Perfect and Imperfect Microsatellite Markers in Determination of Genetic Status of Greater Adjutant Stork (Leptoptilos Dubius Gmelin)

Bioinformatics & Proteomics Open Access Journal ISSN: 2642-6129 MEDWIN PUBLISHERS Committed to Create Value for Researchers

Perfect and Imperfect Microsatellite Markers in Determination of Genetic Status of Greater Adjutant Stork (Leptoptilos dubius Gmelin)

1 2 3 Sharma DK *, Baruah C and Barman PD Research Article 1Department of Zoology, University of Science and Technology, Meghalaya, India Volume 5 Issue 1 2Department of Zoology, Darrang College, India Received Date: May 07, 2021 3Aaranyak, Beltola Survey, India Published Date: June 30, 2021

*Corresponding author: DK. Sharma, University of Science and Technology Meghalaya, Kling Road, Baridua, 793101, India, Email: [email protected]

Abstract

The Greater Adjutant Stork (Leptoptilos dubius), the most endangered stork (IUCN Red List criteria under A2bcd+3bcd+4bcd;

Kamrup, Assam, India. An attempt was made to study the status of genetic variability in Greater Adjutant Stork revealed that C2a) losing its number by population has been confined in a small village named Dadra- Pacharia- Singimari in the district of though the Greater Adjutant Stork population is highly threatened, yet the group has been appeared as genetically stable as recorded from that of the observed heterozygosity. Therefore, it is of importance to study the distribution enrichment and

polymorphism of microsatellites in the genome of the Greater Adjutant Stork. Five microsatellite markers of cross species- number of alleles varying between 2 to 9 across all loci used. The locus Ah341 was observed to have 2 alleles whilst the specific markers were deployed in this study. All the five microsatellite markers were recorded to be polymorphic with the locus Cc07 was with 9 alleles. The heterozygosity of L. dubius was observed to be high for the microsatellite markers used,

with mean observed heterozygosity (Ho) of 0.752±0.09 and mean expected heterozygosity (He) was with 0.677±0.06. The overall mean expected heterozygosity was found to be marginally higher than the observed heterozygosity. The polymorphic

(TG) was dominating at 20 followed by mononucleotide (A) at 12, while the percent (%) of Imperfect iteration stood at the interaction count (PIC) was calculated at 0.569±0.03. Iteration value in the consensus sequence recorded for dinucleotide highest of 14.8%. Thus, the result of this investigation has extended a clear genetic polymorphism in favour of the Greater Adjutant stork, perhaps yet to face any genetic threat.

Keywords: Leptoptilos dubius (Gmelin) Perfect Imperfect Iterations; Microsatellite; Polymorphism; Genetic Status; Greater Adjutant;

Abbreviations: Introduction

SSR: Simple Sequence Repeats; PCR: The Greater Adjutant Stork Leptoptilos dubius, an InformationPolymerase Count Chain Reactions; HWE: Hardy-Weinberg endangered recognized as declining species in number as Equilibrium; HI: Heterozygote Instability; PIC: Polymorphic

Perfect and Imperfect Microsatellite Markers in Determination of Genetic Status of Greater Adjutant Bioinform Proteom Opn Acc J Stork (Leptotilos dubius Gemlin) 2 Bioinformatics & Proteomics Open Access Journal per the IUCN Red List criteria under A2bcd+3bcd+4bcd; C2a The categories of microsatellites, the imperfect and perfect Greater Adjutant stork was once very widely distributed repeatson record states as the that source the former of genetic one diversity is more stableof a species compared [38]. in[1-3] India, and South the species and South is in the East verse Asia, of butextinction. currently The available species gives the opportunity to identify the perfect and imperfect to the later [39,40]. And the application of bioinformatics tool only in Assam and Bihar in India [4-10] and a very few in birdsSouth have East beenAsian found countries in Assam, [1,11,12]. considered Of the tototal be estimatedthe global mutationIt has [41]. already been accepted that except for repeat copy global population of about 1000-1200 birds [13], about 800 number variation, a microsatellite (e.g., ATATATATAT) also has been endowed with the richest diversity of storks and ofstronghold the twenty of thisspecies stork. of Accordingstorks, eleven to Luthin are found [1] South in South Asia mutations, attains the status of imperfect (e.g., ATATATCATAT: East Asia among which eight species are reported from ATsuffers repeat from with nucleotide an insertion substitutions of C and and the insertion/deletion genomes possess

India [1,14]. Seven species of storks are found in Assam a relatively small but significant number of imperfect Kamrup[15,16] ofDistrict which of the Assam, Greater India Adjutant holds the is highest an endangered number variationmicrosatellites being less [42]. prone Imperfect to slippage microsatellites mutation, allows is critical the ofspecies. Greater The Adjutant Dadara-Pacharia-Singimari and is located just village10 km areaaway in from the imperfectfor their maintenance microsatellites in the to genomebe more [43] stable due comparedto mismatch to

of motif mismatches in imperfect microsatellites is still the Greater city of Guwahati,Adjutant Leptoptilos Assam, India dubius [17,18]. has been According adjudged to extremelyperfect microsatellite limited and [40]. their Yet, correlation the level ofwith understanding life aspects asICBP/IWRB the systematically Storks, ibises disappeared and spoonbill bird species group throughout including demands critical evaluation. its early distribution ranges and this might be the possible reasons to attract this species as the most threatened one with the extinction possibilities, needs special attention be one of the reason for no genetic variability investigation, yet certainLack of attemptsspecies-specific were mademicrosatellite on the genetic markers, variability perhaps and to a certain degree of ecological approaches are available [1,18,19]. Information related to its taxonomy, morphology this species exhibits no migratory behaviour and tends to using microsatellite markers in other birds [44,45] like use[20-25], the colonial yet without sites over with the any years genetic like information.that of wood Sincestork oriental population of white stork [46], European white stork Mycteria americana decline[47], white of the faced Greater Ibis [48],adjutant Painted has storkdrawn [49], wider Wood attention stork to[50] this and background. in Asian woolly Hence, necked the aim stork of the [51]. present Thus, study the rapid was [26], generally response to the seasonal to analyse perfect and imperfect microsatellite markers for fluctuation like its attempt for pairing and colony formation determination of genetic status of Greater Adjutant Stork in theSo same far, no locality approach of their has nestingbeen made sites to [27]. investigate on the (Leptoptilos dubius Gmelin). The objectives were to genetic variability in Greater adjutant, which could perhaps  Examine the levels of genetic diversity, be able to determine its position with the help of molecular  Inbreeding status, and markers like microsatellites. Microsatellites or simple  Leptoptilos dubius. Population differentiation in breeding colonies of sequence repeats (SSR) are the nucleotide tandem repeats Microsatellitesof short sequence are motifthe regions of 1-6 baseof DNA pairs that [28], contain distributed di, tri markers developed for L.dubius that have been compiled orboth tetra in nucleotide coding and repeats. non-coding They are regions randomly of DNA distributed [29,30]. This study reports on the five new microsatellite white stork Ciconia ciconia and white heron Ardea herodias high degree of polymorphic nature, they are extensively in a series of PCR with six markers previously described for usedacross in the studies genome related of most to species evolution [31,32]. of genetic Because status of their of the levels of genetic diversity, inbreeding and population differentiation[47,52]. Hence thein breedinggoal of the colonies, present whichstudy wascould to examineperhaps microsatellite in the coding region often changes the protein be able to suggest a benchmark information to formulate a species [33]. Increase or decrease of repeat base number in conservation action plan. product [29,34], and in the noncoding regions leading to the Materials and Methods 10mutationsto 10 [35]. They are concomitant and highly polymorphic markerspolymorphism,-2 [36]-6 carries they are high extensively increases used the mutationin studies rate related like Sampling per meiotic cycle [37]. Because of their high higher rate of mutability the microsatellite has been placed Samples for the present work had been collected from to evolution of genetic status of a species [33]. Due to its

Sharma DK, et al. Perfect and Imperfect Microsatellite Markers in Determination of Genetic Status of Copyright© Sharma DK, et al. Greater Adjutant Stork (Leptotilos dubius Gmelin). Bioinform Proteom Opn Acc J 2021, 5(1): 000137. 3 Bioinformatics & Proteomics Open Access Journal the dead specimens of Greater adjutant either from adult centrifuge tube to which 500 µL of the following solution was or from the chickens at certain wetlands and from the lone garbage site of the capital city of Guwahati in the Kamrup NaCl and 0.8%-1 SDS followed by the-1 District of Assam situated between 25°43 and 26°51 N addedaddition comprising of K 40 µg.mL of-1 10 proteases. mmol-L ,A Tris-HCl, veterinarian 100 mmol-Lfrom the Latitudes and 90°12 and 90°36 E Longitudes/ (Table 1)./ A EDTA,College 150of Veterinary mmol-L Science, Guwahati, India collected the total of 23 tissue samples/ were /opportunistically collected °C till the extraction of DNA. 0.2 g of dead tissues (for each sample) was placed in 2mL of tissue samples, kept in 95% ethanol and stored at -20 following the procedure of Huang and Zhou [53]. In brief Sl. No Wetlands and other foraging sites GPS point 1 Digheli Beel, Dadara 2 Bhoka Beel, Dadara 26°14´17.87´Ń/91°39´17.92´É 3 26°13´26.51´Ń/91°38´31.06´É 4 Singimari, Dadara Pondoba Beel, Dadara 26°13´25.55´Ń/91°38´41.05´É 5 Deepar Beel, Guwahati 26°13´11.69´Ń/91°38´36.36´É 6 Jeng Beel,North Guwahati 26°06´53.01´Ń/09°40´49.62´É 7 Garbage Dump, Boragaon 26°16´45.30´Ń /91°46´33.40´É Table 1: 26°06´53.01´Ń/91°40´49.62´É Extraction GPS coordinates of DNA andof foraging Selection wetlands of Marker and sample collectionon sites the usefor Greaterof existing Adjutant microsatellite Stork. markers on species for

L. dubius was polymorphicwhich they were microsatellite not originally markers designed comprising [55]. Therefore, of three in attemptedDNA isolation to be evaluated was carried by using out usingmicrosatellite modified markers Phenol- the present study cross-species amplification of six highly andChloroform no microsatellite method [54]. markers The Genetic have been status developed of from L. other 3 markers originally developed from Great blue heron dubius markers originally developed from White stork [47] and substantial input of time as well as expertise. to ascertain the genetic marker for L. dubius. The details of so far. Development of microsatellite markers requires the[52] markers were initially used aretested given to assessin the Table the possibility 2. of their use For this reason, considerable effort was given in general

Sl.No. Locus Primer Sequence (5’-3’) TA (⁰C) Developed From F: TTCTTGCATTTGCTCCAGTG 1 Cc01 55 Ciconia ciconia R: CACAAACATCAGCAAGGACAG F: CTCGCTGTCTCCTCTGCTCT 2 Cc06 55 Ciconia ciconia R: GAACAGCAATATCGCATCTACA F: GCATGAAAATGCATAGAGCAGA 3 Cc07 55 Ciconia ciconia R: CCACCGTTATGATCCTTTGG F: GCTCATCAGGAGTTGAATCTGGC 4 Ah211 55 Ardea herodias R: TCTGTCATTCAGCAATGGACC F: GGTAATGATTCTGATTTACCACTGAGGG 5 Ah341 55 Ardea herodias R: ATGTGTTATCATATCTGGTCTTCACAGC F: CATTGCTTAACTTCTGAAGAAAC 6 Ah343 55 Ardea herodias R: CTTGACCCAGCATTTGTGAATAAAACTG Table 2:

PCR primers used for amplification of microsatellite loci of Greater adjutant Stork.

Amplification of Microsatellite Markers In Silico Microsatellite Analysis The microsatellites were obtained using the for a reaction volume of 25µl composed of 100ng of a DNA bioinformatics software tool IMEx (Imperfect Microsatellite All the Polymerase Chain Reactions (PCR) were set template, 0.4 µmol. L per primer, 1.5 m.mol. L MgCl2, Extractor) followed after Mudunuri and Nagarajaram 0.2mmol. L -1 Taq Pol -1 -1 DNTP and 0.8 U [53]. The PCR was microsatellites[59]. IMEx uses and simple reports string-matchingthe motif, copy number, algorithm genomic with atallowed 95°C forto proceed 15 min, ondenatured a Bio-Rad at thermal 94°C for cycler. 30 s, Theannealed settings at location,sliding window nearby genes, approach mutational to screen events DNA and sequences many other for were as°C followsfor 80 sec, that extended the products at 72 ° wereC for pre-60s and degenerated after 40 cycles the products were extended at 72°C for 10 min. The mutation was calculated as: reaction50 -55 was allowed to terminate at 4° features useful for in-depth studies. The percentage of had been detected by 1% agarose Ethidium bromide (EB) tract X100 / gel electrophoresis and the effective primersC. The were PCR selected. product tract.Percent (%) = number of point mutation in the observed Total number of bases in the equivalent perfect ® 3100 Parameters Used For Repeat Types TheGenetic PCR Analyser products and were the gel allele purified sizes andwere sequenced determined for using both forward and reverse direction using an ABI PRISM • Imperfect: Imperfection was counted at 10% for Mono, comparedGENEMAPPER with versionNCBI GenBank 4.0 (Applied database Biosystems) using programme and 500- LIZ as size standard. The sequences generated were then Di, Tri, Tetra, Penta and Hexa repeats. Mismatches • Minimumallowed in PatternNo. of Repeatare for Mono:Units: 1,Mono: Di: 1, 5,Tri: Di: 1, 3,Tetra: Tri: 2,1, BLASTNVerification [56] and were of deposited Amplified in the PCR GenBank. Products and Penta: 2, Hexa: 2; Genetic Analysis ResultsTetra: 2, Penta: and 2,Discussion Hexa: 2 The genetic status of L. dubius was evaluated in terms of observed heterozygosity (Ho) and expected heterozygosity (H ).The estimates of H and H were obtained using markers were recorded to be polymorphic with the number e o e Evaluation of Genetic Status: All the five microsatellite population genetics software package Excel Microsatellite of alleles varying between 2 to 9 across all the loci used (Table 3). The locus Ah341 was observed to have 2 alleles, while the locus Cc07 presented 9 alleles. The mean observed Toolkit 3.1.1 (http://animalgenomics.ucd.ie/sdepark/ Heterozygosity (Ho) 0.752±0.09 and the mean expected mstoolkit/). And this tool generates perfect and imperfect Heterozygosity (He) 0.677±0.06 has been depicted in the Table repeats [57] as well as the differential distribution of repeats [58]. Deviations from the Hardy-Weinberg Equilibrium were 3 out of the 5 microsatellite loci namely Cc01, Cc06, Cc07 and tested using Chi-square test. The nucleotide counts, A-T and 3. The test of Hardy-Weinberg Equilibrium (HWE) presented G-C content as well as individual nucleotide frequencies for all the sequences generated were further estimated. Ah341 deviated from the HWE. Locus Repeat Motif Allele Size Na He Ho PIC P % * Cc01 (TTCT)10 6 0.842 0.761 0.534 0.0467 55 Cc06 (TG) 5 0.638 0.854 0.653 0.0312* 60 13 161-259 Cc07 (AAAG) 9 0.613 0.347 0.456 0.0212* 75 10 201-262 Ah211 (CA) 4 0.845 0.792 0.574 0.1217** 21 13 273-290 Ah341 (AC) 2 0.813 0.631 0.655 0.0342* 61 12 100-114 Mean 5.2 0.752±0.09 0.677±0.06 0.574±0.03 182-207 Table 3:

Characterization of polymorphism in five Microsatellite loci of Greater Adjutant Stork. Na= Number of alleles; He = Expected heterozygosity; Ho= Observed heterozygosity; PIC = Polymorphism information count; P= probabilities of Hardy-Weinberg Equilibrium Test (HWE); P=<0.05 indicates significant deviation from that of HWE test. ‘*’ = Significantly different.

jurisdiction. The mean observed heterozygosity of the present study might be within the similar range with that of Microsatellites amplified with specific primers (12 Mycteria leucocephala sequences out of 23 samples) have been depicted in the Table 4, with iteration and probable mutation (P %). The sequence woollyanother necked stork group stork like (Ciconia Painted episcopus) stork in 66 individuals pairsKY 5252(67, was 2918 68, (Table 69, 70, 4). 71, 72 and 78) showed for imperfect of[49]. population Recent structure studies on in captivity the genetic (Nakhon diversity Ratchima of Asian Zoo, iteration (P %) in between 3-15%. The total number of base NRZ) using 13 microsatellite loci, allowed to infer that the The present analysis on the status of the genetic deleterious genetic issues had been resulted out of captivity polymorphism in Greater Adjutant Stork revealed that the not been possible for the Greater adjutant. However, the of being genetically stable in terms of heterozygosity. All [51], though such experimentation and evaluation had thepopulation microsatellite has been markers qualified had to well be threatenedbeen recorded despite as polymorphism and favours the proposition that the Greater polymorphic with the number of alleles varying in between adjutantpresent study is yet forto facethe firstany genetictime extended threat. Further,the idea itof has genetic well been argued for the heterozygote instability (HI) hypothesis, to have the lowest number of alleles, whilst the locus Cc07 that it locally increases the mutation rate and there has been was2-9 in recorded all the loci for used 9 alleles so far. The(Table loci 3).Ah341 The had heterozygosity been observed of the L. dubius might be high for the microsatellite markers as used in the present study with the mean value recorded increasesthe occurrences the mutation of rare rate allele of ACheterozygous sequence ofsite microsatellite itself. against observed heterozygosity (Ho) at 0.752 ±0. 09. The [67], since the tandem repeats [68] suggest the HI potentially that of Ciconia boyciana . The expected heterozygosity encountered to the microsatellite loci studied from 0.455 (He)sequences is the haveprobability been found that two to be alleles identical chosen in nature at random with to 0.655The with polymorphic a mean value information of 0.577 count (Table (PIC)3) might values be [53] suggestive of allele medium number carries a considerable representation of a sample is the observed Heterozygosity degree of genetic variability could well be supported by the from a population are different [60] and proportionate diversity could well be regarded as a measure of genetic (Ho) [61]. Therefore, these two definitions of mean gene beenwork consideredof Fonteque as and the colleagues high degree [62]. of polymorphism,It was of the opinion while The use of microsatellite in establishing the polymorphic that when the PIC of the gene locus is greater than >0.5 has charactervariability whichand genetic might bevariability significantly has informative already been in nature. well L the PIC in between 0.25 to 0.5 the gene locus is moderate dubius. Cc07against while the the low highest value whilehad been it is obtained at <0.25. against In the Cc06 present at accepted [62] and favours the present observations on 0.653experiment (Table the4) favoured PIC stands high at degree its lowest of genetic level variability at 0.455 for as wetland ecosystem and being carnivorous, occupies the top The Greater adjutant occupies a significant role in the mentionedTandem in earlierrepeats works recorded [53,69]. in this study for 12 termsposition of [63].the observed The loci Cc01,heterozygocity Cc06, Cc07 (Table and Ah3). 341Thus, have all thebeen values able toobtained present in a termssignificant of the mean characterization value of (0.677) of the in imperfectmicrosatellite mutation sequences (Table are 4), found has beento its able maximum to obtain for the polymorphism in L. dubious have been able to substantiate GenBank sequence Ky515273.1 at 14.8% for GAAA with that the species still out of danger regarding its genetic status viability. Thus, in a given species, microsatellite thesupport form ofof certainpolymorphism workers (Table [68]. 3).The It repeatshas been of categorically perfect and markers could well be isolated and developed from scratch mentionedimperfect might that thebe usedbulk toof supportsample therepeats present are findingsembedded in

markers like microsatellites generally evolved naturally using methods such as magnetic beads [64] or by applying in noncoding DNA sequence and it is assumed that such Adjutantscross-species usually amplification might have using a high existing degree markersof relatedness from of dinucleotide followed by others might be explained to the closely related species [65,66]. This small group of Greater [58], however, demands further evaluation. The dominance Therefore, it is speculated that the number of loci deviating dinucleotide might also be evident in L. dubius (Table 4) and which showed even a marginal deviation from that of HWE. thelevel existence of only microsatellite of repeats having evolution little or [57]. no dependence The abundance on the of not the single breeding population group, possibly represent forfrom many the HWEfrom mightdifferent be evidentrange within that these their individuals distributional are population size [67].

GenBank Consensuses sequences with iterations and the (%) value of imperfect mutation within the Accession parenthesis, if any. The total number of base pairs were 2918 number TCTG TCTT GAAA TCT (2) TCA (2) GA (3) (3.8%) (4.6%) (5.9%) TCTG GTTTT GACG GGGA KY515267 TCT (2) TCA (2) AG (4) (4.6%) (2) (3.8%) (3.8%) GCAT TCTG (4, GAAA GACA AGA TCG KY515268 TCT (2) TCA (2) (2) 6%) (3.8%) (5.8%) (2) (2) CAGGG TG KY515269 AT (3) TA (3) TC (3) CAG (2) (2) (8.6%) CAGGG TG KY515270 AT (3) TA (3) TC (3) CCTT (2) TG (3) (2) (9.5%) TG GTG AGA KY515271 AT (3) TA (3) TC (3) CCTT (2) TG (3) (9.5%) (2) (2) GTAT AGAA GAAA AAGA ATG GAAA AAGA KY515272 TTG (2) ATC (2) AT (3) (2) (13.9%) (14.8%) (2) (2) (9.5%) (2) KY515273 AG (3) TAC (2) CAA (2) TGC (2) A (5) G (5) ACAGC GCT (2) A (5) TG (3) GT (3) TA (3) KY515274 (2) GAACGC KY515275 A (7) AT (3) (1) AGTG KY515276 CA (4) CTCA (2) TAC (2) GT (3) ATG (2) (3.1%) AGCCTT KY515278 CA (4) CTCA (2) TAC (2) AG (4) (2) TableKY515279 4: Microsatellite repeat numbers for perfect and imperfect iterations are shown with repeat numbers for Mono (7), Di

(9.5) Tri (2), Tetra (14.8), Penta (2) and Hexa at (2). Category wise dinucleotide numbers are TG=20, AT=15, AG=11, CA=8, TC=3, GT=3, CA=3, while the mononucleotides are A=12 and G=5 for the microsatellite representations. (% =Imperfection). ‘p %’ = Imperfection %. The present analysis showed the dominance of complex compound (GT)n, and (GA)n repeats both shows only dinucleotide followed by mono, di, tri, tetra, penta and hexa moderate level of polymorphism, yet we demand further at only 2. And among the dinucleotide TG (20), AT (15), AG (11), CA (8) and GA, TA, TC, GT are at 3, while the mono A is at 12 as well as G is noted at 5. However, it is a matter fact, how mono,study tetra, over penta their and aspects hexa [70].nucleotide The recordedmotif respectively. dinucleotide The dinucleotiderepeats were/are repeats (Table have 4) been most known prevalent to be followedassociated by with tri, atleast 12 bp long mononucleotides repeats which outnumber copy number variations strand slippage and polymorphic, dinucleotidemicrosatellites repeats; are defined, the reverse since among situation the repeatsis not valid there until are Further, the dinucleotide contribution towards SSR motifs extendsaccounting a platform for genome like evolutionrepeat and and another adaptation complete [71]. (GC)n,a higher the threshold last type isof usedrepeat [67]. being Among rare. dinucleotideNote that there (TG)n are compound (GT). However, the microsatellite density has onlyrepeats four are possible the most types frequent, of dinucleotide followed by repeat, (AT)n, because (CA)n and CA often been attempted to correlate with the genome size, yet

Data, not to speak of stork, but also from other birds are least A model based on the distribution of microsatellite repeat = AC = GT = TG, GA = AG = CT = TC, AT = TA, and GC=CG [57]. the present investigation is data deficient in this direction. analysisavailable on till the date. patterns However, of 3 mouseavian microsatellites genome has confirmed loci, chosen an notlength, be extended which might to the be present at equilibrium work. However, perhaps the due tandem to a forimpressive three different number class of microsatellites of microsatellites (57,70]. which A comparativeare possibly balance between length and point mutation [72,73], could in line with the present like perfect (GA)n repeat and other extend an explanation in the form of iterations of repeat repeats [68] as presented in the Table 4 might be able to

4. (systematicallyCiconia boyciana) disappearing. and 17 storks Yet, from Zan a Japanese and colleagues population. [74] analysed the sequences of 66 storks of Oriental white stork Saikia PK, Bhattacharjee P (1989) Adjutant storks at risk population subdivision between the two populations, where in Assam, India. ICBP/IWRB specialist group on Storks, An analysis of molecular variance showed a significant the Chinese population had a relatively higher genetic 5. IbisesRahmani and AR,Spoonbills Maheshwaran Newsletter G, 2(1-2): Coulter 6-8. MC (2004) diversity with a haplotype diversity and nucleotide diversity Ephippiorhynchus asiaticus Recent records of Black-necked Stork 3).[53]. It However,has also been the closer favoured genetic that relationshipthe observed is low obtainable genetic 6. Rahmani inAR, the Narayan Indian subcontinent. G, Rosalind ForktailL (1990) 5: Status112-116. of variationin cross-specific in Mycteria amplification Americana as ofevident Cuba within this small study colonies (Table the Greater Adjutant (Leptoptilos dubius) in the Indian considered as valuable information for the conservation managementsuffering from of anthropogenicstork population interferences in a given habitat. [50] might It may be 7. Subcontinent.Choudhary SK, Colonial Dey S, WaterbirdsDey S, Mitra 13(2): A (2004) 139-142. Sighting also be well argued that these sets of microsatellites used of the Greater Adjutant stork Leptoptilos dubius in in this study proved to be useful for the Greater adjutant Vikramshila Gangetic Dolphin Sanctuary, Bihar, India. stork genetics and conservation implications. Earlier it has been advocated that they could be used for genetic linkage 8. mapping in the common pheasants and its closely related Journal of Bombay Natural History Society 101: 313-314. Hancock J, Kushlan JA, Kahl MP (1992) Storks, Ibises and 9. SpoonbillsMisra AM, ofMandal the World. JN (2010) Academic Discovery Press, pp:of 385-392.a breeding pheasantsConclusion [45,64]. ground of the Greater Adjutant Leptotilus dubius and

their conservation in the floodplains of Bihar, India. This research used five microsatellite markers that were found to be polymorphic, with the number of alleles 10. Journal of Bombay Natural History 106(2):190-197. rangingwere cross-species from 2 to 9 in specific. each locus. All fiveThe microsatellitelocus Ah341 was markers found B (2020) Saving the Greater Adjutant Stork by Changing to have two alleles, while the locus Cc07 had nine. For the Barman PD, Sharma DK, Cockrem JF, Malakar M, Kakati microsatellite markers used, the heterozygosity of L. dubius was found to be high, with a mean observed heterozygosity Perceptions and Linking to Assamese Traditions in India. 11. Ethnobiology Letters 11(2): 20-29. (He) 0.677±06. The predicted heterozygosity was found to Species diversity and ecology of Tonle Sap Great Lake, be(H0) slightly of 0.0.753 higher +/- than 0.09 the and observed a mean predicted heterozygosity. heterozygocity It can be Campbell IC, Poole C, Giesen W, Valbo-Jorgensen J (2006) inferred that the microsatellites used in this analysis were 12. Cambodia. Aquatic Sciences 68(3): 355-373. the Greater adjutant stork. beneficial to the genetics and conservation consequences of Clements T, O’Kelly H, Sun V (2007) Monitoring of Large Authors Contributions waterbirds at Prek Toal, Tonle Sap Great Lake 2001- 2007. Wildlife Conservation Society Cambodia Program, 13. PhnomBirdlife Penh,International Cambodia, pp:(2018) 1-27. Species Factsheet: Leptoptilos dubius. and DKSCB performed and PDB were the data involved analysis. in planning, DKS and designing, CB wrote andthe realizing the present work. PD performed the experiments 14. aspects of breeding biology of Greater Adjutantt Stork, manuscript. Saikia PK, Bhattacharjee PC (1996) Studies on some manuscript. All authors read, revised, and approved the final Leptoptilos dubius from the Brahmaputra Valley Assam. References 15. Choudhury A (2000) The Birds of Assam. Gibbon Books 1. Luthin CS (1987) Status of and conservation priorities Tropical zoology 1(1): 57-64. for the world’s stork species. Colonial water birds. 10(2): and WWF, pp: 239.

Sharma181-202. DK, et al. Perfect and Imperfect Microsatellite Markers in Determination of Genetic Status of Copyright© Sharma DK, et al. Greater Adjutant Stork (Leptotilos dubius Gmelin). Bioinform Proteom Opn Acc J 2021, 5(1): 000137. 8 Bioinformatics & Proteomics Open Access Journal

16. and plasticity. BMC Genomics 7: 78

Saikia PK, Bhattacharjee P (1993) Present status and 30. conservation of Wetland Birds in Brahamaputra Valley, Assam. Proceedings of Ornothological Society of India, Sreenu VB, Kumar P, Nagaraju J, Nagarajaram HA (2007) 17. pp: 20-27. Simple sequence repeats in mycobacterial genomes. J Treatment and Release of an endangered Greater 31. BiosciMiesfeld 32(1): R, Krystal 3-15. M, Amheim N (1981) A member of AdjutantBarman PD,Leptoptilos Ali S, Deori dubius P, Sharma DK (2015) Rescue, throughout eucaryotic evolution is found between the 18. Barooah D (1991) Greater. Zoo’sAdjutant Print stork30(9): nesting 6-9. in a new repeated sequence family which is conserved

human δ and β globin genes. Nucleic Acids Res 9(22): 19. Assam. Newsletter for Birdwatchers. 30(7): 5-7. 32. 5931-5947.Stallings RL, Ford AF, Nelson D, Torney DC, Hildebrand Sharma DK (2011) Conservation of Adjutant Stork CE, et al. (1991) Evolution and distribution of (GT) (CiconidaeSaikia PK, : SaikiaLeptoptilos MK, dubius Bhattacharjee and Leptoptilos PC, Coulter javanicus) MC, in South and Southeast Asia. India biodiversity portal 1: repetitive sequences in mammalian genomes. Genomics 33. 10(3):Dawson 807-815. H, André S, Karamitopoulou E, Zlobec I, Gabius 20. 189-211. HJ (2013) The growing galectin network in colon cancer the Ciconidae based on behavioral and morphological Wood DS (1984) Concordance between classification of and clinical relevance of cytoplasmic galectin-reactivity. 21. data. Journal Fur Ornithologie 125 (1): 25-37. 34. Anticancer Res 33(8): 3053-3059. within genes: structure, function, and evolution. Mol Biol Kahl MP (1972) A revision of the family Ciconidae (aves). Li YC, Korol AB, Fahima T, Nevo E (2004) Microsatellites 22. Journal of Zoology 167(4): 451-461. 35. Evol 21(6): 991-1007. Kahl MP (1987) An overview of the storks of the world. (2005) Microsatellite instability regulates transcription 23. ColonialMiller E, WaterbirdsRasmussen 10(2):DT, Simons 131-134. EL (1996) Fossil storks Martin P, Makepeace K, Hill SA, Hood DW, Moxon ER (Ciconiidae) from the late Eocene and early Miocene of factor binding and gene expression. Proc Natl Acad Sci 36. USA 102(10): 3800-3804. 24. Egypt.Singha OstrichH, Rahmani 68(1): 23-26.AR, Coulter MC, Javed S (2002) microsatellite isolation: a review. Zane, LB, Patarlello T, Bargelloni L (2002) Strategies for (Leptotilus dubbius) in the Brahaputra valley of Assam, 37. Mol Ecol 11(1): 1-16. Parental investment in the Greater Adjutant Stork Microsatellites: genomic distribution, putative functions andLi YC, mutational Korol AB, mechanisms: Fahima T, a Beiles review. A, Mol Nevo Ecol E 11(12): (2002) 25. India. Malayan Nature Journal 56(3): 239-264.

Barman PD, Sharma DK (2014) Conservation of 38. 2453-2465. Endangered Greater Adjutant in Assam India. Waterbirds advantageous mutators in evolution. Trends Genet 26. of India 16: 202-209. Kashi, Y, King DG (2006) Simple sequence repeats as

Frederick P, Ogden JC (1997) Philopatry and Nomadism: 39. 22(5): 253-259. Contrasting Long-Term Movement Behavior and (1998) A tetranucleotide polymorphic microsatellite, Population Dynamics of White Ibises and Wood Storks. Meloni R, Albanèse V, Ravassard P, Treilhou F, Mallet J 27. Colonial Waterbirds 20(2): 316-323. gene, acts as a transcription regulatory element in vitro. and genetic status of Greater Adjutant Stork Leptoptilos located in the first intron of the tyrosine hydroxylase dubiusBarman Gmelin PD (2018) Foraging Ecology, breeding success Gauhati University, India. 40. Human Molecular Genetics 7(3): 423-428. in Kamrup district, Assam. PhD thesis 28. Schlotterer C (2000) Evolutionary dynamics of associatedSturzeneker microsatellite R, Haddad instability. LA, Bevilacqua Hum Genet RA, Simpson 102(2): AJ, Pena SD (1998) Polarity of mutations in tumor-

29. microsatellite. Chromosoma 109(6): 365-371. 41. 231-235. Microsatellite polymorphism across the M. tuberculosis andSreenu M. bovis VB, Kumar genomes: P, Nagaraju Implications J, Nagarajaram on genome HA evolution (2006) 580.Benson G (1999) Tandem repeats finder: a program to analyze DNA sequences. Nucleic Acid Res 27(2): 573-

42. Brinkmann B, Klintschar M, Neuhuber F, Hühne J, Rolf B 53.

of the structure and length of the tandem repeat. Am J whiteHuang Sork Y, Zhou (Ciconia L (2011) boyciana Screening and application of (1998) Mutation rate in human microsatellites: influence microsatellite markers for genetic diversity of Oriental 54. Ausubel FM, Brent R, Kingsten). Chinese RE, Moore birds DD, 2(1): Seidman 33-38. 43. Hum Genet 62(6): 1408-1415. rd

Behura SK, Severson DW (2015) Motif mismatches in JG, et al. (1996) Short Protocols in Molecular Biology 3 microsatellites: insights from genome-wide investigation 55. (Edn) John Wiley and Sons, New York 24(1): 68. 44. among 20 insect species. DNA Res 22(1): 29-38. in a stream dwelling salmonid: inferences from tagging andWilson microsatellite AJ, Hutchings studies. JA, Ferguson Conservation MM (2004) Genetics Dispersal 5(1): Murata K, Satou M, Matsushima K, Satake S, Yamamoto populationY (2004) Retrospective in Japan using estimation mounted of geneticspecimens diversity and implicationsof an extinct for Oriental reintroduction White Stork programs. (Ciconia Conservation boyciana) 56. 25-37. (1990) Basic local alignment search tool. J Mol Biol Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ 45. Genetics 5(4): 553- 560. Smith CA, et al. (2011) Genetic applications in avian 57. 215(3): 403-410. Haig SM, Bronaugh WM, Crowhurst RS, D’elia J, Eagles- Ellegren H (2004) Microsatellite simple sequences with 46. conservation. The Auk 128(2): 205-229. 58. complex evolution. Nat. Rev Genet 5(6): 435-445.

Zane L, Bargelloni L, Pattranello T (2002) Strategies for Katti MV, Ranjekar PK, Gupta VS (2001) Differential 47. microsatellite isolation: a review. Mol Ecol 11(1): 1-16. distribution of simple sequence repeats in eukaryotic 59. genomeMudunuri sequences. SB, Nagarajaram Mol Biol HAEvol (2007) 18(7): IMEx: 1161-1167. Imperfect ofShephard microsatellite JM, Galbusera markers P, Hellemans in the European B, Jusic A,white Akhandaf stork CiconiaY (2009) ciconia Isolation and characterization of a new suite 1187. Microsatellite Extractor. Bioinformatics 23(10): 1181- 48. de Castro E, .Souza Conservation AS, Miño Genetics CI, Lama 10: 1525-1528. SN (2012) 60. Nei M (1973) Analysis of Gene diversity in subdivided

Polymorphic heterologous microsatellite loci for 61. populatios. Proc Natl Acad Sci USA 70(12): 3321-3323. population genetics studies of the white-faced ibis Belkhir K (1999) Genetix: logiciel sous Windows TM Plegadis chihi (Vieillot, 1817) (Pelecaniformes, pour la génétique des populations. Laboratoire Genóme, 49. Threskiornithidae). Genet Mol Biol 35(1): 74-80. Montpellier II, Montpellier, France. Populations, Interations. CNRS UPR 9060, Université 62. Sharma BB, Banerjee BD, Urfi AJ (2017) A preliminaryMycteria study of cross-amplified microsatellite loci using molted leucocephala) population of north India as a DNA Fonteque GV, Battilana J, Paludo E, Lima-Rosa CA source.feathers BMC from Research a near-threatened Notes 10(1): Painted604. Stork ( (2014) Genetic polymorphism of fifteen microsatellite 50. Llanes–Quevedo A, Alfonso González M, Cárdenas MR, loci in Brazilian (blue-egg Caipira) chickens. Pesquisa 63. Singha, H (1998) Breeding behavior of Greater Adjutant Frankel C, Espinosa LG (2018) Microsatellite variability Veterinária Brasileira 34(1): 98-102. Stork Leptotilus dubius (Gmelin) in Assam, India, of the wood stork Mycteria americana (Aves, Ciconidae) Doctoral Dissertation, Aligarh University, India. in Cuba: implications for its conservation. Animal 64. nine microsatellite loci for a globally vulnerable species, 51. Biodiversity and Conservation 41(2): 357-364. Wang N, Liu Y, ZhangSyrmaticus ZW (2009) reevesii Characterization). Conserv Genet of Jangtarwan K, Koomgun, Prasongmaneerut T, backward to move forward: Assessment of genetic Reeves’s Pheasant ( Thongchum R, Singchat W, et al. (2019) Take one step diversity and population structure of captive Asian 65. 10:Dawson 1511-1514. DA, Horsburgh GJ, Kupper C, Stewart IR, Ball Ciconia episcopus AD, et al. (2010) New methods to identify conserved microsatellite loci and develop primer sets of high woolly-neckeed storks ( ). PLoS One 52. 14(10):McGuire 1-12. HL, Noor MA (2002) Microsatellite loci for great white herons and great blue herons (Aves, Ardeidae, cross-species utility-as demonstrated for birds. Mol Ecol Ardea herodias). Molecular Ecology Notes 66. Resour 10(3): 475-494.

2(2): 170-172. Gu LY, Liu Y, Wang N, Zhang ZW (2012) A panel of Sharma DK, et al. Perfect and Imperfect Microsatellite Markers in Determination of Genetic Status of Copyright© Sharma DK, et al. Greater Adjutant Stork (Leptotilos dubius Gmelin). Bioinform Proteom Opn Acc J 2021, 5(1): 000137. 10 Bioinformatics & Proteomics Open Access Journal

dimer repetitive DNA is consistent with its evolution by (Crossoptilon auritum polymorphic microsatellites in the Blue Eared Pheasant ) developed by cross-species an unbiased single-step mutation process. Journal of 67. amplification. Chinese Birds 3(2):103-107. 73. Molecular Evolution 44: 414-421. mutation rate. Biology Letters 12: 20150929. Amos W (2016) Heterozygosity increases microsatellite resultingKruglyak from S, Durrett a balance RT, Schug between MD, slippage Aquadro events CF (1998) and 68. Equilibrium distributions of microsatellite repeat length 10778. Wexler Y, Yakhini Z, Kashi Y, Geiger D (2005) Finding point mutations. Proc Natl Acad Sci USA 95(18): 10774- approximate Tandem repeats in Genomic sequences. J 74. 69. Comput Biol 12(7): 928-942. Ciconia Construction of a genetic linkage map in man using boycianaZan ST, Zhou IZ, Jiang H, Zhang BW, Wu ZA, et al. (2008) restrictionBotstein D, fragment White RL, length Skolnick polymorphisms. M, Davis RW Am (1980)J Hum Genetic structure of the Oriental white stork ( ): Implications for a breeding colony in a non- 75. breeding area. Integr Zool 3(3): 235-244. 70. Genet 32(3): 314-331. DM (2016) The Conservation genetics juggling act: evolution of Avian microsatellites. Molecular Biology integratingHaig SM, Miller genetics MP, Bellinger and ecology, MR, Draheim science HM,and Mercerpolicy. Primmer CR Ellegren H (1998) Patterns of molecular

71. and Evolution 15(8): 997-1008. 76. Evolutionary Applications 9(1): 181-195. Microsatellite diversity, complexity and host range of and characterization of novel microsatellite markers for Alam MC, Iqbal A, Sharma A, Schulmann AH, Ali S (2019) Mycobacterophage genomes of the Siphovirridae Family. Wang B, Xie X, Wang X, PangPhasianus H, Liu Y colchicus (2017) Development Front Genet 10: 207. the Common Pheasant ( ) using RAD- 72. Bell GI, Jurka J (1997) The length distribution of perfect seq. Avian Research 8: 4.