C in a humidified strated that the therapeutic bipartite pRNA modules were strongly 5% CO2 atmosphere. bound to the target cells and subsequently internalized into can- GFP reporter assay to test the potential of the bipartite pRNA complex in cer cells with high efficiency. escorting siRNA delivered into specific cells. For human nasopharyngeal In summary, our results showed the feasibility of the bipartite epidermal carcinoma KB cells, 105 cells were seeded in 24-well plates. GFP- approach in assembling functional RNA nanoparticles with high expressing plasmid pGFP-N2 (Clontech Laboratories, Mountain View, yield. The self-assembly of pRNA using bipartite approach dem- CA), bipartite Ab′ pRNA/siRNA (eGFP) and different kind of mutant con- onstrated the addressable and programmable nature of pRNA. trols were cotransfected into cells by using lipofactamine 2000 (Invitrogen) The constructed bipartite pRNA/siRNA and bipartite pRNA- 24 hours after seeding. The effect was measured at the level eGFPof expres- 23,24 folate chimera can further assemble into dimeric particles for tar- sion, as observed by fluorescence microscopy. geted delivery of therapeutics into FR positive cancer cells. This Dual-luciferase assays to test the potential of the bipartite pRNA com- approach can be extended in the future to build more complex plex in escorting siRNA delivered into cells. For dual-luciferase assays,23 KB multifunctional nanoparticles for a wide range of therapeutic, cells were seeded in 24-well plates. Gene silencing assays were performed detection, and diagnosis applications. by cotransfecting bipartite chimeric pRNA/siRNA (luciferase) with both plasmid pGL3 and pRL-TK (Promega, Madison, WI) coding for firefly and renilla luciferase, respectively. The latter served as an internal control Materials and Methods to normalize the luciferase data (Dual-Luciferase Reporter Assay System; In vitro synthesis of RNA fragment and assembly of the pRNA complex Promega). Cells were washed once with phosphate-buffered saline (PBS) using two RNA fragments. RNA fragments were transcribed by T7 RNA and lysed with passive lysis buffer. The plates were shaken for 15 minutes polymerase using double-stranded DNA templates from PCR, as described at room temperature. 20 μl of lysate were added to 100 μl of luciferase assay 3 previously. To construct bipartite pRNA/siRNA (eGFP), pRNA/siRNA reagent (LAR II) in a luminometer tube and firefly luciferase activity was (luciferase), and pRNA/siRNA (survivin), the helical region at the 5′/3′ measured. Upon addition of 20 μl of Stop & Glo Reagent, control mea- paired ends of pRNA was replaced with double-stranded siRNA that con- surements of renilla luciferase activity were then obtained. The previously nects to bases 29 and 91. The chimeric pRNA/siRNA bipartite assemblies obtained data was then normalized with respect to the renilla activity for were synthesized in vitro using the similar principle. determining the average ratio of firefly to renilla activity over several trials. The intact bipartite RNA complex pRNA/siRNA (eGFP), pRNA/ siRNA (luciferase), and pRNA/siRNA (survivin) were assembled from the Cell transfection assay followed by RT-PCR and western blot analysis synthesized RNA fragments either by direct mixing of two fragments at 1:1 to test the potential of the bipartite pRNA complex in escorting siRNA for gene silencing. molar ratio in TMS buffer (50 mmol/l Tris, 100 mmol/l NaCl2, 10 mmol/l KB cells were seeded into 24-well plates overnight and

MgCl2) at room temperature for >30 minutes or by annealing the two transfected with 5, 20, and 40 nmol/l bipartite pRNA/siRNA (survivin)

6 37 www.moleculartherapy.org © The American Society of Gene & Cell Therapy Bipartite Assembly of Therapeutic pRNA Nanoparticle

chimera as well as the scrambled control by Lipofectamine 2000. After 48 3. Shu, D, Huang, LP, Hoeprich, S and Guo, P (2003). Construction of phi29 DNA- packaging RNA monomers, dimers, and trimers with variable sizes and shapes as hours treatment, cells were collected and target gene silencing effects were potential parts for nanodevices. J Nanosci Nanotechnol 3: 295–302. assessed by both RT-PCR and western blot assays. 4. Shu, D, Moll, WD, Deng, Z, Mao, C and Guo, P (2004). Bottom-up Assembly of RNA Arrays and Superstructures as Potential Parts in Nanotechnology. Nano Lett 4: Cells were processed for total RNA using illustra RNAspin Mini kits 1717–1723. (GE Healthcare, Buckinghamshire, UK). The first complementary DNA 5. Hansma, HG, Oroudjev, E, Baudrey, S and Jaeger, L (2003). TectoRNA and ‘kissing- strand was synthesized on mRNA (500 ng) from KB cells using SuperScript loop’ RNA: atomic force microscopy of self-assembling RNA structures. J Microsc 212(Pt 3): 273–279. III First-Strand Synthesis System (Invitrogen) according to manufacturer’s 6. Zhang, F, Lemieux, S, Wu, X, St-Arnaud, D, McMurray, CT, Major, F et al. (1998). instruction. PCR was performed using GoTaq Flexi DNA polymerase Function of hexameric RNA in packaging of bacteriophage phi 29 DNA in vitro. Mol Cell 2: 141–147. (Promega). Reactions were carried out in a final volume of 25 μl which 7. Grabow, WW, Zakrevsky, P, Afonin, KA, Chworos, A, Shapiro, BA and Jaeger, L (2011). contained complementary DNA from first-strand synthesis, 1× GoTaq Self-assembling RNA nanorings based on RNAI/II inverse kissing complexes. Nano Lett Flexi colorless buffer, 2.5 mmol/l Mg2+, 0.2 mmol/l deoxynucleoside 11: 878–887. 8. Jaeger, L, Westhof, E and Leontis, NB (2001). TectoRNA: modular assembly units for triphosphates, 0.2 µmol/l of each primer, and 0.02 U/µl GoTaq Flexi DNA the construction of RNA nano-objects. Nucleic Acids Res 29: 455–463. polymerase. The PCR condition was 95 °C for 5 minutes then 25 cycles of 9. Chworos, A, Severcan, I, Koyfman, AY, Weinkam, P, Oroudjev, E, Hansma, HG et al. (2004). Building programmable jigsaw puzzles with RNA. Science 306: 2068–2072. 94 °C for 1 minute, 55 °C for 1 minute and 72 °C for 1 minute, followed by 10. Guo, P (2005). RNA nanotechnology: engineering, assembly and applications in 72 °C for 10 minutes. detection, gene delivery and therapy. J Nanosci Nanotechnol 5: 1964–1982. Primers for human GAPDH48 and survivin49 are: 11. Jaeger, L and Chworos, A (2006). The architectonics of programmable RNA and DNA nanostructures. Curr Opin Struct Biol 16: 531–543. GAPDH left: 5′-ACGGATTTGGTCGTATTGGGCG-3′; 12. Fire, A, Xu, S, Montgomery, MK, Kostas, SA, Driver, SE and Mello, CC (1998). Potent GAPDH right: 5′-CTCCTGAAGATGGTGATGGAA-3′; and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391: 806–811. Survivin left: 5′-GCATGGGTGCCCCGACGTTG-3′; 13. Li, H, Li, WX and Ding, SW (2002). Induction and suppression of RNA silencing by an Survivin right: 5′-GCTCCGGCCAGAGGCCTCAA-3′. animal virus. Science 296: 1319–1321. 14. Brummelkamp, TR, Bernards, R and Agami, R (2002). A system for stable expression of Cells were rinsed and harvested in lysis buffer. Protein concentrations short interfering RNAs in mammalian cells. Science 296: 550–553. were determined and equal amounts of proteins were loaded onto a 15% 15. Carmichael, GG (2002). Medicine: silencing viruses with RNA. Nature 418: polyacrylamide gel. Membranes were blocked, incubated with primary 379–380. 16. Kruger, K, Grabowski, PJ, Zaug, AJ, Sands, J, Gottschling, DE and Cech, TR (1982). antibody to survivin and β-actin (R&D Systems, Minneapolis, MN), Self-splicing RNA: autoexcision and autocyclization of the ribosomal RNA intervening and conjugated to a secondary antibody (Sigma-Aldrich, St Louis, MO). sequence of Tetrahymena. Cell 31: 147–157. 17. Guerrier-Takada, C, Gardiner, K, Marsh, T, Pace, N and Altman, S (1983). The RNA Membranes were then blotted by ECL kit (Millipore, Billerica, MA) and moiety of ribonuclease P is the catalytic subunit of the enzyme. Cell 35(3 Pt 2): exposed to film for autoradiography. 849–857. 18. Sarver, N, Cantin, EM, Chang, PS, Zaia, JA, Ladne, PA, Stephens, DA et al. (1990). Flow cytometry to test cell receptor binding of the bipartite pRNA com- Ribozymes as potential anti-HIV-1 therapeutic agents. Science 247: 1222–1225. 19. Chowrira, BM, Berzal-Herranz, A and Burke, JM (1991). Novel guanosine requirement plex harboring ligands. Cell binding studies were performed on KB cells for catalysis by the hairpin ribozyme. Nature 354: 320–322. maintained in folate-free RPMI-1640 medium (Invitrogen). The folate- 20. Sarver, N, Cantin, EM, Chang, PS, Zaia, JA, Ladne, PA, Stephens, DA et al. (1990) Ribozymes as potential anti-HIV-1 therapeutic agents. Science 24: 1222–1225. deficient KB cells were then trypsinized and rinsed with PBS. 500 nmol/l 21. Ellington, AD and Szostak, JW (1990). In vitro selection of RNA molecules that bind specific ligands. Nature 346: 818–822. bipartite pRNA/folate and control bipartite pRNA/NH2 were each incu- 5 22. Tuerk, C and Gold, L (1990). Systematic evolution of ligands by exponential bated with the 2 × 10 KB cells at 37 °C for 1 hour. After PBS wash, the enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 249: cells were resuspended in PBS buffer. Flow cytometry (Beckman Coulter, 505–510. 23. Guo, S, Tschammer, N, Mohammed, S and Guo, P (2005). Specific delivery of Brea, CA) was used to observe the cell binding efficacy of the pRNA/folate therapeutic RNAs to cancer cells via the dimerization mechanism of phi29 motor complexes. pRNA. Hum Gene Ther 16: 1097–1109. 24. Khaled, A, Guo, S, Li, F and Guo, P (2005). Controllable self-assembly of nanoparticles Confocal microscopy to test cell binding and entry. for specific delivery of multiple therapeutic molecules to cancer cells using RNA For confocal micros- nanotechnology. Nano Lett 5: 1797–1808. copy, KB cells were grown on glass coverslides in folate-free RPMI-1640 25. Guo, S, Huang, F and Guo, P (2006). Construction of folate-conjugated pRNA medium overnight. Bipartite pRNA/folate and control bipartite pRNA/ of bacteriophage phi29 DNA packaging motor for delivery of chimeric siRNA to nasopharyngeal carcinoma cells. Gene Ther 13: 814–820. NH2 with siRNA were each incubated with the cells at 37 °C for 2–3 26. Guo, PX, Erickson, S and Anderson, D (1987). A small viral RNA is required for in vitro hours. After PBS wash, the cells were fixed by 4% paraformaldehyde and packaging of bacteriophage phi 29 DNA. Science 236: 690–694. 27. Chen, C, Zhang, C and Guo, P (1999). Sequence requirement for hand-in- stained by Alexa Fluor 488 phalloidin (Invitrogen) for cytoskeleton and hand interaction in formation of RNA dimers and hexamers to gear phi29 DNA TO-PRO-3 iodide (642/661) (Invitrogen) for nucleus, staining as per translocation motor. RNA 5: 805–818. the manufacturer’s instructions. Cells were then assayed for binding and 28. Chen, C, Sheng, S, Shao, Z and Guo, P (2000). A dimer as a building block in assembling RNA. A hexamer that gears bacterial virus phi29 DNA-translocating entry of the RNA complexes by the Zeiss LSM 510 laser scanning confo- machinery. J Biol Chem 275: 17510–17516. cal microscope (Carl Zeiss, Thornwood, NY). 29. Chen, C and Guo, P (1997). Sequential action of six virus-encoded DNA-packaging RNAs during phage phi29 genomic DNA translocation. J Virol 71: 3864–3871. 30. Shu, D, Zhang, H, Jin, J and Guo, P (2007). Counting of six pRNAs of phi29 DNA- SUPPLEMENTARY MATERIAL packaging motor with customized single-molecule dual-view system. EMBO J 26: Figure S1. Autoradiogram showing the Dicer processing of the [32P] 527–537. 31. Reid, RJ, Bodley, JW and Anderson, D (1994). Characterization of the prohead-pRNA labeled bipartite pRNA/siRNA chimeras. interaction of bacteriophage phi 29. J Biol Chem 269: 5157–5162. Materials and Methods. 32. Garver, K and Guo, P (1997). Boundary of pRNA functional domains and minimum pRNA sequence requirement for specific connector binding and DNA packaging of phage phi29. RNA 3: 1068–1079. ACKNOWLEDGMENTS 33. Lee, TJ and Guo, P (2006). Interaction of gp16 with pRNA and DNA for genome This work was supported by NIH Grant EB003730, GM059944, and packaging by the motor of bacterial virus phi29. J Mol Biol 356: 589–599. CA151648 to P.G. We thank Shuhui Wan for the help with DNA-folate 34. Zhang, C, Tellinghuisen, T and Guo, P (1995). Confirmation of the helical structure of the 5’/3’ termini of the essential DNA packaging pRNA of phage phi 29. RNA 1: synthesis and Farzin Haque and Qixiang Li for their insightful com- 1041–1050. ments. P.G. is a cofounder of Kylin Therapeutics, Inc. 35. Hoeprich, S, Zhou, Q, Guo, S, Shu, D, Qi, G, Wang, Y et al. (2003). Bacterial virus phi29 pRNA as a hammerhead ribozyme escort to destroy hepatitis B virus. Gene Ther 10: 1258–1267. REFERENCES 36. Liu, H, Guo, S, Roll, R, Li, J, Diao, Z, Shao, N et al. (2007). Phi29 pRNA vector for 1. Guo, P (2010). The emerging field of RNA nanotechnology. Nat Nanotechnol 5: efficient escort of hammerhead ribozyme targeting survivin in multiple cancer cells. 833–842. Cancer Biol Ther 6: 697–704. 2. Guo, P, Zhang, C, Chen, C, Garver, K and Trottier, M (1998). Inter-RNA interaction of 37. Li, L, Liu, J, Diao, Z, Shu, D, Guo, P and Shen, G (2009). Evaluation of specific delivery phage phi29 pRNA to form a hexameric complex for viral DNA transportation. Mol of chimeric phi29 pRNA/siRNA nanoparticles to multiple tumor cells. Mol Biosyst 5: Cell 2: 149–155. 1361–1368.

38 Molecular Therapy 7 © The American Society of Gene & Cell Therapy Bipartite Assembly of Therapeutic pRNA Nanoparticle

38. Zhang, HM, Su, Y, Guo, S, Yuan, J, Lim, T, Liu, J et al. (2009). Targeted delivery of 44. Lu, Y and Low, PS (2002). Folate-mediated delivery of macromolecular anticancer anti-coxsackievirus siRNAs using ligand-conjugated packaging RNAs. Antiviral Res 83: therapeutic agents. Adv Drug Deliv Rev 54: 675–693. 307–316. 45. Chen, SJ (2008). RNA folding: conformational statistics, folding kinetics, and ion 39. Fang, Y, Shu, D, Xiao, F, Guo, P and Qin, PZ (2008). Modular assembly of chimeric electrostatics. Annu Rev Biophys 37: 197–214. phi29 packaging RNAs that support DNA packaging. Biochem Biophys Res Commun 46. Mitra, S, Shcherbakova, IV, Altman, RB, Brenowitz, M and Laederach, A (2008). High- 372: 589–594. throughput single-nucleotide structural mapping by capillary automated footprinting 40. Zhang, C, Trottier, M and Guo, P (1995). Circularly permuted viral pRNA active analysis. Nucleic Acids Res 36: e63. and specific in the packaging of bacteriophage phi 29 DNA. Virology 207: 47. Guo, P, Grimes, S and Anderson, D (1986). A defined system for in vitro packaging 442–451. of DNA-gp3 of the Bacillus subtilis bacteriophage phi 29. Proc Natl Acad Sci USA 83: 41. Lee, CS and Guo, P (1994). A highly sensitive system for the in vitro assembly of 3505–3509. bacteriophage phi 29 of Bacillus subtilis. Virology 202: 1039–1042. 48. Guha, M, Plescia, J, Leav, I, Li, J, Languino, LR and Altieri, DC (2009). Endogenous 42. Lee, CS and Guo, P (1995). In vitro assembly of infectious virions of double-stranded tumor suppression mediated by PTEN involves survivin gene silencing. Cancer Res 69: DNA phage phi 29 from cloned gene products and synthetic nucleic acids. J Virol 69: 4954–4958. 5018–5023. 49. Fulda, S and Debatin, KM (2004). Sensitization for tumor necrosis factor-related 43. Lu, Y and Low, PS (2003). Immunotherapy of folate receptor-expressing tumors: apoptosis-inducing ligand-induced apoptosis by the chemopreventive agent review of recent advances and future prospects. J Control Release 91: 17–29. resveratrol. Cancer Res 64: 337–346.

8 39 www.moleculartherapy.org

CHAPTER 2. Optimization of Dimeric pRNA Nano-delivery System

for In Vivo Applications

PART II. Generate Chemically Stable pRNA Nanoparticles for In Vivo

Delivery.

40 INTRODUCTION

RNA is a promising therapeutic agent, but it is different from optimal drug-like molecules

in that: 1) RNA is sensitive to exo- and endo-nucleases and can be easily degraded in serum or in

the blood circulation system within several minutes; 2) Unmodified RNA molecules have limited

biodistribution; 3) RNA can potentially induce off-target effects by stimulating the immune

system.

Wide varieties of chemical modifications have been developed to overcome these problems

and could improve serum stability, specificity, and delivery capacity of RNA nanoparticles.

RNA can be modified on sugar rings, bases and phosphodiester linkages 202-205. The most widely

used RNA modifications are on the sugar moiety, including: 2′-fluorin (2’-F, or FANA) 206, 207,

208, 209 210, 211 212 213 2′-O-methyl (2’- OCH3) , 2′-O-methoxyethyl (2′-MOE) , 2′-NH2 and 4’-thio .

Both 2’-F and 2’- O-methyl modification have been reported to greatly enhance the stability of siRNA without affecting its folding and subsequent gene silencing effects 206, 208, 209, 214. There

are also reports showing that the reducing of siRNA off-targets effects after chemical

modifications 215. Shorter RNA strands with 2’-F modification can be easily obtained by

chemical synthesis. However, modification of longer RNA strand by chemical synthesis is low efficiency and high cost. Thus, synthesis of chemical modified RNA by enzymetic methods is highly desired. However, regular T7 RNA polymerase (RNAP) cannot incorporate 2’-modified nucleic acids into the RNA chain. Sousa R and Padilla R reported a mutant version of T7 RNA polymerase (Y639F, Fig 2.1A) is able to recognize 2’-F modified ribonucleotides and then can be used to transcribe RNA with modified backbones 216, 217. The Y639F mutant T7 RNAP is able

to incorporate 2'-F-2' deoxy CTP and 2'-F-2' deoxy UTP to the elongated RNA chain. Therefore, we purify the Y639F T7 RNAP and establish the in vitro transcription system. 2’-F nucleotide

41 derivatives will be incorporated into RNA to produce stable in vitro RNA transcripts. The modified RNA molecules will be tested in RNase A and cell culture medium containing animal serum to assay their stability.

MATERIALS AND METHODS

Purification of Y639F mutant RNA polymerase

The Y639F mutant T7 RNAP clone was kindly supplied by Professor Chaoping Chen from

University of Colorado. The frozen stock was inoculated into 10mL LB with 100µg/mL ampicillin and incubated overnight. 8.35 mL of an overnight cell culture was transferred into

500mL LB (100µg/mL ampicillin) and incubated at 37ºC with vigorous shaking until the culture achieves an optical density (600 nm) of 0.4-0.6. IPTG was added to a final concentration of

0.4mM and continue incubation for 4 hours. After 4 hours, cells were pelleted in high speed centrifuge and resuspended in 14 mL binding buffer from His-binding buffer kits (Novagen).

Cells were lysed using French Press and then clarified by centrifugation at 15,000 rpm for 15 min. The supernatant was passed through 0.45µm filter and loaded on His-binding column

(Novagen) for purification. The purified Y639F T7 RNAP was assayed by 10% SDS-PAGE and stored in 50% glycerol at -20ºC.

In vitro transcription and purification of chemically modified pRNA nanoparticles

Chemically modified pRNAs were synthesized with Y639F RNA polymerase 216, 217 by run-off transcription. 2’-F modified dCTPs and dUTPs (Trilink Biotechnologies) were mixed with non-modified rATPs and rGTPs (Sigma) in a final concentration of 5mM. Then, 2 µg DNA template, 2 µl reaction buffer (40 mM Tris-acetate pH 8.0, 5 mM DTT, 1 mM EDTA, 10 mM

42 Mg-acetate, 0.5 mM MnCl2, 8 mM spermidine, working concentration), 2 µL 100mM DTT and

2uL purified mutant T7 RNAP were mixed together and 0.05% DEPC treated H2O were added

into final 20 µL reaction system. After overnight incubation at 37 °C, the reaction was

terminated with 1 µL of RNase-free DNase I (1 mg/mL, Sigma). RNA was purified with 8% 8M

urea polyacrylamide gel (PAGE) and the RNA band was then excised under the UV shadow and

eluted out by elution buffer (0.5 M NH4OAC, 0.1 mM EDTA, 0.1% SDS, and 0.5 mM MgCl2). pRNAs were then precipitated overnight at 20 °C after addition of a 2.5 volume of 100% ethanol and 1/10 volume of 3 M NaOAc (pH 6.5). The precipitate was pelleted by centrifugation

(16500g, 10 min), washed with 70% ethanol, and dried by speed vacuum. Finally, dried RNA was resolved in 0.05% DEPC aqueous solution to constitute stock solution of pRNA.

Stability assay in the presence of RNase and serum

In a final volume of 20 µL, 2 µg of unmodified and 2’ F-C/U pRNA Aa’ were incubated at

37 °C in RMPI-1640 medium (Gibco) containing either fetal bovin serum (FBS, Gibco) or

RNase A (RPA grade, Ambion) at a final concentration of 10% and 1 mg/mL, respectively.

Aliquots (4 µL) were taken at multiple time points (0, 10 min, 1 h, 12 h, and 36 h) and ran for 2 h at RT in 8% 8M urea PAGE in TBE buffer. After running, gels were stained by ethidium bromide and images were captured with an Eagle Eye II system (Stratagene).

RESULTS

Purification of Y639F mutant RNAP by His-binding column

The Y639F mutant T7 RNAP was fused with His-tag for purification purpose. The purified

Y639F mutant T7 RNAP showed the correct size (~99kDa) in 10% SDS-PAGE (Fig. 2.1B).

In vitro transcription of chemical modified RNA by mutant T7 RNAP

As wild-type T7 RNAP (Fig. 2.2, lane1), Y639F mutant T7 RNA polymerase can recognize normal rNTPs to transcribe RNA from DNA template (Fig. 2.2, lane 2). Y639F mutant

T7 RNA polymerase also can recognize 2’-F modified ribonucleotides (2’-F-dUTP and 2’-F- dCTP) to transcribe RNA from DNA template either using commercial supplied transcription buffer (Fig. 2.2, lane 4) or using home made transcription buffer (40 mM Tris-acetate pH 8.0, 5 mM DTT, 1 mM EDTA, 10 mM Mg-acetate, 0.5 mM MnCl2, 8 mM spermidine) (Fig.2.2, lane

5). The transcriptional efficiency is similar while comparing to the commercial available

DuraScribe™ Transcription Kit (Epicentre Biotechnologies) (Fig.2.2, lane 3) which is costly and relatively small scale.

2’-F-Modified pRNA Aa’ remains stable in the presence of RNase A or FBS.

Regular pRNA is sensitive to degradation in vitro by RNases and in vitro by serum which contains RNA degradation enzymes. Such instability limits its potential to be used as a building block in bottom-up assembly of therapeutic nanoparticle. Incubation of 2’-F C/U modified pRNA Aa’ with RNase A or FBS showed that 2’-F C/U modified pRNAs demonstrated resistance to both RNase A and FBS digestion for up to 16 h of incubation while regular pRNA

Aa’ is completely degraded (Fig. 2.3A&B). 2’-F C/U modified pRNA Aa’ also well retain its correct folding and function. For more information, please refer to my co-authored manuscript published on ACS Nano, 2011, 5:237-46.

CONCLUSION AND DISCUSSION

44 The chemical modifications increase the RNA stability and make RNA nanoparticle more

suitable for in vivo application. The modified RNAs are resistant to exo- and endo-nucleases

degradation and possess longer retention time in the blood circulation system. In addition,

chemical modified RNA can potentially reduce off-target effects. Although our data showed that

the 2’-F modified RNA molecules retain the correct folding and function as unmodified RNA

molecules, heavy 2’-F modification on RNA chain might affect the folding and function of RNA

and compromise the RNAi potency eventually. Therefore, finding out the optimized chemical

modification pattern on RNA chain or studying other potential chemical modification methods need to be pursued to achieve our final goal: synthesizing RNase-resistant and biologically active

stable RNA nanoparticles for application in nanotechnology.

Figure 2.1 Y639F mutant T7 RNAP. (A) The position of Tyr639 (yellow) as seen in the structure of a T7 RNAP initial transcription complex (PDB 1QLN) 218. Figure is adapted from ref

219 (B) 10% SDS-PAGE showing the purification of Y639 mutant T7 RNAP (~99KD) (1: elution

fraction 1; 2: elution fraction 2; M: Protein ladder).

Figure 2.2 The transcription of chemical modified RNA by mutant T7 RNAP.

Figure 2.3 Urea-PAGE denatured gel showing the stability between unmodified pRNA Aa’ and

2’-F-C/U pRNA Aa’ after incubation at different time points in the presence of (A) RNase A (1 mg/mL) and (B) FBS (10%). This figure is adapted from ref 220.

CHAPTER 2. Optimization of Dimeric pRNA Nano-delivery System

for In Vivo Applications

PART III. Stabilize the tertiary structures of pRNA nanoparticles

by chemical crosslinking.

49 INTRODUCTION

Construction of polyvalent RNA nanoparticles with multiple subunits to carry multiple functions requires the self assembly of RNA subunits to form a quaternary complex. Even though RNA/RNA interactions are much more stable than DNA/DNA interactions, RNA/RNA

interaction is still a kinetic process. Particle stability in vivo at low concentrations will be

affected by the dissociation constant. Approaches based on chemical cross-linking might be

attempted if the polyvalent RNA dissociates at low concentrations in vivo.

Psoralens (F.g 2.4A) are heterocyclic compounds that intercalate into nucleic acids and

form inter-strand crosslinks upon illumination with ultraviolet A (UVA 320 nm to 400 nm) light.

The mechanism involves the formation of a covalent monoadduct on one strand followed by

photoexcitation to form a covalent bond with the nucleic acid on the adjacent second strand

within a certain distance, thereby generating a di-adduct or inter-strand crosslink 221. Many

psoralen derivatives have been synthesized over the last three decades, such as the inclusion of

an amine side chain (Aminomethyltrioxsalen, AMT), which leads to substantially higher water

solubility and overall activity with the target nucleic acids 222. The crosslinking process is a simple reaction between AMT and the olefinic moieties of the nucleic acid pyrimidine base. The preferred nucleotides for intercalation are pyrimidines (U > C > A > G).

The pRNA loops and some designed paring sequences will be thoroughly investigated to select the possible psoralen crosslinking sequences. RNA SELEX will also be used to screen out more potential loop-loop sequences for psoralen crosslinking. The dimeric pRNA constructed based on selected loop sequences will be constructed and crosslinked by psoralen to increase the structure integrity and stability.

50 MATERIALS AND METHODS

In vitro synthesis and purification of pRNA with different loop sequences

pRNA homodimers with different loop sequences were synthesized by enzymatic methods

as described previously 223. The assayed loop sequences are listed in Tab 2.1

Table 2.1 Assayed pRNA loop-loop interactions for psoralen crosslinking Upper loop sequences Lower loop sequences

5’→3’ 5’→3’ Aa’ GGAC GUCC Bb’ ACGC GCGU Cc’ GACA UGUC Dd’ AGGC GCCU Pp’ AUAC GUAU Uu’ mut UACC GGUA Ss’ mut GGAU AUCC Ii’ mut AUCC GGAU

Psoralen crosslink of pRNA homodimers

Psoralen (AMT) was solved in DEPC treated water as 2mg/mL (100X) stock solution and

stored in light proof tubes at -20 ºC. Cross-linking of pRNA homodimers with AMT was

performed as described previously 221. Briefly, 0.2 to 1.0 ug of pRNA in 10 µL of TMS buffer

(50 mM Tris–HCl, pH 7.8, 100 mM NaCl and 10 mM MgCl2) was mixed with AMT at final

20ug/mL concentration. The mixed samples were spotted onto prechilled Parafilm placing on ice.

Each drop is less than 10 µL. The samples were irradiated with long-wavelength UV from a

UVGL-25 instrument (UVP Inc.) with a distance of 4 to 5 cm for 50 min (Fig. 2.4B). The cross-

linked mixture was mixed with an equal volume of 2x formamide loading buffer (98%

formamide, 0.05% bromphenol blue, 0.05% xylene cyanol, 20 M EDTA, 0.025% sodium

51 dodecyl sulfate (SDS) ) before being loaded onto an 8% 8M urea polyacrylamide gel to separate

cross-linked products from uncrosslinked pRNA.

SELEX of potential psoralen crosslinking pRNA loop-loop pairs

In order to select more loop sequences for potential psoralen crosslinking, we designed a

small RNA library using truncated pRNA interlocking interaction domain which has the

randomized upper loop sequence and fixed lower loop sequence as i’ (5’GGUU3’). The random

DNA template was synthesized by IDT and double strand DNA template was obtained by PCR

using primer pairs: 5’-primer: 5’ taatacgactcactataggGTCATGTGTATGTTGGGG 3’ and 3’-

primer 5’ GCCATGATTGACAACCAATC 3’, The DNA pool was transcribed into RNA library

through T7 in vitro transcription. The RNA library then was psoralen crosslinked and run into

8% 8M urea PAGE. The crosslinked bands were cut out and eluted out as the template for following RT-PCR step. The first DNA strand was synthesized using SuperScriptTM III First-

Strand Synthesis System (Invitrogen). PCR was performed using GoTaq Flexi DNA polymerase

(Promega). Reactions contained complementary DNA from first-strand synthesis, 1× GoTaq

Flexi colorless buffer, 2.5 mmol/l Mg2+, 0.2 mmol/l deoxynucleoside triphosphates, 0.2 μmol/l

of each primer, and 0.02 U/μl GoTaq Flexi DNA polymerase. The PCR condition was 95 °C for

5 minutes then 25 cycles of 94 °C for 1 minute, 55 °C for 1 minute and 72 °C for 1 minute,

followed by 72 °C for 10 minutes. The PCR results were assayed on 2% Syneal/Agarose gel

electrophoresis. The PCR products were amplified as the new random library for the next round

selection. After three rounds of selection, the final PCR DNA was cloned in to pGEM-T vector

for sequencing (Fig. 2.5).

52 Assembly of psoralen crosslinked chimeric pRNA dimers with functionalities

One of dimer subunit was with folate labeling. The pRNA was a truncated version which

has the nt# 28 to nt#98 Cd’ pRNA sequence with 3’-extension. After in vitro transcription of the

Cd’ pRNA, the folate-DNA oligo was annealed by simply heating up at 80°C for 5 min and slowly cooling down to room temperature. Cd’ pRNA/folate was purified via 8% 8M urea PAGE.

The other dimre subunit is Dc’ pRNA/siRNA which was in vitro transcribed and purified from

8% 8M urea PAGE. The pRNA/siRNA subunit was whole chain labeled using the Label IT® siRNA Tracker Intracellular Localization Kit, Cy3™ (Mirus Bio LLC). The psoralen crosslinked chimeric pRNA dimers were purified from 8% 8M urea PAGE.

Flow cytometry and confocal microscopy

Human nasopharyngeal carcinoma KB cells [American Type Culture Collection (ATCC)] were maintained in folate-free RPMI-1640 medium (Gibco), then trypsinized and rinsed with

PBS (137 mM NaCl, 2.7 mM KCl, 100 mM Na2HPO4, 2 mM KH2PO4, pH 7.4). 500nM

Cy3/folate labeled chimeric pRNA dimers w/ or w/o psoralen crosslinked were each incubated

5 with 2 x 10 KB cells at 37°C for 1 hr. The folate free NH2-labeled dimers were used as negative

controls. After washing with PBS, the cells were resuspended in PBS buffer. Flow Cytometry

(Beckman Coulter) was used to observe the cell binding efficacy of the Cy3 RNA nanoparticles.

Confocal microscopy

KB cells were grown on glass coverslides in folate free medium overnight. 500nM

Cy3/folate labeled chimeric pRNA dimers w/ or w/o psoralen crosslinked were each incubated

with 2 x 105 KB cells at 37°C for 1 hr. The folate free NH2-labeled dimers were used as negative

53 controls. After washing with PBS, the cells were fixed by 4% paraformaldehyde and stained by

Alexa Fluor® 488 phalloidin (Invitrogen) for cytoskeleton and TO-PRO®-3 iodide (642⁄661)

(Invitrogen) for nucleus. The cells were then assayed for binding and cell entry by Zeiss LSM

510 laser scanning confocal microscope.

RESULTS

Nomenclature

To concisely describe the construction of RNA complexes, we use upper-case letter for the upper loop (or called right-hand loop “R-loop”), and lower-case letters to represent the lower loop (or called left hand loop “L-loop”). Complementary loops are assigned matched same letters in upper and lower cases, respectively; non-complementary loops are assigned unmatched different letters. For example, pRNA (Ab’) itself has an unmatched upper right-hand loop A

5’ 3’ ( G45G46A47C48) and a lower left-hand loop b’ ( U85G84C83G82), but is able to match and pair

3’ 5’ with the left-hand loop a’ ( C85C84U83G82) and right-hand loop B ( A45C46G47C48), respectively,

of the other pRNA (Ba’), which itself also contains unmatched loops. Other descriptions like

pRNA/siRNA represent a pRNA chimera that harbors a siRNA, and pRNA-FA represents a

chimeric pRNA harboring folate as delivery ligand.

Selection of psoralen crosslinked pRNA homodimer

pRNA has several engineered paired loop sequences. pRNA homodimers mixed with

psoralen and stimulated by 320~400nm UV for 50 min. The crosslinked dimeric pRNA was

distinguished by denaturing gel electrophoresis. The results showed pRNA loop C (5’GACA3’)

and c’ (5’UGUC3’) are the potential candidates for crosslinking pRNA dimers (Fig. 2.4C). We

54 also found that any pRNA heterodimer harboring Cc’ interaction can be crosslinked to form stable dimer particle (data not shown). Further study on psoralen crosslinked pRNA dimer showed that crosslinking of pRNA dimer requires the presence of at least 5mM Mg2+ in reaction buffer (data not shown).

RNA SELEX of potential interlock loop sequences for psoralen crosslinking

After three rounds of selection, the selected upper loop sequence which can crosslink with i’ lower loop is 5’- CGUA -3’. However, this selected loop sequence can also crosslink any other

lower loop sequences, indicating that the crosslinking might occur between 5’ CGUA 3’ and other regions alone pRNA chain.

Psoralen crosslinking of dimeric pRNA Cd’/Dc’ chimera to increase the delivery efficacy

The constructed Cd’ pRNA/folate and Dc’ pRNA/siRNA were crosslinked and purified by

8% 8M urea PAGE. The binding efficiency of the pRNA dimer and crosslinked dimer was assayed by flow cytometry. The pRNA dimer without psoralen crosslinking showed ~15% binding efficiency. The crosslinked dimer which could not dissociate showed significantly increased cell binding (almost 100%). The binding specificity was proved by using free FA for the competitive assay. Adding excessive amount of FA which bound to the folate receptor reduced the RNA binding (Fig. 2.6A). The cell internalization was visualized by confocal microscopy (Fig. 2.6B). However, due to the endosome trap issue, the target gene silencing efficacy cannot be measured and compared at this moment.

CONCLUSION AND DISCUSSION

55 As the building block, pRNA can be engineered to harbor different functionalities for diverse purpose, and assembled into higher ordered complex as dimers and trimers through loop- loop interaction. However, we observed dissociation problem of dimeric pRNA nanoparticles which will affect the delivery efficacy. Thus, we tried to use psoralen, which intercalates into

RNA molecules and freezes proximal uridines within certain distances and in certain stereopositions (helix, pseudoknot, etc.) by covalent attachment upon irradiation with 320- to

400-nm light, to crosslink and stabilize pRNA dimer to promote the delivery efficacy.

We tried RNA SELEX method to select potential psoralen crosslinking loops. After three rounds of selection, the selected upper loop sequence was 5’ CGUA 3’ which supposed to be crosslinked with pRNA lower loop i’. However, this selected loop sequence can be also crosslinked with any other lower loop sequences indicated that the crosslinking might occur between 5’ CGUA 3’ and other region alone pRNA chain. Then, pRNA loop-loop interaction sequences C-c’ was found to be the potential psoralen crosslinking sequences to form stable pRNA dimers. The crosslinked dimers can be either purified by denature gel or used as the mixture of crosslinked and uncrosslinked dimers for improvement of target siRNA delivery (Fig.

2.7A). Ideally, monomeric Cd’ pRNA chimera will be conjugated with folate molecule and, its dimer partner, the other Dc’ pRNA will harbor siRNA targeting anti-apoptotic factor gene in tumor cells. While mixing in equal mole ration, the dimer will formed between Cd’ and Dc’.

Meanwhile, this dimer pair can be covalently linked by psoralen through Cc’ interaction. The crosslinked dimer will not be dissociated and will ensure the efficient delivery of siRNA into targeting tumor cells and cause subsequent gene silencing effects. However, psoralen crosslinking efficiency is only around 10% ~20%, which is not suitable for scale-up synthesis and apply for clinical applications. Improving current pRNA nano-delivery system based on

56 interlocking interaction or developing novel delivery system based on other pRNA structure motif is emerging.

Figure 2.4 Psoralen crosslinking of pRNA dimers. (A) Chemical structure of psoralen. (B) The experimental set up (figure is adapted from ref 221). (C) Assay of psoralen crosslinked dimer by

8% 8M urea PAGE. pRNA cannot form dimer in denaturing condition. Upper indicated the

crosslinked stable pRNA dimer by psoralen.

Figure 2.5 Design and procedures of RNA SELEX for potential psoralen crosslinkable pRNA loop sequence.

Figure 2.6 Improved targeting delivery efficacy of pRNA dimer constructs by psoralen crosslinking. (A) Flow cytometry revealed the improved binding efficiency of psoralen crosslinked dimeric pRNA nanoparticles Cy3-[Cd’-FA/Dc’pRNA-siRNA] into folate-receptor- positive cells. Negative control was Cy3-[Cd’-NH2/Dc’pRNA-siRNA] (without FA). The delivery specificity was also proved by adding free FA for competitive assay. (B) Confocal images showed internalization of crosslinked pRNA dimer into cells by co-localization (overlap,

4) of cytoplasm (green, 1) and RNA nanoparticles (red, 2) (magnified, bottom panel). Blue– nuclei,3.

CHAPTER 3. Develop Novel pRNA Nano-delivery System Based on

Different Mechanisms

PART I. Design of Novel pRNA Nanoparticles Based on Three-way Junction

(3WJ) or 3WJ Derived X-shaped Motif of pRNA to Generate Thermodynamically

and Chemically Stable pRNA Nanoparticles for In Vivo Delivery.

pRNA 3WJ work was published in Nature Nanotechnology, 2011, 6:658-67

The contents and figures are copied with permission from Nature Publication Group.

61 INTRODUCTION

Living organisms possess wide assortments of elegant nanomachines, patterned arrays and

highly structured macromolecules performing diverse biological functions. Macromolecules such

as DNA, RNA and proteins have intrinsically defined features at the nanometer scale and can

serve as powerful building blocks for the bottom-up fabrication of biomimetic nanostructures

and nanodevices 3, 4. RNA is a particularly attractive candidate for such applications 224-229, since

it can be designed and manipulated with a level of simplicity characteristic of DNA, while

possessing a versatile flexibility in structure and function similar to some properties of proteins

106. Simple chemical modifications such as, 2’-F can generate RNAs resistant to degradation

without changing its folding into appropriate 3D structure, while retaining authentic biological

and enzymatic functions 220, 230.

There are many types of RNA molecules that could potentially be utilized for

nanotechnology-based therapy such as small interfering RNAs 156, 196, 197, ribozymes 141, 198, 199，

RNA aptamers 124, 231, riboswitches 232, 233, and miRNAs 234-236. Although the methods for gene

silencing with high efficacy and specificity have been achieved in vitro, the effective delivery of

RNA to specific cells in vivo remains challenging. The development of a safe, efficient, specific

and nonpathogenic nanodevice for the delivery of multiple therapeutic RNAs is highly desired.

The feasibility of RNA nanotechnology in disease therapy has been exemplified in the

phi29 pRNA therapeutic system 156, 196-199, 201, 230. The DNA packaging motor of bacteriophage phi29 (Fig. 3.1A) is geared by a hexameric pRNA ring 237-239, which contains two functional

domains 223, 240: the 5’/3’ end helical domain and the central domain. Two domains are linked by

a 3WJ motif. The central domain of each pRNA subunit contains two interlocking loops, denoted

as the right- and left-hand loops (Fig. 3.1B) that can be reengineered to form dimers or trimers

62 via hand-in-hand interactions and deliver therapeutics into specific targeting cells 107, 108, 147, 241,

242.

However, one of the challenges in using of pRNA dimers and trimers for clinical

application is the relative instability without covalent modifications or crosslinking of the

nanoparticles, resulting in the dissociation at ultra low concentrations in vivo after systemic injection. The controlled assembly of stable RNA nanoparticles with multiple functionalities to retain original role is also challenging due to refolding after fusion.

Recently, we found that the 3WJ core (Fig. 3.1C) of the pRNA can be used as a scaffold to assemble with high affinity trivalent RNA nanoparticle based on its features which are stable, resistant to denaturation by 8 M urea and remained intact at ultra low concentrations. And we also demonstrated that the centerfold domain of the pRNA could be engineered to form an X- shaped motif (Fig. 3.1D), which possesses the similar properties as pRNA 3WJ core. Herein, we report the construction of pRNA 3WJ based and pRNA 3WJ derived pRNA-X core based RNA nanoparticles carrying functionalities including HBV RNA ribozyme, siRNA, RNA aptamer, or folate (FA). The resulted trivalent or tetravalent RNA nanoparticles will be served as potential therapeutic agents for cancer and viral infections.

MATERIALS AND METHODS

In vitro synthesis and purification of pRNA and chemically modified pRNA

The pRNA were synthesis by enzymatic methods as described previously 223. Short RNA

oligos were synthesized chemically by IDT (Iowa).

2’-deoxy-2’-Fluoro (2’-F) modified RNAs were synthesized by in vitro transcription with

the mutant Y639F T7 RNA polymerase 243 using the 2’-F modified dCTP and dUTP 220 (Trilink).

63 Please refer to Chapter 2 Part II for more detailed description.

Construction of trivalent pRNA nanoparticles harboring therapeutic and reporter moieties

([3WJ-folate-ribozyme-siRNA] or [3WJ-folate-aptamer-siRNA])

The sequences for the siRNA, HBV ribozyme, malachite green (MG) binding aptamer and folate labeled RNA were rationally designed with the sequences of the pRNA 3WJ strands a3WJ, b3WJ, and c3WJ (Fig. 3.1C), respectively. Multi-module 3WJ-pRNA-HBV ribozyme-Survivin

siRNA-folate donated [3WJ-pRNA-siSur-Rz-FA] or 3WJ-pRNA-MG aptamer-Survivin siRNA-

folate donated [3WJ-pRNA-siSur-MG-FA] was assembled from four individual fragments

including a 26-nt folate labeled RNA (Trilink) or folate-DNA strand (synthesized in house); and,

chemically synthesized 21-nt siRNA or scramble siRNA anti-sense strand (IDT). The 106-nt

strand harboring HBV ribozyme sequence or 96-nt strand harboring MG binding aptamer and the

41-nt strand holding the folate-DNA/RNA were transcribed from DNA template amplified by

PCR. Fluorescent dyes were labeled on the 106-nt RNA strand by using the Label IT® siRNA

Tracker Intracellular Localization Kit, Cy3™ (Mirus Bio LLC). The four RNA strands were

mixed after purification in TMS buffer at equal molar ratio and then heated up to 80°C for 5

mins, followed by slow cooling to 4°C. The assembled nanoparticles were then purified from 8%

native PAGE gel by running in TBM (89 mM Tris, 200 mM Boric Acid, 5 mM MgCl2, pH 7.6) buffer and eluting in 0.5 M NH4OAC, 0.1 mM EDTA, 0.1% SDS for ~4 hrs at 37°C, followed by ethanol precipitation overnight. The dried pellet was then rehydrated in DEPC treated water or TMS buffer. The trivalent particles constructed based on 5S rRNA 3WJ-core ([3WJ-5S rRNA-siSur-Rz-FA] and [3WJ-5S rRNA-siSur-MG-FA]) were also assembled as the same procedures described above.

64 The formation of the complexes were then analyzed by 8% native PAGE or 8M urea PAGE

gel in TBM running buffer, as specified in the Results Section. After running at 4°C for 3 hrs, the

RNA was visualized by ethidium bromide.

Construction of tetravalent RNA pRNA nanoparticles harboring therapeutic and reporter

moieties ([pRNA-X/MG/FA/siLuci/siSurv])

The sequences for the Luciferase siRNA, Survivin siRNA, Malachite Green (MG)

binding aptamer and folate labeled RNA were rationally designed with the sequences of the

strands a, b, c, and d respectively (Fig. 3.1D). Multi-module nanoparticles pRNA-X/MG

aptamer/Folate/ Luciferase siRNA and Survivin siRNA, denoted [pRNA-

X/MG/FA/siLuci/siSurv] or scramble control, denoted [pRNA-X/MG/FA/siPSMA/siSurv Scram] were assembled from five individual fragments including a 26-nt folate labeled RNA (Trilink) or folate-DNA strand (synthesized in house). The individual RNA strands (fragments 1, 2, 3 and 4,

Fig. 3,4A) were transcribed from DNA template amplified by PCR. Fluorescent dyes were labeled on one RNA strand by using the Label IT® siRNA Tracker Intracellular Localization Kit,

Cy3™ (Mirus Bio LLC). The five RNA strands were mixed after purification in TMS buffer at equal molar ratio and then heated up to 80°C for 5 mins, followed by slow cooling to 4°C. The assembled nanoparticles were then purified from 8% native PAGE.

The formation of the complexes were then analyzed by 8% native PAGE or 8M urea PAGE in TBM running buffer, as specified in the Results Section. After running at 4°C for 3 hrs, the

RNA was visualized by ethidium bromide staining.

Stability assay in serum for RNase resistent

65 RNA nanoparticles were synthesized in the presence 2’-F dCTP and dUTP 220, and incubated in RPMI-1640 medium containing 10% fetal bovine serum (Sigma). 200 ng of RNA were taken at 10 mins, 1 hr, 12 hr, and 36 hr time points after incubation at 37°C, followed by analysis using 8% native PAGE.

Flow cytometry analysis of folate mediated cell binding

Human nasopharyngeal carcinoma KB cells or Hela cells[American Type Culture

Collection (ATCC)] were maintained in folate-free RPMI-1640 medium (Gibco), then trypsinized and rinsed with PBS (137 mM NaCl, 2.7 mM KCl, 100 mM Na2HPO4, 2 mM

KH2PO4, pH 7.4). 200 nM Cy3 labeled [3WJ-pRNA/siSur-Rz-FA] or pRNA-X complexes

harboring folate labeled [pRNA-X/MG/FA/siLuci/si/Surv] and the folate-free control [3WJ-

5 pRNA/siSur-Rz-NH2]or [pRNA-X/MG/NH2/siLuci/si/Surv] were each incubated with 2 x 10

KB cells at 37°C for 1 hr. After washing with PBS, the cells were resuspended in PBS buffer.

Flow Cytometry (Beckman Coulter) was used to observe the cell binding efficacy of the Cy3

RNA nanoparticles.

Confocal microscopy

KB or Hela cells were grown on glass cover slides in folate free medium overnight. 200 nM Cy3 labeled [3WJ-pRNA/siSur-Rz-FA] or pRNA-X complexes harboring folate labeled

[pRNA-X/MG/FA/siLuci/si/Surv] and the folate-free control [3WJ-pRNA/siSur-Rz-NH2] or

[pRNA-X/MG/NH2/siLuci/si/Surv] were each incubated with the cells at 37°C for 2 hrs. After washing with PBS, the cells were fixed by 4% paraformaldehyde and stained by Alexa Fluor®

488 phalloidin (Invitrogen) for cytoskeleton and TO-PRO®-3 iodide (642⁄661) (Invitrogen) for

66 nucleus. The cells were then assayed for binding and cell entry by Zeiss LSM 510 laser scanning

confocal microscope.

Activity assay for the HBV ribozyme incorporated in the trivalent RNA nanoparticles

HBV ribozyme is an RNA enzyme that cleaves the genomic RNA of the Hepatitis B Virus

genome 198. The HBV RNA substrate was radio-labeled by [α-32P] UTP (PerkinElmer, Inc) and

incubated with the 3WJ-pRNA or 3WJ-5S rRNA core harboring HBV ribozyme at 37°C for 60

mins in a buffer containing 20 mM MgCl2, 20 mM NaCl, and 50 mM Tris-HCl, pH 7.5. The

pRNA/HBV ribozyme served as a positive control 198, and 3WJ RNA harboring MG binding

aptamer was used as a negative control (Fig. 7). The samples were then loaded on 8M urea/ 10%

PAGE gel for autoradiograph.

Binding assay for the Malachite green (MG) aptamer incorporated in the trivalent or

tetravalent RNA nanoparticles

3WJ-pRNA and 3WJ-5S rRNA trivalent RNA nanoparticles, or tetravalent [pRNA-

X/MG/FA/siLuci/siSurv] nanoparticles harboring MG binding aptamer (100 nM) 244, 245 was

mixed with MG (2 µM) in binding buffer containing 100 mM KCl, 5 mM MgCl2, and 10 mM

HEPES (pH 7.4) and incubated at room temperature for 30 mins (Fig. 8). RNA nanoparticles harboring HBV ribozyme served as negative control. The fluorescence intensity was measured using a fluorospectrometer (Horiba Jobin Yvon; SPEX Fluolog-3), excited at 475 nm (scanning

from 540 to 800 nm for emission) and 615nm (scanning from 625 to 800 nm for emission).

Assay for the silencing of human survivin genes in cancer cell model.

67 Two trivalent 3WJ-RNA constructs were assayed for the subsequent survivin gene

silencing effects: 1) harboring folate and survivin siRNA [3WJ-pRNA/siSur-Rz-FA]; and, 2)

harboring folate and survivin siRNA scramble control [3WJ-pRNA/siScram-Rz-FA]. Two

tetravalent pRNA-X nanoparticles were constructed for assaying the survivin gene silencing

effects harboring: 1) harboring folate and survivin siRNA [pRNA-X/MG/FA/siLuci/si/Surv]; 2)

harboring folate and Survivin siRNA scramble control [pRNA-X/MG/FA/siLuci/siSurv Scram].

KB cells were transfected with 25nM of the individual 3WJ-RNAs and a positive Survivin

siRNA control (Ambion, Inc.) using Lipofectamine 2000 (Invitrogen). After 48 hrs treatment,

cells were collected and target gene silencing effects were assessed by both qRT-PCR and

Western Blot assays.

Hela cells were transfected with 25nM of the individual pRNA-X complexes using

Lipofectamine 2000 (Invitrogen). After 48 hrs treatment, cells were collected and target gene

silencing effects were assessed by both RT-PCR and Western Blot assays.

For both RT-qPCR and RT-PCR assay, cells were processed for total RNA using illustra

RNAspin Mini kits (GE healthcare). The first cDNA strand was synthesized on mRNA (500 ng)

from KB cells with the various 3WJ-RNAs treatment using SuperScriptTM III First-Strand

Synthesis System (Invitrogen).

Primers for human GAPDH and survivin are: GAPDH left: 5′- AGCCACATCGCTCAG

ACAC-3′; GAPDH right: 5′-GCCCAATACGACCAAATCC-3′; Survivin left: 5′-CACCGCA

TCTCTACATTCAAGA-3′; Survivin right: 5′-CAAGTCTGGCTCGTTCTCAGT-3′.

Real-time PCR was performed using Roche Universal Probe Library Assay. All reactions were carried out in a final volume of 10 μl and assayed in triplicate. PCR was performed on

68 LightCycler 480 (Roche) for 45 cycles. The data was analyzed by the comparative CT Method

(ΔΔCT Method).

PCR was performed using GoTaq Flexi DNA polymerase (Promega). Reactions were

carried out in a final volume of 25 μl which contained complementary DNA from first-strand

synthesis, 1× GoTaq Flexi colorless buffer, 2.5 mmol/l Mg2+, 0.2 mmol/l deoxynucleoside

triphosphates, 0.2 μmol/l of each primer, and 0.02 U/μl GoTaq Flexi DNA polymerase. The

PCR condition was 95 °C for 5 minutes then 25 cycles of 94 °C for 1 minute, 55 °C for 1 minute

and 72 °C for 1 minute, followed by 72 °C for 10 minutes. The PCR results were assayed on 2%

Syneal/Agarose gel electrophoresis.

For Western Blot assays, cells were lysed by RIPA lysis buffer (Sigma) and the cell total

protein was extracted for the assay. Equal amounts of proteins were then loaded onto 15% SDS-

PAGE and electrophoretically transferred to Immun-Blot PVDF membranes (Bio-rad). The

membrane was probed with survivin antibody (R&D) (1:4000 diluted) and β–actin antibody

(Sigma) (1:5000 diluted) overnight, followed by 1:10000 anti-rabbit secondary antibody

conjugated with HRP (Millipore) for 1 hr. Membranes were blotted by ECL kits (Millipore) and

exposed to film for autoradiography.

Assay for the silencing of luciferase genes in cancer cell model

Dual-luciferase assay was used to test the potential of the pRNA-X complex in escorting

siRNA delivered into cells. For dual-luciferase assays, Hela cells were seeded in 24-well plates.

Gene silencing assays were performed by co-transfecting [pRNA-X/MG/FA/siLuci/si/Surv] with

both plasmid pGL-3 control and pRL-TK (Promega, Madison, WI) coding for firefly and renilla

luciferase, respectively. The latter served as an internal control to normalize the luciferase data

69 (Dual-Luciferase Reporter Assay System; Promega). Cells were washed once with phosphate-

buffered saline (PBS) and lysed with passive lysis buffer. The plates were shaken for 15 minutes

at room temperature. 20 μl of lysate were added to 50 μl of luciferase assay reagent (LAR II) in

96-well white plate (Thermo Scientific) and firefly luciferase activity was measured using

Synergy 4 plate reader (Bioteck). Upon addition of 50 μl of Stop & Glo Reagent, control

measurements of renilla luciferase activity were then obtained. The data was then normalized

with respect to the renilla activity for determining the average ratio of firefly to renilla activity

over several trials.

The target sites on the luciferase gene for the four siRNAs (Fig. 3,6A) was located at 153-

173, 196-216, 498-518, and 846-869 positions, as published in the literature 246, 247.

AFM imaging

For all samples specially modified mica surfaces (APS mica) were used. The APS mica was obtained by incubation of freshly cleaved mica in 167 nM 1-(3-aminopropyl)silatrane. The details of APS mica surface modification is described elsewhere 248, 249. The RNA samples were

diluted with 1xTMS buffer to a final concentration of 3-5 nM. Then, the droplet of samples (5-

10uL) was immediately deposited on APS mica. After 2 min incubation on the surface, excess

samples were washed with DEPC treated water and dried under a flow of Argon gas. AFM

images in air were acquired using MultiMode AFM NanoScope IV system (Veeco/Digital

Instruments, Santa Barbara, CA) operating in tapping mode. Two type of AFM probes were used

for tapping mode imaging in air: (1) regular tapping Mode Silicon Probes (Olympus from

Asylum Research, Santa_Barbara, CA) with a spring constant of about 42 N/m and a resonant

frequency between 300-320 kHz. (2) non-contact NSG01_DLC probes (K-Tek Nanotechnology,

70 Wilsonville, OR) with a spring constant of about 5.5 N/m and a resonance frequency between

120-150 kHz.

RESULTS

Properties of pRNA-3WJ core

The 3WJ domain of phi29 pRNA was constructed using three pieces of RNA oligos

denoted as a3WJ, b3WJ and c3WJ (Fig. 3.1C). The mixing of the three oligos, a3WJ, b3WJ and c3WJ, at

a 1:1:1 molar ratio resulted in efficient formation of the 3WJ domain without metal ion. Melting

experiments suggest that the 3WJ-pRNA core (Tm of 58.0 ± 0.5ºC) is most stable constructs among 25 3WJ motifs extracted from nature existed RNA structures. The pRNA 3WJ domain remained stable without dissociation in the presence of 8 M urea and at extremely low concentration (160 pmol/L), thereby demonstrating its robust nature (data not show, refer to publications). It has been previously demonstrated that the extension of the phi29 pRNA at the

3’-end does not affect the folding of pRNA global structure 108. Extension of the 3WJ domain

into larger structures with three branches bearing functional modules was also proved to be fully

assembled and stable. AFM images confirmed the formation of larger RNA complexes with

three-branches (data not shown). The features of the pRNA 3WJ motif ensured its potential as

the deliver scaffold to assemble RNA nanoparticles.

Fabrication of chemically modified stable 3WJ-pRNA nanoparticles resistant to

degradation in serum

71 The 2’-F U/C modified RNA nanoparticles were resistant to degradation in cell culture medium with 10% serum even after 36 hours of incubation, while the unmodified RNA degraded within 10 minutes (data not shown).

Construction of a variety of 3WJ-pRNA candidate therapeutic nanoparticles using the

3WJ domain as a scaffold

Multi-module RNA nanoparticles were constructed using this 3WJ-pRNA domain as a scaffold (Fig. 3.2A&B). Each branch of the 3WJ carried one RNA module with defined functionality, such as a cell receptor binding ligand, aptamer, siRNA, ribozyme. Making fusion complexes of DNA or RNA is not difficult, but ensuring the appropriate folding of individual modules within the complex after fusion is not a simple task. The presence of the modules or therapeutic moieties did not interfere with the formation of the 3WJ domain, as demonstrated by

AFM imaging (Fig. 3.2C). To test whether the incorporated RNA moieties retain their original folding and functionality after being fused and incorporated, Hepatitis B virus (HBV) cleaving ribozyme 198 , survivin siRNA, FA, and MG (Malachite Green dye, triphenylmethane) binding aptamer 244, 245 were used as model systems for structure and function verification.

Retention of catalytic activity of the ribozyme incorporated in the 3WJ nanoparticles: It was found that the HBV ribozyme was able to cleave its RNA substrate after being incorporated into the nanoparticles. The pRNA 3WJ or 5S rRNA 3WJ based nanoparticle harboring HBV ribozyme was able to cleave 135nt HBV RNA genome substrates into two fragments (60nt and

75nt) shown as the faster migration bands in the denature PAGE (Fig. 3.2D&E). The HBV ribozyme maintain the similar cleavage efficiency as optimized positive control indicated the correct folding within the RNA complex.

72 Retention of fluorescence emitting activity of the MG-binding aptamer incorporated in the

3WJ nanoparticles: MG binding aptamer was used as the model system to assay the folding and

function of the incorporated moieties into 3WJ scaffold. The free MG is not fluorescent by itself,

but emits fluorescent light after binding to the aptamer. Fused MG-binding aptamer retained its

capacity to bind MG, as revealed by its fluorescence emission (Fig. 3.2 F&G). The activity results are comparable to optimized positive controls and therefore confirm that individual RNA modules fused into the nanoparticles retained their original folding after incorporation into the

RNA nanoparticles.

Cell binding and entry using the 3WJ-pRNA candidate therapeutic nanoparticles in cell

culture: Many kinds of cancer cell lines, especially from the epithelial origin overexpress the

folate receptor on the surface elevated by thousand fold. Folate has been used extensively as a

cancer cell delivery agent via folate receptor-mediated endocytosis 250, 251. The 2’-F U/C

modified fluorescent 3WJ-pRNA nanoparticles with folate conjugated into one of the branches

of the RNA complex were tested for its cell binding efficiency. One RNA fragment of 3WJ-

pRNA core was labeled with the folic acid for targeted delivery 197, the second fragment was

labeled with Cy3, and the third fragment was fused to the siRNA that can silence the gene of the

anti-apoptotic factor, survivin 252-256. As a negative control, the RNA nanoparticles contained

folate and siRNA with a scramble sequence (no sequence identity with any human gene) to

replace the active gene silencing sequence; or 3WJ-pRNA core containing the active siRNA, but without folate. Flow cytometry data revealed that the folate labeled 3WJ-pRNA nanoparticles bound and loaded its siRNA to the cell with almost 100% binding efficiency (Fig. 3.3A).

Confocal imaging indicated a strong binding of the RNA nanoparticles and efficient entry into

73 the targeted cells, as demonstrated by the excellent co-localization and overlap of the fluorescent

3WJ-pRNA nanoparticles (red) and cytoplasma (green) (Fig. 3.3B).

Assay for the targeted gene silencing by 3WJ-RNA in cancer cell model: Two 3WJ-RNAs were constructed for assaying the subsequent gene silencing effects. One of the 3WJ-RNA harbors folate and survivin siRNA [3WJ-pRNA-siSur-rZ-FA], while the other construct harbors folate and Survivin siRNA scramble control [3WJ-pRNA-siScram-Rz-FA]. After 48hrs transfection, both qRT-PCR and Western Blot assays confirmed reduced survivin gene expression level of 3WJ-pRNA-siSur-rZ-FA compared to the scramble control on both mRNA and protein levels. In addition, the silencing potency is comparable to the positive Survivin siRNA only control (Fig. 3.3 C&D).

Properties of pRNA- 3WJ derived pRNA-X shaped motif

The pRNA-X motif was constructed by (1) opening the right-hand loop of pRNA to insert

9 base pairs, thereby forming a double helical segment (Helix H2), and (2) extending the H3 helix by 4 base pairs (Fig. 3.1D). The helices H1 and H4 are identical to the pRNA-3WJ core, while the additional bases in the pRNA-X core are marked in red in Fig. 3.1C.

The pRNA-X motif was assembled by mixing four RNA oligos, denoted a, b, c, and d in equal molar ratio at room temperature efficiently without metal ion. As a candidate therapeutic

RNA nanoparticle, the core remained stable in 8M urea, had TM of 62.7 ± 3.2°C, and showed no signs of dissociation upon serial dilution of the pRNA-X nanoparticles (data not shown), which prove the stability properties of the pRNA-X nanoparticles as pRNA 3WJ core. AFM images confirmed the formation of larger RNA complexes with four-branches (data not shown).

74 Construction of a variety of therapeutic RNA nanoparticles using the X-motif as scaffold

Tetravalent RNA nanoparticles were constructed using the pRNA-X motif as a scaffold by

incorporating four functional modules, MG binding aptamer, Luciferase siRNA (siLuci),

Survivin siRNA (siSurv) and Folate (FA) (Fig. 3.4A), denoted [pRNA-X/MG/FA/siLuci/siSurv]

or corresponding scramble siRNA control. The presence of the functional moieties did not

interfere with the formation of the pRNA-X core and the tetravalent complex assembles with

high affinity (Fig. 3.4B). The purified constructs (Lane 9, Fig 3.4B) were stable in absence of

magnesium and remained intact under strongly denaturing conditions, even after the

incorporation of functionalities. In the next sections we evaluated whether the incorporated RNA

moieties retain their original folding and functionalities.

Assessment of MG fluorescence: MG binding aptamer 245 was used as model system for

structure and function verification. Free MG is not fluorescent by itself, but emits fluorescent

light after binding to the aptamer. Fused MG-binding aptamer retained its capacity to bind MG,

as revealed by its fluorescence emission (Fig. 3.4C). The fluorescence is comparable to

optimized positive controls and therefore confirmed that the MG aptamer assembled from two

strands of the pRNA-X after incorporation into the RNA nanoparticles.

Targeted gene silencing assay in cancer cell model: Two pRNA-X nanoparticles were

constructed for assaying the gene silencing effects harboring: (1) Folate and Survivin siRNA

[pRNA-X/MG/FA/siLuci/siSurv]; (2) FA and Survivin siRNA scramble control [pRNA-

X/MG/FA/siLuci/siSurv Scram]. After 48hrs transfection, both reverse transcription-PCR (RT-

PCR) assayed on mRNA level and western blot assayed on protein expression confirmed reduced survivin gene expression level of [pRNA-X/MG/FA/siLuci/siSurv] nanoparticles compared to the scramble control (Fig. 3.4D).

75 Targeted gene silencing of Luciferase: Dual-Luciferase reporter system was used to quantitatively measure the gene silencing effects of the pRNA-X constructs harboring the siRNA functionality targeting firefly luciferase gene 257 (Fig. 3.4A). The relative luciferase activity was used to reflect the expression level of firefly luciferase gene by normalizing the firefly luciferase activity with the internal control, renilla luciferase activity. The results indicated that [pRNA-

X/MG/FA/siLuci/siSurv] nanoparticles displayed ~70% decrease in firefly luciferase gene expression (Fig. 3.4E).

Cell binding and entry of 4WJ-pRNA nanoparticles: Folate was incorporated in the pRNA-

X nanoparticles to serve as cancer cell delivery agent via folate receptor-mediated endocytosis

197, 230, 251. Fluorescent pRNA-X nanoparticles with folate conjugated into one of the branches of the pRNA-X complex were tested for its cell binding efficiency. pRNA-X harboring FA and Cy3 labels [Cy3-pRNA-X/MG/FA/siLuci/siSurv] served as the test sample, while the negative control harbored NH2 and Cy3 label [Cy3-pRNA-X/MG/NH2/siLuci/siSurv]. Flow cytometry data revealed that the folate labeled pRNA-X nanoparticles bound and loaded its siRNA to the cell with ~85% binding efficiency (Fig. 3.5A). Confocal imaging indicated a strong binding of the RNA nanoparticles and efficient entry into the targeted cells, as demonstrated by the excellent co-localization and overlap of the fluorescent pRNA-X nanoparticles (red) and cytoplasm (green) (Fig. 3.5B).

Gene silencing effects were progressively enhanced as the number of siRNA in each pRNA-

X nanoparticles increased gradually from one, two three to four.

Tetravalent pRNA-X complexes were constructed harboring multiple luciferase siRNAs to assay for enhanced gene silencing effects. Dual-Luciferase reporter system was used to

76 quantitatively measure the gene silencing effects. For all the constructs, the total concentration of

RNA was kept constant at 1.25 nM. The target sites on the luciferase gene for the four siRNAs

(Fig. 3.6A) was located at 153-173, 196-216, 498-518, and 846-869 positions, as published in

the literature 246, 247. The incorporation of four identical siRNA sequences compromised the

assembly of the X-motif due to self-folding of the complementary sequences of the respective

siRNAs. To facilitate the assembly, the siRNA sequences were reversed (denoted with a prime,

such as siLuci-1') at alternate helical branch locations. The reversed sequences has no impact on

the functionality of the siRNA.

Silencing effects with increasing number of different Luciferase siRNA: As the number of

different luciferase siRNAs were gradually increased in the pRNA-X motif, progressive increase

in silencing effects were observed as follows, ~25% (for 1 siRNA), 57% (for 2 siRNA), 72%

(for 3 siRNA), and 81% (for 4 siRNA) (Fig. 3.6B).

Silencing effects of four identical luciferase siRNAs: Significant silencing effects were

observed in presence of four identical siRNAs fused to the pRNA-X motif, compared to a single

siRNA as follows, ~74% (for four siLuciferase-1), ~90% (for four siLuciferase-2), ~80% (for four siLuciferase-3), and ~72% (for four siLuciferase-4) (Fig. 3.6C). For comparison, we constructed the X-motif harboring a single siRNA (either siLuciferase -1 or 2 or 3 or 4) at helical locations H1 or H2 or H3 or H4, respectively (Fig. 3.7A-D). The silencing effects of the four

different siRNAs increased following the trend, siLuciferase-2> siLuciferase-1 ≈ siLuciferase-

4 > siLuciferase-3. The functionality of the siRNA was comparable at each of the arm of the X-

motif. The data demonstrated that greatly enhanced effects were observed in presence of four

identical siRNAs compared to a single siRNA (Fig. 3.7A-D).

77 CONCLUSION AND DISCUSSION

We demonstrated that the 3WJ core and its derived X-shaped motif of bacteriophage phi29

motor pRNA can be engineered to carry three or four functional modules in the absence of metal

ions. The resulting nanoparticles were thermodynamically stable, resistant to RNase degradation,

resistant to dissociation under strongly denaturing conditions or at ultra-low concentrations. As

candidate therapeutic RNA nanodelivery platform, the pRNA 3WJ motif with three branches and

its derived pRNA-X constructs with four branches harboring multi-module functionalities have

to remain intact after systemic delivery, where it will exist at ultra low concentrations due to

dilution by circulating blood, and also, while injecting into blood circulation system, the RNA

will face very complicated environment such as viable metal ion concentration and presented

RNase everywhere. Thus, an ideal delivery platform should be a metal ion independent and

chemically stable to resistant RNase degradation and thermodynamically stable to maintain

intact structure at quite diluted condition. The pRNA 3WJ core and its derived X-shaped motif

possess all these features which ensure the feasibility of in vivo application of RNA nanoparticles.

Incubation of RNA oligos representing therapeutic functional motifs including siRNA, receptor binding aptamer, ribozyme or folate resulted in the self-assembly of trivalent or tetravalent RNA nanoparticles as potential therapeutic agents. All the incorporated functional modules well retained their correct folding and compatible functions indicated the structure and function independency of the functional modules after fusion with 3WJ core or its derived X- pRNA motif. As the delivery platform and scaffold, the maintenance of structural and functional integrity of the delivered cargo is a crucial standard for evaluation a delivery system.

Furthermore, progressive enhancement of gene silencing effects was observed when the number of siRNA in each X-pRNA nanoparticles increased from one to two, three and four. As

78 polyvalent delivery systems, the 3WJ based and X motif based nanoparticles can achieve co- delivery of multiple copies of siRNA targeting to the same gene or different genes within the same signal transduction pathway, and meanwhile, multiple copies of deliver molecules can be also co-delivered to enhance the recognition, entry of RNA nanoparticles into specific targets. A wide range of therapeutic RNA molecules targeting cancer and viral infected cells can potentially be fused to the polyvalent pRNA 3WJ or pRNA-X motifs for the enhanced therapeutic effects.

Figure 3.1 Sequence and secondary structure of phi29 DNA-packaging RNA. (A) Illustration of the phi29 packaging motor geared by six pRNAs (cyan, purple, green, pink, blue and orange structures). (B) Sequence of pRNA monomer Green box: central 3WJ domain. In pRNA Ab′, A and b′ represent right- and left-hand loops, respectively. (C) 3WJ domain composed of three

RNA oligomers in black, red and blue. Helical segments are represented as H1, H2, H3. (D) The core of the pRNA-X domain composed of four RNA oligos (a, b, c, and d). Helical segments are represented as H1, H2, H3 and H4. The additional bases used to construct the pRNA-X motif in helices H2 and H3 are marked in red.

Figure legend on next page

Figure 3.2 Construction of multi-module RNA nanoparticles harboring siRNA, ribozyme and aptamer. (A-C), Assembly of RNA nanoparticles with functionalities using 3WJ-pRNA and

3WJ-5S rRNA as scaffolds. a–c, Illustration (A), 8% native (upper) and denaturing (lower)

PAGE gel (B) and AFM images (C) of 3WJ-pRNA-siSur-Rz-FA nanoparticles. D,E, Assessing the catalytic activity of the HBV ribozyme incorporated into the 3WJ-pRNA (D) and 3WJ-5S rRNA (E) cores, evaluated in 10% 8 M urea PAGE. The cleaved RNA product is boxed. Positive control: pRNA/HBV-Rz; negative control: 3WJ-RNA/siSur-MG-FA. F,G, Functional assay of the MG aptamer incorporated in RNA nanoparticles using the 3WJ-pRNA (F) and 3WJ-5S rRNA (G) cores. MG fluorescence was measured using excitation wavelengths of 475 and 615 nm.

Figure legend on next page

Figure 3.3 In vitro binding and entry of 3WJ-pRNA nanoparticles into targeted cells and target gene knock-down effects. (A) Flow cytometry revealed the binding and specific entry of fluorescent-[3WJ-pRNA-siSur-Rz-FA] nanoparticles into folate-receptor-positive (FA) cells.

Positive and negative controls were Cy3-FA-DNA and Cy3-[3WJ-pRNA-siSur-Rz-NH2]

(without FA), respectively. (B) Confocal images showed targeting of FAt-KB cells by co- localization (overlap, 4) of cytoplasm (green, 1) and RNA nanoparticles (red, 2) (magnified, bottom panel). Blue–nuclei, 3. (C) qRT–PCR with GADPH as endogenous control and (D) western blot assay with b-actin as endogenous control.

Figure legend on next page

Figure 3.4 Construction of multi-module RNA nanoparticles harboring MG (malachite green)

aptamer, Folate, Luciferase siRNA, and Survivin siRNA. (A) Schematic and sequences of the

tetravalent pRNA-X constructs. (B) Step-wise assembly of RNA nanoparticles using the pRNA-

X as scaffold with functionalities assayed by 8% denaturing PAGE. (C) Functional assay of the

MG aptamer incorporated in pRNA-X nanoparticles. MG fluorescence was measured using excitation wavelengths 475 and 615nm. (D) Target Gene Knock-down effects of Survivin siRNA showed by RT-PCR (GADPH is the endogenous control) on mRNA level and Western Blot assay (β–actin bands served as loading control) on protein level. (E) Dual-luciferase assay for target gene knock-down of luciferase gene. The relative firefly luciferase activity reflects the level of luciferase gene expression and is obtained by normalizing firefly luciferase activity using the internal control renilla luciferase activity. Error bars represent s.d. (N = 3).

Figure 3.5 Binding and entry of tetravalent pRNA-X nanoparticles into targeted cells. (A) Flow cytometry revealed that [pRNA-X/MG/FA/siLuci/siSurv] nanoparticles bound and specifically entered cells. Positive and negative controls were Cy3-FA-DNA and Cy3[pRNA-X/MG/

NH2/siLuci/siSurv] (without FA), respectively. (B) Confocal images showed targeting of Folate

positive (FA+) KB cancer cells by the co-localization (overlap, 4) of cytoplasm (green, 1) and

fluorescent RNA nanoparticles (red, 2) (magnified, right panel). Blue represents nuclei, 3.

Figure legend on next page

Figure 3.6: Construction of tetravalent pRNA-X nanoparticles harboring multiple siRNA for enhanced gene silencing effects. (A) Sequences and notations of siRNA used in tetravalent constructs. Blue: siLuci-1 and 1'; Red: siLuci-2 and 2'; Green: siLuci-3 and 3'; Orange: siLuci-4 and 4'; Black: Control siRNA 247. (B-C) Quantification of Luciferase gene expression: Effects of

increasing number of different Luciferase siRNAs (siLuci-1, 2, 3 and 4) (A); and four identical

siRNA constructs (siLuci-1, 2, 3 or 4) incorporated in the pRNA-X motif (B). RLU: Relative

Luciferase Units; siLuci-1', 2' 3' and 4' represent reversed siRNA sequences for siLuci-1, 2, 3 and

4 respectively. Error bars represent s.d. (N = 3).

Figure legend on next page

Figure 3.7: Comparison of gene silencing effects for a single vs. multiple siRNAs incorporated

in the pRNA-X motif. (A-D) Four identical siRNA (siLuci-1, A; siLuci-2, B; siLuci-3, C; siLuci-

4, D) compared with a single siRNA harbored at each pRNA-X motif arm; RLU: Relative

Luciferase Units; siLuci-1', 2' 3' and 4' represent reversed siRNA sequences for siLuci-1, 2, 3 and

4 respectively. Error bars represent s.d. (N = 3).

CHAPTER 3. Develop Novel pRNA Nano-delivery System Based on

Different Mechanisms

PART II. Design of Novel pRNA Nanoparticles Based on reengineered pRNA loop-loop interaction to construct self-assembled and

polyvalent pRNA nanoparticles.

92 INTRODUCTION

Research in nanotechnology involves modification, engineering, and/or assembly of

organized materials on the nanometer scale 3, 4. RNA molecules can be designed and manipulated

at a level of simplicity characteristic to DNA 109, 149, while possessing the versatility in structure,

function, and even enzymatic activity similar to that of proteins. This property makes RNA a

suitable candidate for nanotechnological applications. Likewise, RNA nanoparticles can be

easily constructed using a bottom-up approach 108, 151.

pRNA is one crucial component of bacteriophage phi29 DNA packaging motor (Fig.3.8A).

pRNA contains two domains and two interlocking loops (Fig. 3.8B). One pRNA domain (bases

23-97 at the central region) is for intermolecular interaction 237, 240, 242, 258. Formation of the

pRNA polyvalent nanoparticles relies on the interactions of the interlocking left and right hand

loops. pRNA has a strong tendency to form circular rings by hand-in-hand interaction on portal

connector protein to gear the DNA packaging motor (Fig.3.8A) 147, 148, 259. The property of the

interaction of the interlocking loops has been explored for the construction of pRNA dimer and

trimer by re-engineering of the two loops 237. The assembly of pRNA dimer and trimer is template independent and the efficient formation of pRNA dimer and trimer can be achieved by mixing each subunit in equal molar ratio in the presence of Mg2+. However, the pRNA dimers

and trimers has dissociation problem as described at the previous chapter, and the formation of

higher ordered pRNA polyvalent nanoparticles is template dependent. For example, the pRNA

hexamer assembly requires the prohead serving as the scaffold. The pRNA inter-locking loops

are the potential elements for building of RNA nanostructure and assembly of RNA nanoparticles. Thus, we proposed to extend pRNA loop sequences from 4-nt interlocking

interaction to 7-nt interlocking interaction (Fig. 3.8C). We will try to utilize these loop-extended

93 pRNAs to design and construct pRNA hexameric ring. If successful assembled, this ring

structure will serve as the scaffold to deliver siRNA and other functionalities. The stronger loop-

loop interaction and tool-like assembly strategies also help pRNA forming higher ordered novel

nanostructrues such as tetramer, pentamer, hexamer and heptamer without template support.

The second domain of pRNA, at the 5’/3’ paired ends, plays a key role in the binding of

DNA packaging enzyme gp16 during phi29 DNA packaging223, 260. Removal of this domain does

not affect the nature of the pRNA intermolecular interactions, and replacement or insertion of

nucleotides before residue #23 or after residue #97 does not interfere with its ability to form

dimers and trimers 107, 198, 237. The 5’/3’ proximate double-stranded helical end 261 of pRNA could serve to carry a therapeutic RNA moiety 138, 262-264. We will use loop-extended pRNA hexamer as

the model system to study the folding and appropriate function of six inserted function modules.

The inserted functional modules including 1) siRNA targeting firefly luciferase gene 246, 247, 2)

anti-HBV ribozyme which can specifically recognize HBV genome sequences and catalyze the

cleavage of the HBV genome by a hammer headed catalytic core 198, 3) MG binding aptamer

(free MG is not fluorescent by itself, but emits fluorescent light after binding to the aptamer ) 245,

4) fluorescent labeling (Cy3) or radioisotope labeling ([3H]), 5) streptavidin (STV) binding aptamer 265, and 6) receptor binding ligands, such as folate.

MATERIALS AND METHODS

Nomenclature

Following the pRNA nomenclature, a particular R-loop (upper loop) sequence is assigned

an upper case letter (i.e., A, B, ..), and a particular L-loop (lower loop) sequence is assigned a

lower case letter with a prime (i.e., a’, b’, ..). The same set of letters (i.e., Aa’) designates

complementary sequences in the R/L loop, while different letters indicate lack of sequence

94 complementarities. In order to distinguish with the wild pRNA, a number 7 was added before the letters indicated that the loop-loop interaction sequences were extended from 4bp to 7bp (i.e.

7Aa’). The loop extended pRNA assigned with same set of letters (i.e. 7Aa’) is in self-dimer format at native condition, so called “homo-dimer”. The loop extended pRNA assigned with different set of letters (i.e. 7Ab’) is in monomer format at native condition, so called “hetero- monomer” which require other partner subunits to form higher ordered pRNA polyvalent nanoparticles. “Hetero-dimer” is refer to pRNA dimers formed by two hetero-monomers such as

7Ab’-7Ba’.

The loop extended pRNA with functionalities will be name as 7Xx’-name of functional group. 7Ba’-FA indicated that the pRNA Ba’ harboring folate, 7Cb’-siRNA (firefly luciferase) indicated that the pRNA 7Cb’ harboring siRNA targeting firefly luciferase gene, and 7Dc’-

[3H]/Cy3 indicated the pRNA was [3H] or Cy3 labeled. Same for 7Ed’-HBV ribozyme, 7Fe’-

MG apt, and 7Af’-STV apt, which means pRNA harboring HBV cleaving ribozyme, MG binding aptamer, and STV binding aptamer, respectively.

In vitro synthesis and purification of pRNA with re-engineered loop sequences

The pRNA were synthesis by enzymatic methods as described previously 223. Short DNA and RNA oligos were synthesized chemically by IDT (Iowa).

The homo-dimers and hetero-monomers of pRNA were transcribed from DNA template generated by PCR following sequences in Tab 3.1

Table 3.1 Sequence of loop extended pRNA homo-dimers and hetero-monomers

name RNA sequence (5’→ 3’)

7Aa’ GGAAUGGUACGGUACUUCCAUUGUCAUGUGUAUGUUGGGGAUUAAGUGGACCUGAUUGAGUU Ho CAGCCCACAUACUUUGUUGAUUGUCCACUGUCAAUCAUGGCAAAAGUGCACGCUACUUUCC

95 GGAAUGGUACGGUACUUCCAUUGUCAUGUGUAUGUUGGGGAUUAACAGGCACUGAUUGAGUU 7Bb’ CAGCCCACAUACUUUGUUGAUUUGCCUGUGUCAAUCAUGGCAAAAGUGCACGCUACUUUCC

GGAAUGGUACGGUACUUCCAUUGUCAUGUGUAUGUUGGGGAUUAGCGUUCUCUGAUUGAGUU 7Cc’ CAGCCCACAUACUUUGUUGAUUAGAACGCGUCAAUCAUGGCAAAAGUGCACGCUACUUUCC

GGAAUGGUACGGUACUUCCAUUGUCAUGUGUAUGUUGGGGAUUAAGGCUAGCUGAUUGAGUU 7Dd’ CAGCCCACAUACUUUGUUGAUUCUAGCCUGUCAAUCAUGGCAAAAGUGCACGCUACUUUCC

GGAAUGGUACGGUACUUCCAUUGUCAUGUGUAUGUUGGGGAUUAAGCACCACUGAUUGAGUU 7Ee’ CAGCCCACAUACUUUGUUGAUUUGGUGCUGUCAAUCAUGGCAAAAGUGCACGCUACUUUCC

GGAAUGGUACGGUACUUCCAUUGUCAUGUGUAUGUUGGGGAUUAAGACGUGCUGAUUGAGUU 7Ff’ CAGCCCACAUACUUUGUUGAUUCACGUCUGUCAAUCAUGGCAAAAGUGCACGCUACUUUCC

GGAAUGGUACGGUACUUCCAUUGUCAUGUGUAUGUUGGGGAUUACACUAUCCUGAUUGAGUU 7Gg’ CAGCCCACAUACUUUGUUGAUUGAUAGUGGUCAAUCAUGGCAAAAGUGCACGCUACUUUCC

GGAAUGGUACGGUACUUCCAUUGUCAUGUGUAUGUUGGGGAUUAAGGCAGCCUGAUUGAGUU 7Hh’ CAGCCCACAUACUUUGUUGAUUGCUGCCUGUCAAUCAUGGCAAAAGUGCACGCUACUUUCC

GGAAUGGUACGGUACUUCCAUUGUCAUGUGUAUGUUGGGGAUUAAGCCUGCCUGAUUGAGUU 7Ii’ CAGCCCACAUACUUUGUUGAUUGCAGGCUGUCAAUCAUGGCAAAAGUGCACGCUACUUUCC

GGAAUGGUACGGUACUUCCAUUGUCAUGUGUAUGUUGGGGAUUAACAGGCACUGAUUGAGUU 7Ba’ CAGCCCACAUACUUUGUUGAUUGUCCACUGUCAAUCAUGGCAAAAGUGCACGCUACUUUCC

GGAAUGGUACGGUACUUCCAUUGUCAUGUGUAUGUUGGGGAUUAGCGUUCUCUGAUUGAGUU 7Cb’ CAGCCCACAUACUUUGUUGAUUUGCCUGUGUCAAUCAUGGCAAAAGUGCACGCUACUUUCC

GGAAUGGUACGGUACUUCCAUUGUCAUGUGUAUGUUGGGGAUUAAGGCUAGCUGAUUGAGUU 7Dc’ CAGCCCACAUACUUUGUUGAUUAGAACGCGUCAAUCAUGGCAAAAGUGCACGCUACUUUCC

GGAAUGGUACGGUACUUCCAUUGUCAUGUGUAUGUUGGGGAUUAAGCACCACUGAUUGAGUU 7Ed’ CAGCCCACAUACUUUGUUGAUUCUAGCCUGUCAAUCAUGGCAAAAGUGCACGCUACUUUCC

Hetero-monomers Hetero-monomers GGAAUGGUACGGUACUUCCAUUGUCAUGUGUAUGUUGGGGAUUAAGACGUGCUGAUUGAGUU 7Fe’ CAGCCCACAUACUUUGUUGAUUUGGUGCUGUCAAUCAUGGCAAAAGUGCACGCUACUUUCC

GGAAUGGUACGGUACUUCCAUUGUCAUGUGUAUGUUGGGGAUUAAGUGGACCUGAUUGAGUU 7Af’ CAGCCCACAUACUUUGUUGAUUCACGUCUGUCAAUCAUGGCAAAAGUGCACGCUACUUUCC

GGAAUGGUACGGUACUUCCAUUGUCAUGUGUAUGUUGGGGAUUAAGUGGACCUGAUUGAGUU 7Ab’ CAGCCCACAUACUUUGUUGAUUUGCCUGUGUCAAUCAUGGCAAAAGUGCACGCUACUUUCC

GGAAUGGUACGGUACUUCCAUUGUCAUGUGUAUGUUGGGGAUUAAGUGGACCUGAUUGAGUU 7Ac’ CAGCCCACAUACUUUGUUGAUUAGAACGCGUCAAUCAUGGCAAAAGUGCACGCUACUUUCC

GGAAUGGUACGGUACUUCCAUUGUCAUGUGUAUGUUGGGGAUUAAGUGGACCUGAUUGAGUU 7Ad’ CAGCCCACAUACUUUGUUGAUUCUAGCCUGUCAAUCAUGGCAAAAGUGCACGCUACUUUCC

GGAAUGGUACGGUACUUCCAUUGUCAUGUGUAUGUUGGGGAUUAAGACGUGCUGAUUGAGUU 7Fd’ CAGCCCACAUACUUUGUUGAUUCUAGCCUGUCAAUCAUGGCAAAAGUGCACGCUACUUUCC

GGAAUGGUACGGUACUUCCAUUGUCAUGUGUAUGUUGGGGAUUACACUAUCCUGAUUGAGUU 7Gf’ CAGCCCACAUACUUUGUUGAUUCACGUCUGUCAAUCAUGGCAAAAGUGCACGCUACUUUCC

96 GGAAUGGUACGGUACUUCCAUUGUCAUGUGUAUGUUGGGGAUUAAGUGGACCUGAUUGAGUU 7Ag’ CAGCCCACAUACUUUGUUGAUUGAUAGUGGUCAAUCAUGGCAAAAGUGCACGCUACUUUCC

The function loop-extended pRNA hexamers were synthesized by in vitro transcription according to Table 3.2.

Table 3.2 Sequences of hexamer with six functionalities

name RNA sequence (5’→ 3’)

gGU CAU GUG UAU GUU GGG GAUUA ACAGGCA CUG AUU GAG UUC AGC CCA CAU ACU UUG UUG AUU GUCCACU GU CAA UCA UGGCCAUCCCGCGGCCAUGGCGGCCGGGAG 7Ba’-FA FA-DNA: FA/NH2-CTCCCGGCCGCCATGGCCGCGGGATGGCCATGATTGAC

siLuci:ggCUUACGCUGAGUACUUCGAaaUUGUCAUGUGUAUGUUGGGGAUUAGCGUUCUCUG AUUGAGUUCAGCCCACAUACUUUGUUGAUUUGCCUGUGUCAAUCAUGGaaUCGAAGUACUC AGCGUAAGuguu 7Cb’-siRNA siControl:gGUCGGUUUCGUGAAGGAGAaaUUGUCAUGUGUAUGUUGGGGAUUAGCGUUCUC UGAUUGAGUUCAGCCCACAUACUUUGUUGAUUUGCCUGUGUCAAUCAUGGaaGUCGGUUUC GUGAAGGAGAuu

GGAAUGGUACGGUACUUCCAUUGUCAUGUGUAUGUUGGGGAUUAAGGCUAGCUGAUUGA GUUCAGCCCACAUACUUUGUUGAUUAGAACGCGUCAAUCAUGGCAAAAGUGCACGCUACU UUCC

7Ed’-HBV aGUUGAUUCUAGCCUGUCAAUCAUGGCAAAAGUGCACGCUACUUUCCAAAACAAAUUCUU UACUG(Adisabled)AUGAGUCCGUGAGGACGAAACGGGUCAAAAGGAAUGGUACGGUACUUC ribozyme CAUUGUCAUGUGUAUGUUGGGGAUUAAGCACCACUGAUU GAGUUCAGCCCACAUAC

ggAUGGUAACGAAUGAU UGUCAUGUGUAUGUUGGGGAUUAAGACGUGCUGAUUGAGUUC 7Fe’-MG apt AGCCCACAUACUUUGUUGAUUUGGUGCUGUCAAUCAUGGCAAUCCGACAUc c aGUUGAUUCACGUCUGUCAAUCAUGGCAAcCGACCAGAAUCAUGCAAGUGCGUAAGAUAGU 7Af’-STV apt CGCGGGUCGgUUGUCAUGUGUAUGUUGGGGAUUAAGUGGACCUGAUUGAGUUCAGCCCAC AUAC

Label RNA with [3H] and Cy3

The fluorescent RNA subunit was obtained by using the Label IT® siRNA Tracker

Intracellular Localization Kit, Cy3™ (Mirus Bio LLC) to stain RNA chain after transcription.

The radioisotope labeled RNA was transcribed in vitro by adding [3H]-UTP (PerkinElmer) into the T7 transcription system 223 and the [3H]-UTP was incorporated into RNA chain during

97 transcription elongation. [3H] labeled RNA was purified by 8% 8M Urea PAGE to remove free nucleotides.

Assay pRNA polyvalent nanoparticles formation in native PAGE

Loop extended pRNA homo-dimers were incubation in TMS buffer at 37ºC for 1 hr and then the dimer formation was examined by 6% native PAGE running in TBM (89 mM Tris, 200 mM Boric Acid, 5 mM MgCl2, pH 7.6) buffer for 3~4 hrs at 4°C. The dimer formation was

visualized by ethidium bromide.

Higher ordered pRNA polyvalent nanoparticles formation was assay by mixing required

hetero-monomers at equal molar ratio and then incubating in TMS buffer at 37ºC for 1 hr (Dimer:

7Ab’-7Ba’; Trimer: 7Ba’-7Cb’-7Ac’; Tetramer: 7Ba’-7Cb’-7Dc’-7Ad’; Pentamer: 7Ba’-7Cb’-

7Dc’-7Fd’-7Af’; Hexamer: 7Ba’-7Cb’-7Dc’-7Ed’-7Fe’-7Af’; Heptamer: 7Ba’-7Cb’-7Dc’-7Ed’-

7Fe’-7Gf’-7Ag’), followed by 6% native PAGE running in TBM buffer for 3~4 hrs at 4°C. Each

polyvalent nanoparticles formation was visualized by ethidium bromide.

The formation of the foot-to-foot complexes were accomplished by extending 3’-end of

one loop extended pRNA hetero-monomers with palindrome sequence (5’ CGAUCG 3’). All the

RNA hetero-monomers required for assembling each polyvalent nanoparticles were mixed at

equal molar ratio and then incubating in TMS buffer at 37ºC for 1 hr and then analyzed by 4%

native PAGE in TBM running buffer, as specified in the Results Section. After running at 4°C

for 4~5 hrs, the RNA was visualized by ethidium bromide.

Hexamers harboring six different functional modules were assembled by mixing 7Ba’-FA,

7Cb’-siRNA (firefly luciferase), 7Dc’-[3H]/Cy3, 7Ed’-HBV ribozyme, 7Fe’-MG apt, and 7Af’-

STV apt in TMS buffer at 37ºC for 1 hr. The controls used for the assays are 7Ba’-NH2 without

98 FA conjugation, 7Cb’-siRNA (random sequences), 7Ed’- disabled HBV ribozyme, 7Fe’ without

MG binding aptamer, and 7Af’ with STV binding aptamer. The formation of hexamers was

assay on 6% native PAGE in TBM running buffer. After running at 4°C for 4~5 hrs, the RNA

was visualized by ethidium bromide.

AFM imaging

For all samples specially modified mica surfaces (APS mica) were used. The APS mica

was obtained by incubation of freshly cleaved mica in 167 nM 1-(3-aminopropyl) silatrane. The details of APS mica surface modification is described elsewhere 248, 249. The native PAGE

purified RNA samples were diluted with 1xTMS buffer to a final concentration of 3-5 nM. Then,

the droplet of samples (5-10uL) was immediately deposited on APS mica. After 2 min

incubation on the surface, excess samples were washed with DEPC treated water and dried under

a flow of Argon gas. AFM images in air were acquired using MultiMode AFM NanoScope IV

system (Veeco/Digital Instruments, Santa Barbara, CA) operating in tapping mode. Two type of

AFM probes were used for tapping mode imaging in air: (1) regular tapping Mode Silicon

Probes (Olympus from Asylum Research, Santa_Barbara, CA) with a spring constant of about 42

N/m and a resonant frequency between 300-320 kHz. (2) non-contact NSG01_DLC probes (K-

Tek Nanotechnology, Wilsonville, OR) with a spring constant of about 5.5 N/m and a resonance

frequency between 120-150 kHz.

Binding assay for the MG aptamer incorporated in the loop extended pRNA hexamer

Loop extended hexamer harboring MG binding aptamer or hexamer harboring different

copies of MG binding aptamer (100nM) 244, 245 was mixed with MG (2 µM) in binding buffer

99 containing 100 mM KCl, 5 mM MgCl2, and 10 mM HEPES (pH 7.4) and incubated at room

temperature for 30 mins. RNA hexamer without MG binding aptamer served as negative control.

The fluorescence intensity was measured using a fluorospectrometer (Horiba Jobin Yvon; SPEX

Fluolog-3), excited at 615nm (scanning from 625 to 800 nm for emission). The same samples

can also run into 6% native PAGE in TBM running buffer at 4°C for 3~4 hrs. After stain the gel

with 5~10 µM MG in binding buffer, the MG signal can be excited and imaged by Typhoon

FLA 7000 (GE healthcare) at Cy5 channel.

Binding assay for the STV binding aptamer incorporated in loop extended pRNA hexamer

The hexamer harboring STV binding aptamer was premixed and preassembled in binding

buffer (1×PBS with 10mM Mg2+) before incubation with streptavidin agarose resin (Thermo

Scientific) and 50uL streptavidin resin was equilibrated at room temperature, washed with

binding buffer, and spinned down at 500g for 1 min to remove supernant. The hexamer

harboring STV binding aptamer (total ~3.6ug) in binding buffer was added to incubate with

resin at room temperature for 1hr. Hexamer without STV binding aptamer served as the negative

control. After incubation, the resin was spinned down again and supernatant was removed to

another tube as “passing through”. 50uL binding buffer was added to wash the resin for 15 min

incubation × 6 times, and all the supernatant after each washing step was kept as “wash 1-6”.

Finally, RNA was eluted out by 5mM biotin which can competitively bind to the resin in binding buffer. Samples were run into the 6% native PAGE in TBM buffer, and visualized by

MG staining or ethidium bromide staining. Meanwhile, the [3H] counts of each sample were measured by liquid scintillation counter (Packard).

100 Activity assay for the HBV ribozyme incorporated in the loop extended pRNA hexamer

HBV ribozyme is an RNA enzyme that cleaves the genomic RNA of the Hepatitis B Virus genome 198. The HBV RNA substrate was fluorescent labeled by Cy3 (Mirus) and incubated with the pRNA monomer or hexamer harboring HBV ribozyme (1:2 and 1:4 molar ratio) at 37°C for 60 mins in a buffer containing 20 mM MgCl2, 20 mM NaCl, and 50 mM Tris-HCl, pH 7.5, respectively. The pRNA/HBV ribozyme served as a positive control 198, and pRNA hexamer harboring a disabled HBV ribozyme was used as a negative control. The samples were then loaded on 8M urea/ 10% PAGE gel and scanned by Typhoon FLA 7000 (GE healthcare) at Cy3 channel.

Flow cytometry analysis of folate mediated cell binding

Hela cells[American Type Culture Collection (ATCC)] were maintained in folate-free

RPMI-1640 medium (Gibco), then trypsinized and rinsed with PBS (137 mM NaCl, 2.7 mM KCl,

100 mM Na2HPO4, 2 mM KH2PO4, pH 7.4). 500 nM Cy3 labeled pRNA hexamer harboring FA or hexamer harboring NH2 group were each incubated with 2 x 105 KB cells at 37°C for 1 hr.

After washing with PBS, the cells were resuspended in PBS buffer. Flow Cytometry (Beckman

Coulter) was used to observe the cell binding efficacy of the Cy3 RNA nanoparticles.

Assay for the silencing of luciferase genes in cancer cell model

Dual-luciferase assay was used to test the potential of the pRNA hexamer escorting siRNA delivered into cells. For dual-luciferase assays, Hela cells were seeded in 24-well plates. Gene silencing assays were performed by co-transfecting pRNA hexamers harboring different copies of firefly luciferase siRNA with both plasmid pGL-3 control and pRL-TK (Promega, Madison,

101 WI) coding for firefly and renilla luciferase, respectively. The latter served as an internal control

to normalize the luciferase data (Dual-Luciferase Reporter Assay System; Promega). Cells were

washed once with phosphate-buffered saline (PBS) and lysed with passive lysis buffer. The

plates were shaken for 15 minutes at room temperature. 20 μl of lysate were added to 50 μl of

luciferase assay reagent (LAR II) in 96-well white plate (Thermo Scientific) and firefly

luciferase activity was measured using Synergy 4 plate reader (Bioteck). Upon addition of 50 μl of Stop & Glo Reagent, control measurements of renilla luciferase activity were then obtained.

The data was then normalized with respect to the renilla activity for determining the average ratio of firefly to renilla activity over several trials.

The target firefly luciferase siRNAs was from literature 246, 247.

RESULTS

Design of loop extend pRNA for assembly of higher ordered pRNA nanoparticles

The loop extended pRNAs were constructed by replacing the 4-nt loop complementary

region in R- and L- loop with 7-nt sequences which were from designed sequences pool or

adapted from ref 266. Considering that altering nucleic acid sequences might affect the global

folding of RNA molecules, pRNA with re-engineered loop sequences was folded by online

RNA folding program Mfold (http://mfold.rna.albany.edu/?q=mfold/RNA-Folding-Form) 182.

There are total 9 pairs of loop sequences were selected out from the 7nt loop sequence pool with predicted correct folding (Fig. 3.9A). Then these loop extended pRNAs were synthesized by in vitro transcription for future test.

Assay the re-engineered loop-loop interaction via homo-dimer formation

102 Computation of loop-extended pRNA folding showed that 9 pairs of loop-loop interaction

are potentially available for assembly of pRNA nanoparticles. To confirm the correct folding of

the re-engineered pRNAs, 9 pRNA homo-dimers were synthesized to assay the loop-loop

interactions. pRNA homo-dimer is an excellent system to assay the loop-loop interaction since

the paired loop sequences are assigned to the R-loop and L-loop within the same pRNA. The

correct folded pRNA will form a self-dimer by its complementary R-/L-loop in the presence of

Mg2+, which will migrate to higher position compared to monomer in native PAGE. After

transcription, the 9 homo-dimers were refold in TMS at 37 ºC for 1 hr and load into 6% native

PAGE to assay the dimer formation. The results showed that 7 pairs of loop-loop sequences

were able to facilitate homo-dimer formation (Fig. 3.9B) and 2 pairs of loop-loop sequences

showed weak dimer formation indicating the misfolding of the pRNA structure after loop

sequence alteration. The dimer formation confirmed that 7 pairs of loop-loop sequences are

potential candidates for building up pRNA nano-scale assemblies.

Interestingly, besides dimer bands, there are several bands migrated higher than dimer position in the native PAGE. We further assayed these higher bands by comparing their migration position with known pRNA polyvalent nanoparticles migration position in native

PAGE. The wild-type pRNA homo-dimer Aa’ and hetero-dimer Ab’/Ba’, as well as loop extended pRNA homo-dimer 7Aa’ and hetero-dimer 7Ab’/7Ba’ were assembled in the presence of Mg2+ and loaded into native PAGE along with loop extended pRNA monomer, dimer, trimer,

tetramer, pentamer, and hexamer “ladders”. The results revealed the pRNA assembly pattern for

two aspects (Fig. 3.10): 1) For homo-dimers: the higher bands for wild-type pRNA are trimer

and structures between trimers and tetramers; and the higher bands for loop extended pRNA are

trimer and tetramer. For hetero-dimers: the higher bands for wild-type pRNA are weak tetramer;

103 and the higher bands for loop extended pRNA are tetramer and weak hexamer (?). The results

indicated that the dimers can served as the building blocks for continuous growing of higher

ordered structures. The pattern for homo-dimers to assemble higher ordered structures is homo-

dimer → trimer → tetramer → (pentamer? → hexamer?) and for hetero-dimers is hetero- monomer → hetero-dimer → tetramer (→ hexamer?). 2) The loop-extended pRNA showed much stronger higher bands than wild-type pRNA which might indicate that the 7-bp loop-loop interaction is stronger than wild-type 4-bp version of interlocking interaction. Therefore, the 7- bp loop-loop interaction is able to facilitate the continuous growing of the pRNA polyvalent nanoparticles and can help stabilizing the structures such as hexamers without template support.

Tool-like methods to assemble different pRNA nanoparticles

Via stronger loop-loop interaction, pRNA dimer (7Ab’-7Ba’), trimer (7Ba’-7Cb’-7Ac’), tetramer (7Ba’-7Cb’-7Dc’-7Ad’), pentamer (7Ba’-7Cb’-7Dc’-7Fd’-7Af’), hexamer (7Ba’-7Cb’-

7Dc’-7Ed’-7Fe’-7Af’), and heptamer (7Ba’-7Cb’-7Dc’-7Ed’-7Fe’-7Gf’-7Ag’ ) were assembled following a stepwise formation process (Fig. 3.11). The formation of each nanoparticle was confirmed by AFM imaging (Fig. 3.12).

By introducing 3’-end extension with palindrome sequences on one subunit during the pRNA polyvalent nanoparticles formation process. All the loop-extended pRNA dimer, trimer, tetramer, pentamer, hexamer, and heptamer can further assemble into foot-to-foot structures as

shown in Fig. 3.13.

By rational design and sequence manipulation, construction of different pRNA

nanoparticles via loop-loop interaction and palindrome sequence paring can serve as the tool-like

methods for pRNA nano-materials fabrication.

104

Assembly of loop extended pRNA hexamer

Hexamer formed by loop extended pRNA was used as the specific model system for the

following application studies.

Free MG is a triarylmethane dye and itself does not emit fluorescence. However, upon

binding with MG binding RNA aptamer, it will be excited by both 475nm and 615nm with a emission peak around 650nm. MG binding aptamer 245 was a good indicator for structure and

function verification.

pRNA hexamer is able to upload up to six copies of MG binding aptamer. We constructed

loop-extended pRNA fused with MG aptamer and assayed the stepwise hexamer assembly

process. Meanwhile, hexamers harboring different copies of the MG binding aptamer were also

assayed by native PAGE. We observed the increasing intensity of MG binding emitted fluorescence during the assembly of the hexamer process and we also observed the proportional increasing of the fluorescent intensity while increasing copies of MG binding aptamers were presented into the hexamer complex (Fig. 3.14A). The MG fluorescent intensity can also be

quantified by fluorometer (Fig. 3.14B). The results clearly revealed the assembly process of the

pRNA hexamer by stepwise increased MG fluorescent intensity. In addition, hexamer is able to

upload up to six copies of MG binding aptamer within one particle, which has the highest signal intensity compared with hexamers enclosed lower copy numbers or MG binding aptamer. This feature indicated the potential of using multivalency of hexamer to achieve better delivery efficacy and enhanced effects.

Assembly of loop extended pRNA hexamer harboring different functionalities

105 The loop extended pRNAs harboring 6 different functionalities (7Ba’-FA, 7Cb’-siRNA,

7Ed’-HBV ribozyme, 7Fe’-MG apt, and 7Af’-STV apt) were assembly in TMS buffer at 37ºC

for 1hr and purified by 6% native PAGE for functional assays. The functionalities include

detection modules such as [3H] and Cy3, therapeutic modules such as siRNA and ribozyme,

delivery ligands like folate, as well as purification module STV binding aptamer as well as

structure and function indicator MG binding aptamer (Fig. 3.15).

Assay the function of each incorporated functional modules within loop extended pRNA

hexamer

Assessment of MG fluorescence: MG binding aptamer 245 was used as model system for

structure and function verification. Fusing MG-binding aptamer into pRNA, no matter in monomeric format or in hexamer assemblies, retained its capacity to bind MG, as revealed by its

fluorescence emission on both gel and quantified by fluorometer (Fig. 3.16).

Assay the binding of hexamer to streptavidin resin: STV binding aptamer can bind to

streptavidin resin and can be competitively eluted out by excessive amount of biotin 265.

Hexamer harboring STV binding aptamer and hexamer without STV binding aptamer were incubated with streptavidin resin, respectively. The data showed that STV binding aptamer retain its correct folding and function after fusing with pRNA and further assembled into the hexamer complex. The hexamer harboring STV binding aptamer can bind to streptavidin resin and then eluted out by biotin (Fig. 3.17A), and hexamer without STV binding aptamer did not appear at elution fractions even by using more sensitive [3H] counting (Fig. 3.17B). In addition, the eluted hexamer still maintain the integrity of the structure and correct function as revealed by native

106 PAGE. The RNA bands with MG binding aptamer can be stained with MG and visualized at Cy5

channel (Fig. 3.17A).

Retention of catalytic activity of the ribozyme incorporated in pRNA hexamer: It was

found that the HBV ribozyme was able to cleave its RNA substrate after being incorporated into

nanoparticles. The pRNA-ribozyme alone or hexamers harboring HBV ribozyme was able to

cleave 135nt HBV RNA genome substrates into two fragments (60nt and 75nt) shown as the

faster migration bands in the denature PAGE (Fig. 3.18). The HBV ribozyme maintained the

similar cleavage efficiency as optimized positive control indicated the correct folding within the

hexamer complex.

Cell binding of hexamer particles harboring folate as the delivery ligand: Folate was incorporated in the pRNA hexameric nanoparticles to serve as cancer cell delivery agent via folate receptor-mediated endocytosis 197, 230, 251. Cy3 dye was also conjugated into another

hexamer subunit. The pRNA hexamer harboring FA and Cy3 labels [Cy3-FA-hexamer] served

as the test sample, while the negative control harbored NH2 and Cy3 label [Cy3-NH2-hexamer].

Flow cytometry data revealed that the folate labeled pRNA hexameric nanoparticles bound to the

cell with ~5.11% binding efficiency (Fig. 3.19). The experimental condition need to be further

optimized since the positive control only showed ~9.45% binding efficiency.

Targeted gene silencing of Luciferase: Dual-Luciferase reporter system was used to

quantitatively measure the gene silencing effects of pRNA hexamer construct harboring the

siRNA functionality targeting firefly luciferase gene 257. The relative luciferase activity was used to reflect the expression level of firefly luciferase gene by normalizing the firefly luciferase activity with the internal control, renilla luciferase activity. The results indicated that pRNA

107 hexamer harboring one firefly luciferase siRNA displayed ~70% decrease in firefly luciferase

gene expression (Fig. 3.20B).

Hexameric pRNA nanoparticles harboring multiple copies of luciferase siRNAs were

constructed to assay for enhanced gene silencing effects (Fig. 3.20A). Dual-Luciferase reporter

system was used to quantitatively measure the gene silencing effects. For all the constructs, the

total concentration of RNA was kept constant at 1.25 nM. The incorporation of six identical

siRNA sequences did not affect the folding of pRNA hexamers. As the number of different luciferase siRNAs were gradually reduced in the pRNA hexamer, progressive decreasing in

silencing effects was observed. The data demonstrated that greatly enhanced gene knock down

effects were observed in presence of multiple copies of identical siRNAs (2~6) compared to a

single siRNA (Fig. 3.20B).

CONCLUSION AND DISCUSSION

As the building block, phi29 pRNA can be engineered to harbor different functionalities for

diverse purpose, and then assembled into dimers and trimers through interlocking loop-loop interaction. However, we observed dissociation of dimeric and trimeric pRNA nanoparticles

which will affect the delivery efficacy (Fig. 2.6). In addition, assembly of higher ordered pRNA nanoparticles requires phage prohead served as template. In order to obtain more stable pRNA polyvalent nanoparticles and assembly template free pRNA nanoparticles, wild-type pRNA loop

sequences were extended from 4-nt to 7-nt and the re-engineered pRNAs have stronger interlocking interactions and are utilized as the building block for assembly of polyvalent pRNA nanoparticles.

The RNA primary sequence decides it global folding and alteration of the sequence might

change the folding properties completely. Therefore, the computational predication of the pRNA

108 folding after loop extension is highly desired. From about 30~40 pairs of loop sequences, there

are only 9 pairs of loop sequences replacement did not affect the pRNA folding structure. Later

experiments showed that 7 of 9 pairs are able to actually facilitate the homo-dimer formation and

used as the tool-like methods to construct varieties of pRNA nanoparticles. The RNA structure

computation fastens the sequences screening, reduces the work load, and increases the possibility

of obtained desired structures.

The loop extended pRNA are able to form dimer, trimer, tetramer, pentamer, hexamer, and

heptamer. 3’-end palindrome sequence in one assembly subunits promoted further formation of pRNA into foot-to-foot trimer (hexamer), foot-to-foot tetramer (octamer), foot-to-foot pentamer

(decamer), foot-to-foot hexamer (dodecamer), and foot-to-foot heptamer (fourteen subunits).

Two RNA structure motifs were applied for building up the nanoparticles: one is interlocking

loop-loop interaction and the other is end palindromic annealing. By rational design with the

known motifs, RNA nanoparticles can be self-assembled with controllable size, defined structure

and précised stoichiometry, which would be the key issue to ensure better biodistribution and

lower toxicity for future in vivo applications.

Making fusion complexes of DNA or RNA is not difficult, but ensuring the appropriate

folding of individual modules within the complex after fusion is not a simple task. Loop

extended pRNA hexamer was used as the model system to conjugate with six functional modules

and assay their function after incorporation. All the functional modules work well within the

hexamer complex except folate binding needs further investigation. The polyvalent RNA

nanoparticles can deliver up to six kinds of molecules to specific cells including therapeutics,

detection modules, purification modules, or structural and functional indicators. This particular

system provides unprecedented versatility in constructing polyvalent delivery vehicles since it is

109 based on a modular design. Hence, individual RNA subunits with various cargos can be

constructed separately and assembled into the final quaternary complex by mixing them together

in any desired combination.

Furthermore, progressive enhancement of gene silencing effects was observed when the

number of siRNA in each pRNA hexameric nanoparticles increased from one to six. As

polyvalent delivery system, pRNA hexamer based nanoparticles can achieve co-delivery of

multiple copies of siRNA targeting to the same gene or different genes within the same signal

transduction pathway, and meanwhile, multiple copies of deliver molecules can be also co-

delivered to enhance the recognition, entry of RNA nanoparticles into specific targets. A wide

range of therapeutic RNA molecules targeting cancer and viral infected cells can potentially be fused to the polyvalent pRNA hexameric nanoaparticles for the enhanced therapeutic effects.

110

Figure 3.8 The illustration of constructing loop extended pRNA. (A) Bacteriophage phi29 DNA packaging motor. Six copies of wild-type pRNAs assemble a hexamer ring on the connector portal to gear the viral DNA into the prohead. (B) The primary sequence and secondary structure of wild-type pRNA. (C) The extension region of the pRNA loop sequences (4-nt to 7-nt).

111

Figure 3.9 Assay homo-dimer formations of loop extended pRNAs by native PAGE. (A) The wild-type pRNA loop sequences were replaced by 9 pairs of extended loops and the folding of the new pRNAs were predicted by Mfold. (B) Assay dimer formations of 7Aa’, 7Bb’, 7Cc’,

7Dd’, 7Ee’, 7Ff’, and 7Gg’ (lane 1-7) by 6% TBM native PAGE. Highly ordered structure was formed as slower migration bands shown in the gel. M: monomer, D: dimer; L: DNA ladders.

112

Figure 3.10 Assay of pRNA homo-dimer and hetero-dimer assembly patterns by 6% native

PAGE.

113

Figure 3.11 Stepwise assembly of loop extended pRNA polyvalent nanoparticles. (A) Chart of loop extended pRNA hetero-monomers as the building block for assembly of pRNA polyvalent nanoparticles, 6% native PAGE showed the formation of (B) dimer; (C) trimer; (D) tetramer; (E) pentamer; (F) hexamer; and (G) heptamer.

114

Figure 3.12 AFM images of assembled pRNA nanoparticles.

115

Figure 3.13 Assay the formation of pRNA foot-to-foot assemblies via 3’- end palindrome sequences.

116

Figure 3.14 Formation of pRNA hexamer ring harboring MG binding aptamer as folding and function indicator. (A) Stepwise formation of pRNA hexamer ring harboring different copies of

MG binding aptamer (lane 1-6, stepwise formation of hexamer; lane 6-12: hexamer harboring decreasing numbers of MG binding aptamer). Gel was stained by both MG (left) and EB (right).

(B) Fluorescent intensity change upon assembly of hexamer and upon adding different copies of

MG binding aptamer.

117

Figure 3.15 Assay formation of pRNA hexamer ring harboring functionalities including folate, siRNA, [3H] or Cy3 labeling, HBV ribozyme, MG binding aptamer, and STV binding aptamer by 6% native PAGE .

118

Figure 3.16 Assay of MG binding aptamer function within the pRNA hexamer ring. (A) 6%

TBM native PAGE showed the correct folding of MG binding aptamer within pRNA hexamer complex. MG binding aptamer can be stained by MG and showed up in Cy5 emission channel.

(B) The fluorescent emission of the hexamer harboring MG binding aptamer (ex.=615nm).

119

Figure 3.17 Assay of STV binding aptamer function within the pRNA hexamer ring. (A) 6%

TBM native PAGE. Upper column: hexamer w/STV binding aptamer; lower column: hexamer w/o STV binding aptamer. (B) [3H] counting of sample fractions.

120

Figure3. 18 Assay HBV ribozyme catalytic function within the pRNA hexamer.

121

Figure 3.19 Assay cell binding of FA-pRNA hexamer by flow cytometry. Negative control is pRNA hexamer with NH2 group.

122

Figure 3.20 Assay of firefly luciferase siRNA function within pRNA hexamer ring. (A)

Assembly and purification of pRNA hexamers harboring different copies of firefly luciferase siRNA. 6% TBM native PAGE (M: monomer; D: dimer; T: trimer; T: tetramer; P: pentamer;

H1-7: hexamers harboring different copies of firefly luciferase siRNA). (B) Assay the target gene knock-down by Dual-luciferase assay.

123

CHAPTER 4. Application of pRNA Nanoparticles for Disease Treatment

124 Collaboration with Dr. John Rossi group

The potent ability of siRNA to inhibit the expression of complementary RNA transcripts is

being exploited as a new class of therapeutics for diseases including HIV. However, efficient delivery of siRNAs remains a key obstacle to successful application. A targeted intracellular delivery approach for siRNAs to specific cell types is highly desirable. HIV-1 infection is initiated by the interactions between viral glycoprotein gp120 and cell surface receptor CD4, leading to fusion of the viral membrane with the target cell membrane. Once HIV infects a cell it produces gp120 which is displayed at the cell surface. We previously described a novel dual inhibitory anti-gp120 aptamer-siRNA chimera in which both the aptamer and the siRNA portions have potent anti-HIV activities. We also demonstrated that gp120 can be used for aptamer mediated delivery of anti-HIV siRNAs. Here we report the design, construction and evaluation of chimerical RNA nanoparticles containing a HIV gp120-binding aptamer escorted by the pRNA of bacteriophage phi29 DNA-packaging motor. We demonstrate that pRNA-aptamer chimeras specifically bind to and are internalized into cells expressing HIV gp120. Moreover, the pRNA-aptamer chimeras alone also provide HIV inhibitory function by blocking viral infectivity. The Ab' pRNA-siRNA chimera with 2'-F modified pyrimidines in the sense strand not only improved the RNA stability in serum, but also was functionally processed by Dicer, resulting in specific target gene silencing. Therefore, this dual functional pRNA-aptamer not only represents a potential HIV-1 inhibitor, but also provides a cell-type specific siRNA delivery vehicle, showing promise for systemic anti-HIV therapy. This collaborated work was published on Methods, 2011, 54:284-94.

Collaboration with Dr. Shukmei Ho group

125 Ovarian cancer is a highly metastatic and lethal disease, making it imperative to find

treatments that target late-stage malignant tumors. The pRNA of bacteriophage phi29 DNA-

packaging motor has been reported to function as a highly versatile vehicle to carry siRNA for silencing of survivin. In this article, we explore the potential of pRNA as a vehicle to carry siRNA specifically targeted to metallothionein-IIa (MT-IIA) messenger RNA (mRNA), and

compare it to survivin targeting pRNA. These two anti-apoptotic cell survival factors promote

tumor cell viability, and are overexpressed in recurrent tumors. We find that pRNA chimeras

targeting MT-IIA are processed into double-stranded siRNA by dicer, are localized within the

GW/P-bodies, and are more potent than siRNA alone in silencing MT-IIA expression. Moreover,

knockdown of both survivin and MT-IIA expression simultaneously results in more potent

effects on cell proliferation in the aggressive ovarian tumor cell lines than either alone, suggesting that therapeutic approaches that target multiple genes are essential for molecular

therapy. The folate receptor-targeted delivery of siRNA by the folate-pRNA dimer emphasizes

the cancer cell-specific aspect of this system. The pRNA system, which has the capability to

assemble into polyvalent nanoparticles, has immense promise as a highly potent therapeutic

agent. This collaborated work is published on Molecular Therapy, 2011, 19:386-94.

Collaboration with Dr. Malak Kotb group

Dr. Kobt’s group found that leukemic cells utilize significantly higher levels of S-

adenosylmethionine (SAMe) than normal lymphocytes 267. Methionine adenosyltransferase-II

(MAT-II) catalyzes SAMe synthesis from ATP and l-Met. Knockdown of MAT-IIbeta subunit

expression in leukemic cell lines will reduce SAMe synthesis and induce apoptosis and diminish

leukemic cell growth but no harm to normal cells at physiological condition. This finding

126 suggested that it may be possible to silence MAT-IIbeta to reduce leukemic cell survival. We

explored the potential of pRNA as a vehicle to carry siRNA specifically targeted to MAT-IIbeta

messenger RNA (mRNA). The constructed pRNA/siRNA chimera showed efficient target gene

knock-down effects. Meanwhile, anti-CD4 RNA aptamer were used for receptor-targeted

delivery of siRNA into leukemic cells. The pRNA/CD4 aptamer showed strong binding and

internalization into CD4+ leukemic cell lines. Then the dimeric pRNA nanoparticles harboring

MAT-IIbeta siRNA and anti CD4 aptamer were incubated with Jurkat cells and showed

cytoplasm delivery of the pRNA nanoparticle and knockdown of targeted MAT-IIbeta genes.

Meanwhile, pRNA 3WJ-core was also used to construct nanoparticles contain anti-CD4 aptamer

for target delivery of MAT-IIbeta siRNA into leukemic cells. The manuscript is in preparation

for this collaboration work.

Collaboration with Dr. B. Mark Evers group

Colorectal cancer is the second leading cause of cancer-related deaths in the United States

268. Metastatic or recurrent disease is the most common cause of death in these patients. Despite

the development of various delivery carriers for siRNA, few successful cases have been reported

for treating metastatic tumors with systemically delivered siRNA. The goal of our collaborated

project is to evaluate RNA aptamer conjugated phi29 pRNA 3WJ nanoparticles for the selective delivery of siRNA into colorectal cancer liver metastases via epithelial cell adhesion molecule

(EpCAM, 97.7% expression in colon cancer cells) in vitro and in vivo. We tested several metastatic colorectal cancer (CRC) tumor cell lines for EpCAM expression and found that

HCT116 cells expressed high levels of EpCAM and exhibited specific binding and internalization of 3WJ-pRNA harboring EpCAM aptamer. 3WJ-pRNA nanoparticles that contain

127 both EpCAM binding aptamer and siRNAs against firefly luciferase was constructed for specific

gene silencing evaluation. Colon cells lines were stably transfected with the firefly luciferase

(Luc) vectors. We evaluated in vitro delivery of 3WJ-pRNA nanoparticle harboring both the

EpCAM binding aptamer and the siRNA (firefly luciferase) into EpCAM positive tumor cells with firefly luciferase expression. Next, we will evaluate the in vivo delivery of 3WJ-pRNA nanoparticle. Lastly, we will determine whether PI3K-specific 3WJ-pRNA nanoparticle suppresses protein expression and possesses therapeutic potential in colorectal cancer liver metastases.

128 BIBLIOGRAPHY

1. Ferrari,M. Cancer nanotechnology: opportunities and challenges. Nat Rev. Cancer 5, 161-171 (2005).

2. Jain,R.K. The next frontier of molecular medicine: delivery of therapeutics. Nat Med. 4, 655-657 (1998).

3. Niemeyer,C.M. The developments of semisynthetic DNA-protein conjugates. Trends Biotechnol. 20, 395-401 (2002).

4. Schmidt,O.G. & Eberl,K. Nanotechnology. Thin solid films roll up into nanotubes. Nature 410, 168 (2001).

5. Puri,A. et al. Lipid-based nanoparticles as pharmaceutical drug carriers: from concepts to clinic. Crit Rev. Ther. Drug Carrier Syst. 26, 523-580 (2009).

6. Lu,X.Y., Wu,D.C., Li,Z.J., & Chen,G.Q. Polymer nanoparticles. Prog. Mol. Biol. Transl. Sci. 104, 299-323 (2011).

7. Lehto,T. et al. A peptide-based vector for efficient gene transfer in vitro and in vivo. Mol. Ther. 19, 1457-1467 (2011).

8. Lehto,T., Ezzat,K., & Langel,U. Peptide nanoparticles for oligonucleotide delivery. Prog. Mol. Biol. Transl. Sci. 104, 397-426 (2011).

9. Ricart,A.D. Antibody-drug conjugates of calicheamicin derivative: gemtuzumab ozogamicin and inotuzumab ozogamicin. Clin. Cancer Res. 17, 6417-6427 (2011).

10. Pericleous,P. et al. Quantum dots hold promise for early cancer imaging and detection. Int. J. Cancer(2012).

11. Unak,G. et al. Gold nanoparticle probes: design and in vitro applications in cancer cell culture. Colloids Surf. B Biointerfaces. 90, 217-226 (2012).

12. Bangham,A.D., Standish,M.M., & Watkins,J.C. Diffusion of univalent ions across the lamellae of swollen phospholipids. J. Mol. Biol. 13, 238-252 (1965).

13. Smylie,M.G., Wong,R., Mihalcioiu,C., Lee,C., & Pouliot,J.F. A phase II, open label, monotherapy study of liposomal doxorubicin in patients with metastatic malignant melanoma. Invest New Drugs 25, 155-159 (2007).

14. Drummond,D.C., Meyer,O., Hong,K., Kirpotin,D.B., & Papahadjopoulos,D. Optimizing liposomes for delivery of chemotherapeutic agents to solid tumors. Pharmacol. Rev. 51, 691-743 (1999).

15. Andreopoulou,E. et al. Pegylated liposomal doxorubicin HCL (PLD; Caelyx/Doxil): experience with long-term maintenance in responding patients with recurrent epithelial ovarian cancer. Ann. Oncol. 18, 716-721 (2007).

129 16. Rodriguez,M.A. et al. Vincristine sulfate liposomes injection (Marqibo) in heavily pretreated patients with refractory aggressive non-Hodgkin lymphoma: report of the pivotal phase 2 study. Cancer 115, 3475-3482 (2009).

17. Fassas,A. & Anagnostopoulos,A. The use of liposomal daunorubicin (DaunoXome) in acute myeloid leukemia. Leuk. Lymphoma 46, 795-802 (2005).

18. Montier,T., Benvegnu,T., Jaffres,P.A., Yaouanc,J.J., & Lehn,P. Progress in cationic lipid- mediated gene transfection: a series of bio-inspired lipids as an example. Curr. Gene Ther. 8, 296-312 (2008).

19. Felgner,P.L. et al. Lipofection: a highly efficient, lipid-mediated DNA-transfection procedure. Proc. Natl. Acad. Sci. U. S. A 84, 7413-7417 (1987).

20. Allen,T.M. & Cullis,P.R. Drug delivery systems: entering the mainstream. Science 303, 1818- 1822 (2004).

21. Gregoriadis,G. Homing of liposomes to target cells. Biochem. Soc. Trans. 3, 613-618 (1975).

22. Torchilin,V. Antibody-modified liposomes for cancer chemotherapy. Expert. Opin. Drug Deliv. 5, 1003-1025 (2008).

23. Turk,M.J., Waters,D.J., & Low,P.S. Folate-conjugated liposomes preferentially target macrophages associated with ovarian carcinoma. Cancer Letters 213, 165-172 (2004).

24. Cressman,S., Dobson,I., Lee,J.B., Tam,Y.Y., & Cullis,P.R. Synthesis of a labeled RGD-lipid, its incorporation into liposomal nanoparticles, and their trafficking in cultured endothelial cells. Bioconjug. Chem. 20, 1404-1411 (2009).

25. Garde,S.V. et al. Binding and internalization of NGR-peptide-targeted liposomal doxorubicin (TVT-DOX) in CD13-expressing cells and its antitumor effects. Anticancer Drugs 18, 1189-1200 (2007).

26. Pangburn,T.O., Petersen,M.A., Waybrant,B., Adil,M.M., & Kokkoli,E. Peptide- and aptamer- functionalized nanovectors for targeted delivery of therapeutics. J. Biomech. Eng 131, 074005 (2009).

27. Beuttler,J., Rothdiener,M., Muller,D., Frejd,F.Y., & Kontermann,R.E. Targeting of epidermal growth factor receptor (EGFR)-expressing tumor cells with sterically stabilized affibody liposomes (SAL). Bioconjug. Chem. 20, 1201-1208 (2009).

28. Puri,A. et al. HER2-specific affibody-conjugated thermosensitive liposomes (Affisomes) for improved delivery of anticancer agents. J. Liposome Res. 18, 293-307 (2008).

29. Arvinte,T., Wahl,P., & Nicolau,C. Resonance energy-transfer and fluorescence intensity studies of the transport of liposome-encapsulated molecules into isolated mouse liver nuclei. Biochemistry 26, 765-772 (1987).

30. Gutierrez-Merino,C., Bonini,d.R., I, Pietrasanta,L.I., & Barrantes,F.J. Preferential distribution of the fluorescent phospholipid probes NBD-phosphatidylcholine and rhodamine-

130 phosphatidylethanolamine in the exofacial leaflet of acetylcholine receptor-rich membranes from Torpedo marmorata. Biochemistry 34, 4846-4855 (1995).

31. Douglas,S.J., Davis,S.S., & Illum,L. Nanoparticles in drug delivery. Crit Rev. Ther. Drug Carrier Syst. 3, 233-261 (1987).

32. Moon,M.H. & Giddings,J.C. Size distribution of liposomes by flow field-flow fractionation. J. Pharm. Biomed. Anal. 11, 911-920 (1993).

33. Brochu,H., Polidori,A., Pucci,B., & Vermette,P. Drug delivery systems using immobilized intact liposomes: a comparative and critical review. Curr. Drug Deliv. 1, 299-312 (2004).

34. Singh A. & Marchywka S.. Synthesis and characterization of head group modified 1,3 diacetylenic phospholipids. Abstracts of Papers of the American Chemical society 198, 147 (1989).

35. Agarwal,K., Bali,A., & Gupta,C.M. Influence of the phospholipid structure on the stability of liposomes in serum. Biochim. Biophys. Acta 856, 36-40 (1986).

36. Gupta,C.M. & Bali,A. Carbamyl analogs of phosphatidylcholines. Synthesis, interaction with phospholipases and permeability behavior of their liposomes. Biochim. Biophys. Acta 663, 506- 515 (1981).

37. Fuhrhop,J.H. & Wang,T. Bolaamphiphiles. Chem. Rev. 104, 2901-2937 (2004).

38. Clary,L. et al. Phase behavior of fluorocarbon and hydrocarbon double-chain hydroxylated and galactosylated amphiphiles and bolaamphiphiles. Long-term shelf-stability of their liposomes. Chem. Phys. Lipids 99, 125-137 (1999).

39. Fuhrhop J.H., Spiroski D, & Boettcher C. Molecular monolayer rods and tubules made of alpha- (l-lysine),omega-(amino) bolaamphiphiles. J. Am. Chem. Soc. 115, 1600-1601 (1993).

40. Kwon,S.M. et al. In vivo time-dependent gene expression of cationic lipid-based emulsion as a stable and biocompatible non-viral gene carrier. J. Control Release 128, 89-97 (2008).

41. Nam,H.Y., Park,J.H., Kim,K., Kwon,I.C., & Jeong,S.Y. Lipid-based emulsion system as non- viral gene carriers. Arch. Pharm. Res. 32, 639-646 (2009).

42. Choi,W.J. et al. Low toxicity of cationic lipid-based emulsion for gene transfer. Biomaterials 25, 5893-5903 (2004).

43. Wissing,S.A. & Muller,R.H. Solid lipid nanoparticles as carrier for sunscreens: in vitro release and in vivo skin penetration. J. Control Release 81, 225-233 (2002).

44. Iscan,Y., Wissing,S.A., Hekimoglu,S., & Muller,R.H. Solid lipid nanoparticles (SLN) for topical drug delivery: incorporation of the lipophilic drugs N,N-diethyl-m-toluamide and vitamin K. Pharmazie 60, 905-909 (2005).

45. Saupe,A., Wissing,S.A., Lenk,A., Schmidt,C., & Muller,R.H. Solid lipid nanoparticles (SLN) and nanostructured lipid carriers (NLC) -- structural investigations on two different carrier systems. Biomed. Mater. Eng 15, 393-402 (2005).

131 46. Martins,S., Sarmento,B., Ferreira,D.C., & Souto,E.B. Lipid-based colloidal carriers for peptide and protein delivery--liposomes versus lipid nanoparticles. Int. J. Nanomedicine. 2, 595-607 (2007).

47. Wissing,S.A. & Muller,R.H. The influence of solid lipid nanoparticles on skin hydration and viscoelasticity--in vivo study. Eur. J. Pharm. Biopharm. 56, 67-72 (2003).

48. Koziara,J.M., Lockman,P.R., Allen,D.D., & Mumper,R.J. The blood-brain barrier and brain drug delivery. J. Nanosci. Nanotechnol. 6, 2712-2735 (2006).

49. Lockman,P.R., Koziara,J.M., Mumper,R.J., & Allen,D.D. Nanoparticle surface charges alter blood-brain barrier integrity and permeability. J. Drug Target 12, 635-641 (2004).

50. Vasey,P.A. et al. Phase I clinical and pharmacokinetic study of PK1 [N-(2- hydroxypropyl)methacrylamide copolymer doxorubicin]: first member of a new class of chemotherapeutic agents-drug-polymer conjugates. Cancer Research Campaign Phase I/II Committee. Clin. Cancer Res. 5, 83-94 (1999).

51. Liu,C. & Zhang,N. Nanoparticles in gene therapy principles, prospects, and challenges. Prog. Mol. Biol. Transl. Sci. 104, 509-562 (2011).

52. Lee,J.B., Hong,J., Bonner,D.K., Poon,Z., & Hammond,P.T. Self-assembled RNA interference microsponges for efficient siRNA delivery. Nat. Mater.(2012).

53. Duncan,R. Polymer therapeutics as nanomedicines: new perspectives. Curr. Opin. Biotechnol. 22, 492-501 (2011).

54. Maham,A., Tang,Z., Wu,H., Wang,J., & Lin,Y. Protein-based nanomedicine platforms for drug delivery. Small 5, 1706-1721 (2009).

55. Svenson,S. & Tomalia,D.A. Dendrimers in biomedical applications--reflections on the field. Adv. Drug Deliv. Rev. 57, 2106-2129 (2005).

56. Gillies,E.R. & Frechet,J.M. Dendrimers and dendritic polymers in drug delivery. Drug Discov. Today 10, 35-43 (2005).

57. Tomalia,D.A., Reyna,L.A., & Svenson,S. Dendrimers as multi-purpose nanodevices for oncology drug delivery and diagnostic imaging. Biochem. Soc. Trans. 35, 61-67 (2007).

58. Gupta,U., Agashe,H.B., Asthana,A., & Jain,N.K. Dendrimers: novel polymeric nanoarchitectures for solubility enhancement. Biomacromolecules. 7, 649-658 (2006).

59. Rademacher,T.W., Parekh,R.B., & Dwek,R.A. Glycobiology. Annu. Rev. Biochem. 57, 785-838 (1988).

60. Modi,J., Joshi,G., & Sawant,K. Chitosan based mucoadhesive nanoparticles of ketoconazole for bioavailability enhancement: formulation, optimization, in vitro and ex vivo evaluation. Drug Dev. Ind. Pharm.(2012).

61. Nam,H.Y. et al. Cellular uptake mechanism and intracellular fate of hydrophobically modified glycol chitosan nanoparticles. J. Control Release 135, 259-267 (2009).

132 62. Kim,J.H. et al. Self-assembled glycol chitosan nanoparticles for the sustained and prolonged delivery of antiangiogenic small peptide drugs in cancer therapy. Biomaterials 29, 1920-1930 (2008).

63. Kim,J.H. et al. Antitumor efficacy of cisplatin-loaded glycol chitosan nanoparticles in tumor- bearing mice. J. Control Release 127, 41-49 (2008).

64. Pahwa,R., Saini,N., Kumar,V., & Kohli,K. Chitosan-based gastroretentive floating drug delivery technology: an updated review. Expert. Opin. Drug Deliv.(2012).

65. Dong,C.M. Glyconanoparticles for biomedical applications. Comb. Chem. High Throughput. Screen. 14, 173-181 (2011).

66. Marradi,M., Martin-Lomas,M., & Penades,S. Glyconanoparticles polyvalent tools to study carbohydrate-based interactions. Adv. Carbohydr. Chem. Biochem. 64, 211-290 (2010).

67. Garcia,I., Marradi,M., & Penades,S. Glyconanoparticles: multifunctional nanomaterials for biomedical applications. Nanomedicine. (Lond) 5, 777-792 (2010).

68. van Kasteren,S.I. et al. Glyconanoparticles allow pre-symptomatic in vivo imaging of brain disease. Proc. Natl. Acad. Sci. U. S. A 106, 18-23 (2009).

69. Manchester,M. & Singh,P. Virus-based nanoparticles (VNPs): platform technologies for diagnostic imaging. Adv. Drug Deliv. Rev. 58, 1505-1522 (2006).

70. Rae,C.S. et al. Systemic trafficking of plant virus nanoparticles in mice via the oral route. Virology 343, 224-235 (2005).

71. Kumar,S. et al. Tomato bushy stunt virus (TBSV), a versatile platform for polyvalent display of antigenic epitopes and vaccine design. Virology 388, 185-190 (2009).

72. Singh,P. et al. Bio-distribution, toxicity and pathology of cowpea mosaic virus nanoparticles in vivo. J. Control Release 120, 41-50 (2007).

73. Singh,P., Destito,G., Schneemann,A., & Manchester,M. Canine parvovirus-like particles, a novel nanomaterial for tumor targeting. J. Nanobiotechnology. 4, 2 (2006).

74. Brumfield,S. et al. Heterologous expression of the modified coat protein of Cowpea chlorotic mottle bromovirus results in the assembly of protein cages with altered architectures and function. J. gen. virol. 85, 1049-1053 (2004).

75. Uchida,M. et al. Biological containers: Protein cages as multifunctional nanoplatforms. Advanced Materials 19, 1025-1042 (2007).

76. Weiner,L.M. Monoclonal antibody therapy of cancer. Semin. Oncol. 26, 43-51 (1999).

77. Harrison,J., Shi,X., Wang,L., Ma,J.K., & Rojanasakul,Y. Novel delivery of antioxidant enzyme catalase to alveolar macrophages by Fc receptor-mediated endocytosis. Pharm. Res 11, 1110- 1114 (1994).

78. Lindgren,M., Hallbrink,M., Prochiantz,A., & Langel,U. Cell-penetrating peptides. Trends Pharmacol. Sci 21, 99-103 (2000).

133 79. Henke,E. et al. Peptide-conjugated antisense oligonucleotides for targeted inhibition of a transcriptional regulator in vivo. Nat. Biotechnol. 26, 91-100 (2008).

80. Bloomfield,V.A. DNA condensation. Curr. Opin. Struct. Biol. 6, 334-341 (1996).

81. Morris,M.C., Vidal,P., Chaloin,L., Heitz,F., & Divita,G. A new peptide vector for efficient delivery of oligonucleotides into mammalian cells. Nucleic Acids Res. 25, 2730-2736 (1997).

82. Lehto,T., Ezzat,K., & Langel,U. Peptide nanoparticles for oligonucleotide delivery. Prog. Mol. Biol. Transl. Sci. 104, 397-426 (2011).

83. Lehto,T. et al. A peptide-based vector for efficient gene transfer in vitro and in vivo. Mol. Ther. 19, 1457-1467 (2011).

84. Kumar,P. et al. Transvascular delivery of small interfering RNA to the central nervous system. Nature 448, 39-43 (2007).

85. Huang,H.C., Barua,S., Sharma,G., Dey,S.K., & Rege,K. Inorganic nanoparticles for cancer imaging and therapy. J. Control Release 155, 344-357 (2011).

86. Shukla,R. et al. Biocompatibility of gold nanoparticles and their endocytotic fate inside the cellular compartment: a microscopic overview. Langmuir 21, 10644-10654 (2005).

87. Zhang,Y., Sun,C., Kohler,N., & Zhang,M. Self-assembled coatings on individual monodisperse magnetite nanoparticles for efficient intracellular uptake. Biomed. Microdevices. 6, 33-40 (2004).

88. Zhang,Y., Kohler,N., & Zhang,M. Surface modification of superparamagnetic magnetite nanoparticles and their intracellular uptake. Biomaterials 23, 1553-1561 (2002).

89. Kallenbach,N., Ma,R., & Seeman,N. An immobile nucleic acid junction constructed from oligonucleotides. Nature 305, 829-831 (1983).

90. Feldkamp,U. & Niemeyer,C.M. Rational design of DNA nanoarchitectures. Angewandte Chemie- International Edition 45, 1856-1876 (2006).

91. Rothemund,P.W.K. Folding DNA to create nanoscale shapes and patterns. Nature 440, 297-302 (2006).

92. Chen,J.H. & Seeman,N.C. Synthesis from DNA of a molecule with the connectivity of a cube. Nature 350, 631-633 (1991).

93. Ke,Y., Liu,Y., Zhang,J., & Yan,H. A study of DNA tube formation mechanisms using 4-, 8-, and 12-helix DNA nanostructures. J. Am. Chem. Soc. 128, 4414-4421 (2006).

94. Kuzuya,A., Wang,R., Sha,R., & Seeman,N.C. Six-helix and eight-helix DNA nanotubes assembled from half-tubes. Nano. Lett. 7, 1757-1763 (2007).

95. Winfree,E., Liu,F., Wenzler,L.A., & Seeman,N.C. Design and self-assembly of two-dimensional DNA crystals. Nature 394, 539-544 (1998).

96. Gu,H., Chao,J., Xiao,S.J., & Seeman,N.C. Dynamic patterning programmed by DNA tiles captured on a DNA origami substrate. Nat. Nanotechnol. 4, 245-248 (2009).

134 97. Ke,Y. et al. Multilayer DNA origami packed on a square lattice. J. Am. Chem. Soc. 131, 15903- 15908 (2009).

98. Mao,C., Sun,W., Shen,Z., & Seeman,N.C. A nanomechanical device based on the B-Z transition of DNA. Nature 397, 144-146 (1999).

99. Yan,H., Zhang,X., Shen,Z., & Seeman,N.C. A robust DNA mechanical device controlled by hybridization topology. Nature 415, 62-65 (2002).

100. Yurke,B., Turberfield,A.J., Mills,A.P., Jr., Simmel,F.C., & Neumann,J.L. A DNA-fuelled molecular machine made of DNA. Nature 406, 605-608 (2000).

101. Sherman,W.B. & Seeman,N.C. A precisely controlled DNA biped walking device. Nano Letters 4, 1203-1207 (2004).

102. Lund,K. et al. Molecular robots guided by prescriptive landscapes. Nature 465, 206-210 (2010).

103. Zhang,C. et al. Conformational flexibility facilitates self-assembly of complex DNA nanostructures. Proc. Natl. Acad. Sci. USA 105, 10665-10669 (2008).

104. Singh,R. & Lillard,J.W., Jr. Nanoparticle-based targeted drug delivery. Exp. Mol. Pathol. 86, 215-223 (2009).

105. Grimm,D. et al. Fatality in mice due to oversaturation of cellular microRNA/short hairpin RNA pathways. Nature. 441, 537-541 (2006).

106. Guo,P. The emerging field of RNA nanotechnology. Nat Nanotechnol. 5, 833-842 (2010).

107. Shu,D., Huang,L., Hoeprich,S., & Guo,P. Construction of phi29 DNA-packaging RNA (pRNA) monomers, dimers and trimers with variable sizes and shapes as potential parts for nano-devices. J. Nanosci. Nanotechnol. 3, 295-302 (2003).

108. Shu,D., Moll,W.D., Deng,Z., Mao,C., & Guo,P. Bottom-up assembly of RNA arrays and superstructures as potential parts in nanotechnology. Nano Lett. 4, 1717-1723 (2004).

109. Hansma,H.G., Oroudjev,E., Baudrey,S., & Jaeger,L. TectoRNA and 'kissing-loop' RNA: atomic force microscopy of self-assembling RNA structures. J Microsc. 212, 273-279 (2003).

110. Pan,T., Long,D.M., & Uhlenbeck,O.C. Divalent metal ions in RNA folding and catalysis in RNA World (eds. Gesteland,R.F. & Atkins,J.F.) 271-302 (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1993).

111. Strobel,S.A. & Cochrane,J.C. RNA catalysis: ribozymes, ribosomes, and riboswitches. Curr. Opin. Chem. Biol. 11, 636-643 (2007).

112. Fabian,M.R., Sonenberg,N., & Filipowicz,W. Regulation of mRNA translation and stability by microRNAs. Annu. Rev. Biochem. 79, 351-379 (2010).

113. Taft,R.J., Pang,K.C., Mercer,T.R., Dinger,M., & Mattick,J.S. Non-coding RNAs: regulators of disease. J. Pathol. 220, 126-139 (2010).

135 114. Lee,C.Y.F., Rennie,P.S., & Jia,W.W.G. MicroRNA Regulation of Oncolytic Herpes Simplex Virus-1 for Selective Killing of Prostate Cancer Cells. Clinical Cancer Research 15, 5126-5135 (2009).

115. Zhang,C. Novel functions for small RNA molecules. Curr. Opin. Mol. Ther. 11, 641-651 (2009).

116. Sudarsan,N. et al. Riboswitches in eubacteria sense the second messenger cyclic di-GMP. Science 321, 411-413 (2008).

117. Henkin,T.M. Riboswitch RNAs: using RNA to sense cellular metabolism. Genes & Development 22, 3383-3390 (2008).

118. Ogawa,A. & Maeda,M. An artificial aptazyme-based riboswitch and its cascading system in E. coli. Chembiochem 9, 206-209 (2008).

119. Bouvet,P. Determination of nucleic acid recognition sequences by SELEX. Methods Mol. Biol 148, 603-610 (2001).

120. Ciesiolka,J., Gorski,J., & Yarus,M. Selection of an RNA domain that binds Zn2+. RNA 1, 538- 550 (1995).

121. Clark,S. & Remcho,V. Aptamers as analytical reagents. Electrophoresis 23, 1335-1340 (2002).

122. Kraus,E., James,W., & Barclay,A.N. Cutting edge: novel RNA ligands able to bind CD4 antigen and inhibit CD4+ T lymphocyte function. J Immunol. 160, 5209-5212 (1998).

123. Shu,D. & Guo,P. A Viral RNA that binds ATP and contains an motif similar to an ATP-binding aptamer from SELEX. J. Biol. Chem. 278(9), 7119-7125 (2003).

124. Gold,L. The SELEX process: a surprising source of therapeutic and diagnostic compounds. Harvey Lect. 91, 47-57 (1995).

125. Ellington,A.D. & Szostak,J.W. In vitro selection of RNA molecules that bind specific ligands. Nature 346, 818-822 (1990).

126. Tuerk,C. & Gold,L. Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA ploymerase. Science 249, 505-510 (1990).

127. McNamara,J.O. et al. Cell type-specific delivery of siRNAs with aptamer-siRNA chimeras. Nat Biotech 24, 1005-1015 (2006).

128. Dassie,J.P. et al. Systemic administration of optimized aptamer-siRNA chimeras promotes regression of PSMA-expressing tumors. Nat Biotechnol. 27, 839-849 (2009).

129. Zhou,J., Li,H., Zaia,J., & Rossi,J.J. Novel dual inhibitory function aptamer-siRNA delivery system for HIV-1 therapy. Mol Ther. 16, 1481-1489 (2008).

130. Cerchia,L. & de,F., V Targeting cancer cells with nucleic acid aptamers. Trends Biotechnol. 28, 517-525 (2010).

136 131. Cech,T.R., Zaug,A.J., & Grabowski,P.J. In vitro splicing of the ribosomal RNA precursor of Tetrahymena: involvement of a guanosine nucleotide in the excision of the intervening sequence. Cell 27, 487-496 (1981).

132. Guerrier-Takada,C., Gardiner,K., Marsh,T., Pace,N., & Altman,S. The RNA moiety of ribonuclease P is the catalytic subunit of the enzyme. Cell 35, 849-857 (1983).

133. Fire,A. et al. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391, 806-811 (1998).

134. Ghildiyal,M. & Zamore,P.D. Small silencing RNAs: an expanding universe. Nat. Rev. Genet. 10, 94-108 (2009).

135. Guo,P. et al. Engineering RNA for Targeted siRNA Delivery and Medical Application. Advanced Drug Delivery Reviews 62, 650-666 (2010).

136. Li,H., Li,W.X., & Ding,S.W. Induction and suppression of RNA silencing by an animal virus. Science 296, 1319-1321 (2002).

137. Brummelkamp,T.R., Bernards,R., & Agami,R. A system for stable expression of short interfering RNAs in mammalian cells. Science 296, 550-553 (2002).

138. Jacque,J.M., Triques,K., & Stevenson,M. Modulation of HIV-1 replication by RNA interference. Nature 418, 435-438 (2002).

139. Varambally,S. et al. The polycomb group protein EZH2 is involved in progression of prostate cancer. Nature 419, 624-629 (2002).

140. Carmichael,G.G. Medicine: silencing viruses with RNA. Nature 418, 379-380 (2002).

141. Sarver,N.A. et al. Ribozymes as potential anti-HIV-1 therapeutic agents. Science 247, 1222-1225 (1990).

142. Chowrira,B.M., Berzal-Herranz,A., & Burke,J.M. Novel guanosine requirement for catalysis by the hairpin ribozyme. Nature 354, 320-322 (1991).

143. Forster,A.C. & Symons,R.H. Self-cleavage of virusoid RNA is performed by the proposed 55- nucleotide active site. Cell 50, 9-16 (1987).

144. Nava Sarver,N. et al. Ribozymes as Potential Anti-HIV-1 Therapeutic Agents. Science 24, 1222- 1225 (1990).

145. Coleman,J., Hirashima,A., Inocuchi,Y., Green,PJ., & Inouye,M. A novel immune system against bacteriophage infection using complementary RNA (micRNA). Nature 315, 601-603 (1985).

146. Knecht,D.A. & Loomis,W.F. Antisense RNA inactivation of myosin heavy chain gene expression in Dictyostelium discoideum. Science 236, 1081-1086 (1987).

147. Guo,P., Zhang,C., Chen,C., Trottier,M., & Garver,K. Inter-RNA interaction of phage phi29 pRNA to form a hexameric complex for viral DNA transportation. Mol. Cell. 2, 149-155 (1998).

137 148. Zhang,F. et al. Function of hexameric RNA in packaging of bacteriophage phi29 DNA in vitro. Mol. Cell. 2, 141-147 (1998).

149. Jaeger,L. & Leontis,N.B. Tecto-RNA: One dimensional self-assembly through tertiary interactions. Angew. Chem Int. Ed Engl. 39, 2521-2524 (2000).

150. Jaeger,L., Westhof,E., & Leontis,N.B. TectoRNA: modular assembly units for the construction of RNA nano-objects. Nucleic Acids Res. 29, 455-463 (2001).

151. Chworos,A. et al. Building programmable jigsaw puzzles with RNA. Science 306, 2068-2072 (2004).

152. Guo P RNA Nanotechnology: Engineering, Assembly and Applications in Detection, Gene Delivery and Therapy. Journal of Nanoscience and Nanotechnology 5(12), 1964-1982 (2005).

153. Jaeger L & Chworos A The architectonics of programmable RNA and DNA nanostructures. Curr Opin Struct Biol. 16, 531-543 (2006).

154. Leontis,N.B. & Westhof,E. Analysis of RNA motifs. Curr. Opin. Struct. Biol. 13, 300-308 (2003).

155. Leontis NB, Lescoute A, & Westhof E The building blocks and motifs of RNA architecture. Curr Opin Struct Biol 16, 279-287 (2006).

156. Khaled,A., Guo,S., Li,F., & Guo,P. Controllable Self-Assembly of Nanoparticles for Specific Delivery of Multiple Therapeutic Molecules to Cancer Cells Using RNA Nanotechnology. Nano Letters 5, 1797-1808 (2005).

157. Tarapore,P., Shu,Y., Guo,P., & Ho,S.M. Application of Phi29 Motor pRNA for Targeted Therapeutic Delivery of siRNA Silencing Metallothionein-IIA and Survivin in Ovarian Cancers. Molecular Therapy 19, 386-394 (2010).

158. Abdelmawla,S. et al. Pharmacological Characterization of Chemically Synthesized Monomeric pRNA Nanoparticles for Systemic Delivery. Molecular Therapy In Press, (2011).

159. Westhof,E., Masquida,B., & Jaeger,L. RNA tectonics: Towards RNA design. Folding & Design 1, R78-R88 (1996).

160. Lescoute,A. & Westhof,E. Topology of three-way junctions in folded RNAs. RNA. 12, 83-93 (2006).

161. Jossinet,F., Ludwig,T.E., & Westhof,E. RNA structure: bioinformatic analysis. Current Opinion in Microbiology 10, 279-285 (2007).

162. Leontis,N.B. & Westhof,E. The annotation of RNA motifs. Comp Funct. Genomics 3, 518-524 (2002).

163. Leontis,N.B. & Westhof,E. Geometric nomenclature and classification of RNA base pairs. RNA. 7, 499-512 (2001).

164. Cadd,T.L. & Patterson,J.L. Synthesis of viruslike particles by expression of the putative capsid protein of Leishmania RNA virus in a recombinant baculovirus expression system. J. Virol. 68, 358-365 (1994).

138 165. McKinney,S.A., Declais,A.C., Lilley,D.M.J., & Ha,T. Structural dynamics of individual Holliday junctions. Nature Structural Biology 10, 93-97 (2003).

166. Lilley,D.M. Structure, folding and catalysis of the small nucleolytic ribozymes. Curr. Opin. Struct. Biol 9, 330-338 (1999).

167. Schroeder,K.T., McPhee,S.A., Ouellet,J., & Lilley,D.M. A structural database for k-turn motifs in RNA. RNA. 16, 1463-1468 (2010).

168. Shapiro,B.A. Computational Design Strategies for RNA Nanostructures. J. Biomol. Str. Dyn. 26, 820 (2009).

169. Afonin,K.A. et al. In vitro assembly of cubic RNA-based scaffolds designed in silico. Nat. Nanotechnol. 5, 676-682 (2010).

170. Yingling,Y.G. & Shapiro,B.A. Computational design of an RNA hexagonal nanoring and an RNA nanotube. Nano Letters 7, 2328-2334 (2007).

171. Bindewald,E., Grunewald,C., Boyle,B., O'Connor,M., & Shapiro,B.A. Computational strategies for the automated design of RNA nanoscale structures from building blocks using NanoTiler. Journal of Molecular Graphics & Modelling 27, 299-308 (2008).

172. Grabow,W.W. et al. Self-Assembling RNA Nanorings Based on RNAI/II Inverse Kissing Complexes. Nano Lett. 11, 878-887 (2011).

173. Shapiro,B.A., Bindewald,E., Kasprzak,W., & Yingling,Y. Protocols for the in silico design of RNA nanostructures. Methods Mol. Biol. 474, 93-115 (2008).

174. Berman,H.M. et al. The Protein Data Bank. Nucleic Acids Res. 28, 235-242 (2000).

175. Berman,H.M. et al. Realism about PDB. Nat. Biotechnol. 25, 845-846 (2007).

176. Berman,H.M. et al. The Protein Data Bank. Acta Crystallogr. D. Biol. Crystallogr. 58, 899-907 (2002).

177. Berman,H.M. et al. The nucleic acid database. A comprehensive relational database of three- dimensional structures of nucleic acids. Biophys. J. 63, 751-759 (1992).

178. Klosterman,P.S., Hendrix,D.K., Tamura,M., Holbrook,S.R., & Brenner,S.E. Three-dimensional motifs from the SCOR, structural classification of RNA database: extruded strands, base triples, tetraloops and U-turns. Nucleic Acids Res. 32, 2342-2352 (2004).

179. Tamura,M. et al. SCOR: Structural Classification of RNA, version 2.0. Nucleic Acids Res. 32, D182-D184 (2004).

180. Nagaswamy,U. et al. NCIR: a database of non-canonical interactions in known RNA structures. Nucleic Acids Res. 30, 395-397 (2002).

181. Bindewald,E., Hayes,R., Yingling,Y.G., Kasprzak,W., & Shapiro,B.A. RNAJunction: a database of RNA junctions and kissing loops for three-dimensional structural analysis and nanodesign. Nucleic Acids Res. 36, D392-D397 (2008).

139 182. Zuker,M. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 31, 3406-3415 (2003).

183. Markham,N.R. & Zuker,M. UNAFold: software for nucleic acid folding and hybridization. Methods Mol. Biol. 453, 3-31 (2008).

184. Mathews,D.H. et al. Incorporating chemical modification constraints into a dynamic programming algorithm for prediction of RNA secondary structure. Proc. Natl. Acad. Sci. U. S. A 101, 7287-7292 (2004).

185. Ding,Y., Chan,C.Y., & Lawrence,C.E. Sfold web server for statistical folding and rational design of nucleic acids. Nucleic Acids Res. 32, W135-W141 (2004).

186. Steffen,P., Voss,B., Rehmsmeier,M., Reeder,J., & Giegerich,R. RNAshapes: an integrated RNA analysis package based on abstract shapes. Bioinformatics. 22, 500-503 (2006).

187. Shapiro,B.A. & Wu,J.C. Predicting RNA H-type pseudoknots with the massively parallel genetic algorithm. Comput. Appl. Biosci. 13, 459-471 (1997).

188. Kasprzak,W., Bindewald,E., Kim,T.J., Jaeger,L., & Shapiro,B.A. Use of RNA structure flexibility data in nanostructure modeling. Methods(2010).

189. Martinez,H.M., Maizel,J.V., & Shapiro,B.A. RNA2D3D: A program for generating, viewing, and comparing 3-dimensional models of RNA. J. Biomol. Str. Dyn. 25, 669-683 (2008).

190. Massire,C. & Westhof,E. MANIP: an interactive tool for modelling RNA. J Mol. Graph. Model. 16, 197 (1998).

191. Macke T & Case DA Modeling unusual nucleic acids with NAB. ABSTRACTS OF PAPERS OF THE AMERICAN CHEMICAL SOCIETY 213, 289-COMP (1997).

192. Cruz,J.A. et al. RNA-Puzzles: A CASP-like evaluation of RNA three-dimensional structure prediction. RNA. 18, 610-625 (2012).

193. Khaladkar,M., Bellofatto,V., Wang,J.T.L., Tian,B., & Shapiro,B.A. RADAR: a web server for RNA data analysis and research. Nucleic Acids Res. 35, W300-W304 (2007).

194. Severcan I, Geary C, ,V.E., ,C.A., & Jaeger L Square-shaped RNA particles from different RNA folds. Nano Lett. 9, 1270-1277 (2009).

195. Severcan,I. et al. A polyhedron made of tRNAs. Nat. Chem. 2, 772-779 (2010).

196. Guo,S., Tschammer,N., Mohammed,S., & Guo,P. Specific delivery of therapeutic RNAs to cancer cells via the dimerization mechanism of phi29 motor pRNA. Hum Gene Ther. 16, 1097- 1109 (2005).

197. Guo,S., Huang,F., & Guo,P. Construction of folate-conjugated pRNA of bacteriophage phi29 DNA packaging motor for delivery of chimeric siRNA to nasopharyngeal carcinoma cells. Gene Ther 13, 814-820 (2006).

198. Hoeprich,S. et al. Bacterial virus phi29 pRNA as a hammerhead ribozyme escort to destroy hepatitis B virus. Gene Ther. 10, 1258-1267 (2003).

140 199. Liu,H. et al. Phi29 pRNA Vector for Efficient Escort of Hammerhead Ribozyme Targeting Survivin in Multiple Cancer Cells. Cancer Biol. Ther. 6, 697-704 (2007).

200. Li,L., Liu,J., Diao,Z., Guo,P., & Shen,G. Evaluation of specific delivery of chimeric phi29 pRNA/siRNA nanoparticles to multiple tumor cells. Molecular BioSystems 5, 1361-1368 (2009).

201. Zhang,H.M. et al. Targeted delivery of anti-coxsackievirus siRNAs using ligand-conjugated packaging RNAs. Antiviral Res. 83, 307-316 (2009).

202. Hall,A.H. et al. High potency silencing by single-stranded boranophosphate siRNA. Nucleic Acids Res. 34, 2773-2781 (2006).

203. Hall,A.H., Wan,J., Shaughnessy,E.E., Ramsay,S.B., & Alexander,K.A. RNA interference using boranophosphate siRNAs: structure-activity relationships. Nucleic Acids Res. 32, 5991-6000 (2004).

204. Shaw,B.R. Versatility of borane nucleic acids mimics for coding, decoding and modulating genetic information. Nucleic Acids Symp. Ser. (Oxf)117 (2007).

205. Geary,R.S., Yu,R.Z., & Levin,A.A. Pharmacokinetics of phosphorothioate antisense oligodeoxynucleotides. Curr. Opin. Investig. Drugs 2, 562-573 (2001).

206. Kawasaki,A.M. et al. Uniformly modified 2'-deoxy-2'-fluoro phosphorothioate oligonucleotides as nuclease-resistant antisense compounds with high affinity and specificity for RNA targets. J. Med. Chem. 36, 831-841 (1993).

207. Dowler,T. et al. Improvements in siRNA properties mediated by 2'-deoxy-2'-fluoro-beta-D- arabinonucleic acid (FANA). Nucleic Acids Res. 34, 1669-1675 (2006).

208. Kraynack,B.A. & Baker,B.F. Small interfering RNAs containing full 2'-O-methylribonucleotide- modified sense strands display Argonaute2/eIF2C2-dependent activity. RNA. 12, 163-176 (2006).

209. Chen,P.Y. et al. Strand-specific 5'-O-methylation of siRNA duplexes controls guide strand selection and targeting specificity. RNA. 14, 263-274 (2008).

210. Zhang,H. et al. Reduction of liver Fas expression by an antisense oligonucleotide protects mice from fulminant hepatitis. Nat Biotechnol. 18, 862-867 (2000).

211. Crooke,R.M. et al. An apolipoprotein B antisense oligonucleotide lowers LDL cholesterol in hyperlipidemic mice without causing hepatic steatosis. J. Lipid Res. 46, 872-884 (2005).

212. Parrish,S., Fleenor,J., Xu,S., Mello,C., & Fire,A. Functional anatomy of a dsRNA trigger: differential requirement for the two trigger strands in RNA interference. Mol. Cell 6, 1077-1087 (2000).

213. Dande,P. et al. Improving RNA interference in mammalian cells by 4'-thio-modified small interfering RNA (siRNA): effect on siRNA activity and nuclease stability when used in combination with 2'-O-alkyl modifications. J. Med. Chem. 49, 1624-1634 (2006).

214. Pagratis,N.C. et al. Potent 2'-amino-, and 2'-fluoro-2'-deoxyribonucleotide RNA inhibitors of keratinocyte growth factor. Nature Biotechnology 15, 68-73 (1997).

141 215. Snove,J. & Rossi,J.J. Chemical Modifications Rescue Off-Target Effects of RNAi. ACS Chem. Biol. 1, 274-276 (2006).

216. Kam NW, Liu Z, & Dai H Functionalization of carbon nanotubes via cleavable disulfide bonds for efficient intracellular delivery of siRNA and potent gene silencing. J Am Chem Soc. 127, 12492-12493 (2005).

217. Sousa,R., Chung,Y.J., Rose,J.P., & Wang,B.C. Crystal structure of bacteriophage T7 RNA polymerase at 3.3 A resolution. Nature 364, 593-599 (1993).

218. Cheetham,G.M. & Steitz,T.A. Structure of a transcribing T7 RNA polymerase initiation complex. Science 286, 2305-2309 (1999).

219. Padilla,R. & Sousa,R. A Y639F/H784A T7 RNA polymerase double mutant displays superior properties for synthesizing RNAs with non-canonical NTPs. Nucleic Acids Res. 30, e138 (2002).

220. Liu,J. et al. Fabrication of Stable and RNase- Resistant RNA Nanoparticles Active in Gearing the Nanomotors for Viral DNA Packaging. ACS Nano 5, 237-246 (2010).

221. Wassarman,D.A. Psoralen crosslinking of small RNAs in vitro. Molecular Biology Reports 17, 143-151 (1993).

222. Wollowitz,S. Fundamentals of the psoralen-based Helinx technology for inactivation of infectious pathogens and leukocytes in platelets and plasma. Semin. Hematol. 38, 4-11 (2001).

223. Zhang,C.L., Lee,C.-S., & Guo,P. The proximate 5' and 3' ends of the 120-base viral RNA (pRNA) are crucial for the packaging of bacteriophage 29 DNA. Virology 201, 77-85 (1994).

224. Studnicka,G.M., Rahn,G.M., Cummings,I.W., & Salser,W.A. Computer method for predicting the secondary structure of single-stranded RNA. Nucleic Acids Res. 5, 3365-3387 (1978).

225. Yap,N.L. & Rao,V.B. Novel mutants in the 5' upstream region of the portal protein gene 20 overcome a gp40-dependent prohead assembly block in bacteriophage T4. J Mol. Biol 263, 539- 550 (1996).

226. Zuker,M. On finding all suboptimal foldings of an RNA molecule. Science 244, 48-52 (1989).

227. Jaeger,J.A., SantaLucia,J.J., & Tinoco,I.J. Determination of RNA structure and thermodynamics. Annu. Rev. Biochem. 62, 255-285 (1993).

228. Pleij,C.W. & Bosch,L. RNA pseudoknots: Structure, Detection, and Prediction. Meth. Enzymol. 180, 289-303 (1989).

229. Correll,C.C., Freeborn,B., Moore,P.B., & Steitz,T.A. Metals, motifs, and recognition in the crystal structure of a 5S rRNA domain. Cell 91, 705-712 (1997).

230. Shu,D., Shu,Y., Haque,F., Abdelmawla,S., & Guo,P. Thermodynamically stable RNA three-way junctions as platform for constructing multifuntional nanoparticles for delivery of therapeutics. Nature Nanotechnology 6, 658-667 (2011).

142 231. Ellington,A.D. & Szostak,J.W. Selection in vitro of single-stranded DNA molecules that fold into specific ligand-binding structures. Nature 355, 850-852 (1992).

232. Winkler,W.C., Nahvi,A., Roth,A., Collins,J.A., & Breaker,R.R. Control of gene expression by a natural metabolite-responsive ribozyme. Nature 428, 281-286 (2004).

233. Mulhbacher,J., St-Pierre,P., & Lafontaine,D.A. Therapeutic applications of ribozymes and riboswitches. Curr. Opin. Pharmacol. 10, 551-556 (2010).

234. Chen,Y., Zhu,X., Zhang,X., Liu,B., & Huang,L. Nanoparticles modified with tumor-targeting scFv deliver siRNA and miRNA for cancer therapy. Mol. Ther. 18, 1650-1656 (2010).

235. Pegtel,D.M. et al. Functional delivery of viral miRNAs via exosomes. Proc. Natl. Acad. Sci. U. S. A 107, 6328-6333 (2010).

236. Ye,X., Liu,Z., Hemida,M., & Yang,D. Mutation Tolerance and Targeted Delivery of Anti- Coxsackievirus Artificial MicroRNAs Using Folate Conjugated Bacteriophage Phi29 pRNA. PLoS ONE In Press, (2011).

237. Chen,C., Zhang,C., & Guo,P. Sequence requirement for hand-in-hand interaction in formation of pRNA dimers and hexamers to gear phi29 DNA translocation motor. RNA 5, 805-818 (1999).

238. Xiao,F., Zhang,H., & Guo,P. Novel mechanism of hexamer ring assembly in protein/RNA interactions revealed by single molecule imaging. Nucleic Acids Res 36 (20), 6620-6632 (2008).

239. Shu,D., Zhang,H., Jin,J., & Guo,P. Counting of six pRNAs of phi29 DNA-packaging motor with customized single molecule dual-view system. EMBO J. 26, 527-537 (2007).

240. Reid,R.J.D., Bodley,J.W., & Anderson,D. Characterization of the prohead-pRNA interaction of bacteriophage phi29. J Biol Chem 269, 5157-5162 (1994).

241. Guo,P., Erickson,S., & Anderson,D. A small viral RNA is required for in vitro packaging of bacteriophage phi29 DNA. Science 236, 690-694 (1987).

242. Chen,C., Sheng,S., Shao,Z., & Guo,P. A dimer as a building block in assembling RNA: A hexamer that gears bacterial virus phi29 DNA-translocating machinery. J Biol Chem 275(23), 17510-17516 (2000).

243. Sousa,R. & Padilla,R. A mutant T7 RNA polymerase as a DNA polymerase. EMBO J. 14, 4609- 4621 (1995).

244. Kolpashchikov,D.M. Binary malachite green aptamer for fluorescent detection of nucleic acids. J. Am. Chem. Soc. 127, 12442-12443 (2005).

245. Baugh,C., Grate,D., & Wilson,C. 2.8 A crystal structure of the malachite green aptamer. J. Mol. Biol. 301, 117-128 (2000).

246. Miyagishi,M., Sumimoto,H., Miyoshi,H., Kawakami,Y., & Taira,K. Optimization of an siRNA- expression system with an improved hairpin and its significant suppressive effects in mammalian cells. J. Gene Med. 6, 715-723 (2004).

143 247. Nakashima,Y., Abe,H., Abe,N., Aikawa,K., & Ito,Y. Branched RNA nanostructures for RNA interference. Chem. Commun. (Camb. ) 47, 8367-8369 (2011).

248. Shlyakhtenko,L.S. et al. Silatrane-based surface chemistry for immobilization of DNA, protein- DNA complexes and other biological materials. Ultramicroscopy 97, 279-287 (2003).

249. Lyubchenko,Y.L. & Shlyakhtenko,L.S. AFM for analysis of structure and dynamics of DNA and protein-DNA complexes. Methods 47, 206-213 (2009).

250. Lee,R.J. & Low,P.S. Delivery of liposomes into cultured KB cells via folate receptor-mediated endocytosis. J Biol Chem 269, 3198-3204 (1994).

251. Lu,Y. & Low,P.S. Folate-mediated delivery of macromolecular anticancer therapeutic agents. Adv. Drug Deliv. Rev. 54, 675-693 (2002).

252. Ambrosini,G., Adida,C., Sirugo,G., & Altieri,D.C. Induction of apoptosis and inhibition of cell proliferation by survivin gene targeting. J. Biol. Chem. 273, 11177-11182 (1998).

253. Ambrosini,G., Adida,C., & Altieri,D.C. A novel anti-apoptosis gene, survivin, expressed in cancer and lymphoma. Nat. Med. 3, 917-921 (1997).

254. Ambrosini,G., Adida,C., Sirugo,G., & Altieri,D.C. Induction of apoptosis and inhibition of cell proliferation by survivin gene targeting. J Biol Chem 273, 11177-11182 (1998).

255. Chen,J. et al. Down-regulation of survivin by antisense oligonucleotides increases apoptosis, inhibits cytokinesis and anchorage-independent growth. Neoplasia 2, 235-241 (2000).

256. Olie,R.A. et al. A novel antisense oligonucleotide targeting survivin expression induces apoptosis and sensitizes lung cancer cells to chemotherapy. Cancer Research 60, 2805-2809 (2000).

257. Shu,Y., Cinier,M., Fox,S.R., Ben-Johnathan,N., & Guo,P. Assembly of Therapeutic pRNA- siRNA Nanoparticles Using Bipartite Approach. Molecular Therapy 19, 1304-1311 (2011).

258. Garver,K. & Guo,P. Boundary of pRNA functional domains and minimum pRNA sequence requirement for specific connector binding and DNA packaging of phage phi29. RNA. 3, 1068- 1079 (1997).

259. Hendrix,R.W. Bacteriophage DNA packaging: RNA gears in a DNA transport machine (Minireview). Cell 94, 147-150 (1998).

260. Lee,T.J. & Guo,P. Interaction of gp16 with pRNA and DNA for genome packaging by the motor of bacterial virus phi29. J. Mol Biol. 356, 589-599 (2006).

261. Zhang,C.L., Tellinghuisen,T., & Guo,P. Confirmation of the helical structure of the 5'/3' termini of the essential DNA packaging pRNA of phage 29. RNA 1, 1041-1050 (1995).

262. Elbashir,S.M. et al. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411, 494-498 (2001).

263. McCaffrey,A.P. et al. RNA interference in adult mice. Nature 418, 38-39 (2002).

144 264. McManus,M.T. et al. Small interfering RNA-mediated gene silencing in T lymphocytes. J Immunol. 169, 5754-5760 (2002).

265. Srisawat,C. & Engelke,D.R. Streptavidin aptamers: affinity tags for the study of RNAs and ribonucleoproteins. RNA. 7, 632-641 (2001).

266. Grabow,W.W. et al. Self-assembling RNA nanorings based on RNAI/II inverse kissing complexes. Nano. Lett. 11, 878-887 (2011).

267. Attia,R.R. et al. Selective targeting of leukemic cell growth in vivo and in vitro using a gene silencing approach to diminish S-adenosylmethionine synthesis. J. Biol. Chem. 283, 30788-30795 (2008).

268. Jemal,A., Siegel,R., Xu,J., & Ward,E. Cancer statistics, 2010. CA Cancer J. Clin. 60, 277-300 (2010).

145 APPENDICES

Publication List

Peer reviewed publications:

1. Shu D, Shu Y (co-first author), Haque F, Abdelmawla S, Guo P. Thermodynamically stable

RNA three-way junction as a platform for constructing multifunctional nanoparticles for delivery

of therapeutics. Nature Nanotech. 2011;6(10):658-67.

2. Shu Y, Cinier M, Fox R. Sejal, Ben-Johnathan N, Guo P. Assembly of Therapeutic pRNA-

siRNA Nanoparticles Using Bipartite Approach. Molecular Therapy. 2011. 19(7):1304-11.

3. Shu Y, Cinier M, Shu D, Guo P. Assembly of multifunctional phi29 pRNA nanoparticles for specific delivery of siRNA and other therapeutics to targeted cells. Methods. 2011; 54(2):204-14.

4. Zhou J, Shu Y, Guo P, Smith DD, Rossi JJ. Dual functional RNA nanoparticles containing phi29 motor pRNA and anti-gp120 aptamer for cell-type specific delivery and HIV-1 Inhibition.

Methods. 2011; 54(2):284-94.

5. Liu J, Guo S, Cinier M, Shlyakhtenko LS, Shu Y, Chen C, Shen G, Guo P. Fabrication of stable and RNase-resistant RNA nanoparticles active in gearing the nanomotors for viral DNA packaging. ACS Nano. 2011;5(1):237-46.

6. Tarapore P, Shu Y, Guo P, Ho SM. Application of phi29 motor pRNA for targeted therapeutic delivery of siRNA silencing metallothionein-IIA and survivin in ovarian cancers. Molecular

Therapy. 2011;19(2):386-94.

7. Guo P, Coban O, Snead NM, Trebley J, Hoeprich S, Guo S, Shu Y. Engineering RNA for targeted siRNA delivery and medical application. Adv Drug Deliv Rev. 2010;62(6):650-66.

Conference proceedings:

146 8. Shu Y, Shu D, Diao Z, Shen G, Guo P. Fabrication of polyvalent therapeutic RNA nanoparticles for specific delivery of siRNA, ribozyme and drugs to targeted cells for cancer therapy.IEEE NIH Life Sci Syst Appl Workshop. 2009:9-12.

Book Chapters:

9. Cinier M, Shu Y, Binzel D, Guo P. Synthesis, conjugation, and labeling of multifunctional

pRNA nanoparticles for specific delivery of siRNA, drugs and other therapeutics to target cells.

In Methods in Molecular Biology: Rational drug design (Zheng Y, Ed.). 2011. Springer.

10. Zhang H, Feng X, Shu Y, Yuan F, Guo P. pRNA geared nanomotor for nanotechnology and gene delivery” NANOMEDICINE: Design of Paricles, Sensors, Motors, Implants, Robots and

Devices Chapter 8. 2009. p211-236.

Manuscript in Preparation:

11. Haque F, Shu D, Shu Y (co-first author), Shlyakhtenko L, Rychahou P, Evers BM, and Guo

P. Thermodynamically stable RNA X-nanoparticles carrying four siRNA for enhanced gene

silencing. In submission.

12. Shu Y, Haque F, Shu D, Li W, Zhu Z, Shlyakhtenko L, Kotb M and Guo P. Toolkits for

fabrication of versatile RNA nanoparticles. In preparation.

13. Shu Y, Li W, and Guo P. Re-engineered bacteriophage phi29 hexamer ring as the platform

for constructing nanoparticles harborin six funcrionalities for potential delivery of therapeutics.

In preparation.

147