DOCSLIB.ORG

Seres Health, 160 First Street Suite 1A, Cambridge MA 02142 1

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Seres Health, 160 First Street Suite 1A, Cambridge MA 02142 1 Genetics: Early Online, published on September 27, 2013 as 10.1534/genetics.113.152306 1 Tolerance of Escherichia coli to fluoroquinolone antibiotics depends on specific 2 components of the SOS response pathway 3 4 Alyssa Theodore, Kim Lewis, Marin Vulić1 5 Antimicrobial Discovery Center, Department of Biology, Northeastern University, 6 Boston, Massachusetts 02115 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 1Present Address: Seres Health, 160 First Street Suite 1A, Cambridge MA 02142 1 Copyright 2013. 32 Fluoroquinolone Tolerance in Escherichia coli 33 34 Keywords: SOS response, Persisters, Tolerance, DNA repair, fluoroquinolones 35 36 Corresponding Author: 37 Marin Vulić 38 Current Address: Seres Health 39 160 First Street Suite 1A 40 Cambridge MA 02142 41 [email protected] 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 2 65 ABSTRACT 66 67 Bacteria exposed to bactericidal fluoroquinolone (FQ) antibiotics can survive without 68 becoming genetically resistant. Survival of these phenotypically resistant cells, 69 commonly called persisters, depends on the SOS gene network. We have examined 70 mutants in all known SOS-regulated genes to identify functions essential for tolerance in 71 Escherichia coli. The absence of DinG and UvrD helicases and Holliday junction 72 processing enzymes RuvA and RuvB lead to a decrease in survival. Analysis of the 73 respective mutants indicates that in addition to repair of double strand breaks, tolerance 74 depends on the repair of collapsed replication forks and stalled transcription complexes. 75 Mutation in recF results in increased survival, which identifies RecAF recombination as 76 a poisoning mechanism not previously linked to FQ lethality. DinG acts upstream of SOS 77 promoting its induction, whereas RuvAB participates in repair only. UvrD directly 78 promotes all repair processes initiated by FQ-induced damage and prevents RecAF- 79 dependent misrepair making it one of the crucial SOS functions required for tolerance. 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 3 96 INTRODUCTION 97 98 In the face of a potentially lethal stress, the presence of phenotypic variants of 99 genetically identical bacterial cells can make a difference between survival of the lineage 100 and extermination. A clonal population of cells of a strain genetically susceptible to an 101 antibiotic can harbor tolerant phenocopies that will survive the antibiotic challenge. 102 These cells are termed persisters and are of special interest because of their ability to 103 influence the outcome of antibiotic treatments (Lewis 2010; Mulcahy et al. 2010). 104 Toxins from chromosomally encoded toxin-antitoxin (TA) modules have been shown to 105 play a role in persister formation under certain condition (Keren et al. 2004; Dorr et al. 106 2010; Gerdes and Maisonneuve 2012) To date, screening of E. coli mutant libraries have 107 yielded no single mutants that completely lack persisters (Spoering 2006; Hansen et al. 108 2008). These studies have shown that there are many pathways that lead to persister 109 formation (Lewis 2010). We have shown that tolerance to fluoroquinolones (FQs) 110 antibiotics depends on a functional SOS response (Dörr et al. 2009). The SOS regulated 111 tisAB/istR toxin antitoxin locus contributes to tolerance to ciprofloxacin (Dorr et al. 112 2010). When overproduced, the membrane peptide TisB decreases proton motive force 113 and intracellular ATP levels (Gurnev et al. 2012). During SOS induction, tisB is 114 overexpressed, which may induce stasis and prevent killing by the antibiotic. However, it 115 only influences tolerance at high ciprofloxacin concentration (100X minimal inhibitory 116 concentration, MIC), therefore it is not the only mechanism of FQ tolerance. 117 Fluoroquinolones target gyrase and topoisomerase IV (Drlica and Zhao 1997). 118 Upon FQ binding these enzymes become endonucleases introducing DSBs into the 119 bacterial chromosome (Malik et al. 2006). Cells repair DSBs largely through the DNA- 120 damage-inducible SOS gene network (Radman 1975; Friedberg 2006). The susceptibility 121 to the FQ therefore depends on the cellular concentration of the active gyrase and 122 topoisomerase molecules and the state of induction of the SOS response. 123 Gyrase and topoisomerase IV are essential during replication and transcription 124 (De Wyngaert and Hinkle 1979) and their maximal amount in a cell is expected during 125 maximal growth rate. Indeed, gyrA and gyrB, structural genes of DNA gyrase, reach 126 maximal expression in the early exponential growth phase and decrease during 4 127 subsequent growth, attaining the lowest level in stationary phase (Gomez-Gomez et al. 128 1996; Schneider et al. 1999). The susceptibility to FQs would be expected to parallel to 129 this dynamic and experimental data confirm this; the bactericidal effect of FQs is the 130 largest in early exponential phase and the lowest in stationary phase (Keren et al. 2004; 131 Dörr et al. 2009). 132 The SOS gene network is controlled by the LexA repressor, and LexA regulated 133 genes exhibit heterogeneous expression in a culture not subject to an external SOS- 134 inducing treatment (McCool et al. 2004). The heterogeneity of expression is a result of 135 stochastic factors resulting from the binding affinity of LexA to different SOS boxes and 136 intrinsic DNA damage (Pennington and Rosenberg 2007; Kamensek et al. 2010; Butala 137 et al. 2011). Combined heterogeneity of the expression of the target and the repair 138 mechanism translates into a wide spectrum of phenotypic states and hence varied 139 susceptibility to a FQ. 140 In this study we have analyzed knock-outs of all known SOS genes (Fernandez 141 De Henestrosa et al. 2000; Courcelle et al. 2001) in order to identify the SOS functions 142 crucial for tolerance. We have found that the removal of DinG, UvrD and RuvAB lead to 143 the formation of fewer persisters at high and low concentrations of the antibiotic, 144 confirming that the repair processes these proteins catalyze are essential for tolerance. In 145 addition, the inactivation of recF leads to an increase in tolerance, identifying the 146 RecFOR recombination pathway as a poisoning mechanism. 147 148 MATERIALS AND METHODS 149 150 Tolerance Assays 151 All killing experiments were conducted at 37˚C in cation adjusted Mueller Hinton 152 Broth (MHB, Teknova) buffered with 0.1 M HEPES pH 7.2 unless otherwise noted. 153 Cultures were treated with 0.1 μg/ml ciprofloxacin, unless otherwise noted. Tolerance 154 was tested by diluting an overnight culture of 1:100 in 3 mL of fresh MHB in 17- by 100- 155 mm polypropylene tubes placed at an angle on a rotating platform and growing for 1.5 156 hours with shaking (200 rpm), until there were approximately 2x108 colony forming units 157 (CFUs) per ml. CFU counts were measured by washing cells with 1% NaCl to remove 5 158 the antibiotic, serially diluting and plating on Luria-Bertani (LB) agar supplemented with 159 20 mM MgSO4 to neutralize ciprofloxacin carry over. The colonies were counted after 40 160 hours incubation at 37°C. For UvrD complementation experiments, 0.1 mM IPTG was 161 added to the diluted culture 30 minutes prior to ciprofloxacin treatment. All antibiotics 162 and chemicals were purchased from Sigma (St. Louis, MO). For the minimal media 163 persister assays, cultures were grown to stationary phase in minimal medium and diluted 164 into the same medium. Cells were diluted 1:100 into MOPS minimal medium (Neidhardt 165 et al. 1974) with 0.2% glucose as a carbon source and grown for 2 hours at 37°C with 166 shaking. Cells were diluted 1:50 into MOPS medium with 0.3% glycerol as a carbon 167 source and grown for 3.5 hours under the same conditions. For experiments done at 168 28°C, cells were diluted 1:100 in buffered MHB and incubated for 12 hours with shaking. 169 170 Strain Construction 171 E. coli K-12 MG1655 was used as the parental strain (wild type) for all strain 172 construction. Bacterial strains are listed in Table S2. P1 transduction was used to move 173 different alleles from the KEIO collection (Baba et al. 2006) into MG1655. The 174 kanamycin cassette was cured using pCP20 when needed. Precise deletions were made 175 using the methods described in (Datsenko and Wanner 2000) into the MG1655 176 background. 177 MG1655 pZS*34uvrD was constructed by cloning the ORF of uvrD into the KpnI/ClaI 178 (in bold) cloning site of pZS*34 (Lutz and Bujard 1997) using the primers uvrDkpn 179 (ATTTTAGGTACCAGGAGGCAGCTAATGGACGTTTCTTACCTGCTCGACA 180 GCC) and uvrDClaI (TATTAATCGATTTACACCGACTCCAGCCGGGCGTATG). 181 182 Measurement of SOS Induction 183 To measure SOS induction by measuring β-galactosidase production of strains 184 carrying recA::lacZ reporter fusion (Casaregola et al. 1982b), overnight cultures were 185 diluted 1:100 in 3 ml MHB and grown for 1.5 hours in 17- by 100-mm polypropylene 186 tubes with shaking. An 800 μL aliquot was removed from the culture and the optical 187 density (OD) 600 was measured. Cultures were treated with 0.1 μg/ml ciprofloxacin or 4 188 μg/ml mitomycin C at 37˚C for ~20 minutes. Both the treated and untreated culture were 6 189 measured for recA::lacZ expression using the methods described in (Miller 1992) with 190 the exception that β-mercaptoethanol was not added to the Z-buffer stock, and was 191 instead added directly to the reaction tube. Miller units were calculated as described in 192 (Miller 1992). 193 194 195 Flow Cytometry Analysis 196 An E. coli strain with GFP under the sulA promoter (McCool et al.
Load more

Recommended publications
  • Management of E. Coli Sister Chromatid Cohesion in Response to Genotoxic Stress
    ARTICLE Received 1 Oct 2016 | Accepted 13 Jan 2017 | Published 6 Mar 2017 DOI: 10.1038/ncomms14618 OPEN Management of E. coli sister chromatid cohesion in response to genotoxic stress Elise Vickridge1,2,3, Charlene Planchenault1, Charlotte Cockram1, Isabel Garcia Junceda1 & Olivier Espe´li1 Aberrant DNA replication is a major source of the mutations and chromosomal rearrange- ments associated with pathological disorders. In bacteria, several different DNA lesions are repaired by homologous recombination, a process that involves sister chromatid pairing. Previous work in Escherichia coli has demonstrated that sister chromatid interactions (SCIs) mediated by topological links termed precatenanes, are controlled by topoisomerase IV. In the present work, we demonstrate that during the repair of mitomycin C-induced lesions, topological links are rapidly substituted by an SOS-induced sister chromatid cohesion process involving the RecN protein. The loss of SCIs and viability defects observed in the absence of RecN were compensated by alterations in topoisomerase IV, suggesting that the main role of RecN during DNA repair is to promote contacts between sister chromatids. RecN also modulates whole chromosome organization and RecA dynamics suggesting that SCIs significantly contribute to the repair of DNA double-strand breaks (DSBs). 1 Center for Interdisciplinary Research in Biology (CIRB), Colle`ge de France, UMR CNRS-7241, INSERM U1050, PSL Research University, 11 place Marcelin Berthelot, 75005 Paris, France. 2 Universite´ Paris-Saclay, 91400 Orsay, France. 3 Ligue Nationale Contre le Cancer, 75013 Paris, France. Correspondence and requests for materials should be addressed to O.E. (email: [email protected]). NATURE COMMUNICATIONS | 8:14618 | DOI: 10.1038/ncomms14618 | www.nature.com/naturecommunications 1 ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms14618 ll cells must accurately copy and maintain the integrity of or cohesin-like activities26,27.
    [Show full text]
  • Interaction of Silver Atomic Quantum Clusters With
    Chemical Volume 6 Number 12 December 2015 Pages 6681–7356 Science www.rsc.org/chemicalscience ISSN 2041-6539 EDGE ARTICLE B. García, F. Dominguez et al. Interaction of silver atomic quantum clusters with living organisms: bactericidal eff ect of Ag3 clusters mediated by disruption of topoisomerase–DNA complexes Chemical Science View Article Online EDGE ARTICLE View Journal | View Issue Interaction of silver atomic quantum clusters with living organisms: bactericidal effect of Ag3 clusters Cite this: Chem. Sci.,2015,6,6717 mediated by disruption of topoisomerase–DNA complexes† a b a b a b J. Neissa,‡ C. Perez-Arnaiz,´ ‡ V. Porto, N. Busto, E. Borrajo, J. M. Leal, c b a M. A. Lopez-Quintela,´ B. Garc´ıa* and F. Dominguez* Essential processes for living cells such as transcription and replication depend on the formation of specific protein–DNA recognition complexes. Proper formation of such complexes requires suitable fitting between the protein surface and the DNA surface. By adopting doxorubicin (DOX) as a model probe, we report here that Ag3 atomic quantum clusters (Ag-AQCs) inhibit the intercalation of DOX into DNA and have considerable influence on the interaction of DNA-binding proteins such as topoisomerase IV, Escherichia coli DNA gyrase and the restriction enzyme HindIII. Ag-AQCs at nanomolar Creative Commons Attribution-NonCommercial 3.0 Unported Licence. concentrations inhibit enzyme activity. The inhibitory effect of Ag-AQCs is dose-dependent and occurs by intercalation into DNA. All these effects, not observed in the presence of Ag+ ions, can explain the Received 5th June 2015 powerful bactericidal activity of Ag-AQCs, extending the knowledge of silver bactericidal properties.
    [Show full text]
  • Association of Mutation Patterns in Gyra and Parc Genes with Quinolone Resistance Levels in Lactic Acid Bacteria
    The Journal of Antibiotics (2015) 68, 81–87 & 2015 Japan Antibiotics Research Association All rights reserved 0021-8820/15 www.nature.com/ja ORIGINAL ARTICLE Association of mutation patterns in GyrA and ParC genes with quinolone resistance levels in lactic acid bacteria Shaoying Li1,5, Zhen Li1,5, Wan Wei2, Chunyan Ma1, Xiaomin Song1, Shufen Li3, Wenying He4, Jianjun Tian1 and Xiaoyan Huo1 The quinolone resistance of 19 lactic acid bacterial strains belonging to the genera Enterococcus and Lactobacillus isolated from the natural fermented koumiss and yoghurt were investigated. The objective of this study was to determine the quinolone resistance levels and to explore the association of the resistance with the mutation patterns in gyrA and parC genes, as is currently recommended by the Food and Agriculture Organization/World Health Organization Joint Expert Committee in Guidelines for Evaluation of Probiotics in Food for probiotic lactic acid bacteria drug resistance in 2001. The Oxford Cup method and double-tube dilution method were used to determine the quinolone resistance levels of the isolated strains. Generally, all of the 19 strains showed resistance towards norfloxacin and ciprofloxacin when the Oxford cup method was used, whereas the incidence was lower (to norfloxacin 89.5% and to ciprofloxacin 68.4%) when minimum inhibitory concentration breakpoints (CLSI M100-S23) were tested. Furthermore, gene sequencing was conducted on gyrA and parC of topoisomerase II of these isolated strains. The genetic basis for quinolone resistance may be closely related to mutations in gyrA genes as there were 10 mutation sites in amino-acid sequences encoded by gyrA genes in 10 quinolone resistance strains and 14 mutation sites in Enterococcus durans HZ28, whereas no typical mutations were detected in parC genes.
    [Show full text]
  • Topoisomerase IV, Not Gyrase, Decatenates Products of Site-Specific Recombination in Escherichia Coli
    Downloaded from genesdev.cshlp.org on October 3, 2021 - Published by Cold Spring Harbor Laboratory Press Topoisomerase IV, not gyrase, decatenates products of site-specific recombination in Escherichia coli E. Lynn Zechiedrich,1,3 Arkady B. Khodursky,2 and Nicholas R. Cozzarelli1,4 1Department of Molecular and Cell Biology and 2Graduate Group in Biophysics, University of California, Berkeley, California 94720-3204 USA DNA replication and recombination generate intertwined DNA intermediates that must be decatenated for chromosome segregation to occur. We showed recently that topoisomerase IV (topo IV) is the only important decatenase of DNA replication intermediates in bacteria. Earlier results, however, indicated that DNA gyrase has the primary role in unlinking the catenated products of site-specific recombination. To address this discordance, we constructed a set of isogenic strains that enabled us to inhibit selectively with the quinolone norfloxacin topo IV, gyrase, both enzymes, or neither enzyme in vivo. We obtained identical results for the decatenation of the products of two different site-specific recombination enzymes, phage l integrase and transposon Tn3 resolvase. Norfloxacin blocked decatenation in wild-type strains, but had no effect in strains with drug-resistance mutations in both gyrase and topo IV. When topo IV alone was inhibited, decatenation was almost completely blocked. If gyrase alone were inhibited, most of the catenanes were unlinked. We showed that topo IV is the primary decatenase in vivo and that this function is dependent on the level of DNA supercoiling. We conclude that the role of gyrase in decatenation is to introduce negative supercoils into DNA, which makes better substrates for topo IV.
    [Show full text]
  • Review-Article.Pdf
    162 THENATIONALMEDICALJOURNALOFINDIA VOL. 12, ,-10. 4, 1999 Review Article Mechanisms of resistance to fluoroquinolones A. RATTAN ABSTRACT 1. Alteration of the molecular target of the action of fluoroquino- Fluoroquinolones have some of the properties of an 'ideal' anti- lones, and microbial agent. Because of their potent broad spectrum activity 2. Mechanisms reducing drug accumulation in the cells. and absence of transferable mechanism of resistance or inactivat- ing enzymes, it was hoped that clinical resistance to this useful ALTERATION OF THE TARGET group of drugs would not occur. However, over the years, due Fluoroquinolones target bacterial topoisomerases. These enzymes to intense selective pressure and relative lack of potency of the are found in all cells. They alter the topological state of DNA. To available quinolones against some strains, bacteria have evolved date, four topoisomerases have been identified inE. coli and other at least two mechanisms of resistance: (i) alteration of molecular bacteria. Fluoroquinolones are not inhibitors of either topoiso- merase I or III but have a high affinity for DNA gyrase and topo- targets, and (il)reduction of drug accumulation. DNA gyrase and isomerase IV. Gyrases control DNA supercoiling and relieve topoisomerase IV are the two molecular. targets of f1uoro- topological stress arising from the translocation of transcription quinolones. Mutations inspecified regions (quinolone resistance- and replication complexes along the DNA. Topoisomerase IV is determining region) in genes coding for the gyrase and/or topo- a decatenating enzyme that resolves interlinked daughter chromo- isomerase leads to clinicalresistance. An efflux pump effective in somes following DNA replication. Since both enzymes are re- pumping out hydrophilic quinolones has been described.
    [Show full text]
  • Mapping Topoisomerase IV Binding and Activity Sites on the E. Coli Genome Hafez El Sayyed
    Mapping Topoisomerase IV Binding and Activity Sites on the E. coli genome Hafez El Sayyed To cite this version: Hafez El Sayyed. Mapping Topoisomerase IV Binding and Activity Sites on the E. coli genome. Biochemistry, Molecular Biology. Université Paris-Saclay, 2016. English. NNT : 2016SACLS362. tel-01591487 HAL Id: tel-01591487 https://tel.archives-ouvertes.fr/tel-01591487 Submitted on 21 Sep 2017 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. NNT : 2016SACLS362 THESE DE DOCTORAT DE L’UNIVERSITE PARIS-SACLAY PREPAREE A L’UNIVERSITE PARIS-SUD AU SEIN DU CENTRE INTERDISCIPLINAIRE DE RECHERCHE EN BIOLOGIE ECOLE DOCTORALE N° 577 Structure et dynamique des systèmes vivants (SDSV) Spécialité de doctorat : Science de la vie et de la santé Par M. Hafez El Sayyed Mapping Topoisomerase IV Binding and Activity on the E. coli genome Thèse présentée et soutenue au Collège de France, le 26 Octobre 2016 Composition du Jury : M. Confalonieri, Fabrice Pr. I2BC, Orsay, France Président Mme Lamour, Valérie Dr. IGBMC, Illkirch, France Rapporteur M. Nollmann, Marcelo Dr. Centre de Biochimie Structurale, Montpellier Rapporteur M. Koszul, Romain Dr. Institut Pasteur, France Examinateur Mme Sclavi, Bianca DR.
    [Show full text]
  • The Role of Supercoiling in Altering Chromosome Structure, Gene
    THE ROLE OF SUPERCOILING IN ALTERING CHROMOSOME STRUCTURE, GENE EXPRESSION AND ANTIBIOTIC RESISTANCE IN BACTERIA by LIAM STEPHEN REDGRAVE A thesis submitted to the University of Birmingham for the degree of DOCTOR OF PHILOSOPHY Antimicrobials Research Group Institute of Microbiology and Infection College of Medical and Dental Sciences University of Birmingham March 2017 University of Birmingham Research Archive e-theses repository This unpublished thesis/dissertation is copyright of the author and/or third parties. The intellectual property rights of the author or third parties in respect of this work are as defined by The Copyright Designs and Patents Act 1988 or as modified by any successor legislation. Any use made of information contained in this thesis/dissertation must be in accordance with that legislation and must be properly acknowledged. Further distribution or reproduction in any format is prohibited without the permission of the copyright holder. Abstract Antibiotic resistance is a major problem estimated to cost $100 trillion and cause 10 million deaths per year by 2050. Despite novel molecules targeting Gram-positive bacteria, there are no new antibiotics active against Gram-negatives. To prolong use of current drugs, we need to understand mechanisms of resistance to inform prescribing practices and drug discovery. Quinolone resistance is primarily conferred by mutations in the target loci: DNA gyrase (gyrA) and topoisomerase IV. Quinolone resistance arising from gyrA mutations has also been shown to confer a low level of protection against a range of non-quinolone drugs. This thesis investigated the hypotheses that altered supercoiling levels, resulting from gyrA mutations, alter expression of stress response genes and confer a generic protective effect against other antibiotics and chemicals.
    [Show full text]
  • Topoisomerase IV, Alone, Unknots DNA in E. Coli
    Downloaded from genesdev.cshlp.org on September 27, 2021 - Published by Cold Spring Harbor Laboratory Press Topoisomerase IV, alone, unknots DNA in E. coli Richard W. Deibler,1,2 Sonia Rahmati,2 and E. Lynn Zechiedrich1,2,3 1Program in Cell and Molecular Biology and 2Department of Molecular Virology and Microbiology, Baylor College of Medicine, Houston, Texas 77030-3411, USA Knotted DNA has potentially devastating effects on cells. By using two site-specific recombination systems, we tied all biologically significant simple DNA knots in Escherichia coli. When topoisomerase IV activity was blocked, either with a drug or in a temperature-sensitive mutant, the knotted recombination intermediates accumulated whether or not gyrase was active. In contrast to its decatenation activity, which is strongly affected by DNA supercoiling, topoisomerase IV unknotted DNA independently of supercoiling. This differential supercoiling effect held true regardless of the relative sizes of the catenanes and knots. Finally, topoisomerase IV unknotted DNA equally well when DNA replication was blocked with hydroxyurea. We conclude that topoisomerase IV, not gyrase, unknots DNA and that it is able to access DNA in the cell freely. With these results, it is now possible to assign completely the topological roles of the topoisomerases in E. coli. It is clear that the topoisomerases in the cell have distinct and nonoverlapping roles. Consequently, our results suggest limitations in assigning a physiological function to a protein based upon sequence similarity or even upon in vitro biochemical activity. [Key Words: DNA supercoiling; gyrase; site-specific recombination; DNA catenane; quinolone; DNA replication] Received December 8, 2000; revised version accepted January 25, 2001.
    [Show full text]
  • Topoisomerase IV Bends and Overtwists DNA Upon Binding
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector 384 Biophysical Journal Volume 89 July 2005 384–392 Topoisomerase IV Bends and Overtwists DNA upon Binding G. Charvin,*y T. R. Strick,z D. Bensimon,* and V. Croquette* *Laboratoire de Physique Statistique, Ecole Normale Supe´rieure, UMR 8550 Centre National de la Recherche Scientifique, Paris, France; yThe Rockefeller University, New York, New York; and zInstitut Jacques Monod, Paris, France ABSTRACT Escherichia coli topoisomerase IV (Topo IV) is an essential ATP-dependent enzyme that unlinks sister chromosomes during replication and efficiently removes positive but not negative supercoils. In this article, we investigate the binding properties of Topo IV onto DNA in the absence of ATP using a single molecule micromanipulation setup. We find that the enzyme binds cooperatively (Hill coefficient a ; 4) with supercoiled DNA, suggesting that the Topo IV subunits assemble 1 ÿ K 1 ¼ : ; K ÿ ¼ : upon binding onto DNA. It interacts preferentially with ( ) rather than ( ) supercoiled DNA ( d 0 15 nM d 0 23 nM) and K 0 ; more than two orders-of-magnitude more weakly with relaxed DNA ( d 36 nM). Like gyrase but unlike the eukaryotic Topo II, Topo IV bends DNA with a radius R0 ¼ 6.4 nm and locally changes its twist and/or its writhe by 0.16 turn per bound complex. We estimate its free energy of binding and study the dynamics of interaction of Topo IV with DNA at the binding threshold. We find that the protein/DNA complex alternates between two states: a weakly bound state where it stays with probability p ¼ 0.89 and a strongly bound state (with probability p ¼ 0.11).
    [Show full text]
  • Mechanism of Type IA Topoisomerases
    molecules Review Mechanism of Type IA Topoisomerases Tumpa Dasgupta 1,2,3, Shomita Ferdous 1,2,3 and Yuk-Ching Tse-Dinh 1,2,* 1 Department of Chemistry and Biochemistry, Florida International University, Miami, FL 33199, USA; tdasg002@fiu.edu (T.D.); sferd001@fiu.edu (S.F.) 2 Biomolecular Sciences Institute, Florida International University, Miami, FL 33199, USA 3 Biochemistry PhD Program, Florida International University, Miami, FL 33199, USA * Correspondence: yukching.tsedinh@fiu.edu; Tel.: +1-305-348-4956 Academic Editor: Dagmar Klostermeier Received: 21 September 2020; Accepted: 15 October 2020; Published: 17 October 2020 Abstract: Topoisomerases in the type IA subfamily can catalyze change in topology for both DNA and RNA substrates. A type IA topoisomerase may have been present in a last universal common ancestor (LUCA) with an RNA genome. Type IA topoisomerases have since evolved to catalyze the resolution of topological barriers encountered by genomes that require the passing of nucleic acid strand(s) through a break on a single DNA or RNA strand. Here, based on available structural and biochemical data, we discuss how a type IA topoisomerase may recognize and bind single-stranded DNA or RNA to initiate its required catalytic function. Active site residues assist in the nucleophilic attack of a phosphodiester bond between two nucleotides to form a covalent intermediate with a 50-phosphotyrosine linkage to the cleaved nucleic acid. A divalent ion interaction helps to position the 30-hydroxyl group at the precise location required for the cleaved phosphodiester bond to be rejoined following the passage of another nucleic acid strand through the break.
    [Show full text]
  • A Topology-Centric View on Mitotic Chromosome Architecture
    Review A Topology-Centric View on Mitotic Chromosome Architecture Ewa Piskadlo and Raquel A. Oliveira * Instituto Gulbenkian de Ciência, Rua da Quinta Grande 6, 2780-156 Oeiras, Portugal; [email protected] * Correspondence: [email protected]; Tel.: +351-214-464-690 Received: 28 November 2017; Accepted: 15 December 2017; Published: 18 December 2017 Abstract: Mitotic chromosomes are long-known structures, but their internal organization and the exact process by which they are assembled are still a great mystery in biology. Topoisomerase II is crucial for various aspects of mitotic chromosome organization. The unique ability of this enzyme to untangle topologically intertwined DNA molecules (catenations) is of utmost importance for the resolution of sister chromatid intertwines. Although still controversial, topoisomerase II has also been proposed to directly contribute to chromosome compaction, possibly by promoting chromosome self-entanglements. These two functions raise a strong directionality issue towards topoisomerase II reactions that are able to disentangle sister DNA molecules (in trans) while compacting the same DNA molecule (in cis). Here, we review the current knowledge on topoisomerase II role specifically during mitosis, and the mechanisms that directly or indirectly regulate its activity to ensure faithful chromosome segregation. In particular, we discuss how the activity or directionality of this enzyme could be regulated by the SMC (structural maintenance of chromosomes) complexes, predominantly cohesin and condensin, throughout mitosis. Keywords: mitotic chromosomes; chromosome condensation; mitosis; topoisomerase II; condensin; cohesin; ultra-fine bridges; sister chromatid resolution; catenation; sister chromatid intertwines 1. Introduction Topoisomerase II is a homodimer that performs a unique role in living cells. Besides the ability to change the supercoiling state of DNA that it shares with other types of topoisomerases, only topoisomerase II can untangle topologically intertwined DNA molecules (catenations).
    [Show full text]
  • Mycobacterium Tuberculosis DNA Gyrase As a Target for Drug Discovery
    Infectious Disorders - Drug Targets 2007, 7, 000-000 1 Mycobacterium tuberculosis DNA Gyrase as a Target for Drug Discovery Khisimuzi Mdluli* and Zhenkun Ma Global Alliance for Tuberculosis Drug Development, 80 Broad Street, 31st Floor. New York, NY. 10004 Abstract: Bacterial DNA gyrase is an important target of antibacterial agents, including fluoroquinolones. In most bacterial species, fluoroquinolones inhibit DNA gyrase and topoisomerase IV and cause bacterial cell death. Other naturally occurring bacterial DNA gyrase inhibitors, such as novobiocin, are also known to be effective as antibacterial agents. DNA gyrase is an ATP-dependent enzyme that acts by creating a transient double-stranded DNA break. It is unique in catalyzing the negative supercoiling of DNA and is essential for efficient DNA replication, transcription, and recombination. DNA gyrase is a tetrameric A2B2 protein. The A subunit carries the breakage-reunion active site, whereas the B subunit promotes ATP hydrolysis. The M. tuberculosis genome analysis has identified a gyrB-gyrA contig in which gyrA and gyrB encode the A and B subunits, respectively. There is no evidence that M. tuberculosis has homologs of the topoisomerase IV, parC and parE genes, which are present in most other bacteria. Newer fluoroquinolones, including moxifloxacin and gatifloxacin, exhibit potent activity against M. tuberculosis, and show potential to shorten the duration for TB treatment. Resistance to fluoroquinolones remains uncommon in clinical isolates of M. tuberculosis. M. tuberculosis DNA gyrase is thus a validated target for anti-tubercular drug discovery. Inhibitors of this enzyme are also active against non-replicating mycobacteria, which might be important for the eradication of persistent organisms.
    [Show full text]