Role of Patched-1 Intracellular Domains in Canonical and Non-Canonical Hedgehog Signalling Events

Malcolm Harvey

A thesis submitted in conformity with the requirements for the degree of Master of Science Graduate Department of Laboratory Medicine & Pathobiology University of Toronto

Role of Patched-1 Intracellular Domains in Canonical and Non- Canonical Hedgehog Signalling Events

Malcolm Harvey

Master of Science

Department of Laboratory Medicine & Pathobiology University of Toronto

2013 Abstract

Patched-1 (Ptch1) is the primary receptor for Hedgehog (Hh) ligands and mediates both canonical and non-canonical Hh signalling. Previously, our lab identified that mice possessing a

Ptch1 C-terminal truncation display blocked mammary gland development at puberty that is overcome by overexpression of activated c-src. Testing the hypothesis that this involves a direct interaction between Ptch1 and c-src, we identified through co-immunoprecipitation that Ptch1 and c-src associate in an Hh-dependent manner, and that the Ptch1 C-terminus regulates activation of c-src in response to Hh ligand. Since the effects of Ptch1 intracellular domain deletions on canonical Hh signalling are ill-defined, we assayed this through luciferase reporter assays and qRT-PCR. Transient assays revealed that the Ptch1 middle intracellular loop is required for response to ligand, while qRT-PCR from primary cells showed that C-terminal truncation impairs canonical Ptch1 function. Together, this indicates that the intracellular domains of Ptch1 mediate distinct canonical and non-canonical functions.

Acknowledgments

First, I would like to thank my supervisor Dr. Paul A. Hamel for offering me the opportunity to pursue graduate studies in his lab and for his guidance, advice, support, and patience along the way. I also give my sincere thanks to Drs. Stephane Angers and Reinhart Reithmeier for being a part of my advisory committee and contributing their valuable insight, suggestions, and time. Additionally, I would like to thank Drs. Jorge Filmus and Herman Yeger for agreeing to participate in my thesis defense. I would also like to thank present and former Hamel lab members Dr. Laurent Balenci, Dr. Hong Chang, Andrew Fleet, Melissa Hicuburundi, Jennifer Lee, Nadia Okolowsky, and Aaliya Tamachi for their assistance, friendship, and kindness. I am especially grateful to Aaliya for assisting with cloning, Nadia for assisting with primary cell isolation, and both of them for always being there through the many ups and downs. And most importantly, I would like to thank my family for their endless love and support. Assuming this thesis is defended successfully, I may at last have an answer to the question of "When are you coming home!?"

iii

Table of Contents

ABSTRACT ...... II

ACKNOWLEDGEMENTS ...... III

TABLE OF CONTENTS ...... IV

LIST OF FIGURES ...... VI

ABBREVIATION KEY ...... VII

INTRODUCTION ...... 1

1 THE CANONICAL HEDGEHOG SIGNALLING PATHWAY ...... 1

1.1 LIGAND SYNTHESIS AND SECRETION ...... 2 1.2 LIGAND RECEPTION ...... 4 1.3 SIGNAL TRANSDUCION THROUGH SMOOTHENED ...... 7 1.4 REGULATION OF GLI-MEDIATED TRANSCRIPTION ...... 10 1.5 TRANSCRIPTION OF HEDGEHOG TARGET GENES ...... 14

2 PTCH1 STRUCTURE AND FUNCTION ...... 14

2.1 MOLECULAR CHARACTERIZATION ...... 14 2.1.1 The sterol sensing domain ...... 15 2.1.2 Ptch1 splice variants ...... 16 2.1.3 Function of the Ptch1 C-terminus ...... 17 2.2 MECHANISM OF SMOOTHENED INHIBITION ...... 18 2.3 EFFECT OF PTCH1 MUTATION IN NEOPLASIA AND DEVELOPMENTAL DISORDER .. 20 2.3.1 Nevoid basal cell carcinoma syndrome ...... 20 2.3.2 Basal cell carcinoma ...... 22 2.3.3 Medulloblastoma ...... 24 2.3.4 Holoprosencephaly ...... 25 2.4 RELATION TO PTCH2 ...... 26

3 NON-CANONICAL HEDGEHOG SIGNALLING ...... 27

3.1 NON-CANONICAL HEDGEHOG SIGNALLING EVENTS ACTING THROUGH PTCH1 ..... 28 3.2 IDENTIFICATION OF A NOVEL PTCH1-MEDIATED SIGNALLING CASCADE INVOLVING C-SRC ...... 30

RATIONALE ...... 33

HYPOTHESIS & OBJECTIVES ...... 33

MATERIALS & METHODS ...... 34

CELL CULTURE ...... 34 PRIMARY CELL CULTURE ...... 34 CLONING & EXPRESSION CONSTRUCTS ...... 35 WESTERN BLOTTING AND IMMUNOPRECIPITATION ...... 35 GLYCOSIDASE TREATMENT ...... 36 PREPARATION OF SHH-CONDITIONED MEDIA ...... 36 LUCIFERASE ASSAYS...... 37 RT-PCR AND qRT-PCR ...... 38 IMMUNOFLUORESCENCE AND IMAGING ...... 39 IN VITRO BINDING ASSAYS ...... 39

RESULTS ...... 41

DELETION MUTANT ANALYSIS OF THE PTCH1-C-SRC INTERACTION ...... 41 EFFECT OF HEDGEHOG LIGAND STIMULATION ON THE PTCH1-C-SRC INTERACTION ...... 45 DIFFERENTIAL EFFECTS OF PTCH1 AND THE MES MUTANT ON SIGNAL TRANSDUCTION CASCADES ...... 47 CANONICAL HEDGEHOG SIGNALLING CONSEQUENCES OF PTCH1 INTRACELLULAR DOMAIN DELETIONS ...... 48

DISCUSSION ...... 55 EXOGENOUS PTCH1 AND C-SRC INTERACT IN VITRO ...... 55 MODULATION OF THE PTCH1-C-SRC ASSOCIATION IN RESPONSE TO SHH LIGAND ...... 58 THE MES ALLELE IS HYPOMORPHIC IN MAMMARY FIBROBLASTS ...... 59 LOSS OF THE PTCH1 MIDDLE INTRACELLULAR LOOP RESULTS IN AN INABILITY TO RESPOND TO SHH STIMULATION ...... 62 CONCLUSIONS ...... 64

REFERENCES ...... 66

List of Figures

FIGURE 1. MAJOR INTRACELLULAR DOMAINS OF VERTEBRATE PTCH1 CONTAIN PUTATIVE SH2- AND SH3-BINDING DOMAINS ...... 42

FIGURE 2. PTCH1 DELETION MUTANTS EXHIBIT CORRECT SECRETORY PATHWAY TRAFFICKING IN HEK 293 CELLS ...... 43

FIGURE 3. OVEREXPRESSED PTCH1 AND ACTIVATED C-SRC CO-IMMUNOPRECIPITATE BY AN INTERACTION REQUIRING THE PTCH1 C-TERMINUS ...... 44

FIGURE 4.OVEREXPRESSED PTCH1 IS A TARGET FOR TYROSINE PHOSPHORYLATION BY OVEREXPRESSED ACTIVATED C-SRC ...... 45

FIGURE 5. ASSOCIATION OF PTCH1 AND C-SRC IS ABOLISHED IN RESPONSE TO SHH STIMULATION ...... 46

FIGURE 6. PRIMARY MAMMARY MESENCHYMAL CELLS CONTAINING A PTCH1 C- TERMINAL MUTATION FAIL TO ACTIVATE C-SRC IN RESPONSE TO SHH STIMULATION ... 47

FIGURE 7. PRIMARY MAMMARY MESENCHYMAL CELLS CONTAINING A PTCH1 C- TERMINAL MUTATION DISPLAY CONSTITUTIVE ACTIVATION OF GLI1 ...... 49

FIGURE 8. PTCH1 MUTANTS LACKING THE LARGE INTRACELLULAR LOOP FAIL TO RESPOND TO SHH STIMULATION ...... 50

FIGURE 9. DELETION OF THE PTCH1 LARGE INTRACELLULAR LOOP DOES NOT AFFECT SHH-BINDING CAPABILITY ...... 51

FIGURE 10. DELETION OF PTCH1 LARGE INTRACELLULAR DOMAINS DOES NOT ABOLISH THE CAPABILITY TO LOCALIZE TO THE PRIMARY CILIUM ...... 52

FIGURE 11. DELETION OF THE PTCH1 LARGE INTRACELLULAR LOOP RESULTS IN INCREASED CILIARY LENGTH ...... 53

FIGURE 12. HA-TAGGED PTCH1 RESULTS IN ALTERED BINDING AND TYROSINE PHOSPHORYLATION PROPERTIES IN RESPONSE TO ACTIVATED C-SRC OVEREXPRESSION ...... 57

vii

Abbreviation Key

ANOVA analysis of variance AP alkaline phosphatase Arbp 60S acidic ribosomal protein P0 BBS Bardet-Biedl syndrome BCC basal cell carcinoma Bcl-2 B cell lymphoma-2 Boc brother of Cdo BSA bovine serum albumin cAMP cyclic adenosine monophosphate Cdo cell adhesion molecule-related/down-regulated by oncogenes cGCP cerebellar granule cell progenitor CK1 casein kinase 1 DDM n-dodecyl-β-d-maltoside Dhh desert hedgehog Disp1 dispatched-1 DMEM Dulbecco's modified eagle medium dpc days post-coitum DRAL downregulated in rhabdomyosarcoma LIM-domain protein EDTA ethylenediaminetetraacetic acid EGF epidermal growth factor Endo H endoglycosidase H ENU n-ethyl-n-nitrosourea ER endoplasmic reticulum ERK extracellular signal-regulated kinase EVC Ellis-van Creveld syndrome protein FBS fetal bovine serum FITC fluorescein isothiocyanate FoxM1 forkhead box protein M1 FRET fluorescence resonance energy transfer GAPDH glyceraldehyde-3-phosphate-dehydrogenase Gas-1 growth arrest specific 1 Gli glioma-associated oncogene GRK2 G-protein coupled receptor kinase 2 GSK3β glycogen synthase kinase 3β GST glutathione-s-transferase GTP guanosine triphosphate HA hemagglutinin HBAH Hank's balanced salt solution viii

HBS Hank's buffered saline HEK human embryonic kidney Hh hegdehog Hhat hegdehog acetyltransferase Hip1 hedgehog interacting protein 1 HPE holoprosencephaly IFT intraflagellar transport Ig immunoglobulin Ihh indian hedgehog IR ionizing radiation Kif3a kinesin-like protein Kif3a Kif7 kinesin-like protein Kif7 LOH loss of heterozygosity LRP2 low-density lipoprotein related receptor 2 MEF mouse embryonic fibroblast MEK mitogen activated protein kinase-kinase MMTV mouse mammary tumour virus NALP1 NLR family, pyrin domain containing 1 NBCCS nevoid basal cell carcinoma syndrome NEDD4 neural precursor cell expressed developmentally down-regulated protein 4 N-Myc N-myc proto-oncogene protein PACAP pituitary adenylate cyclase-activating polypeptide PBS phosphate buffered saline PCR polymerase chain reaction PDAC pancreatic ductal adenocarcinoma PEI polyethylenimine PI3K phosphatidylinositol-3-kinase PKA protein kinase A PMSF phenylmethylesulfonyl fluoride PNGase F peptide-n-glycosidase F Ptch1 patched-1 Ptch2 patched-2 RNA ribonucleic acid RNAi ribonucleic acid interference RND resistance, nodulation, disease RT reverse transcription SAG smoothened agonist SANT-1 smoothened antagonist 1 Scube signal sequence, cubulin domain, EGF-related SDS sodium-dodecyl-sulfate SDS-PAGE SDS-polyacrylamide gel electrophoresis SFK src family kinase ix

SH2 src homology 2 SH3 src homology 3 Shh sonic hedgehog SIX3 homeobox protein SIX3 Smo smoothened SSD sterol sensing domain SSP sterol synthesis pathway Sufu suppressor of fused TBS tris buffered saline TGF-β tumour growth factor β TGIF TGF-β induced factor TUCAN tumour up-regulated CARD-containing antagonist of caspase-9 UV ultraviolet WW tryptophan-tryptophan YFP yellow fluorescent protein ZIC2 zinc finger protein ZIC2

x 1

Introduction

1 The canonical Hedgehog signalling pathway

Showing conservation of core components from flies to mammals, the Hedgehog (Hh) signalling pathway is an evolutionarily-conserved signal transduction cascade that plays an essential role in development by governing cell proliferation, differentiation, and morphogenesis (Ingham et al., 2011). Well-characterized examples in vertebrates include specifying ventral cell fate of neural progenitors in the developing neural tube via a ventral to dorsal morphogen gradient (Dessaud et al., 2008), specifying digit formation along the anterio-posterior axis in the developing limb bud via a posterior to anterior morphogen gradient (Suzuki, 2013), and driving proliferation of granule neuron precursors in the developing cerebellum (Vaillant and Monard, 2009). Loss-of-function mutations or genetic aberrations affecting factors promoting pathway activation result in developmental defects such as holoprosencephaly (Roessler and Muenke, 2010), while ectopic pathway activation is associated with the tumourigenesis of basal cell carcinoma, medulloblastoma, and rhabdomyosarcoma (Barakat et al., 2010).

Although core pathway components are conserved between Drosophila and vertebrates, Hh-signalling in vertebrates is dependent on the primary cilium, a microtubule-based organelle involved in the signal transduction response to the surrounding cellular environment (Goetz and Anderson, 2010). In the absence of ligand, the primary Hh receptor and negative regulator Patched-1 (Ptch1) localizes to the primary cilium and represses the activity and ciliary localization of Smoothened (Smo) (Rohatgi et al., 2007). In response to Hh ligand Ptch1 is internalized, allowing to Smo to translocate to the primary cilium and promote downstream signal transduction (Corbit et al., 2005; Rohatgi et al., 2007). This involves the dissociation of a complex consisting of the downstream negative regulator Suppressor of Fused (Sufu) and either of the transcription factors glioma-associated oncogene 2 or 3 (Gli2/3), allowing Gli2/3 to translocate to the nucleus and promote transcription of Hh target genes (Humke et al., 2010; Tukachinsky et al., 2010).

1.1 Ligand synthesis and secretion

Mammals possess three Hedgehog family ligands – Sonic Hedgehog (Shh), Desert Hedgehog (Dhh), and Indian Hedgehog (Ihh) (Echelard et al., 1993). After translation, the signal peptide of trafficking Hh ligands is removed and the molecule undergoes an autocatalytic processing event, producing a 19 kDa N-terminal peptide and a 27 kDa C-terminal peptide (Chang et al., 1994; Lee et al., 1994). A recent study has shown that self-cleavage of the Hh precursor takes place in the endoplasmic reticulum, and that the C-terminal fragment is subsequently degraded by the ER-associated degradation pathway (Chen et al., 2011a). The N- terminal fragment, termed N-Shh, was identified as being responsible for signalling activity in both flies and vertebrates by early work in Drosophila and the developing chick limb bud and neural plate (Fietz et al., 1995; López-Martínez et al., 1995; Martí et al., 1995; Porter et al., 1995). Significance of this cleavage event is emphasized by the fact that many mutations in human SHH associated with holoprosencephaly are due to disruption of the proper processing and formation of N-SHH (Maity et al., 2005; Roessler et al., 2009a; Traiffort et al., 2004).

During autoproteolysis, the C-terminal fragment of the full-length Hh molecule mediates the attachment of a cholesterol moiety to the C-terminus of the N-terminal peptide via an ester linkage (Porter et al., 1996a, 1996b). In addition to this cholesterol modification, N-Shh is palmitoylated via an amide linkage at its N-terminal cysteine. This modification results in increased activity of the ligand, as measured by induction of alkaline phosphatase activity in C3H10T1/2 cells (Pepinsky et al., 1998). Four independent genetic screens in Drosophila identified a novel protein sharing homology with transmembrane acetyltransferases whose mutation did not affect Hh transcription or cleavage, but was required for Hh target gene expression (Amanai and Jiang, 2001; Chamoun et al., 2001; Lee and Treisman, 2001; Micchelli et al., 2002). A knockout model of the mouse homolog to this putative acetyltransferase, termed Hedgehog acetyltransferase (Hhat), resulted in long-range signalling defects in the developing limb bud and neural tube, which was attributed to the inability of Shh lacking palmitate modification to form soluble multimers (Chen et al., 2004a). Biochemical evidence that Hhat is a Shh palmitoylacetyltransferase was provided in a later study which demonstrated in vitro specificity of Hhat for Shh, and that this modification takes place in the secretory pathway and is not dependent on autoproteolysis or cholesterol modification of Shh (Buglino and Resh, 2008).

Initial work using a transgenic mouse expressing only an allele of N-Shh which cannot be modified with cholesterol suggested that the cholesterol modification is required for long-range signalling, based on the inability of this mutant allele to specify anterior digits in the developing limb bud (Lewis et al., 2001). A more recent study contradicted this conclusion by showing that conditional expression of an allele of N-Shh that cannot be cholesterol modified results in increased propensity of N-Shh to spread from its site of synthesis (Li et al., 2006). In their manuscript, Li et al. reason that this discrepancy is a result of a difference in Shh mRNA stability, and consequently, levels of N-Shh protein expression between the two models. They propose that the use of a truncating stop codon by Lewis et al. resulted in nonsense-mediated mRNA decay, as opposed to their model, which utilized conditional deletion of the C-terminal Shh autoprocessing domain. Biochemical analysis of Shh lipid modification has suggested that hydrophobic modification of the N-Shh N-terminus increases potency, while cholesterol modification of the C-terminus promotes cell surface expression (Grover et al., 2011; Taylor et al., 2001).

More recent studies have furthered the current understanding of the role of lipid modification in Shh processing and secretion. In vitro studies have shown that both the cholesterol and palmitate moieties are cleaved prior to release, and that this cleavage is mediated by a disintegrin and metalloprotease (ADAM) family members (Dierker et al., 2009; Ohlig et al., 2011). Furthermore, the N-terminal cleavage of the palmitate moiety is especially important. Although the palmitate modification is required for membrane association and shedding (Ohlig et al., 2012), N-terminal peptide cleavage is vital to expose the zinc coordination site required for Ptch1 binding (Ohlig et al., 2011). Additionally, the C-terminal cholesterol moiety and heparin sulfate proteoglycans (HSPGs) have been implicated in mediating the formation of Shh multimers at the cell surface (Chang et al., 2011; Ohlig et al., 2011)

A genetic screen in Drosophila yielded the discovery of the twelve-pass transmembrane sterol sensing domain-containing protein, dispatched (disp), which was shown to be essential for the release of cholesterol-modified Hh from producing cells (Burke et al., 1999). Subsequent murine knockout models identified that the first of two mouse disp homologs, Disp1, is essential for Shh embryonic patterning activity, as Disp1-null mice exhibit embryonic lethality in a manner similar to that of Smo-null animals (Kawakami et al., 2002; Ma et al., 2002). These studies also identified a conserved role of Disp1 in the export, but not synthesis or processing of

4 cholesterol-modified N-Shh (Kawakami et al., 2002; Ma et al., 2002). Additional work from a forward genetics ENU screen in mice would produce a Disp1 mutant that identified Disp1 as being essential for long-range Hh signalling, but not juxtacrine signalling, based on the observation that, unlike loss-of-function Smo mutants, Shh expression is maintained in the notochord of Disp1 mutants (Caspary et al., 2002). Further characterization of Disp1 has been limited, although a recent study has posited that Disp1 functions as a trimer and may have a role outside of Shh-producing cells for long-range signalling (Etheridge et al., 2010).

The Scube (signal sequence, cubulin domain, EGF-related) family of proteins are secreted glycoproteins that have been implicated as upstream factors in long-range Hh-signalling in zebrafish (Hollway et al., 2006; Kawakami et al., 2005; Woods and Talbot, 2005). While early zebrafish studies focused on scube2, recent work involving knockdown of all three family members (scube1-3) has determined that the combined activity of all three family members is essential for Hh signalling in zebrafish (Johnson et al., 2012). The first molecular characterization of mammalian Scube2 in the context of Hh signalling identified human SCUBE2 as a positive regulator of Hh signalling in in vitro reporter assays (Tsai et al., 2009). This group also showed that SCUBE2 is able to complex with PTCH1 and SHH, and that this association with SHH occurs in caveolin-1-enriched lipid raft microdomains (Tsai et al., 2009). Recently, more comprehensive molecular analysis has identified a role for Scube2 in the release of lipid-modified Shh from producing cells, in conjunction with Disp1 (Creanga et al., 2012; Tukachinsky et al., 2012). Creanga et al. demonstrated that Scube2 mediates the release of N- Shh from both cultured cell lines and cell-free lipid rafts, and that this release is dependent on Disp1 expression. Additionally, work from Tukachinsky et al. was able to show through cross- link assays that Disp1 and Scube2 both associate with the cholesterol moiety of Shh, but at different locations, establishing the hypothesis that Shh secretion might involve a "hand-off" mechanism from Disp1 to Scube2.

1.2 Ligand reception

Reception of the Hh signal is mediated by the binding of Hh ligand to the twelve-pass transmembrane receptor, Patched-1 (Ptch1) (Goodrich et al., 1996; Marigo et al., 1996; Stone et al., 1996). Ptch1 is essential not only for reception of Hh ligand, but also for inhibiting

5 downstream signalling in the absence of ligand, as loss of Ptch1 in mice results in complete ventralization of the neural tube and embryonic lethality at E9.5 (Goodrich et al., 1997; Hahn et al., 1998).

In addition to Ptch1, work in both Drosophila and mammals has identified multiple co- receptors whose activity is required for proper Hh signal transduction. Two of these are cell adhesion molecule-related/downregulated by oncogenes (Cdo) and brother of Cdo (Boc), which were discovered as Ig superfamily members involved in myogenic differentiation (Kang et al., 1997, 2002). The observation that Cdo-/- mice display microform holoprosencephaly was the first suggestion of a possible role for these molecules in Hh signalling (Cole and Krauss, 2003). Subsequent work from the same group identified Cdo as a positive regulator of Hh signalling by demonstrating downregulation of Shh target genes in the developing forebrain of Cdo-/- mice, as well as in vitro reporter assays that showed an increased Hh response in the presence of Cdo (Zhang et al., 2006). Additionally, ectopic expression of Boc and Cdo in chick neural tube induced ventral cell fate. Both molecules were shown further to be capable of binding Shh via their fibronectin repeats, strongly suggesting that Boc and Cdo function as positive regulators of Hh signal transduction (Okada et al., 2006; Tenzen et al., 2006).

Growth arrest specific gene 1 (Gas-1) was first implicated in Hh signalling in a screen for molecules capable of interacting with Shh at the cell surface (Lee et al., 2001). In addition to being capable of binding Shh, initial work in vitro first suggested that Gas-1 functioned as a negative regulator of Hh signalling (Cobourne et al., 2004; Lee et al., 2001). However, later genetic and in vitro analyses contradicted this result, and establish Gas-1 as a positive regulator of vertebrate Hh signalling (Allen et al., 2007; Martinelli and Fan, 2007; Seppala et al., 2007). Analyses of Gas-1-/- mice demonstrated craniofacial and limb defects associated with reduced Shh signalling that were exacerbated in Gas-1-/- mice missing one Shh allele; furthermore, ectopic expression of Gas-1 in chick neural tube resulted in induction of Shh-dependent cell fate (Allen et al., 2007; Martinelli and Fan, 2007; Seppala et al., 2007). Additionally, mutations in either SHH or GAS-1 that disrupt the SHH-GAS-1 interaction have been identified in holoprosencephaly patients, further suggesting a positive role in Hh signalling for GAS-1 (Martinelli and Fan, 2009; Pineda-Alvarez et al., 2012).

Analysis of mice deficient for two or more of Cdo, Boc, and Gas-1 has provided further insight into the co-receptor requirements for proper Shh signal transduction. Compound Cdo-/- Gas-1-/- mice display a severe increase in craniofacial abnormalities compared to single mutants, yet they still possess an intact notochord, suggesting that there is not a complete loss of Shh signalling (Allen et al., 2007). Furthermore, a study of Cdo-/-Boc-/- mice demonstrated that, while loss of Boc does not result in holoprosencephaly, loss simultaneously of Boc and Cdo results in a more severe holoprosencephaly phenotype than that exhibited by Cdo-/- mice (Zhang et al., 2011). Despite this, the holoprosencephaly phenotype displayed by compound Cdo-/-Boc-/- mice is not as severe as that of Shh-/- animals, indicating that there is not complete abrogation of Shh signalling (Zhang et al., 2011). A study of Boc-/-Gas-1-/- cerebellar granular neural progenitors, which lack endogenous Cdo expression, showed that lack of the three co-receptors resulted in a complete inability to proliferate in response to Shh (Izzi et al., 2011). Biochemical analysis by the same group also demonstrated that Gas-1 and Boc form distinct receptor complexes with Ptch1, in line with a previous study that identified synergy between Ptch1 and Gas-1 or Cdo, but not Cdo and Gas-1 (Izzi et al., 2011; Martinelli and Fan, 2007). Finally, a study of compound Boc-/-Cdo-/-Gas-1-/- mice demonstrated that the three co-receptors are essential for Shh signal transduction in vertebrates, as the triple-deficient mice display severe developmental defects similar to Shh-/-Ihh-/- and Smo-/- animals, and are embryonic lethal by E9.5 (Allen et al., 2011).

The first piece of evidence suggesting a possible role for megalin/LRP2 (low-density lipoprotein related receptor 2) in Hh signalling came from the observation that LRP2-/- mice display holoprosencephaly (Willnow et al., 1996). Later biochemical and genetic work would then demonstrate that N-Shh can bind LRP2 in vitro, and that conditional knockout of LRP2 results in loss of Shh expression in the ventral forebrain (McCarthy et al., 2002; Spoelgen et al., 2005). While further characterization of the role of LRP2 in Hh signalling has been limited, a recent study has shown that LRP2 is required for Shh signalling in the murine forebrain neuroepithelium, and that in vitro expression of recombinant LRP2 can increase Hh reporter activity in a manner similar to Boc and Cdo (Christ et al., 2012).

Discovered in a biochemical screen for mouse limb bud cDNA library products capable of binding mammalian Hh ligands, Hip1 (Hedgehog interacting protein 1) was identified as a transmembrane protein that is upregulated in response to Shh stimulation (Chuang and McMahon, 1999). Additionally, the observation that overexpression of Hip1 in chondrocytes

7 impairs Ihh signalling led to the postulation that the primary function of Hip1 is sequestration of Hh ligands and attenuation of signal transduction (Chuang and McMahon, 1999). While the murine knockout of Hip1 did not reveal any defects in limb bud or neural tube patterning, possibly due to functional redundancy with Ptch1, they did display defects in lung branching, indicating a tissue-specific requirement for Hip1 function (Chuang et al., 2003).

Taken together, this information indicates that while Ptch1 is essential for reception of Hh ligand, the tissue-specific expression of both positive and negative co-receptors and regulators is also critical for proper Hh signal transduction.

1.3 Signal transduction through Smoothened

The seven-pass transmembrane protein Smoothened (Smo) is an essential component of the Hh machinery, and is responsible for transducing signalling by Hh ligands in both Drosophila and vertebrates (Alcedo et al., 1996; van den Heuvel and Ingham, 1996; Murone et al., 1999). Loss of Smo in mice results in severe developmental defects resembling Shh-/-Ihh-/- double mutants, indicating complete loss of Hh signalling activity (Zhang et al., 2001). In the absence of Shh ligand, Smo activity is indirectly repressed by sub-stoichiometric amounts of Ptch1 (Taipale et al., 2002). Upon reception of Shh ligand, Ptch1 is internalized and Smo traffics to the primary cilium and promotes downstream Hh transcriptional activation (Corbit et al., 2005; Rohatgi et al., 2007).

Multiple studies have shown that the primary cilium is essential for both Smo function and downstream Hh signal transduction. Both ciliary assembly and the trafficking of cilia- localized proteins are dependent upon the function of two multi-protein intraflagellar transport (IFT) complexes, IFT-A and IFT-B (Cole et al., 1998; Follit et al., 2009; Taschner et al., 2012). IFT-B is typically associated with anterograde transport, while IFT-A is typically associated with retrograde transport (Taschner et al., 2012). Loss of either of the anterograde IFT-B components IFT172 or IFT88, or the anterograde motor kinesin Kif3A, results in loss of cilia formation and loss of the ability to respond to Hh ligand (Huangfu et al., 2003; Kolpakova-Hart et al., 2007; Liu et al., 2005; Ocbina and Anderson, 2008). Interestingly, loss of the IFT-B component IFT25

8 does not produce any defects in cilia assembly, but results in impaired ciliary export of Smo, indicating a role for IFT-B in retrograde transport (Keady et al., 2012).

Loss of function of the retrograde motor component Dync2h1 results in constitutive localization of Smo to the primary cilium, but loss of Hh signalling, indicating that Smo traffics transiently in and out of the cilium in the absence of stimulation, and that retrograde IFT activity is required for its exit (Kim et al., 2009a; Ocbina and Anderson, 2008; Ocbina et al., 2011). In the absence of the small GTPase Arl13b, Smo displays constitutive ciliary localization with a muted ability to transduce signal, while loss of the IFT-A component IFT144 prevents both Smo and Arl13b from localizing to cilia, indicating a potential role for IFT-A in anterograde transport (Larkins et al., 2011; Liem et al., 2012). Additionally, proper ciliary localization of Smo has been shown to require the ciliary membrane diffusion barrier protein Septin 2, the transition zone-localized Tctn1, and the Bardet-Biedl Syndrome (BBS) complex (Garcia-Gonzalo et al., 2011; Hu et al., 2010; Zhang et al., 2012). Altogether this information indicates that the ciliary trafficking of Smo is dependent upon complex interactions between ciliary machinery components, yet further work is required to deduce the complete mechanism, since disruption of core components that impair cilia assembly makes it difficult to distinguish specific defects in Hh transduction from general defects in cilia integrity.

Recent in vitro analysis has shed more light on the mechanism of Smo activation in response to Shh ligand. Multiple studies have demonstrated that translocation of Smo to the primary cilium is an essential step for pathway activation (Corbit et al., 2005; Kovacs et al., 2008). Furthermore, this process is dependent on the ability of Smo to form a complex with β- arrestin 1 or 2, and the kinesin Kif3A (Kovacs et al., 2008). Although translocation of Smo to the primary cilium is necessary for downstream signalling, multiple studies have shown that it is not sufficient. The small-molecule Smo inhibitors cyclopamine (Taipale et al., 2000) and SANT-1 (Chen et al., 2002) have been used to demonstrate differential trafficking of inactive Smo, SANT-1 preventing ciliary localization and while cyclopamine induces it, indicating that a conformational switch is required for Smo activation in addition to ciliary localization (Rohatgi et al., 2009; Wang et al., 2009; Wilson et al., 2009). These data support previous FRET analysis showing a conformational switch in Smo in response to Shh stimulation (Zhao et al., 2007). Moreover, recent studies have indicated that Smo exists both on the cell surface and in intracellular vesicles in the absence of ligand, and that upon Shh stimulation Smo on the cell

9 surface translocates laterally to the primary cilium before intracellular Smo (Milenkovic et al., 2009; Wang et al., 2009; Wu et al., 2012).

Phosphorylation of the Smo C-terminus by protein kinase A (PKA) and casein kinase I (CKI) is a critical event in Hh signal transduction in Drosophila. However, these C-terminal PKA phosphorylation sites are not conserved in vertebrate Smo (Apionishev et al., 2005; Jia et al., 2004; Zhao et al., 2007). Regardless, multiple studies have suggested that phosphorylation of vertebrate Smo is a critical step in its activation. G-protein coupled receptor kinase 2 (GRK2) phosphorylates exogenous Smo, and acts as a positive regulator of Shh signalling in in vitro reporter assays (Chen et al., 2004b; Meloni et al., 2006; Philipp et al., 2008). Additionally, casein kinase 1α (CK1α) was suggested to act as a positive regulator of mammalian Hh signalling by a kinome siRNA library screen (Evangelista et al., 2008). Recently, a comprehensive molecular analysis assessing the role of GRK2 and CK1α identified that the two kinases phosphorylate the C-terminus of Smo and regulate its conformation and activity in response to Shh ligand, and that these phosphorylation events are dependent on Kif3A (Chen et al., 2011b). Although this group used a phospho-specific Smo antibody to identify Smo phosphorylation, exogenous expression of Smo was required for detection, hence phosphorylation of endogenous mammalian Smo in response to Hh ligand has yet to be confirmed.

Insight into Shh signal transduction immediately downstream of Smo has been gained from recent work focused on the molecular mechanisms behind the autosomal recessive skeletal dysplasia, Ellis-van Creveld syndrome (Ruiz-Perez et al., 2000). Ellis-van Creveld syndrome arises from mutation of one or both of the transmembrane proteins EVC or EVC2 (Galdzicka et al., 2002; Ruiz-Perez et al., 2000). Analysis of mice deficient for the murine homolog, Evc, revealed a function for Evc downstream of Smo in the response to Ihh stimulation, and that Evc localizes to the primary cilium (Ruiz-Perez et al., 2007). Subsequent in vitro work demonstrated Evc2 to also be a positive regulator of Hh signalling, and that Evc and Evc2 co-localize at the basal body of the primary cilium in a co-dependent manner (Blair et al., 2011).

Recent molecular analysis from multiple groups has confirmed that Evc/Evc2 are capable of complexing with, yet function downstream of Smo, as loss of expression of either protein does not impair Smo localization, but results in attenuation of downstream signalling (Caparrós- Martín et al., 2013; Dorn et al., 2012; Yang et al., 2012). Additionally, Evc was shown to

10 promote dissociation of Sufu and Gli3, despite not co-immmunoprecipitating with either (Caparrós-Martín et al., 2013). A more detailed focus on the localization of Evc/Evc2 suggested that they do not localize to the ciliary basal body, but instead adjacent to the transition zone (Dorn et al., 2012). One unresolved issue with the molecular studies to date is the effect of Evc/Evc2 loss or overexpression in the absence of Sufu expression. Work from two groups employing RNAi knockdown of Evc/Evc2 or overexpression of Evc2 in Sufu-/- MEFs displayed no apparent change in downstream Hh signalling in response to changes in Evc/Evc2 expression, indicating that Evc/Evc2 function entirely upstream of Sufu (Dorn et al., 2012; Yang et al., 2012). However, results from RNAi knockdown of Evc or Evc2 in Sufu-/- MEFs by a third group showed a decrease in Hh activity in response to loss of Evc/Evc2, suggesting that Evc/Evc2 may also possess function downstream of Sufu (Caparrós-Martín et al., 2013).

While the characterization of Evc/Evc2 represents a step forward in identifying the mechanistic link between Smo activation and Gli-mediated transcription, the tissue-specific effects exhibited by knockout animals indicate that in other tissues, different molecules are likely responsible for this link. There may also exist entirely different mechanisms of transduction from Smo to Sufu and Gli that are not present in cells expressing Evc/Evc2.

1.4 Control of Gli-mediated transcriptional regulation

Transcription of Hh target genes in vertebrates is mediated by the Gli family of transcription factors (Ruppert et al., 1988). Mammals possess three family members – Gli1, Gli2, and Gli3. Gli2 and Gli3 are the main mediators of activation and repression of Hh target genes, respectively (Bai et al., 2002; Ding et al., 1998; Lipinski et al., 2006; Litingtung et al., 2002; Sasaki et al., 1997; Wang et al., 2000; te Welscher et al., 2002; Wijgerde et al., 2002). Evidence exists that Gli3 also possesses weak activating capabilities and that Gli2 possesses weak repressing capabilities, both often only becoming apparent in the absence of the other family member (Bai et al., 2004; Buttitta et al., 2003; McDermott et al., 2005; Mo et al., 1997; Motoyama et al., 1998a, 2003). The ability of Gli-proteins to act as transcriptional activators depends on the presence of a C-terminal activation domain, and truncation of this domain results in the formation of N-terminal Gli repressor (Gli-R) (Sasaki et al., 1999). Gli1 lacks an N- terminal repressor domain and can therefore only function as an activator (Dai et al., 1999).

Furthermore, Gli1 is dispensable for mammalian development, as Gli1-/- mice are viable and maintain a normal appearance (Park et al., 2000).

In addition to Ptch1, two other regulating factors promote repression of mammalian Hh signalling in the absence of ligand, both by exerting direct influence on Gli-family transcription factors. The first of these is Suppressor of Fused (Sufu), which initial in vitro work demonstrated as being able to bind Gli1, Gli2, and Gli3, as well as downregulate Hh activity upon overexpression, presumably by sequestering the Gli proteins in the cytoplasm (Ding et al., 1999; Kogerman et al., 1999). Subsequent murine knockout models revealed that Sufu is an essential Hh pathway component, as Sufu-/- mice exhibit embryonic lethality at 9.5 dpc with severe neural tube defects in a manner similar to Ptch1-/- mice (Cooper et al., 2005; Svärd et al., 2006). The other negative regulator of mammalian Hh signalling is Protein Kinase A (PKA) (Epstein et al., 1996; Huang et al., 2002; Wang et al., 2000). Mice with complete loss of PKA activity display ectopic Hh pathway activation resulting in severe neural tube defects and embryonic lethality at 9 dpc, akin to Ptch1-/- and Sufu-/- animals (Tuson et al., 2011).

Formation of Gli-R requires initial phosphorylation of full-length Gli by PKA, which allows for subsequent phosphorylation by glycogen synthase kinase 3β (GSK3β) and casein kinase 1 (CK1) (Tempe et al., 2006; Wang and Li, 2006; Wang et al., 2000). Additionally, the recruitment of GSK3β has been shown to be mediated by Sufu (Kise et al., 2009). Phosphorylated Gli is then recognized by the β-transducin repeat containing protein (β-TrCP) E3 ubiquitin ligase, ubiquitylated, and processed by the proteasome (Tempe et al., 2006; Wang and Li, 2006). While Gli3 is preferentially processed to its repressor form, the processing of Gli2 is much less efficient, resulting in complete proteasomal degradation (Bhatia et al., 2006; Pan et al., 2006). In vitro analysis identified that the difference in processing between Gli2 and Gli3 is due to differences in a C-terminal domain that determines partial or complete proteasomal degradation, termed the processing determinant domain (PDD) (Pan and Wang, 2007). Like Ptch1 and Smo, the Gli-proteins and Sufu display dynamic localization to the primary cilium, and mutations in both anterograde and retrograde ciliary machinery components impair proper Gli2/3 processing and trafficking (Haycraft et al., 2005; Huangfu and Anderson, 2005; Keady et al., 2012; Liu et al., 2005; Qin et al., 2011). Recent genetic experiments have also shown that cilia integrity is vital for PKA function, as mice with a partial loss of PKA and a complete loss of IFT172 exhibit a complete loss of Hh signalling akin to IFT172-/- mice, instead of the increased

12 pathway activation produced by loss of PKA activity (Tuson et al., 2011). Conversely, studies using Kif3A-/- and IFT88-/- MEFs have demonstrated that the repressive function of Sufu is maintained in the absence of cilia formation (Chen et al., 2009; Jia et al., 2009).

Recent in vitro work using endogenous protein has provided new information on the mechanism of Gli-mediated transcriptional activation in response to Shh ligand. These studies determined that Shh ligand stimulation results in the trafficking of a Sufu-full length Gli complex to the tip of the primary cilium and the dissociation of the Sufu-Gli interaction, allowing Gli to traffic to the nucleus (Humke et al., 2010; Tukachinsky et al., 2010). This event requires active, cilia-localized Smo, and the trafficking of Sufu is dependent on the presence of Gli (Chen et al., 2011c; Kim et al., 2009a; Tukachinsky et al., 2010; Zeng et al., 2010). Furthermore, analysis of Gli stability has demonstrated that the Sufu-Gli interaction is required to maintain stability of full-length Gli2 and Gli3, as they are both degraded at a faster rate than Gli3-R in response to Shh ligand or in cells lacking Sufu expression (Humke et al., 2010; Wang et al., 2010; Wen et al., 2010). Overexpression and knockdown assays in cultured cells have demonstrated that the degradation of full-length Gli proteins is mediated by the speckle-type POZ protein (SPOP)- Cullin3 (Cul3) E3 ubiquitin ligase complex (Chen et al., 2009; Wang et al., 2010; Wen et al., 2010). Additionally, SPOP is also capable of mediating the processing of Gli3 to its repressor form in the presence of Sufu (Wang et al., 2010).

While experiments in NIH-3T3 cells using the adenylate cyclase activator forskolin as a means of activating PKA displayed a prevention of Shh-induced ciliary localization of Gli2/3, the same experiment performed in PKA-/- MEFs showed that the translocation of Gli2 to the tip of the primary cilium was also blocked (Tukachinsky et al., 2010; Tuson et al., 2011). Furthermore, Gli2/3 deletion analysis has demonstrated that loss of PKA phosphorylation sites does not prevent the forskolin-induced block in ciliary localization (Zeng et al., 2010). Taken together, these data indicate that the forskolin-mediated block in ciliary Gli trafficking is at least partially independent of PKA activity. Although the effects of forskolin treatment on Gli2/3 trafficking are difficult to interpret, recent work in cerebellar granule cell progenitors (cGCP), using a combination of phospho-specific antibodies and chemical inhibitors, showed that treatment with pituitary adenylate cyclase-activating polypeptide (PACAP) antagonizes both Shh target expression and SAG-induced Gli2 ciliary localization via activation of PKA (Niewiadomski et al., 2013). Moreover, work from the same study has also suggested that Shh

13 stimulation modulates only a specific compartment of PKA activity, as treatment of cGCPs with both N-Shh and a reduced dose of PACAP results in both Hh target transcription and increased levels of total PKA activity. The intuitive hypothesis would be that Shh only affects the activity of cilia-associated PKA, as PKA has been shown to localize to the base of the cilium (Barzi et al., 2010; Tuson et al., 2011).

Identification of the G-protein coupled receptor Gpr161 has provided a potential link between PKA activity, Shh stimulation, and the primary cilium. Gpr161 localizes to the primary cilium in an IFT-A-dependent manner where it increases intracellular cAMP levels, thereby negatively regulating Hh signalling through the assumed activation of PKA (Mukhopadhyay et al., 2013). Furthermore, Gpr161 is internalized upon Hh stimulation, providing a potential mechanism for PKA inhibition in response to Hh ligand (Mukhopadhyay et al., 2013). Despite these observatoins, additional work will be required to identify specific modulation of PKA activity by Gpr161.

Another factor involved in the regulation of Gli-mediated transcription is the kinesin Kif7, which is one of two mammalian homologs of the essential Drosophila Hh factor, Costal2 (Cos2) (Varjosalo et al., 2006). While initial in vitro studies using NIH-3T3 cells and involving overexpression and RNAi knockdown did not indicate a role for Kif7 in mammalian Hh signalling, subsequent genetic and cell-based experiments identified it as being a critical regulator with tissue-specific negative and positive functions (Varjosalo et al., 2006). Kif7-/- mice exhibit polydactyly and exencephaly similar to the phenotype of Gli3-/- animals; furthermore, biochemical analysis of Kif7-/- embryos identified a decreased Gli3R/Gli3Fl ratio, indicating a role for Kif7 in the production of Gli3-R (Cheung et al., 2009; Endoh-Yamagami et al., 2009; Liem et al., 2009). Kif7 function is dependent upon the primary cilia, as mice possessing mutations in Kif7 and IFT172 exhibit a complete loss of Hh signalling, phenocopying IFT172 single mutants (Liem et al., 2009). Experiments performed in whole embryo lysates and MEFs, respectively, showed that Kif7 is capable of binding Gli2/3 and promotes the Smo-dependent trafficking of, and travels with, Gli2/3 to the cilia tip in response to pathway stimulation, further suggesting a role for Kif7 in Gli processing (Cheung et al., 2009; Endoh-Yamagami et al., 2009).

In contrast to work in fibroblasts, studies employing other cell types have indicated a positive role for Kif7 in Hh signalling. Experiments in proliferating Kif7-/- chondrocytes

14 identified an increased amount of Gli2/3 and Sufu at the cilia tip as compared to wild type cells (Hsu et al., 2011). The same study would also demonstrate an increased amount of complexed Sufu and Gli2 in Kif7-/- chondrocytes, suggesting that Kif7 is required for the dissociation of Sufu and Gli2. Additionally, loss of Kif7 was associated with increased Sufu protein levels, indicating that Kif7 may also function as a positive regulator by controlling Sufu stability. Recent work in keratinocytes has also demonstrated a positive role for Kif7 in the dissociation of Sufu and Gli2 (Li et al., 2012). Multiple studies have also presented genetic evidence for the ability of Kif7 to function as a positive regulator, as compound loss of Kif7 partially rescues the complete neural tube ventralization observed in Ptch1-/- mice (Law et al., 2012; Liem et al., 2009). While the precise mechanism of Kif7 function is not fully elucidated, current understanding proposes a model in which Kif7 can act as a tissue-specific positive or negative regulator of mammalian Hh signalling based on its ability to regulate the trafficking and processing of Gli2/3 and Sufu.

Taken together, the control of Gli-mediated transcription involves a complex network of regulatory factors acting in concert to produce processed Gli activator or repressor. The integrity of the primary cilium and the trafficking of Gli2/3 to the tip of the primary cilium are both essential for proper Gli processing. The dissociation of the Sufu-Gli complex in response to ligand is also a crucial event, and current knowledge suggests that in addition to ciliary-localized activated Smo, Kif7 and, in some tissues, Evc/Evc2 are involved in this process.

1.5 Transcription of Hedgehog target genes

Gli transcription factors control the tissue-specific regulation of genes involved in cell proliferation, differentiation, survival, and migration, and examples include Cyclins D1, D2, and E; N-Myc; Bcl-2; FoxM1; and osteopontin (Kenney and Rowitch, 2000; Kenney et al., 2003; Regl et al., 2004; Teh et al., 2002; Yoon et al., 2002). Additionally, several Hh pathway components are themselves regulated by pathway stimulation. Gli1 is a well-characterized universal target that is upregulated in response to signalling, demonstrating a positive feedback mechanism (Dai et al., 1999). Conversely, Ptch1, Ptch2, and Hip1 are upregulated, while Boc, Cdo, and Gas-1 are downregulated in response to signalling, producing a negative feedback response (Agren et al., 2004; Chuang and McMahon, 1999; Martinelli and Fan, 2007; Rahnama

15 et al., 2004; Tenzen et al., 2006). Together these feedback mechanisms allow for increased control of both the initial response and the ability to respond to future stimulation.

2 Ptch1 structure and function 2.1 Molecular characterization

Murine Ptch1 is a 1434 amino acid predicted 12-pass transmembrane protein that is encoded by a 23-exon 4305bp mRNA transcript (Goodrich et al., 1996; Stone et al., 1996). The predicted topology of Ptch1 is characterized by a cytoplasmic N-terminal domain (residues 1- 86), two large extracellular loops (residues 108-422 and 756-1013), one large intracellular loop (residues 585-734), and a cytoplasmic C-terminal tail (residues 1162-1434). Deletion analysis showed that loss of either extracellular loop abolishes the ability to bind Shh in vitro (Marigo et al., 1996). Furthermore, experiments in both cultured fibroblasts and chick neural tube further demonstrated that deletion of the second extracellular loop produces a Hh-insensitive dominant- negative variant that retains Smo-inhibitory activity (Briscoe et al., 2001; Taipale et al., 2002).

2.1.1 The sterol sensing domain

The predicted topology of Ptch1 resembles bacterial resistance, nodulation, and disease (RND) transporters, which are multi-pass transmembrane proton motive force efflux pumps associated with the transport of heavy metals and hydrophobic compounds (Tseng et al., 1999). Additionally, Ptch1 also shares homology with eukaryotic multi-pass transmembrane proteins involved in cholesterol transport via its sterol sensing domain (SSD), which spans from its second to fifth transmembrane helices (Chang et al., 2006; Tseng et al., 1999). Various mutations in the SSD of the Ptch1-related protein involved in the lipid storage disorder Niemann-Pick Type C disease (NPC1) produce both gain- and loss-of-function effects on its ability to transport cholesterol out of lysosomes and late endosomes (Millard et al., 2005).

Multiple studies assessing the effect of missense mutations in the SSD on Drosophila Ptch function have identified the conference of dominant negative activity. Drosophila Ptch-SSD mutants retain the ability to bind Hh, but lose the ability to repress Smo (Hime et al 2 art n et al 2 1 Strutt et al 2 1). Furthermore, these studies also indicated that certain

Drosophila Ptch-SSD mutants can activate Hh signalling in the absence of ligand, as expression of SSD mutants in cells that typically do not receive Hh ligand causes activation of Hh pathway targets (Strutt et al., 2001).

An analysis of SSD mutations in mammalian Ptch1 identified via luciferase reporter assays in a Ptch1-/- MEF-derived cell line that missense mutations in the SSD can abolish the repressive function of Ptch1 (Taipale et al., 2002). Because these experiments were performed in the absence of endogenous Ptch1 expression, the potential for these Ptch1-mutants to function as dominant-negatives was not assessed. One study focusing specifically on characterizing a truncation-producing Ptch1 mutation, first identified in basal cell carcinoma patients, suggested that the SSD of mammalian Ptch1 can also confer dominant negative activity (Barnes et al., 2005). The Q688X mutation produces a truncation in the middle intracellular loop just after the fifth transmembrane domain, truncating the C-terminal half of the molecule but leaving an intact SSD. Overexpression of this mutant in NIH-3T3 cells resulted in an increase in pathway activation in the absence of Shh ligand; however, the relative expression levels of mutant and endogenous Ptch1 were not taken into account (Barnes et al., 2005). This deficiency leaves the possibility that a gross excess of non-functional Q688X impaired the trafficking of endogenous Ptch1, thereby producing an apparent dominant negative phenomenon.

2.1.2 Ptch1 splice variants

The existence of alternative first exons and 5`splicing events has been identified for both human PTCH1 and murine Ptch1, providing insight into the role of the cytoplasmic N-terminus in Ptch1 function. Both human PTCH1 and murine Ptch1 possess 5 first exons termed, in the 5' to 3' direction, exons 1A-1E (Nagao et al., 2005a). Two of these exons (1A & 1C) possess alternative splice sites in humans; furthermore, the skipping of exon 2 has been characterized for isoforms containing exon 1A, resulting in nine identified PTCH1 5`splice variants (Nagao et al., 2005a; Shimokawa et al., 2007). Together, these nine isoforms result in four protein isoforms that differ in their N-terminal amino acid sequence. The protein isoform resulting from transcripts containing exons 1C, 1D, or 1E, lack the first 152 residues of full-length PTCH1, and subsequently, the first transmembrane domain (Nagao et al., 2005a). This isoform exhibits decreased protein stability, as well as a decreased ability to repress Smo activity in luciferase reporter assays compared to the other three isoforms (Nagao et al., 2005a; Shimokawa et al.,

2007). The protein isoforms resulting from transcripts containing exons 1A or 1B are both upregulated in response to Shh signalling, and those from exon 1B-containing transcripts display the strongest repressive function (Kogerman et al., 2002; Shimokawa et al., 2004, 2007). Taken together, these data indicate that the presence of the first transmembrane domain is important for PTCH1 repressive function as well as protein stability and that the former may be a product of the latter. Furthermore, Shh signalling results in the upregulation of the 5' PTCH1 splice variants encoding the protein isoforms that possess the strongest repressive capability.

In addition to 5' alternative splicing events, an alternative exon 12, termed exon 12B, was identified in human and murine Ptch1 (Nagao et al., 2005b). This exon contains an in-frame stop codon, and its incorporation results in a truncated PTCH1 protein containing only the first 607 amino acids. The truncation occurs in the middle intracellular loop, just after the SSD, similar to the aforementioned Q688X mutant. Co-expression of this PTCH1 variant with an equal amount of wild type PTCH1 resulted in Gli-luciferase reporter activity above that of wild type PTCH1 by itself, and similar to the elevated levels of PTCH1-exon12B by itself, indicating dominant negative activity of this truncated variant (Uchikawa et al., 2006).

2.1.3 Function of the Ptch1 C-terminus

Initial analysis of the role of the Ptc C-terminus in Drosophila identified that truncation of the C-terminus produced ligand-independent pathway activation, yet maintained Hh-binding capability (Johnson et al., 2000). A later study in Drosophila supported this result, but also showed through FRET and co-immunoprecipitation that full length Drosophila Ptc, Ptc with a C- terminal truncation, or the isolated C-terminus itself are all capable of forming trimers when overexpressed (Lu et al., 2006). This study also demonstrated that truncation of the C-terminus or mutation of a C-terminal Nedd4 ubiquitin ligase-binding site confers protein stability. The extent of conservation of Ptch1 function between Drosophila and mammals is currently unknown, since the precise mechanism of Ptch1 repression remains undefined and Hh signalling in Drosophila does not depend on the primary cilium. Despite these limitations, one study demonstrated that stable expression of human PTCH1 in Drosophila S2 cells that had endogenous Ptc knocked-down resulted in a rescue of both Smo repression and the upstream response to Hh, suggesting that human PTCH1 and Drosophila Ptc share conserved functions (De Rivoyre et al., 2006).

Although the trimerization of mammalian Ptch1 has not yet been identified, a group working with Ptch1-/- MEFs demonstrated that viral co-expression of the isolated, truncated, C- and N-terminal halves of the molecule restores Ptch1 repressive function, while expression of either individual C- or N-terminal half does not (Bailey et al., 2002). These data suggest that the two halves of the Ptch1 protein can assemble into a functional conformation via non-covalent interactions, supporting the possibility of functioning as a multimer. Analysis of the contribution of the murine Ptch1 C-terminus to protein stability has shown through cyloheximide experiments that, like in Drosophila, loss of the C-terminus confers stability under conditions of overexpression, and that mutation of a conserved C-terminal PPPY motif also confers stability (Kawamura et al., 2008).

Further insight into the role of the Ptch1 C-terminus in mice has been gained from analysis of the spontaneous mesenchymal dysplasia (mes) mutant (Sweet et al., 1996). The mes mutation constitutes a 32bp deletion in the C-terminus of Ptch1, resulting in the last 220 amino acids being replaced by a 68 amino acid nonsense peptide (Makino et al., 2001). Homozygous mes mice are viable and do not display abnormalities in neural tube development, but do exhibit pre-axial polydactyly and increased body weight (Makino et al., 2001), characteristics that are indicative of ectopic Hh signalling in the absence of Ptch1 (Milenkovic et al., 1999). Thus, mes appears to function as a tissue-specific, hypomorphic allele of Ptch1. The limited molecular analysis performed to date also supports this contention, with elevated steady state levels of Hh target genes in mes mice being identified in epididymal white adipose tissue (Li et al., 2008a), but not in total skin (Nieuwenhuis et al., 2007).

2.2 Mechanism of Smoothened inhibition

Taking into consideration that Ptch1 possesses a sterol sensing domain, that missense mutation of select SSD residues attenuates repressive function, that Smo activity can be modulated by steroidal alkaloids, and that genetic loss of key sterol synthesis pathway (SSP) components results in holoprosencephaly, multiple studies have been performed to assess the role of cholesterol derivatives in Hh signal transduction (Taipale et al., 2000, 2002; Wassif et al., 1998; Waterham et al., 2001).

Early experiments investigating the effects of cholesterol depletion on Hh signalling identified that both pharmacological depletion and genetic loss of cholesterol biosynthesis inhibited the ability of fibroblasts to respond to Shh stimulation (Cooper et al., 2003). Furthermore, this effect was shown to depend on events occurring between Ptch1 and Smo, as cholesterol depletion inhibited the constitutive pathway activation displayed by Ptch1-/- MEFs, but not that of cells expressing a constitutively active Smo mutant (Cooper et al., 2003). Studies following this would show that stimulation of fibroblasts or medulloblastoma cells with select oxysterols induced Smo ciliary localization and Hh target gene activation (Corcoran and Scott, 2006; Dwyer et al., 2007; Rohatgi et al., 2007). Additionally, Corcoran and Scott employed the use of multiple SSP inhibitors to confirm that it is in fact a cholesterol derivative that is required for Hh pathway activation, since blocking the conversion of cholesterol to steroid precursors or supplementing with the steroid precursor pregnenolone did not affect Hh pathway activity (Corcoran and Scott, 2006).

While Dwyer et al. demonstrated through the use of Smo-/- MEFs that the activation of Hh signalling in response to oxysterols is Smo-dependent, they hypothesized that oxysterols are unlikely to act directly on Smo, since the oxysterol mixture they employed did not compete with a fluorescently-labelled cyclopamine derivative for Smo binding (Dwyer et al., 2007). However, a later study from Nachtergaele et al. presented multiple lines of evidence that oxysterols act via a direct interaction with Smo, the strongest being the ability of a magnetic bead-conjugated 20-S- hydroxycholesterol (20-S-OHC) derivative to bind Smo in vitro (Nachtergaele et al., 2012). The same group also observed that the target of 20-S-OHC is enantioselective, which supports a protein target since lipid interactions typically don't depend on stereochemistry (Mannock et al., 2003; Westover et al., 2003). The observation that 20-S-OHC and Smoothened agonist (SAG) show synergistic activation of Hh signalling lent further support to the existence of a separate binding site for oxysterols that is distinct from the site occupied by the characterized modulators cyclopamine, SANT-1, and SAG (Nachtergaele et al., 2012). Indeed, a recent comprehensive molecular analysis has confirmed this by demonstrating that oxysterols bind the cysteine-rich N- terminus of Smo, as opposed to the heptahelical bundle site occupied by cyclopamine (Nedelcu et al., 2013). Interestingly, mutation of the Smo residues required for oxysterol binding decreased, but did not abolish, the ability of re-constituted Smo-/- MEFs to respond to Shh stimulation (Nedelcu et al., 2013). This suggests that Ptch1 regulates Smo through the control of

20 at least two separate mechanisms – one acting on the cysteine-rich N-terminus, and perhaps another through the cyclopamine-binding site.

Although the inhibitory function of Ptch1 is assumed to be cell-autonomous, one study has suggested otherwise. This group used overexpressed Smo and Gli-reporter plasmids in a pool of reporter cells to measure the Hh response to treatment with conditioned media from C3H10T1/2 fibroblasts or MDA-MB-231 breast carcinoma cells possessing overexpressed or siRNA-knocked down Ptch1. Media from cells overexpressing Ptch1 was shown to inhibit Hh activity in the reporter cells; furthermore, analysis of the media from Ptch1-overexpressing cells revealed elevated amounts of 3β-hydroxysteroids (Bijlsma et al., 2006). The authors would also identify that vitamin D3 acts as a Smo antagonist and is capable of in vitro binding to Smo in a cylopamine-competitive manner. It has been noted, however, that vitamin D3 is unlikely to be the repressive molecule responsible for the inhibitory effects of their Ptch1-conditioned media, since de novo synthesis of vitamin D3 requires UV irradiation (Eaton, 2008). Furthermore, pro- vitamin D3, 7-dehydrocholesterol (7-DHC), is also unlikely to be responsible, as its inhibitory effect on Hh signalling is not significant under most conditions (Bijlsma et al., 2006; Tang et al., 2011). While there has yet to be any further characterization of the ability of Ptch1 to secrete a sterol-derived Smo antagonist, studies investigating the therapeutic potential of vitamin D3 as a Smo antagonist have confirmed that it can inhibit Hh signalling independent of vitamin D receptor, providing support for Smo being one of its targets (Tang et al., 2011; Uhmann et al., 2011).

Taken together, this information proposes a model in which the activation of Smo is regulated endogenously by at least two different factors. Although the identities of the endogenous regulatory molecules have not yet been discovered, the evidence to date suggests that the N-terminus of Smo is agonistically regulated, possibly by an oxysterol, and that a separate site is antagonistically regulated. The mechanism by which Ptch1 would control the trafficking of these regulating factors remains undefined, although Ptch1 has been shown to both bind and promote the cellular efflux of a fluorescently labelled cholesterol derivative in an in vitro system (Bidet et al., 2011).

2.3 Effect of Ptch1 mutation in neoplasia and developmental disorder

2.3.1 Nevoid basal cell carcinoma syndrome

Nevoid basal cell carcinoma syndrome (NBCCS), also referred to as basal cell nevus syndrome or Gorlin syndrome, is an autosomal dominant disorder with an estimated prevalence of 1 in 19,000 (Evans et al., 2010), resulting in multiple developmental anomalies and an increased likelihood of developing certain neoplasias (Gorlin, 2004). Most notably, these include an estimated 90% likelihood of developing basal cell carcinoma (BCC) and odontogenic keratocysts by age 40 (Evans et al., 1993), as well as a 5% chance of developing medulloblastoma, often within the first two years of life (Cowan et al., 1997). Developmental anomalies associated with NBCCS include macrocephaly, rib and vertebral abnormalities, and less often, pre- or post-axial polydactyly (Gorlin, 2004).

Early studies mapping the gene responsible for NBCCS identified that loss of heterozygosity (LOH) in a region of chromosome 9q22-31 was associated with the spontaneous development of NBCCS-associated tumours, indicating the loss of a tumour suppressor (Farndon et al., 1992; Gailani et al., 1992). The subsequent cloning of PTCH1 and mapping it to chromosome 9q22.3 allowed for the identification of PTCH1 mutations in both NBCCS patients and spontaneous BCCs, thus indicating its function as a tumour suppressor (Hahn et al., 1996; Johnson et al., 1996). An initial screen of PTCH1 mutations in 71 independent NBCCS patients revealed that a large majority (86%) were nonsense or frameshift mutations resulting in a truncated protein (Wicking et al., 1997). Furthermore, no correlation between phenotype and the type or location of PTCH1 mutation was identified (Wicking et al., 1997). A more recent study assessing the relationship between BCC incidence and PTCH1 mutation type in NBCCS patients also found no correlation (Jones et al., 2011).

A 2005 meta-analysis of 132 published NBCCS PTCH1 mutations confirmed what prior independent case studies had suggested – that the majority are truncating nonsense or frameshift mutations (73%), as compared to missense (17%) or putative splice site (10%) mutations (Lindström et al., 2006). Analysis of the identified missense mutations indicated that 9 out of 23 were in the SSD, and a total of 15 out of 23 were located in transmembrane regions, highlighting the importance of these regions for PTCH1 function (Lindström et al., 2006). Subsequent case

22 reports have continued to identify missense and in-frame deletion mutations occurring in the SSD (Lü et al., 2008; Marsh et al., 2005; Matsuzawa et al., 2006; Nakamura and Tokura, 2009).

Heterozygous Ptch1 mice recapitulate several features of NBCCS, including increased body size, increased incidence of medulloblastoma and rhabdomyosarcoma, as well as polydactyly and rib abnormalities (Goodrich et al., 1997; Hahn et al., 1998). Additionally, recent work from an ENU screen for facial defect mutants in mice has identified a hypomorphic allele of Ptch1, Dogface-like (Ptch1DL), that results in NBCCS-like limb, rib, and craniofacial defects (Feng et al., 2013). Ptch1DL mice possess a point mutation at the exon 13-intron 13 junction, producing a splice site mutation that results in two aberrant protein isoforms – a more prominently expressed 571 amino acid isoform truncated in the SSD, and a 1446 amino acid isoform possessing a 12 residue insertion in the large intracellular loop. While further work will be required to identify the molecular characteristics of the two Ptch1DL isoforms, the Ptch1DL allele may be a useful genetic tool in characterizing in vivo Ptch1 function.

2.3.2 Basal cell carcinoma

Basal cell carcinoma (BCC) is the most common cancer affecting Caucasians, with a current estimated lifetime risk of 30% (Miller and Weinstock, 1994). Increased risk is associated with male sex, increased age, fair complexion, sun sensitivity, UV exposure, and ionizing radiation (Wong et al., 2003). Typically lesions present themselves on head and neck areas exposed to sun, but development on other parts of the body is also possible (Wong et al., 2003). BCCs are named thus as they resemble basal keratinocytes of the epidermis. Although they rarely metastasize, they can display aggressive invasive growth and cause local tissue destruction (Lo et al., 1991; Walling et al., 2004). BCCs can be subdivided into two main subsets, indolent- growth and aggressive-growth, based on their behaviour (Crowson, 2006). Indolent-growth BCCs include the histological classes nodular, micronodular, and superficial, while aggressive- growth BCCs are comprised of the infiltrative, metatypical, and morpheaform histological classes (Crowson, 2006). BCCs express the Hh pathway targets PTCH1 and GLI1 (Dahmane et al., 1997; Nagano et al., 1999; Undén et al., 1997), and transgenic mice overexpressing positive Hh effectors have been shown to develop BCC (Grachtchouk et al., 2000; Nilsson et al., 2000; Oro et al., 1997; Xie et al., 1998).

As mentioned, PTCH1 mutations are commonly identified in spontaneous BCCs (Aszterbaum et al., 1998; Gailani et al., 1996; Unden et al., 1996), with more recent analyses identifying PTCH1 mutations in 67% of 42 (Reifenberger et al., 2005), 48% of 60 (Heitzer et al., 2007), and 55% of 31 (Huang et al., 2013) spontaneous BCC tumours analyzed. In addition to mutation, loss of heterozygosity at the PTCH1 locus is also common, with studies reporting LOH in 40-60% of tumours analyzed (Danaee et al., 2006; Huang et al., 2013; Reifenberger et al., 2005). Interestingly, distribution analysis of PTCH1 mutations in 86 sporadic BCCs revealed that while the majority of mutations were truncating, the majority of missense mutations were located in the two large extracellular loops, the large intracellular loop, and the C-terminus, which is different from the pattern observed for germline missense mutations in NBCCS patients (Lindström et al., 2006). Also, in contrast to the high percentage of deletions and insertions found in germline NBCCS mutations, PTCH1 mutations in sporadic BCCs are primarily substitutions, with studies identifying 40-50% as being C > T or CC > TT UVB-associated mutations, highlighting the importance of UVB exposure in development of BCC (Brash, 1997; Daya-Grosjean and Sarasin, 2000; Lindström et al., 2006; Reifenberger et al., 2005). It is interesting to note, however, that in a study analyzing both PTCH1 and tumor suppressor p53 mutations a larger percentage (72%) of p53 mutations found in BCC, which occured in 40% of cases, were UVB associated compared to PTCH1(40%), indicating the presence of UV- independent mechanisms of inactivation of PTCH1. Higher p53 protein expression levels have been correlated with aggressive-growth BCCs (Ansarin et al., 2006; Auepemkiate et al., 2002), and one study has shown a modest correlation between aggressive-growth BCC and frequency of p53 mutation (Bolshakov et al., 2003). In addition to mutations in PTCH1, multiple studies have also identified the presence of activating Smo mutations in BCC, with frequencies of occurrence ranging from 6-13% of tumours analyzed (Reifenberger et al., 1998, 2005; Xie et al., 1998).

Ptch1 transgenic mouse models have been employed extensively in studies focused on identifying the underlying mechanism of BCC. Although Ptch1+/- mice do not spontaneously develop macroscopic BCCs (Goodrich et al., 1997; Hahn et al., 1998), they do in response to UVB or ionizing radiation (IR) treatment (Aszterbaum et al., 1999; Mancuso et al., 2004). Additionally, BCCs from UVB treated Ptch1+/- mice exhibit UV-associated p53 mutations and exposure to UVB or IR treatment can produce BCCs with LOH at the Ptch1 locus, demonstrating that tumours from irradiated Ptch1+/- mice recapitulate key features of sporadic BCCs in human

24 patients (Aszterbaum et al., 1999; Mancuso et al., 2004). Further analysis of irradiated Ptch1+/- mice would reveal that the susceptibility to tumour development is influenced by the hair follicle cycle during irradiation, with the greatest susceptibility being displayed during early anagen phase when hair follicle bulge stem cells are proliferating (Mancuso et al., 2006). Ptch1+/- mice have also been used in studies attempting to identify the cell of origin in mouse BCC. Work from Wang et al. used IR treated Ptch1+/- mice in combination with inducible YFP expression under control of the follicle bulge cell marker keratin 15 (K15) promoter to show that BCCs in irradiated Ptch1+/- mice arise primarily from this cell population (Wang et al., 2011). Interestingly, expression of constitutively active Smo (SmoM2) in follicle bulge stem cells does not induce BCC formation (Wong and Reiter, 2011; Youssef et al., 2010). Wang et al. suggested in their manuscript that the difference between the two models may be explained by an increase of nuclear cyclin B1 in Ptch1+/- mice, as compared to those expressing SmoM2 (Wang et al., 2011). Support for Smo-independent regulation of cyclin B1 localization by Ptch1 comes not only from earlier molecular studies (described in section 3.1, Barnes et al., 2001), but also from work using an inducible knockout of Ptch1 that produces BCC and increased nuclear cyclin B1 and D1 upon Ptch1 elimination (Adolphe et al., 2006). Inducible Ptch1 knockout mice have also been used to show that bi-allelic, but not mono-allelic loss of Ptch1 is required for BCC formation in mice, supporting a two-hit hypothesis of BCC tumourigenesis (Zibat et al., 2009). Moreover, inducible Ptch1 ablation has identified a role for Hh signalling in promoting hair follicle stem cell proliferation at the expense of differentiation, through the upregulation of insulin-like growth factor binding protein 2 (Igfbp2) (Villani et al., 2010).

2.3.3 Medulloblastoma

The cerebellar cancer medulloblastoma is the most common nervous system malignancy affecting infants (Rutkowski et al., 2010). Medulloblastomas are currently categorized into one of four molecular groups, SHH, WNT, Group 3, or Group 4, based on their transcriptional profiling (Kool et al., 2012). Of these, the WNT group generally has the best prognosis, with Group 3 having the least favourable, and SHH and Group 4 lying in the middle (Kool et al., 2012). More than half of medulloblastomas in adults and infants, and 14% in children ages 4-16 fall into the SHH group (Kool et al., 2012). Transcriptional profiling of infant and adult SHH medulloblastomas suggests that these two categories comprise distinct sub-groups within the SHH group (Northcott et al., 2011). SHH medulloblastomas are known to display mutation in

PTCH1 (Dong et al., 2000; Pietsch et al., 1997; Raffel et al., 1997; Wolter et al., 1997; Zurawel et al., 2000a) and SUFU (Brugières et al., 2010, 2012; Taylor et al., 2002), with recent studies showing mutation of PTCH1 in 23-30% of SHH group tumours (Jones et al., 2012; Kool et al., 2008; Pugh et al., 2012; Robinson et al., 2012). Additionally, a recent meta-analysis of medulloblastoma copy-number aberration data has indicated that about 47% of SHH group tumours display partial or complete loss of chromosome 9q (Kool et al., 2012). An earlier distribution analysis of 23 PTCH1 mutation-containing sporadic medulloblastoma samples revealed that the large majority of mutations are truncating, and that 4 of the 5 missense mutations analyzed localized to transmembrane regions (Lindström et al., 2006).

Ptch1+/- mice develop spontaneous medulloblastomas at a frequency of about 14% within a span of 10 months (Goodrich et al., 1997; Wetmore et al., 2000). The incidence of medulloblastoma development in these animals is increased greatly when combined with ionizing radiation treatment or p53 loss (Pazzaglia et al., 2002; Wetmore et al., 2001). The Ptch1+/- mouse medulloblastoma model has been used extensively in studies focused on genetic interactions between Ptch1 and downstream Hh targets (Kimura et al., 2005; Pogoriler et al., 2006) or other tumour suppressors (Ayrault et al., 2009; Briggs et al., 2008), as well as studies investigating the therapeutic potential of Hh pathway inhibitors (Berman et al., 2002; Romer et al., 2004). Although earlier work suggested that medulloblastomas from Ptch1+/- mice retain expression of the wild type allele (Wetmore et al., 2000; Zurawel et al., 2000b), later studies in both the exon 1-2 and exon 6-7 neomycin insertion models used primers capable of differentiating between the wild type and insertion alleles to demonstrate that expression of wild type Ptch1 is lost in cerebellar tumours from these animals, supporting a two-hit model of tumourigenesis (Oliver et al., 2005; Pazzaglia et al., 2006). In addition to Ptch1 heterozygotes, conditional deletion of Ptch1 has also been used, most notably to show that conditional bi-allelic loss of Ptch1 in neural stem cells or granule neuron precursors can result in medulloblastomas arising from either respective Ptch1-deficient cell population (Yang et al., 2008).

2.3.4 Holoprosencephaly

Holoprosencephaly (HPE) results from failure of the prosencephalon to separate into cerebral hemispheres, and is the most commonly observed developmental anomaly of the forebrain in humans (Dubourg et al., 2007). Although considered an autosomal dominant

26 disorder, high inter- and intra-family phenotypic variability indicates that HPE is the result of a complex interaction between multiple genetic and environmental factors (Hehr et al., 2004). SHH is one of four genes most commonly mutated in HPE, along with ZIC2, SIX3, and TGIF, and mutations in SHH occur in roughly 9% of cases (Dubourg et al., 2004). In addition to SHH, mutations in other Hh pathway factors have also been identified, including GLI2 (Bertolacini et al., 2012; Roessler et al., 2003), DISP1 (Roessler et al., 2009b), GAS-1 (Pineda-Alvarez et al., 2012), CDO (Bae et al., 2011), and PTCH1 (Ming et al., 2002; Rahimov et al., 2006; Ribeiro et al., 2006). Analysis of the 11 cases of PTCH1 mutation identified to date reveals that 5 occur in the large extracellular loops, 4 occur in intracellular loops, and 2 occur in transmembrane domains. In contrast to PTCH1 mutations identified in NBCCS or sporadic neoplasia, mutations associated with HPE would be assumed to produce a gain-of-function effect with respect to pathway inhibition. Thus, the mutations in the extracellular loops would be expected, based on previous characterization of extracellular loop deletions (Marigo et al., 1996; Taipale et al., 2002). However, the mechanism by which intracellular loop mutants would produce increased pathway inhibition still remains unresolved.

2.4 Relation to Ptch2

In addition to Ptch1, mammals possess Ptch2, a second 12-pass transmembrane SSD- containing hedgehog receptor. Murine Ptch2 consists of 1182 amino acids and shares 56% sequence identity with Ptch1 (Motoyama et al., 1998b). Its predicted topology is similar to Ptch1, although its cytoplasmic N- and C- termini are both shorter and show the most variability, along with the hydrophilic region between transmembrane domains 6 and 7 (Motoyama et al., 1998b). The shorter C-terminus has been suggested to confer increased protein stability relative to Ptch1 (Kawamura et al., 2008). Early characterization of Ptch2 identified that it is capable of binding all three Hh ligands with an affinity similar to Ptch1 (Carpenter et al., 1998), and that it itself is a direct transcriptional target of Hh pathway activation (Rahnama et al., 2004).

It has been well established through luciferase reporter assays that Ptch2 is capable of pathway repression, although the relative strength of its repressive capability in comparison to Ptch1 remains less well defined, with two studies showing a slightly weaker repression by Ptch2 and one showing no apparent difference (Holtz et al., 2013; Nieuwenhuis et al., 2006; Rahnama

27 et al., 2004). There have also been splice variants characterized for both murine Ptch2 and human PTCH2. These include a murine Ptch2 variant that skips exons 6 and 7, resulting in slightly attenuated repressive capability (Nieuwenhuis et al., 2006), as well as human PTCH2 variants that skip exon 22 or exons 9 and 10, resulting in increased repressive capability for the variant that skips exon 22 and no apparent change in repressive capability for the variant that skips exons 9 and 10 (Rahnama et al., 2004). A recent study has further characterized the molecular function of Ptch2, showing that it is capable of localizing to the primary cilium upon overexpression; capable of complexing with Boc, Cdo, and Gas-1; and that mutation of SSD residues showing conservation with bacterial RND transporters impairs its repressive capability, akin to Ptch1 (Holtz et al., 2013).

Unlike Ptch1-/- mice, Ptch2-/- mice are both viable and fertile, and do not display any defects in neural tube or limb bud patterning (Holtz et al., 2013; Lee et al., 2006; Nieuwenhuis et al., 2006). However, analysis of mice homozygous for a hypomorphic Ptch2 allele did reveal the presence of alopecia and epidermal hyperplasia in male mice with increased age, suggesting a requirement for Ptch2 in the maintenance of skin homeostasis (Nieuwenhuis et al., 2006). While Ptch2-/- mice do not display overt developmental defects, experiments employing compound mutants have helped to dissect its regulatory function. First, loss of Ptch2 increases the incidence of tumourigenesis in Ptch1+/- mice. Although IR treatment or compound p53 loss does not produce any synergistic effects with Ptch2 deficiency in tumourigenesis, compound loss of one or both Ptch2 alleles does increase the incidence of medulloblastoma and rhabdomyosarcoma development in Ptch1+/- mice, suggesting a compensatory role for Ptch2 in the presence of Ptch1 haploinsufficiency (Lee et al., 2006). It is also worth mentioning that, although rare, there have been case reports identifying PTCH2 mutations in NBCCS patients (Fan et al., 2008; Fujii et al., 2013), as well as sporadic BCCs and medulloblastomas (Smyth et al., 1999).

Additionally, a recent study has used mice with compound Ptch1, Ptch2, and Hip1 deficiencies to identify the genetic interactions between the three receptors in embryonic neural patterning. Holtz et al. employed the use of Ptch1-/- mice expressing low levels of a Ptch1 transgene under a metallothionein promoter (MT-Ptch1;Ptch1-/-), which is assumed to express enough Ptch1 to allow for Smo inhibition but not proper sequestration of Hh ligand (Milenkovic et al., 1999). MT-Ptch1; Ptch1-/-Ptch2-/- mice displayed an expansion of ventral progenitor domains in the developing neural tube at E10.5 compared to MT-Ptch1; Ptch1-/- mice, similar to

28 previous work using MT-Ptch1; Ptch1-/-Hip1-/- mice (Holtz et al., 2013; Jeong and McMahon, 2005). Furthermore, triple deficient MT-Ptch1; Ptch1-/-Ptch2-/-Hip1-/- mice showed complete ventralization of the neural tube at E10.5, similar to Ptch1-/- animals, indicating that in the absence of Ptch1 and Hip1, Ptch2 is required for proper establishment of the Shh morphogen gradient in the developing neural tube (Holtz et al., 2013).

3 Non-canonical Hedgehog signalling

Although the canonical Hh signalling pathway involving reception of Hh ligand, activation and transduction through Smo, and Gli-mediated transcriptional regulation has been well characterized, growing evidence indicates the existence of other signalling cascades involving select core Hh components. These include signalling events occurring through Ptch1 that are independent of Smo, as well as events acting through Smo that are independent of Gli- mediated transcription. A well-characterized example of the latter is the ability of Shh to induce cytoskeletal re-organization. Specifically, it has been demonstrated that stimulation of endothelial cells that lack a transcriptional response to Hh ligands results in cyclopamine- sensitive activation of the small GTPase RhoA and actin stress fiber formation (Chinchilla et al., 2010). Follow-up work in cultured fibroblasts has also shown through chemical inhibition that the Smo-mediated activation of Rac1 and RhoA small GTPases is dependent on PI3K and Gi activity (Polizio et al., 2011).

3.1 Non-canonical Hedgehog signalling events acting through Ptch1

A role for Ptch1 in the regulation of a cell cycle G2/M checkpoint was first identified through the molecular characterization of a direct interaction with cyclin B1 (Barnes et al., 2001). This study first identified Ptch1 as being a cyclin B1 interactor via a yeast two hybrid screen using a phospho-mimetic cyclin B1 mutant as bait. Subsequent biochemical analysis would reveal that that the two endogenous proteins co-immunoprecipitate, likely requiring the middle intracellular loop of Ptch1, and that Ptch1 binds a phospho-mimetic, but not a constitutively non-phosphorylated cyclin B1. Furthermore, treatment with Shh ligand resulted in

29 translocation of cyclin B1 to the nucleus. This creates a model in which Ptch1 tethers phosphorylated cyclin B1 in the cytoplasm in the absence of ligand, while stimulation with Shh breaks this interaction and allows cyclin B1 to translocate to the nucleus and promote mitosis.

Subsequent in vivo studies have provided support for this model. First, a study in mice employing a conditional knockout of Ptch1 in interfollicular epithelium basal cells demonstrated that conditional deletion of Ptch1 results in a 30% increase in nuclear cyclin B1 compared to non-induced controls, as measured by immunohistochemical analysis (Adolphe et al., 2006). Additionally, work analyzing via immunohistochemistry the expression of PTCH1 and SHH in human urinary tract development identified a downregulation of SHH in the medullary collecting duct at 28 weeks, as compared to 26 weeks (Jenkins et al., 2007). Jenkins et al. used this observation as a basis to compare the localization of cyclin B1 in PTCH1-expressing cells in the presence or absence of SHH expression. They identified that at 28 weeks when SHH expression is downregulated, cyclin B1 localizes to the apical cell surface, similar to the localization of PTCH1. However, at 26 weeks when SHH expression is high, cyclin B1 displayed a diffuse cytoplasmic localization with occasional nuclear localization, supporting a model in which cyclin B1 localization is influenced by Shh stimulation.

In addition to cell cycle regulation, a role for Ptch1 in the promotion of apoptosis has also been identified. In HEK293 cells and in the chick neural tube, overexpression of Ptch1 induces apoptosis via activation of caspase activity. This pro-apoptotic activity is inhibited in the presence of Shh ligand (Thibert et al., 2003). This study would also identify that the C-terminus of Ptch1 is itself a substrate of caspases-3,7, and 8, and that the caspase-mediated cleavage of Ptch1 depends on a conserved aspartic acid at residue 1392 of human Ptch1. Mutation of D1392 to asparagine abrogated the ability of Ptch1 to promote apoptosis, while a truncation of Ptch1 at residue 1392 resulted in the promotion of apoptosis even in the presence of Shh, suggesting that cleavage at this residue exposes the domain of the Ptch1 C-terminus required for promotion of apoptosis. The results of this study led the authors to classify Ptch1 as a dependence-receptor, which are defined loosely as a family of receptors involved in cell survival and differentiation that promote apoptosis in the absence of their ligand via a cytoplasmic caspase cleavage site, but have this pro-apoptotic activity inhibited in the presence of their respective ligands (Mehlen and Bredesen, 2004). A more recent study in human umbilical vein endothelial cells has also supported a non-canonical, pro-apoptotic function of Ptch1 by demonstrating that Shh

30 stimulation in the presence of Smo inhibition, or RNAi knockdown of Ptch1, both lead to a reduction in caspase-3 activity (Chinchilla et al., 2010).

Subsequent in vitro work aimed at identifying the mechanism by which Ptch1 promotes apoptosis showed that in the absence of Shh, Ptch1 recruits via its C-terminus a pro-apoptotic complex consisting of the adaptor protein DRAL, either of the caspase recruitment domain- containing proteins TUCAN or NALP1, and caspase-9 (Mille et al., 2009). Moreover, RNAi knockdown of individual complex members demonstrated their requirement for Ptch1-induced apoptosis. A follow-up study by the same group has recently identified that Ptch1 associates with the E3 ubiquitin ligase NEDD4 in a Shh-independent manner, and that the recruitment of NEDD4 to the pro-apoptotic DRAL complex is required for the ubiquitination of caspase-9 and subsequent caspase-mediated apoptotic activity (Fombonne et al., 2012). Despite this, the mechanistic association between caspase cleavage of Ptch1 and the recruitment of the pro- apoptotic DRAL/caspase-9 complex has yet to be elucidated.

The discovery of a C-terminal Ptch1 polymorphism in the FVB strain of mice led to the identification of another potential non-canonical interaction involving Ptch1. FVB mice contain a T1267N polymorphism that makes them susceptible to squamous cell carcinoma induced by an oncogenic H-Ras transgene; furthermore, this polymorphism also results in a decreased ability of Ptch1 to complex the tumour suppressor Tid1 (Wakabayashi et al., 2007). While the significance of this interaction has yet to be fully defined, follow up work from the same group has demonstrated that chemical activation of Protein Kinase C leading to extracellular signal- regulated kinase 1/2 (ERK1/2) activation destabilizes the interaction between C57BL/6 variant Ptch1 and Tid1, potentially linking Ras activation to the Ptch1-Tid1 interaction (Kang et al., 2013).

Previous work from our lab has also identified a novel non-canonical Hh signalling cascade. Experiments in cultured fibroblast mammary epithelial cell lines demonstrated that stimulation with N-Shh results in MEK-dependent activation of ERK1/2 (Chang et al., 2010). This event was shown to be Smo-independent, as ERK1/2 activation was still observed in the presence of Smo-inhibition, as well as in the mammary epithelial cell line MCF10A, which lack detectable Smo expression (Chang et al., 2010; Zhang et al., 2009). Although the precise mechanism of this non-canonical signalling event remains undefined, biochemical analysis from

31 the same study identified through GST pull-down assays and co-immunoprecipitation that the isolated C-terminus of Ptch1 associates with multiple Src homology 3 (SH3)-domain-containing factors, namely the non-receptor tyrosine kinase c-src, the PI3K regulatory subunit p85β and the E3 ubiquitin ligase Smurf2.

3.2 Identification of a novel Ptch1-mediated signalling cascade involving c-src

Discovered as the cellular avian homolog of the oncogene responsible for transformation via Rous-sarcoma virus (Stehelin et al., 1976; Takeya and Hanafusa, 1982), the proto-oncogene c-src is a non-receptor tyrosine kinase that has function in multiple signal transduction pathways (Kim et al., 2009b). Well characterized examples of these include promoting proliferation through MEK-mediated ERK activation via the activation of growth factor receptor tyrosine kinases, promotion of cell survival via PI3K/Akt activation, and the promotion of proliferation through the activation of signal transducer and activator of transcription (STAT) family members (Kim et al., 2009b; Silva, 2004). In addition to c-src, the Src family kinase (SFK) family also includes Fyn, Lyn, Lck, Hck, Blk, Yes, Yrk, Yrg, and Fgr. All family members share four Src homology (SH) protein domains: an SH1 domain that contains the catalytic residues, an SH2 domain that binds phosphotyrosine residues, an SH3 domain that binds poly-proline motifs, and an SH4 domain that possesses a myristoylation sequence (Wheeler et al., 2009). Out of all SFK family members, c-src, Fyn, and Yes are the three that display ubiquitous tissue expression (Wheeler et al., 2009).

Roles for c-src have been identified in both mammary gland development and breast cancer. Mice deficient for c-src display a delay in mammary gland development at puberty, and further molecular analysis of mammary epithelial cells derived from these animals revealed impairment in the ability to activate estrogen receptor alpha (ERα) and Akt in response to estrogen treatment (Kim et al., 2005). Defects in lactation have also been identified in nursing c- src-/- mice (Watkin et al., 2008). Although analysis of transgenic mice expressing activated c-src in mammary epithelial cells has indicated that c-src possesses mild oncogenic capacity in the mammary gland (Webster et al., 1995), breast cancer samples and cell lines show elevated levels of c-src protein and SFK kinase activity (Wheeler et al., 2009). Additionally, breast cancer

32 mouse models employing transformation via mammary epithelium-expressed polyomavirus (PyV) middle T antigen or overexpressed ErbB2 both display increased c-src kinase activity, and disruption of c-src impairs tumourigenesis via PyV (Guy et al., 1994; Marcotte et al., 2012; Muthuswamy et al., 1994).

A previous study from our lab, in collaboration with the lab of Dr. Michael Lewis, identified that mes mice exhibit a block in mammary gland development during puberty. Specifically, the mammary glands of mes mice fail to respond to ovarian hormones during puberty and do not exhibit any ductal branching beyond the rudimentary structure formed during embryogenesis (Moraes et al., 2009). The aforementioned GST-pulldown data in conjunction with the observation that stimulation of cultured fibroblasts and mammary epithelial cells with N-Shh can activate c-src led to the hypothesis that c-src may function downstream of Ptch1. To test this, mice expressing a mammary epithelial cell-restricted activated c-src transgene (MMTV- c-srcAct) were crossed onto the mes background. At 24 weeks, mes mice possessing the MMTV- c-srcAct transgene displayed ductal branching to the edge of the fat pad, indicating rescue of the block in mammary gland morphogenesis (Chang et al., 2012). Crossing mice possessing an MMTV-ErbB2Act transgene onto the mes background did not rescue the block in mammary gland development, indicating that c-src is a specific downstream effector of Ptch1.

Rationale

Taking into consideration that the isolated SH3-domain of c-src is capable of in vitro binding to the isolated C-terminus of Ptch1 (Chang et al., 2010), and that mammary-epithelial specific overexpression of an activated c-src transgene rescues the defect in mammary gland development displayed by mes mice (Chang et al., 2012), we propose that the link between Ptch1 and c-src involves a physical association. Furthermore, characterization to date of the effect of the mes allele on canonical Hh signalling is ambiguous, with studies showing elevated levels of Hh target genes in some tissues (Li et al., 2008a), but not others (Nieuwenhuis et al., 2007). We propose to clarify its canonical function through the use of both transient reporter assays and direct transcriptional analysis of primary cells.

Hypothesis & Objectives

We hypothesize that the intracellular domains of Ptch1, in particular the C-terminus, mediate distinct canonical and non-canonical functions, one being a direct association with c-src. The objectives are as follows:

1. Identify the structural requirements for the interaction between Ptch1 and c-src.

2. Identify the role of the Ptch1 C-terminus in non-canonical activation of c-src and ERK in response to Shh stimulation.

3. Identify the role of the Ptch1 C-terminus in the transcriptional activation of canonical Hedgehog targets.

Materials & Methods

Cell culture

HEK 293 cells (a kind gift of Prof. S. Girardin) and Ptch1-/- MEFs (a kind gift of Prof. S. Angers) were cultured in DMEM with 10% FBS and 1% penicillin-streptomycin. MCF10A cells were cultured in D E /F12 with 5% horse serum 1 μg/ml insulin 5 μg/ml hydrocortisone 2 ng/ml EGF, 1 ng/ml cholera toxin, and 1% penicillin-streptomycin. Shh Light II fibroblasts (ATCC) were cultured in DMEM.

For serum starvation of MCF10A cells, cells were trypsinized and replated in growth medium to allow re-attachment. Four hours later, the medium was changed to DMEM/F12 with 0.5% serum. After 24h of serum starvation the cells were stimulated with Shh- or pcDNA3- conditioned media for 1 hour and lysed in DDM lysis buffer.

Primary cell culture

Wildtype and mes/mes littermate animals on C57Bl/6 background were sacrificed at 3 months. Thoracic and inguinal mammary glands were then dissected and minced into as small of fragments as possible. Next, the mammary glands were incubated in a solution of 3mg/ml

35 collagenase A in DMEM/F12 for 45 minutes at 37°C. Mechanical dissociation was then performed by slowly pipetting 10-15 times with a 5ml pipette, adding FBS to a final concentration of 2%, and then pipetting harder 15 times. Epithelial (pelleted) and mesenchymal (supernatant) layers were separated by centrifuging at 250rpm for 2 minutes. The mesenchymal layer was then strained using a 40µm cell strainer, washed with 5ml of DMEM/F12, and plated in D E /F12 with 1 % FBS 1 μg/ml insulin 1 μg/ml transferrin and 20 ng/ml EGF.

For c-src and ERK1/2 activation assays, primary mouse mammary mesenchymal cells were starved for 48h in serum-free D E /F12 then stimulated with 1μg/ml N-Shh peptide (R & D Systems), or 2 ng/μl EGF for 1h Cells were then lysed in 1% DD lysis buffer

For canonical pathway activation assays, primary mammary mesenchymal cells were starved as described above, then stimulated with pcDNA3-conditioned media, Shh-conditioned media, or Shh-conditioned media with 1 µM SANT-1 (Toronto Research Chemicals) for 24h.

Cloning & Expression Constructs

Wild type, full length mouse Ptch1, tagged at its C-terminus and the full length mes Ptch1 mutant in pcDNA3 described previously (Chang et al., 2010; Nieuwenhuis et al., 2007) were kind gifts of Prof. C.C. Hui (Hospital for Sick Children Research Institute). To make the untagged, full length, wild type version of Ptch1, sequence encoding the C-terminus in the HA-tagged version was removed at the Pflm1 site and replaced with untagged wild type sequence we isolated previously (Nieuwenhuis et al., 2007). The Ptch1∆C mutant (∆1173-1311) was produced by truncation of the full length cDNA at the PflM1 site (nt 3519) and religating the vector. The Ptch1∆ L mutant (∆614-709) was produced by cutting out the sequence between the Stu I site (nt 1845) and the Xho I site (nt 2127), blunt ending the Xho I site with Klenow and religating the vector. The compound Ptch∆ L∆C mutant was produced from the Ptch1∆ L mutant and cutting off the C-terminus at the PflMI site as described for the Ptch1∆C mutant Human activated c-src (Y530F) was a kind gift of Prof. William J. Muller.

Western blotting and immunoprecipitation

Western blots were performed as described previously (Chang et al., 2010). Briefly, adherent cells in monolayer were washed 3 times in ice cold PBS. Cells in 100 mm plates were then scraped following addition of 0.5 ml DDM lysis buffer containing protease and phosphatase inhibitors (50mM Tris pH 7.6, 150mM NaCl, 2mM EDTA, 1% n-dodecyl-β-d-maltoside, 57m P SF 1 μ leupeptin 3μ aprotinin 1 m NaF 1m sodium orthovanadate) Lysates were incubated for 20 minutes at 4°C and then centrifuged in a refrigerated microcentrifuge for 30 minutes at 13,000 rpm to pellet insoluble material. Supernatant concentrations were measured by Bradford assay using Bio-Rad Protein Assay reagent. For straight western blots, 4x SDS-loading buffer (50mM Tris pH 6.8, 100mM DTT, 2% SDS, 0.1% bromophenol blue, 10% glycerol) was added to lysates containing 40µg of protein and incubated for 15 minutes at 37°C to avoid aggregation of membrane proteins. Samples were resolved by 10% SDS-PAGE and blotted onto nitrocellulose membrane. Blots were blocked with 5% skim milk powder in TBS-T (137mM NaCl, 2.7mM KCl, 25mM Tris, 0.1% Triton X-100), and then probed with primary antibody overnight at 4°C. Antibodies and dilutions used are as follows: 1:1 goat α-Ptch1 (Santa Cruz; sc-6149) 1:1 rabbit α-c-src (Cell Signaling), 1:1000 rabbit α-p-src- 16 (Cell Signaling) 1:1 mouse α-non-p-src- 16 (Cell Signaling) 1:5 rabbit α- actin (Sigma) 1:1 mouse α-p-ERK (Cell Signaling) 1:1 rabbit α-ERK (Cell Signaling), 1:1000 rabbit α-phosphotyrosine (BD) and 1:1 mouse α-HA (Applied Biological Materials). Blots to be re-probed were stripped in stripping buffer (2% SDS, 62.5mM Tris pH 6.8, 100mM β-mercaptoethanol) for 30 minutes at 72°C.

For immunoprecipitation 15 μg (HEK 293) or 6 μg ( CF1 A) of total cell lysate were incubated with primary antibody overnight at °C in DD lysis buffer 15μl of Protein G- agarose beads (Invitrogen) were added to each sample the following day and incubated at 4°C for 90 minutes. Beads were washed 5 times with DDM lysis buffer and re-suspended in 25μl of SDS loading buffer.

Glycosidase treatment

For glycosidase treatment μg of DD cell lysate was incubated in a 3 μl reaction for 1h at 37°C with 250 U Endo H (New England Biolabs) or 500 U PNGase F (New England Biolabs).

Preparation of Shh-conditioned media

Shh- and pcDNA-conditioned media were prepared by transfecting 40% confluent 100mm plates of HEK 293 cells in 5% FBS with 15µg of pCDNA3.1-N-Shh or pcDNA3 using 2mg/ml PEI at a 2:1 ratio. Cells were grown for 4-5 days and the media was harvested by centrifugation at 2500 rpm for 5 minutes at 4°C. The supernatant was then sterile-filtered with a 0.22μm syringe filter Prior to use, conditioned media was diluted 10X in serum free media to a final serum concentration of 0.5%. Activity of conditioned media was measured by luciferase assay in Shh Light II fibroblasts as described below.

Shh:AP-conditioned media was prepared by transfecting 40% confluent 100mm plates of HEK 293 cells in 10% FBS with 15µg of pcDNA3-Shh:AP (a kind gift of Prof. F. Charron) using 2mg/ml PEI at a 2:1 ratio. Cells were grown for 4 days and the media was harvested by centrifugation at 2500 rpm for 5 minutes at 4°C. The supernatant was then sterile-filtered with a 22μm syringe filter Alkaline phosphatase activity of conditioned media was measured by absorbance at 405nm, as described below.

Luciferase assays

Activity of the Shh ligand (peptide or conditioned media) was assayed using Shh Light II fibroblasts. Confluent cells were serum-starved in 0.5% serum for 24h and then stimulated with conditioned media or Shh-peptide for 24h. Cells were then lysed in passive lysis buffer (Promega) and luciferase activity was measured by Dual-Luciferase Reporter Assay System (Promega). Shh Light II fibroblasts contain an 8X-Gli-binding-site Luciferase firefly reporter transgene and a constitutive renilla luciferase transgene. Gli-reporter activity was normalized to renilla activity.

Activity of the wild type and deletion mutants of Ptch1 was determined using Ptch1-/- MEFs. For Hh-pathway repression activity of Ptch1, a confluent 100 mm plate of Ptch1-/- MEFs cells were seeded at a 1:5 ratio in 24-well plates. The following day, cells were transfected with Fugene 6 (3:1 ratio; Promega) mixed with 400ng 8X Gli-Luciferase reporter, 40ng pCMV5-Renilla luciferase, and 25ng or 200ng Ptch1 and pcDNA3, the latter used to bring the total amount of DNA to 640ng. Cells were grown for 48h, then lysed in passive lysis buffer and measured for luciferase activity as described above. For assays measuring the ability of Ptch1 or Ptch1 mutants to mediate Shh-ligand signalling, cells were plated and transfected as described above but using only one concentration (25ng) of Ptch1 expression construct. Cells were grown for 48h, switched to Shh- or pcDNA3-conditioned media in 0.5% serum for 24h, lysed in passive lysis buffer and assayed as described.

RT-PCR and qRT-PCR

For RT-PCR, total RNA was isolated from primary mouse mammary mesenchymal cells using Trizol reagent (Invitrogen). RT-PCR was performed using a SuperScript III One-Step RT-PCR kit (Invitrogen) with 260ng of RNA per sample. Primer sequences were as follows: mouse Ptch1 forward 5' GTCTTGGGGGTTCTCAATG 3'; mouse Ptch1 reverse 5' ATGGCGGTGGACGTTGGGTCCC 3'; mouse Gli1 forward 5' TGGACTCCATAGGGAGGTGAA 3'; mouse Gli1 reverse 5' CTCCTCCTCGGAGTTCAGTCA 3'; mouse GAPDH forward 5' TGAGAACGGGAAGCTTGTCA 3'; and mouse GAPDH reverse 5' GGAAGGCCATGCCAGTGA 3'. Reaction conditions were 1 minute denaturation, 1 minute annealing, and 1 minute extension for 30 cycles. The annealing temperature for Ptch1 was 68°C, while the annealing temperature for Gli1 and GAPDH was 56°C.

For quantitative RT-PCR, total RNA was isolated as above. DNAse treatment (Fermentas) was performed on 400ng of RNA from each sample. Reverse transcription was then performed using a SuperScript II Reverse Transcriptase (Invitrogen) and random hexamer primers (Fermentas). A 25X dilution of the resulting cDNA was subjected to qPCR using an iQ SYBR Green Supermix

(Bio-Rad) with 1 ul reactions Results were quantified using the ΔΔCt method corrected for primer efficiency with Arbp as a reference gene. Primers adapted from previously published sequences were used as follows: mouse Ptch1 forward 5' GGTGGTTCATCAAAGTGTCG 3'; mouse Ptch1 reverse 5' GGCATAGGCAAGCATCAGTA 3' (Zhou et al., 2012); mouse Gli1 forward 5' CCCATAGGGTCTCGGGGTCTCAAAC 3'; mouse Gli1 reverse 5' GGAGGACCTGCGGCTGACTGTGTAA 3' (Svard et al., 2009); mouse Arbp forward 5' GAAAATCTCCAGAGGCACCATTG 3'; and mouse Arbp reverse 5' TCCCACCTTGTCTCCAGTCTTTAT 3' (Pernot et al., 2010). All reactions consisted of 40 cycles with 30s denaturation at 72°C and 30s annealing/extension at 60°C. Primer specificity was confirmed by a combination of agarose gel electrophoresis and melt curve analysis.

Immunofluorescence and imaging

Ptch1-/- MEFs grown on 2cm coverslips in 24-well plates were transfected with 1μg of plasmid using Fugene 6 (3:1 ratio; Promega). Cells were grown for 24h and then switched to serum-free media for 48h to promote cilia formation. After 2 washes with ice cold PBS, the cells were fixed with freshly prepared 4% paraformaldehyde in PBS for 20 minutes at room temperature. Blocking and permeabilization was performed by incubating with 5% donkey serum and 0.2% Triton X-100 in PBS for 20 minutes at room temperature. Incubation with primary antibody was performed overnight in a humidified chamber at 4°C in 5% donkey serum in PBS. Antibodies and dilutions used were 1:500 goat α-Ptch1 (Santa Cruz; sc-61 9) and 1:1 mouse α- acetylated tubulin (Sigma). After 3 washes with PBS, incubation with secondary antibody was performed for 1h at room temperature in 5% donkey serum in PBS. Antibodies and dilutions used were 1:200 Alexa Fluor 568 donkey α-mouse IgG (Invitrogen) and 1:400 FITC-conjugated donkey α-goat IgG (Jackson ImmunoResearch). Coverslips were then washed 3 times with PBS and mounted on slides with Vectashield Mounting Medium with DAPI (Vector Laboratories). Slides were viewed on a Nikon Eclipse 80i microscope and images taken with a QImaging Qicam Fast 1394 camera using QCapture Pro 6.0.

In vitro binding assays

In vitro binding assays were performed as described (Flanagan and Cheng, 2000). Briefly, HEK 293 cells were transfected with the indicated Ptch1 expression constructs and then lysed in 1% DDM lysis buffer 24h post-transfection. Using an agarose bead-conjugated primary antibody against Ptch1 (Santa Cruz; sc-6149 AC), immunoprecipitation was performed as described above with 400µg of lysate. Following the final 1% DDM washes, the immunoprecipitates were washed two times with cold HBAH (0.5 mg/ml BSA, 0.1% sodium azide, 20mM HEPES pH 7.0) and then incubated with 400µl of Shh:AP-conditioned media for two hours at room temperature. Immunoprecipitates were then washed 5 times with HBAH, once with HBS (150mM NaCl, 20mM HEPES, pH 7.0), resuspended in 100µl of HBS, and heated at 65°C for 10 minutes. The samples were then transferred to ice and mixed with 100µl of 2X AP substrate buffer (31mM p-nitrophenyl phosphate, 1mM MgCl2, 2M diethanolamine, pH 9.8) for measurement of alkaline phosphatase activity via absorbance at 405nm in a kinetic microplate reader.

Results

Deletion mutant analysis of the Ptch1-c-src interaction

We showed previously that the C-terminus of Ptch1 was capable of binding to a number of factors harbouring SH3- or WW-domains. A GST-SH3 fusion protein from one of these candidates, c-src, bound to the C-terminal domain of mPtch1. Furthermore, genetic work from our lab further demonstrated that mammary epithelial cell-restricted expression of an activated c- src [c-srcAct;(Webster et al., 1995)] transgene can rescued the block in mammary gland development caused by mutation of the Ptch1 C-terminus (Chang et al., 2012). In order to characterize the potential physical interaction between full length murine Ptch1 and c-src, co- immunoprecipitation assays were performed using full length Ptch1 as well as mutants that delete specific cytoplasmic domains of this 12-pass integral membrane protein.

Although the C-terminus of Ptch1 contains multiple putative SH2- and SH3-binding domains, the large middle intracellular loop (residues 584-734) also contains potential SH2- and SH3-binding consensus sequences (Figure 1). To determine the contribution of these intracellular domains to a potential Ptch1-c-src interaction, deletion-mutants of the Ptch1 C- terminus (residues 1173-1 3 "Ptch1ΔC") the large middle intracellular loop (residues 614- 7 9 "Ptch1Δ L") and of both of the aforementioned domains (residues 61 -709/1173-1434; "Ptch1Δ C") were constructed (Figure 2A). Additionally, a construct containing the full-length mesenchymal dysplasia (mes) allele of Ptch1 was cloned to further identify regions of the Ptch1 C-terminus contributing to the Ptch1-c-src interaction (Figure 2A). In order to confirm that these deletion mutants underwent proper secretory pathway trafficking, Endo H/PNGase F analysis was performed in HEK 293 cells (Figure 2B). All of the deletion mutants were partially resistant to Endo H, indicating that they traffic beyond the medial Golgi apparatus. The truncation Ptch1ΔStu (residues 615-1434) was used as a negative control.

HEK 293s were then transfected with an expression vector for activated c-src (c-srcAct), as well as an amount of expression vector for the Ptch1 mutants that produced roughly equal levels of each protein as determined by immunoblot blot using an antibody directed to the N- terminal region of Ptch1 (Figures 3A & D). Co-immunoprecipitations were then performed using an agarose-conjugated goat α-Ptch1 antibody against the Ptch1 N-terminus (Figure 3B

Figure 1. Major intracellular domains of vertebrate Ptch1 contain conserved putative SH2- and SH3-binding domains. Sequence alignment of the middle intracellular loop (murine residues 585-734) and C-terminus (murine residues 1162-1434) of vertebrate Ptch1. Green text denotes intracellular domains, while conserved poly-proline motifs and tyrosines are highlighted in grey and blue, respectively. and E) or a rabbit α-c-src antibody (Figure 3C and F). Immunoprecipitation of Ptch1 mutants ∆C and ∆ L∆C revealed that loss of the entire C-terminus reduces to background levels the ability of Ptch1 to co-immunoprecipitate activated c-src. In contrast, loss of the large middle intracellular loop in the ∆ L mutant did not prevent Ptch1 from co-immunoprecipitating c-srcAct (Figure 3B). In the reciprocal immunoprecipitation using antibody directed against c-src, only wild type Ptch1 co-immunoprecipitated although a weak band for the Δ L mutant was apparent (Figure 3C). Interestingly, co-immunoprecipaution assays interrogating the activity of the mes mutant showed no apparent difference in the Ptch1-c-src interaction in wildtype Ptch1 versus mes (Figure 3E & F). These data suggest that amino acids 1173-1215 harbour residues that are critical for interaction between Ptch1 and c-src. Alternatively but less likely, the 63 amino acid nonsense product of the mes deletion may itself confer ability to bind c-src.

Figure 2. Ptch1 deletion mutants exhibit correct secretory pathway trafficking in HEK 293 cells. Schematic of Ptch1 deletion mutants used in mapping experiments (A). Equal amounts of Ptch1-HA, Ptch1ΔC, Ptch1ΔML, Ptch1ΔMC, mes, and Ptch1ΔStu were transfected into HEK 293 cells. Cells were lysed in 1% DDM lysis buffer 24h post- transfection and 40μg aliquots of each lysate were taken and subjected to Endo H or PNGase F treatment. All of the Ptch1 constructs tested except Ptch1ΔStu are partially resistant to Endo H, indicating correct secretory pathway trafficking (B). The truncation Ptch1ΔStu is shown as a negative control to indicate failure to traffic through the secretory pathway. E = Endo H, P = PNGase F.

In addition to containing potential SH3-binding motifs, the C-terminus and large middle

Figure 3. Overexpressed Ptch1 and activated c-src co-immunoprecipitate via an interaction requiring the Ptch1 C-terminus. Ptch1 deletion mutants were transfected into HEK 293 cells with or without activated c-src and lysed in 1% DDM lysis buffer at 24h post-transfection. Expression levels of transfected plasmid were verified by western blot, shown in A and D. Immunoprecipitations were performed using a goat α-Ptch1 agarose conjugate antibody against the Ptch1 N-terminus, or a rabbit α-c-src antibody. The corresponding western blots were probed for Ptch1 and c-src (B and C, respectively). Immunoprecipitation with Ptch1 or c-src both indicate that the C-terminus of Ptch1 is required to co-immunoprecipitate activated c-src. The same experiment was performed to directly compare wildtype Ptch1 and the mes mutant, showing that unlike a complete truncation of the C- terminus, the mes allele is capable of co-immunoprecipitating activated c-src (E and F).

intracellular loop of Ptch1 also contain multiple tyrosines that are potential phosphorylation targets of c-src. These motifs are conserved between Ptch1 proteins in all vertebrates (Figure 1). To determine if Ptch1 is a target for tyrosine phosphorylation by c-src, immunoprecipitations were carried out in the same manner as described above and probed with an antibody against phosphotyrosine. While wild type Ptch1 displayed the strongest phosphotyrosine signal relative to the amount of protein immunoprecipitated, the three other deletion mutants assayed were all

detected by the anti-phosphotyrosine antibody upon overexpression of c-srcAct (Figure 4A & B). Furthermore, no apparent difference in the ability of c-src to mediate tyrosine phosphorylation in wild type Ptch1 versus mes was evident, as shown by the similar ratio of phosphotyrosine signal relative to the protein levels observed for Pcth1 and mes in the immunoblot (Figure 4C & D). Taken together, these results show that Ptch1 is a target for tyrosine phosphorylation by c-srcAct, and that there exist c-src phosphorylation sites in Ptch1 outside of those predicted to reside in the C-terminus or middle intracellular loop.

Figure 4. Overexpressed Ptch1 is a target for tyrosine phosphorylation by overexpressed activated c-src. HEK 293 cells were transfected with the indicated Ptch1 construct with or without activated c-src and lysed in 1% DDM lysis buffer after 24h, shown by western blot in A and C. Immunoprecipitation of Ptch1 was performed with a goat α-Ptch1 agarose conjugate antibody and the subsequent western blot was probed with an antibody against phospho-tyrosine (B and D, top). This blot was then stripped and re- probed with α-Ptch1 (B and D, bottom). All of the Ptch1 constructs assayed display tyrosine phosphorylation in response to co-transfection with activated c-src.

Effect of Hedgehog ligand stimulation on the Ptch1-c-src interaction

To further characterize the interaction between Ptch1 and c-src, we asked what effect Shh ligand stimulation would have on this association. This analysis was performed using the human immortal mammary epithelial cell line, MCF10A, since these cells i) lack detectable expression of Smoothened (Chang et al., 2010; Zhang et al., 2009), ii) cannot transduce canonical Hh-

46 signalling with Hh-ligand (Chang et al., 2010), and iii) remain able to activate ERK1/2 in response to stimulation with N-Shh (Chang et al., 2010). Thus, the effects of Hh-ligand on the association of Ptch with endogenous c-src can be determined in the absence of signalling through the canonical Hh-pathway.

MCF10A cells were transfected with HA-tagged Ptch1, grown for 48h, serum starved for 24h, then stimulated with Shh-conditioned or control media for 1h and Ptch1 immunoprecipitated from 6 μg of lysate As Figure 5A reveals, Ptch1 co-immunoprecipitated endogenous c-src when MCF10A cells were treated with control-conditioned media. This association was lost, however, when these cells were stimulated with Shh-conditioned media. The immunoblot of activated and total endogenous c-src in Figure 5B also shows that stimulation of MCF10A cells with Shh-conditioned media increased the levels of endogenous, phospho416 (activated)-c-src (Figure 5B). These results indicate that Ptch1 and c-src form a transient association that is disrupted upon Hh stimulation; furthermore, this dynamic interaction is independent of Smo activity.

Figure 5. Association of Ptch1 and c-src is abolished in response to Shh stimulation. MCF10A cells were transfected with Ptch1-HA, grown for 48h, serum starved for 24h, and then stimulated with Shh- or pcDNA3-conditioned media for 1h. Cells were then lysed in 1% DDM lysis buffer and prepared for immunoprecipitation using a goat α-Ptch1 antibody. Treatment with Shh-conditioned media abolishes the association between Ptch1-HA and endogenous c- src, as compared to treatment with pcDNA3-conditioned media (A). The corresponding western blot indicates an increase in levels of p-src-416 in response to Shh stimulation (B).

Differential effects of Ptch1 and the mes mutant on signal transduction cascades

In order to assess whether activation of c-src by Hh-ligands was affected by the mutation arising in Ptch1 in mes mice, primary mammary mesenchymal cells (fibroblasts) were isolated from wildtype and mes/mes littermates. The mesenchymal cells were serum starved for 48h, then stimulated with 1μg/ml N-Shh peptide or 200ng/ml EGF for 1h. Lysates were then prepared and resolved by SDS-PAGE, and the subsequent western blots were probed with antibodies against p416-src and p-ERK1/2. The blots were then stripped and re-probed for total c-src and ERK1/2 (Figure 6). Consistent with our previous observations, primary mammary mesenchymal cells from wild type and mes/mes mice exhibited increases in p-ERK1/2 in response to N-Shh peptide. In contrast, the primary mammary mesenchymal cells from the mes/mes animals exhibited a higher level of endogenous p416-src relative to starved cells from wild type mice. Furthermore, these levels did not change upon stimulation with the N-Shh peptide. These data suggest that there is a defect in the regulation or activation of c-src in mes/mes mesenchymal cells, and that activation of c-src and ERK1/2 in response to Shh stimulation occur through different mechanisms.

Figure 6. Primary mammary mesenchymal cells containing a Ptch1 C-terminal mutation fail to activate c-src in response to Shh stimulation. Primary mammary mesenchymal cells isolated from littermate wildtype and mes/mes mice were serum starved for 48h, then treated with Shh peptide for 1h. Cells were lysed in 1% DDM lysis buffer and lysates were separated by SDS-PAGE. Blots were probed for p-src-416 and p-ERK1/2, then stripped and re-probed for total c-src and total ERK1/2. Mesenchymal cells from wildtype animals displayed activation of both c-src and ERK1/2 in response to Shh peptide (1μg/ml) stimulation, while mes/mes mesenchymal cells displayed activation of ERK1/2, but not c-src. EGF (200ng/ml) was used as a positive control for c-src and ERK1/2 activation (A). Quantification of (A) (B).

Canonical Hedgehog signalling consequences of Ptch1 intracellular domain deletions

To date, molecular studies of the effect of the mes allele on canonical Hedgehog target activation have all involved assaying the steady state levels of Hedgehog target mRNA by endpoint RT-PCR (Chang et al., 2012; Li et al., 2008; Nieuwenhuis et al., 2007). These assays, however, have not interrogated the ability of the mes variant of mPtch1 to respond to stimulation by the Hh-ligands.

To identify if the mes allele alters the response to Shh-ligand stimulation, activation assays were performed using primary mouse mammary mesenchymal cells isolated from littermate wildtype and mes/mes animals as described above. Mammary mesenchymal cells were serum starved for 48h, then stimulated with Shh-conditioned media, control-conditioned media, or Shh-conditioned media with 1μ of the Smo inhibitor SANT-1, for 24h. Figure 7A shows that in a qualitative endpoint RT-PCR analysis, mesenchymal cells isolated from both wild type and mes/mes animals displayed similar basal levels of Ptch1 expression which responded with a similar increase in expression in response to Shh stimulation. In contrast, mesenchymal cells from the mes/mes animal displayed a constitutive level of Gli1 message that was not apparent in cells from the wild type animal. Furthermore, wild type mesenchymal cells responded to stimulation by Shh with a clear increase in Gli1 expression while Gli1 levels in the mes/mes mesenchymal cells exhibited no apparent change.

To quantify more carefully the altered expression levels of these two Hh-pathway target genes, qPCR was performed (Figure 7B). This analysis revealed that while the fold increase in Ptch1 expression in response to Shh stimulation was similar for wild type and mes/mes mammary mesenchymal cells (5-fold for wildtype versus 5.5-fold for mes/mes), the level for

Ptch1 in starved mes/mes mammary mesenchymal cells was 3-fold that of wild type. Consistent with the previous endpoint RT-PCR data, qPCR analysis of Gli1 revealed a large increase in expression in wild type mesenchymal cells, while the mes/mes mesenchymal cells produced a muted (< 2-fold) increase above their constitutively active expression. Taken together, these data show that mes/mes mammary mesenchymal display elevated levels of Ptch1 and Gli1. Furthermore, the constitutive Gli1 expression and low response to stimulation in comparison to wild type cells suggests that there may be multiple mechanisms of Hh-target gene regulation perturbed by the mes allele.

Figure 7. Primary mammary mesenchymal cells containing a Ptch1 C-terminal mutation display constitutive activation of Gli1. Primary mammary mesenchymal cells isolated from littermate wildtype and mes/mes mice were serum starved for 48h, then stimulated with pcDNA3-conditioned media, Shh-conditioned media, or Shh-conditioned media with 1μM SANT-1 for 24h. Qualitative RT-PCR indicates that Ptch1 mRNA levels in cells from both animals respond similarly in response to Shh stimulation, while mes/mes mesenchymal cells display a level of Gli1 expression in the absence of Shh ligand that is not present in mesenchymal cells from wild type animals (A). Quantitative RT-PCR of RNA from a separate cell isolate shows increased basal levels of Ptch1 and Gli1 in mes/mes mammary mesenchymal cells. Both wildtype and mes/mes cells show a similar Ptch1 fold expression response upon Shh stimulation; however, the constitutively active Gli1 expression in mes/mes mammary mesenchymal shows a muted increase in As an alternative approach to assay the response to Shh stimulation, compared to that of the wildtype samples (B). Data are displayed as contribution of Ptch1 intracellular domains to mean ± SD, n = 3. canonical Hedgehog pathway activation, a Gli-luciferase reporter assay was performed in Ptch1-/- MEFs. Previously reported assays have only assessed the Hh-signalling repression function of Ptch in Ptch1-deficient cells and/or have been performed in cell lines expressing endogenous Ptch1 (Nieuwenhuis et al., 2007; Rahnama et al., 2006). Assays involving activation have primarily focused on changes in Ptch activity in

50 mutants that delete the extracellular, Hh-ligand-binding domains of Ptch1 or that harbour specific point mutations (Taipale et al., 2002).

Thus, in order to assess the ability of Ptch1 to repress canonical Hh-signalling as well as to respond to stimulation by the Hh-ligands, Ptch1-/- MEFs were transfected with an 8X Gli1- binding site-luciferase reporter construct, a constitutive renilla luciferase reporter, and expression vectors for wild type or mutant mPtch1 (Figure 8). Initial experiments focused on the ability of Ptch1 deletion mutants to repress pathway activity (Figure 8A). Two hundred ng or 25ng of the Ptch1 expression vectors were transfected with the luciferase reporters, grown for 48h and

Figure 8. Ptch1 mutants lacking the middle intracellular loop fail to respond to Shh stimulation. Ptch1-/- MEFs were transfected with an 8X Gli-luciferase reporter, a constitutive renilla luciferase plasmid, and 25ng or 200ng of the indicated Ptch1 mutant. After 48h the cells were lysed and relative luciferase activity was measured. At both amounts of transfected plasmid, deletions of the Ptch1 C- terminus and the middle intracellular loop both remained capable of repressing canonical Hedgehog signalling. Data are displayed as mean ± SD, n = 3 (A). Reporter constructs and 25ng of the indicated Ptch1 construct were transfected into Ptch1-/- MEFs as above, grown for 48h, switched to Shh- or pcDNA3-conditioned media in 0.5% serum for 24h, lysed, and measured for relative luciferase activity. Both Ptch1ΔC and mes produced a significant increase in reporter activity in response to Shh stimulation, while Ptch1ΔML and Ptch1ΔMC did not. Data were analyzed by two-way ANOVA followed by pairwise comparison of means using Tukey's Honest Significant Difference Test. Data are displayed as mean ± SD, n = 6. * p < 0.05, ** p < 0.01, *** p < 0.001 (B). assayed for relative luciferase activity. All of the Ptch1 deletion mutants at both concentrations were capable of repressing Hh-signalling to levels similar to the wild type protein. We then assessed the ability of these mPtch1 mutants harbouring deletions of the cytoplasmic domains to respond to Shh stimulation. Ptch1-/- MEFs were transfected as above with 25ng of Ptch1 expression vectors, grown for 48h, then stimulated with Shh- or control-conditioned media for 24h in low serum (Chen et al., 2011) (Figure 8B). The resulting data were analyzed by two-way

ANOVA followed by pairwise comparison of means using Tukey's Honest Significant Difference test. Ptch1 (p< 0.001), mes (p= 3518) and Ptch1ΔC (p< 1) all exhibited statistically significant increases in luciferase activity in response to Shh stimulation, revealing that the repression of Hh-signalling by these mutants could be reversed by stimulation with Hh- ligand similar to the wild type protein Interestingly while Δ L and Δ C were able to repress Hh-signalling, addition of Shh-ligand did not reverse this activity for either ∆ L (p< 1 relative to Ptch1) or Δ C (p= 735 relative to Ptch1)

To ensure that inability of Δ L to respond to Shh stimulation was not caused by its inability to complex Shh-ligand, an in vitro binding assay using an Shh:AP fusion protein was performed (Flanagan and Cheng, 2000). Wild type Ptch1 Δ L or ΔStu the latter mutant deleting the second extracellular loop previously defined as required for Shh-ligand binding (Briscoe et al., 2001), were transfected into HEK 293s and Ptch1 was immunoprecipitated after lysis. The immunoprecipitated proteins were then incubated with Shh:AP-conditioned media and assessed for Shh-binding activity by assaying for alkaline phosphatase activity. Both wild type mPtch1 and Δ L displayed a >1 -fold increase in alkaline phosphatase activity compared to the ΔStu mutant or an untransfected control (Figure 9). These results demonstrate that deletion of the Ptch1 large intracellular loop abrogates the ability to respond to Shh-ligand, despite retaining the ability to bind.

Figure 9. Deletion of the Ptch1 large intracellular loop does not affect Shh-binding capability. HEK 293 cells were transfected with wildtype Ptch1, Ptch1 ΔML, or Ptch1ΔStu, and lysed in 1% DDM lysis buffer at 24h post- transfection. Immunoprecipitation of Ptch1 was performed, followed by incubation with Shh:AP- conditioned media. Measurement of the resulting AP activity indicates that Ptch1 and Ptch1ΔML bound similar amounts of the Shh:AP fusion protein, as compared to an untransfected control.

Figure 10. Deletion of Ptch1 large intracellular domains does not abolish the capability to localize to the primary cilium. Ptch1-/- MEFs were transfected with the indicated Ptch1 expression vector, grown for 24h, then serum starved for 48h to promote cilia formation. The cells were then fixed, and immunofluorescence was performed using antibodies against Ptch1 and acetylated tubulin. Despite varying expression patterns upon gross overexpression, all of the Ptch1 mutants assayed retained the capability to localize to the primary cilium.

As an additional approach to assay the functional capabilities of the previously described Ptch1 deletion mutants, and knowing that they all clear the secretory pathway, we asked which of the mutants retained the ability to localize to the primary cilium. Ptch1-/- MEFs were

53 transfected with equal amounts of the indicated Ptch1 expression construct, grown for 24h, then serum starved for 48h to promote cilia formation. The cells were then fixed and immunofluorescence was performed using antibodies against Ptch1 and acetylated tubulin. Although the expression patterns of the Ptch1 deletion mutants assayed varied depending on the amount of protein being expressed by any given transfected cell, the cells displaying lower levels of Ptch1 expression retained the ability to localize to the primary cilium. This was observed for all of the deletion mutants assayed (Figure 10). Because commercially available antibodies against the Ptch1 N- terminus cannot detect endogenous levels of Ptch1, and overexpression of Hh pathway components can result in constitutive localization patterns, we were not able to assay trafficking in response to

Figure 11. Deletion of the Ptch1 large intracellular loop Shh stimulation (Haycraft et results in increased ciliary length. Ptch1-/- MEFs were transfected with the indicated Ptch1 expression vector, grown for al., 2005; Kovacs et al., 2008). 24h, then serum starved for 48h to promote cilia formation. The Thus, we can only conclude cells were then fixed, and immunofluorescence was performed using antibodies against Ptch1 and acetylated tubulin. After that deletion of Ptch1 large observation of an apparent increase in ciliary length in cells transfected with Ptch1ΔML, ciliary length was measured for all intracellular domains does not Ptch1 mutants assayed. The increase in ciliary length in Ptch ΔML-transfected samples was found to be significant. Data were abolish the capability of analyzed by one-tailed Welch's t-tests between groups of transfected and untransfected cells from the same slide. A exogenously expressed protein combined minimum of 28 cilia were analyzed from two to localize to the primary independent experiments, and the resulting p-values were corrected for multiple comparisons using the Bonferroni method. cilium Data are displayed as mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001. During the process of localizing the Ptch1 deletion mutants, we observed an apparent increase in ciliary length for the Ptch1Δ L mutant To quantify this increase and assay whether expression of other Ptch1 intracellular domain deletion mutants produces an increase in ciliary length, the primary cilia from transfected and untransfected cells of the same slide were measured. The resulting data

54 were analyzed by performing one-tailed Welch's t-tests between transfected and untransfected cells of the same Ptch1 deletion mutant transfection and correcting for multiple comparisons using the Bonferroni method. The increase in ciliary length in cells transfected with Ptch1Δ L was found to be significant (p<0.001) (Figure 11). This suggests that overexpression of a Ptch1 mutant missing the middle intracellular loop exerts influence on the regulation of ciliary length. Whether this occurs directly or indirectly, and whether this would occur with expression of Ptch Δ L at endogenous levels are both yet to be determined

Discussion

Exogenous Ptch1 and c-src interact in vitro

SH3 domain-mediated interactions are involved in multiple cellular processes, including signal transduction, cytoskeletal arrangement, growth, and differentiation (Li, 2005). The basic structure of SH3 domains is a roughly 6 kDa β-barrel structure consisting of two anti-parallel β sheets, each comprised of three strands, which are connected by three loops and a 310 helix. SH3- binding ligands are characterized by a three residue-per-turn left-handed helix polyproline type- II (PPII) motif, and the minimum consensus sequence is a well-characterized PXXP motif (Li, 2005). Furthermore, consensus SH3-binding ligands can be classified as class I or class II, with respective consensus sequences of +XΦPXΦP and ΦPXΦPX+ where "+" refers to any basic residue and "Φ" refers to any hydrophobic residue (Li, 2005). Class I and class II consensus sequences have been identified as assuming opposite orientations when binding to SH3 domains (Lim et al., 1994; Yu et al., 1994). The study of multiple SH3-mediated interactions has also revealed the presence of many non-consensus SH3-binding ligand motifs, and interestingly, these are often associated with high-affinity or highly specific interactions (Saksela and Permi, 2012).

In addition to being able to bind polyproline motifs via their SH3 domain, SFKs can also bind phosphotyrosine residues via their SH2 domain. The structure of SH2 domains is characterized by a central β-sheet between two alpha helices, and binding of SH2-ligands involves insertion of the phospho-tyrosine into a pocket of the central β-sheet via interactions with arginine and histidine side chains of the SH2 domain (Liu et al., 2012; Waksman et al., 1992). Different SH2 domains preferentially recognize different ligands usually, but not always, on the basis of the 3-4 residues C-terminal of the phosphotyrosine (Liu et al., 2012). The SH2 domain of c-src in particular, recognizes preferentially a pYEEI motif (Songyang et al., 1993), although it is also capable of binding to other sequences.

In this study we have expanded on and further characterized a putative interaction between Ptch1 and c-src. These studies were suggested based on prior genetic evidence that mammary epithelial cell-restricted expression of an activated c-src transgene rescued the block in mammary gland development displayed by mice possessing the Ptch1 C-terminal truncation-

56 producing mes allele. Furthermore, GST-pulldown data demonstrated an association between the isolated C-terminus of Ptch1 and the isolated SH3 domain of c-src. Analysis of the primary sequence of the large intracellular loop and C-terminus of Ptch1 reveals the presence of multiple poly-proline motifs, as well as multiple potential tyrosine phosphorylation sites. I showed in immunoprecipitation assays using intracellular domain deletions of Ptch1 that the C-terminus of Ptch1 is likely required for this interaction, since truncation of Ptch1 at a.a. 1172 abrogates strongly the ability to complex c-src. Although initial experiments employed HA-tagged Ptch1, this tag was later removed since the HA-tag enhanced phosphorylation of full length Ptch1 by activated c-src and appeared to enhance the strength of the interaction between these two factors (Figure 12). Interestingly, the mes protein, which partially truncates the C-terminus of Ptch1, was capable of complexing c-src to the same extent as wild type, indicating that residues between amino acids 1172 and 1214 contain sequence capable of mediating this interaction. This sequence contains a minimum SH3-ligand consensus site of PEPP from amino acids 1185 to 1188. It is predicted that point mutation of prolines 1185 and 1188 in conjunction with the mes truncation may produce a mutant incapable of complexing c-srcAct.

In addition to being able to complex activated c-src, tyrosine phosphorylation of Ptch1 in response to c-srcAct overexpression was also shown. Tyr-phosphorylation was observed for all three of the intracellular domain deletion proteins assayed, although wild type Ptch1 exhibited the greatest amount of phosphorylation relative to the amount of Ptch1 immunoprecipitated. Interestingly, wild type Ptch1 and mes showed similar levels of tyrosine phosphorylation in response to srcAct overexpression. Together this indicates that although the C-terminus and middle intracellular loop may contain tyrosines that are targets for phosphorylation by c-srcAct, there undoubtedly are other sites that can act as substrates. This further suggests that there are other sites outside of the middle intracellular loop and C-terminus that c-srcAct is capable of binding to. Although Ptch1 does not possess a preferred c-src substrate motif of EE(I/V)Y(G/E)EFF (Songyang et al., 1995), analysis with Group Based Prediction 2.1 (GPS 2.1), a primary sequence phospho-site prediction algorithm based on experimentally-verified phospho-sites from the PhosphoELM database (Xue et al., 2011), predicts four c-src phosphorylation sites in Ptch1 that are conserved between vertebrates – two in the middle intracellular loop (Y616 and Y661), one in the second extracellular loop (Y774), and one in the

C-terminus (Y1211). Thus, Y774 may be a target for tyrosine phosphorylation of Ptch1 even when the C-terminus and middle intracellular loop are deleted.

Figure 12. HA-tagged Ptch1 results in altered binding and tyrosine phosphorylation properties in response to activated c-src overexpression. HA-tagged or untagged Ptch1 was transfected into HEK 293 cells with activated c-src and lysed in 1% DDM lysis buffer at 24h post- transfection. After verification of expression levels by western blot (A), immunoprecipitations were performed using a goat α-Ptch1 agarose conjugate antibody or a rabbit α-c-src antibody (B and C, respectively). These indicate a qualitative increase in the amount of protein co-immunoprecipitated by HA-tagged Ptch1 versus untagged Ptch1. The immunoprecipitation of Ptch1 was stripped and reprobed with an α-phosphotyrosine antibody, demonstrating an increased amount of tyrosine phosphorylation of HA-tagged Ptch1 versus untagged Ptch1 (D).

The functional significance of this modification is not yet known, although one possibility is that tyrosine phosphorylation is required for the docking of other SH2-domain- containing factors. Identification of the exact phosphorylation sites would allow for the construction c-src-phosphorylation site mutants. These mutants could be expressed virally in

Ptch1-/- MEFs and assayed for their ability to mediate known non-canonical Hh signalling cascades. It is proposed further that it is unlikely that this src-family kinase-mediated modification is involved in canonical Hh activity since chemical inhibition of SFK activity in cultured fibroblasts does not have any effect on Gli-luciferase reporter activity (Yam et al., 2009).

Modulation of the Ptch1-c-src association in response to Shh ligand

In addition to demonstrating association of exogenous Ptch1 and c-srcAct, the use of MCF10A cells has identified a dynamic, Hh-ligand-dependent association between overexpressed Ptch1-HA and endogenous c-src. Specifically, one-hour stimulation with Shh- conditioned media abolishes the Ptch1-HA-c-src association and is accompanied by an increase in c-src activation, as determined by p-src-416 protein levels. Current understanding of Ptch1 trafficking suggests that membrane-bound Ptch1 is internalized into endosomal vesicles upon ligand binding (Incardona et al., 2002; Rohatgi et al., 2007). Conversely, steady-state levels of activated c-src are primarily associated with the plasma membrane (Donepudi and Resh, 2008), and growth factor stimulation has been shown to promote the membrane-localization of activated c-src (Sandilands et al., 2004, 2007). Taken together, this information establishes a hypothesis in which the Ptch1-c-src association is disrupted due to differential trafficking, with Ptch1 being internalized and activated c-src remaining at the plasma membrane. A remaining question is whether Ptch1 associates preferentially with active or inactive c-src. This could be assayed in vitro by comparing constitutively active c-src and catalytically dead c-src in their ability to complex with Ptch1.

Whether or not, and in what manner the primary cilium factors into this interaction is still unclear. To date, the only characterization of c-src function in relation to the primary cilium has come from a study investigating the role of the actin regulatory protein Missing in Metastasis (MIM) in Hh signal transduction. Bershteyn et al. demonstrated that through an as-of-yet undefined mechanism MIM antagonizes SFK activity, which in turn leads to decreased activity of the actin regulatory protein Cortactin and the promotion of primary cilium formation (Bershteyn et al., 2010). Furthermore, overexpression of activated c-src inhibits cilia formation and knockdown of MIM enables the visualization of activated c-src at the basal body of the

59 cilium (Bershteyn et al., 2010). Thus, there is a possibility that the primary cilium is involved in a Ptch1-c-src association.

The fact that activation of c-src in response to Shh was observed in MCF10A cells indicates that this cascade is likely independent of Smo activity, since this human mammary epithelial cell line lacks detectable Smo expression (Chang et al., 2010; Zhang et al., 2009). It is interesting to note, however, that the ability of Shh ligand to activate SFKs has been characterized for commissural neurons, and this process was shown to be Smo-dependent (Yam et al., 2009). Together these data suggest the existence of two distinct Shh-induced cascades capable of activating c-src, and that their presence may vary with cell type. Indeed, the distinct effects of the mes mutation on development of different tissues supports the notion that distinct but overlapping sets of signalling cascades may be regulated by the Hh-ligands at the level of Ptch1.

As a tool to assess the requirement of the Ptch1 C-terminus in non-canonical activation of c-src, we have employed the use of primary mouse mammary mesenchymal cells from littermate wild type and mes/mes mice. Wild type mesenchymal cells responded to Shh peptide stimulation with an increase in c-src activation, while cells from mes/mes animals displayed constitutively elevated levels of activated c-src that did not increase in response to Shh peptide. This observation indicates that the C-terminus of Ptch1 could be involved in regulating the levels of activated c-src in the absence of Hh ligand, mediating the activation of c-src in response to Shh ligand, or both of these functions. Importantly, both wild type and mes/mes mesenchymal cells displayed activation of ERK1/2 in response to Shh peptide, suggesting that this cascade is distinct from that of c-src activation and is not dependent on the Ptch1 C-terminus. It should also be noted that

The mes allele of Ptch1 is hypomorphic in mammary fibroblasts

Current understanding of the effect of the mes allele on canonical Hh signalling indicates that Ptch1-dependent inhibition of Smo activity is de-repressed in some tissues, but not in others. Specifically, while both a previous in vitro analysis of the mes allele via Gli-binding site luciferase reporter assay and a qualitative RT-PCR of Hh targets in total skin of mes/mes animals did not reveal any impairment in Smo inhibition (Nieuwenhuis et al., 2007), RT-PCR of

60 transcriptional targets of Hh-signalling in epididymal white adipose tissue of mes/mes animals did (Li et al., 2008b).

Curiously, none of these analyses have investigated the ability of the mes variant of Ptch1 to respond to stimulation by the Hh-ligands. Using serum-starved primary mouse mammary mesenchymal cells treated with Shh or Shh with SANT-1, we performed qRT-PCR on cells from littermate wild type and mes/mes animals to assay both the starved and stimulated levels of Ptch1 and Gli1. In the case of Ptch1, cells from mes/mes mice displayed elevated levels of transcript compared to wild type, but the fold increase between the two was roughly similar. These data indicate a partial loss of Smo inhibition, but similar ability of mes to respond to Shh stimulation. Conversely, mes/mes mammary mesenchymal cells exhibited constitutive Gli1 expression that increased less than two-fold in response to Shh ligand, while cells from wild type animals showed a ~170-fold induction of Gli1. The muted increase in Gli1 expression in response to Shh ligand in mes/mes mesenchymal cells suggests that unlike Ptch1, expression of Gli1 in these cells is near maximal levels in the absence of ligand. Taken together, these results indicate that, in addition to ectopic pathway activation due to a partial de-repression of Smo activity, a distinct pathway involved in the transcriptional regulation of Gli1 may also be perturbed in mes/mes mammary mesenchymal cells.

Multiple studies have identified alternate mechanisms of Gli1 transcriptional activation that are independent of Shh stimulation. Specifically, expression of oncogenic RAS variants have been shown to increase Hh-signalling reporter activity as well as GLI1 transcription in a MEK- dependent manner in pancreatic ductal adenocarcinoma (PDAC) and gastric cancer cell lines (Ji et al., 2007; Nolan-Stevaux et al., 2009; Seto et al., 2009). In the case of PDAC cells, it has been demonstrated that this effect may be mediated through regulation of GLI1 protein stability, as MEK-inhibitor treatment results in reduced GLI1 protein levels within two hours (Ji et al., 2007). Additionally, the observation that in gastric cancer cell lines, overexpression of SUFU inhibits induction of Gli-reporter activity via activated MEK or KRAS overexpression also supports regulation of GLI1 at the protein level (Seto et al., 2009). It is important to note, however, that contradictory results exist with respect to the effect of oncogenic RAS mutants on Hh pathway output. A more recent study using both fibroblasts and pancreatic cancer cell lines has suggested that activated RAS inhibits Hh pathway output by both altering Gli protein processing and downregulating Gli2 and Gli3 mRNA levels, and that its inhibitory effects are dependent on Sufu

61 expression (Lauth et al., 2010). TGF-β is another factor that has been implicated in Hh- independent regulation of Gli activity. Treatment of fibroblast, breast carcinoma, lung cancer, and PDAC cell lines with TGF-β has been shown to directly stimulate Gli2 transcription in a Smad3-dependent manner, leading to subsequent increases in Gli1 transcription (Dennler et al., 2007; Nolan-Stevaux et al., 2009). While activated RAS and TGF-β seem to activate Gli1 transcription in an indirect manner, both the Ewing sarcoma oncoprotein EWS-FLI1 (Beauchamp et al., 2009), as well as c-Myc (Yoon et al., 2013) have been shown to directly regulate the Gli1 promoter and drive Gli1 expression independent of Shh stimulation.

In addition to the regulation of Gli1 by via crosstalk with other signalling pathways, one study has presented evidence that PTCH1, at least when overexpressed, can inhibit GLI1 protein activity in a non-canonical fashion (Rahnama et al., 2006). This group demonstrated that overexpression of PTCH1 and GLI1 in HEK 293 or NIH-3T3 cells inhibits the overexpressed GLI1-mediated activation of a PTCH2 or GLI binding site Hh reporter plasmid. Furthermore, overexpressed PTCH1 also inhibited the overexpressed GLI1-mediated transcription of endogenous Gli1 in NIH-3T3 cells. This inhibitory effect of Ptch1 was deemed to be independent of Smo or Sufu activity based on experiments employing cyclopamine and Sufu-/- MEFs, respectively. Thus, the exact mechanism of this inhibition remains undefined, as the authors reported that they could not detect a direct interaction between PTCH1 and GLI1 via co- immunoprecipitation. A more recent and controversial study has also proposed a non-canonical inhibitory function of Ptch1. Using a novel antibody against the Ptch1 C-terminus, the authors detected an endogenous 37kDa C-terminal Ptch1 fragment that preferentially localizes to the nucleus in fibroblasts (Kagawa et al., 2011). Moreover, overexpression of this fragment inhibited overexpressed Gli1-mediated Hh reporter activity in HeLa cells, indicating that it possesses repressive function through an as-of-yet undefined mechanism. It is interesting to note, however, that the inhibitory Ptch1 function described by Rahnama et al. is unlikely to be the same as that of Kagawa et al., since expression of a C-terminally truncated PTCH1 variant showed the same inhibitory capability as wild type PTCH1 in Rahnama et al.'s assay.

One caveat with any of the aforementioned factors or mechanisms being involved in the constitutive Gli1 expression observed in mes/mes primary mammary mesenchymal cells is that, with the exception of the work of Kagawa et al., they have all been shown to function independently of Smo, whereas the constitutive activation conferred by the mes allele is fully

62 sensitive to SANT-1 treatment. Thus, there is no obvious explanation for the SANT-1-sensitive elevated levels of Gli1 observed in mes/mes mesenchymal cells outside of them being a result of attenuated Smo inhibition. It would also be worthwhile, then, to assess the levels of other Hh target genes in mes/mes mammary mesenchymal cells to see if they respond to Shh stimulation in a manner more similar to Ptch1 or Gli1. If the former, then that would indicate that, despite there not being a clear explanation in the literature, there is in fact a secondary mechanism of Gli1 regulation that is disrupted due to truncation of the Ptch C-terminus.

Loss of the Ptch1 middle intracellular loop results in an inability to respond to Shh stimulation

To date, the most comprehensive analysis of the function of individual Ptch1 domains in canonical pathway activation has come from Taipale et al. This group reconstituted a soft agar- cloned Ptch1-/- MEF-derived line with Ptch1 point mutations identified from NBCCS patients and performed transient luciferase reporter assays in order to measure both pathway repression and response to stimulation (Taipale et al., 2002). Although this study identified that point mutation of select SSD residues that are conserved with bacterial RND transporters attenuates Ptch1 repressive function, a comparative deletion analysis of Ptch1 intracellular domains has not yet been performed. Using deletions of the Ptch1 C-terminus, middle intracellular loop, as well as the mes allele, we have performed this assay in Ptch1-/- MEFs. All deletion mutants assayed retained the ability to repress Smo activity; however, mutants possessing a deletion of the middle intracellular loop were unable to respond to Shh ligand.

The mechanism preventing Hh-ligand-dependent pathway stimulation in the presence of these mutanhts remains undefined, although it is not due to an inability to bind Shh, as shown by an Shh:AP-binding alkaline phosphatase binding assay. An alternative hypothesis could be that this domain is required for proper exit from the primary cilium or proper internalization of Ptch1 upon ligand binding. Indeed, recent work has demonstrated that the Bardet-Biedel syndrome (BBS) protein complex, the BBSome, is involved in the proper exit of both Ptch1 and Smo from the primary cilium (Zhang et al., 2012). Additionally, the BBSome subunit BBS1 was shown to co-immunoprecipitate with the overexpressed, isolated C-terminus of PTCH1 in HEK 293 cells,

63 and this interaction requires residues 1321-1447 of human PTCH1 (Zhang et al., 2012). While this study showed binding of BBS1 to the isolated PTCH1 C-terminus, work from our lab has identified that factors capable of interacting with the isolated Ptch1 C-terminus can occasionally display differential domain requirements in the context of interaction with full-length Ptch1 (A. Tamachi, unpublished observation). Hence, it would be worthwhile to determine if the large intracellular loop of Ptch1 is also involved in mediating interaction between BBS1 and full- length Ptch1. Another alternative hypothesis for the inability of Ptch1 large intracellular loop deletions to respond to Shh ligand is that loss of this domain may disrupt interaction with Boc, Cdo, or Gas-1. Presumably, disruption of these interactions would still allow pathway repression, but attenuate the ability to receive and sequester ligand. The in vitro structural requirements for these interactions could be determined via co-immunoprecipitation assays. It is also worth noting that Ming et al. identified the human PTCH1 T728M mutation in two separate HPE cases, hence mutation of this residue may be of importance in conferring a presumed gain-of-function effect with respect to pathway inhibition, potentially through disruption of one of the aforementioned mechanisms (Ming et al., 2002).

To further characterize the canonical Hh pathway function of the Ptch1 intracellular domain deletions, their ability to traffic to the primary cilium was assessed. There are, however, two intertwined drawbacks that limit the conclusions that can be drawn from these experiments. First, transfection of the Ptch1 mutants produces variably overexpressed protein levels that are unlikely to mimic endogenous functionality. Second, this problem is further compounded by the limited immuno-reagents currently available for Ptch1 detection. To date, all published antibodies capable of reliable detection of endogenous Ptch1 have been independently produced and raised against the C-terminus – residues 1238-1413 of mouse Ptch1 (Ocbina et al., 2011; Rohatgi et al., 2007), residues 1321-1427 of mouse Ptch1 (Bidet et al., 2011), and residues 1420- 1434 of human PTCH1 (Kagawa et al., 2011). Of these, antisera raised against the mouse Ptch1 1238-1413 immunogen has been used commonly for detection of Ptch1 by immunofluorescence in high impact studies. Because our focus is on the functionality of the middle intracellular loop and C-terminal domains, we have employed a commercially available antibody against the Ptch1 N-terminus. Unfortunately, this reagent is not capable of detecting Ptch1 expressed at endogenous levels. This creates a dilemma whereby overexpression is required for detection, but limits the ability to perform functional assays. Thus, the only conclusion we can draw from this

64 set of localization experiments is that all of the Ptch1 deletion mutants tested retain the capability to localize to the primary cilium. Testing the trafficking of these mutants in response to Shh ligand would require either an antibody that is capable of detecting physiological levels of Ptch1, or the use of viral or stably-transfected expression of tagged Ptch1 mutants.

While in the process of localizing the Ptch1 deletion mutants, it was observed that the Ptch1Δ L mutant appeared to produce an increase in ciliary length Upon quantification this increase was determined to be significant. The cause of this phenomenon is not currently known, although one possibility is that the ability of the Ptch1Δ L mutant to transiently exit the primary cilium is perturbed, while its ability to localize to the cilium is not. Therefore when overexpressed, this mutant may accumulate in the primary cilium to such an extent that the function of the retrograde IFT machinery required for cilia disassembly is impaired. Certainly, a defect in its ability to either traffic transiently out of the cilium or be internalized in response to ligand would match with the luciferase reporter data. It would also be interesting to determine if this increase in ciliary length is observed when Ptch1Δ L is expressed at near physiological levels. Such a finding would indicate that the increase in ciliary length is not a by-product of overexpression, but rather the result of a direct influence on cilia assembly/disassembly by mutant Ptch1.

Conclusions

In summary, this work offers a further characterization of the role of Ptch1 intracellular domains in both canonical and non-canonical Hh signalling pathways. We have further characterized the interaction between Ptch1 and c-src, demonstrating that the C-terminus of Ptch1 is required for this interaction and that Ptch1 is a target for tyrosine phosphorylation by activated c-src. Additionally, the nature of this association in response to Shh stimulation was also assayed, showing that the Ptch1-c-src association is disrupted in response to Shh ligand and that the Ptch1 C-terminus is involved in the regulation of Shh-mediated c-src activation, but not Shh-mediated ERK1/2 activation. Taken together, this suggests that the previously identified non-canonical genetic interaction between Ptch1 and c-src may also involve a dynamic physical association.

In addition to the characterization of non-canonical Ptch1 function, this work has also assessed the contribution of the large intracellular domains of Ptch1 to canonical Hh pathway activity. Specifically, in vitro luciferase reporter assays identified that the middle intracellular loop is essential for response to Shh stimulation, while the C-terminus is not. Interestingly, although as measured by luciferase reporter assay, the mes allele does not result in any noticeable attenuation of Smo-inhibition, analysis in primary mammary mesenchymal cells suggests otherwise. Direct measurement of Ptch1 and Gli1 transcriptional output revealed the presence of Smo-dependent constitutive elevation of Hh target genes, indicating that the Ptch1 C-terminus does in fact contribute to Smo-repression. These experiments also highlight the importance of, whenever possible, employing systems comprised entirely of endogenous components.

References

Adolphe, C., Hetherington, R., Ellis, T., and Wainwright, B. (2006). Patched1 functions as a gatekeeper by promoting cell cycle progression. Cancer Res. 66, 2081–2088.

Agren, M., Kogerman, P., Kleman, M.I., Wessling, M., and Toftgard, R. (2004). Expression of the PTCH1 tumor suppressor gene is regulated by alternative promoters and a single functional Gli-binding site. Gene 330, 101–114.

Alcedo, J., Ayzenzon, M., Von Ohlen, T., Noll, M., and Hooper, J.E. (1996). The Drosophila smoothened gene encodes a seven-pass membrane protein, a putative receptor for the hedgehog signal. Cell 86, 221–232.

Allen, B.L., Tenzen, T., and McMahon, A.P. (2007). The Hedgehog-binding proteins Gas1 and Cdo cooperate to positively regulate Shh signaling during mouse development. Genes Dev 21, 1244–1257.

Allen, B.L., Song, J.Y., Izzi, L., Althaus, I.W., Kang, J.-S., Charron, F., Krauss, R.S., and McMahon, A.P. (2011). Overlapping roles and collective requirement for the coreceptors GAS1, CDO, and BOC in SHH pathway function. Dev. Cell 20, 775–787.

Amanai, K., and Jiang, J. (2001). Distinct roles of Central missing and Dispatched in sending the Hedgehog signal. Development 128, 5119–5127.

Ansarin, H., Daliri, M., and Soltani-Arabshahi, R. (2006). Expression of p53 in aggressive and non-aggressive histologic variants of basal cell carcinoma. Eur. J. Dermatol. EJD 16, 543–547.

Apionishev, S., Katanayeva, N.M., Marks, S.A., Kalderon, D., and Tomlinson, A. (2005). Drosophila Smoothened phosphorylation sites essential for Hedgehog signal transduction. Nat Cell Biol 7, 86–92.

Aszterbaum, M., Rothman, A., Johnson, R.L., Fisher, M., Xie, J., Bonifas, J.M., Zhang, X., Scott, M.P., and Epstein, E.H. (1998). Identification of Mutations in the Human PATCHED Gene in Sporadic Basal Cell Carcinomas and in Patients with the Basal Cell Nevus Syndrome. J. Invest. Dermatol. 110, 885–888.

Aszterbaum, M., Epstein, J., Oro, A., Douglas, V., LeBoit, P.E., Scott, M.P., and Epstein, E.H. (1999). Ultraviolet and ionizing radiation enhance the growth of BCCs and trichoblastomas in patched heterozygous knockout mice. Nat Med 5, 1285–1291.

Auepemkiate, S., Boonyaphiphat, P., and Thongsuksai, P. (2002). p53 expression related to the aggressive infiltrative histopathological feature of basal cell carcinoma. Histopathology 40, 568– 573.

Ayrault, O., Zindy, F., Rehg, J., Sherr, C.J., and Roussel, M.F. (2009). Two tumor suppressors, p27Kip1 and patched-1, collaborate to prevent medulloblastoma. Mol. Cancer Res. MCR 7, 33– 40.

Bae, G.-U., Domene, S., Roessler, E., Schachter, K., Kang, J.-S., Muenke, M., and Krauss, R.S. (2011). Mutations in CDON, Encoding a Hedgehog Receptor, Result in Holoprosencephaly and Defective Interactions with Other Hedgehog Receptors. Am. J. Hum. Genet. 89, 231–240.

Bai, C.B., Auerbach, W., Lee, J.S., Stephen, D., and Joyner, A.L. (2002). Gli2, but not Gli1, is required for initial Shh signaling and ectopic activation of the Shh pathway. Development 129, 4753–4761.

Bai, C.B., Stephen, D., and Joyner, A.L. (2004). All mouse ventral spinal cord patterning by hedgehog is Gli dependent and involves an activator function of Gli3. Dev Cell 6, 103–115.

Bailey, E.C., Milenkovic, L., Scott, M.P., Collawn, J.F., and Johnson, R.L. (2002). Several PATCHED1 missense mutations display activity in patched1-deficient fibroblasts. J. Biol. Chem. 277, 33632–33640.

Barakat, M.T., Humke, E.W., and Scott, M.P. (2010). Learning from Jekyll to control Hyde: Hedgehog signaling in development and cancer. Trends Mol. Med. 16, 337–348.

Barnes, E.A., Kong, M., Ollendorff, V., and Donoghue, D.J. (2001). Patched1 interacts with cyclin B1 to regulate cell cycle progression. EMBO J. 20, 2214–2223.

Barnes, E.A., Heidtman, K.J., and Donoghue, D.J. (2005). Constitutive activation of the shh-ptc1 pathway by a patched1 mutation identified in BCC. Oncogene 24, 902–915.

Barzi, M., Berenguer, J., Menendez, A., Alvarez-Rodriguez, R., and Pons, S. (2010). Sonic- hedgehog-mediated proliferation requires the localization of PKA to the cilium base. J. Cell Sci. 123, 62–69.

Beauchamp, E., Bulut, G., Abaan, O., Chen, K., Merchant, A., Matsui, W., Endo, Y., Rubin, J.S., Toretsky, J., and Uren, A. (2009). GLI1 Is a Direct Transcriptional Target of EWS-FLI1 Oncoprotein. J. Biol. Chem. 284, 9074–9082.

Berman, D.M., Karhadkar, S.S., Hallahan, A.R., Pritchard, J.I., Eberhart, C.G., Watkins, D.N., Chen, J.K., Cooper, M.K., Taipale, J., Olson, J.M., et al. (2002). Medulloblastoma growth inhibition by hedgehog pathway blockade. Science 297, 1559–1561.

Bershteyn, M., Atwood, S.X., Woo, W.-M., Li, M., and Oro, A.E. (2010). MIM and cortactin antagonism regulates ciliogenesis and hedgehog signaling. Dev. Cell 19, 270–283.

Bertolacini, C.D.P., Ribeiro-Bicudo, L.A., Petrin, A., Richieri-Costa, A., and Murray, J.C. (2012). Clinical findings in patients with GLI2 mutations--phenotypic variability. Clin. Genet. 81, 70–75.

Bhatia, N., Thiyagarajan, S., Elcheva, I., Saleem, M., Dlugosz, A., Mukhtar, H., and Spiegelman, V.S. (2006). Gli2 is targeted for ubiquitination and degradation by beta-TrCP ubiquitin ligase. J Biol Chem 281, 19320–19326.

Bidet, M., Joubert, O., Lacombe, B., Ciantar, M., Nehmé, R., Mollat, P., Brétillon, L., Faure, H., Bittman, R., Ruat, M., et al. (2011). The hedgehog receptor patched is involved in cholesterol transport. PloS One 6, e23834.

Bijlsma, M.F., Spek, C.A., Zivkovic, D., van de Water, S., Rezaee, F., and Peppelenbosch, M.P. (2006). Repression of smoothened by patched-dependent (pro-)vitamin D3 secretion. PLoS Biol. 4, e232.

Blair, H.J., Tompson, S., Liu, Y.-N., Campbell, J., MacArthur, K., Ponting, C.P., Ruiz-Perez, V.L., and Goodship, J.A. (2011). Evc2 is a positive modulator of Hedgehog signalling that interacts with Evc at the cilia membrane and is also found in the nucleus. BMC Biol. 9, 14.

Bolshakov, S., Walker, C.M., Strom, S.S., Selvan, M.S., Clayman, G.L., El-Naggar, A., Lippman, S.M., Kripke, M.L., and Ananthaswamy, H.N. (2003). p53 Mutations in Human Aggressive and Nonaggressive Basal and Squamous Cell Carcinomas. Clin. Cancer Res. 9, 228– 234.

Brash, D.E. (1997). Sunlight and the onset of skin cancer. Trends Genet. 13, 410–414.

Briggs, K.J., Corcoran-Schwartz, I.M., Zhang, W., Harcke, T., Devereux, W.L., Baylin, S.B., Eberhart, C.G., and Watkins, D.N. (2008). Cooperation between the Hic1 and Ptch1 tumor suppressors in medulloblastoma. Genes Dev. 22, 770–785.

Briscoe, J., Chen, Y., Jessell, T.M., and Struhl, G. (2001). A Hedgehog-Insensitive Form of Patched Provides Evidence for Direct Long-Range Morphogen Activity of Sonic Hedgehog in the Neural Tube. Mol. Cell 7, 1279–1291.

Brugières, L., Pierron, G., Chompret, A., Paillerets, B.B., Di Rocco, F., Varlet, P., Pierre-Kahn, A., Caron, O., Grill, J., and Delattre, O. (2010). Incomplete penetrance of the predisposition to medulloblastoma associated with germ-line SUFU mutations. J. Med. Genet. 47, 142–144.

Brugières, L., Remenieras, A., Pierron, G., Varlet, P., Forget, S., Byrde, V., Bombled, J., Puget, S., Caron, O., Dufour, C., et al. (2012). High frequency of germline SUFU mutations in children with desmoplastic/nodular medulloblastoma younger than 3 years of age. J. Clin. Oncol. Off. J. Am. Soc. Clin. Oncol. 30, 2087–2093.

Buglino, J.A., and Resh, M.D. (2008). Hhat is a palmitoylacyltransferase with specificity for N- palmitoylation of Sonic Hedgehog. J. Biol. Chem. 283, 22076–22088.

Burke, R., Nellen, D., Bellotto, M., Hafen, E., Senti, K.A., Dickson, B.J., and Basler, K. (1999). Dispatched, a novel sterol-sensing domain protein dedicated to the release of cholesterol- modified hedgehog from signaling cells. Cell 99, 803–815.

Buttitta, L., Mo, R., Hui, C.C., and Fan, C.M. (2003). Interplays of Gli2 and Gli3 and their requirement in mediating Shh-dependent sclerotome induction. Development 130, 6233–6243.

Caparrós-Martín, J.A., Valencia, M., Reytor, E., Pacheco, M., Fernandez, M., Perez-Aytes, A., Gean, E., Lapunzina, P., Peters, H., Goodship, J.A., et al. (2013). The ciliary Evc/Evc2 complex

69 interacts with Smo and controls Hedgehog pathway activity in chondrocytes by regulating Sufu/Gli3 dissociation and Gli3 trafficking in primary cilia. Hum. Mol. Genet. 22, 124–139.

Carpenter, D., Stone, D.M., Brush, J., Ryan, A., Armanini, M., Frantz, G., Rosenthal, A., and de Sauvage, F.J. (1998). Characterization of two patched receptors for the vertebrate hedgehog protein family. Proc Natl Acad Sci U S 95, 13630–13634.

Caspary, T., Garcia-Garcia, M.J., Huangfu, D., Eggenschwiler, J.T., Wyler, M.R., Rakeman, A.S., Alcorn, H.L., and Anderson, K.V. (2002). Mouse Dispatched homolog1 is required for long-range, but not juxtacrine, Hh signaling. Curr Biol 12, 1628–1632.

Chamoun, Z., Mann, R.K., Nellen, D., von Kessler, D.P., Bellotto, M., Beachy, P.A., and Basler, K. (2001). Skinny hedgehog, an acyltransferase required for palmitoylation and activity of the hedgehog signal. Science 293, 2080–2084.

Chang, D.T., Lopez, A., von Kessler, D.P., Chiang, C., Simandl, B.K., Zhao, R., Seldin, M.F., Fallon, J.F., and Beachy, P.A. (1994). Products, genetic linkage and limb patterning activity of a murine hedgehog gene. Development 120, 3339–3353.

Chang, H., Li, Q., Moraes, R.C., Lewis, M.T., and Hamel, P.A. (2010). Activation of Erk by sonic hedgehog independent of canonical hedgehog signalling. Int. J. Biochem. Cell Biol. 42, 1462–1471.

Chang, H., Balenci, L., Okolowsky, N., Muller, W.J., and Hamel, P.A. (2012). Mammary epithelial-restricted expression of activated c-src rescues the block to mammary gland morphogenesis due to the deletion of the C-terminus of Patched-1. Dev. Biol. 370, 187–197.

Chang, S.-C., Mulloy, B., Magee, A.I., and Couchman, J.R. (2011). Two distinct sites in sonic Hedgehog combine for heparan sulfate interactions and cell signaling functions. J. Biol. Chem. 286, 44391–44402.

Chang, T.-Y., Chang, C.C.Y., Ohgami, N., and Yamauchi, Y. (2006). Cholesterol sensing, trafficking, and esterification. Annu. Rev. Cell Dev. Biol. 22, 129–157.

Chen, J.K., Taipale, J., Young, K.E., Maiti, T., and Beachy, P.A. (2002). Small molecule modulation of Smoothened activity. Proc Natl Acad Sci U S 99, 14071–14076.

Chen, M.H., Li, Y.J., Kawakami, T., Xu, S.M., and Chuang, P.T. (2004a). Palmitoylation is required for the production of a soluble multimeric Hedgehog protein complex and long-range signaling in vertebrates. Genes Dev 18, 641–659.

Chen, M.-H., Wilson, C.W., Li, Y.-J., Law, K.K.L., Lu, C.-S., Gacayan, R., Zhang, X., Hui, C., and Chuang, P.-T. (2009). Cilium-independent regulation of Gli protein function by Sufu in Hedgehog signaling is evolutionarily conserved. Genes Dev. 23, 1910–1928.

Chen, W., Ren, X.R., Nelson, C.D., Barak, L.S., Chen, J.K., Beachy, P.A., De Sauvage, F., and Lefkowitz, R.J. (2004b). Activity-dependent internalization of smoothened mediated by beta- arrestin 2 and GRK2. Science 306, 2257–2260.

Chen, X., Tukachinsky, H., Huang, C.-H., Jao, C., Chu, Y.-R., Tang, H.-Y., Mueller, B., Schulman, S., Rapoport, T.A., and Salic, A. (2011a). Processing and turnover of the Hedgehog protein in the endoplasmic reticulum. J. Cell Biol. 192, 825–838.

Chen, Y., Sasai, N., Ma, G., Yue, T., Jia, J., Briscoe, J., and Jiang, J. (2011b). Sonic Hedgehog dependent phosphorylation by CK1α and GRK2 is required for ciliary accumulation and activation of smoothened. PLoS Biol. 9, e1001083.

Chen, Y., Yue, S., Xie, L., Pu, X., Jin, T., and Cheng, S.Y. (2011c). Dual Phosphorylation of Suppressor of Fused (Sufu) by PKA and GSK3? Regulates Its Stability and Localization in the Primary Cilium. J. Biol. Chem. 286, 13502–13511.

Cheung, H.O.-L., Zhang, X., Ribeiro, A., Mo, R., Makino, S., Puviindran, V., Law, K.K.L., Briscoe, J., and Hui, C.-C. (2009). The kinesin protein Kif7 is a critical regulator of Gli transcription factors in mammalian hedgehog signaling. Sci. Signal. 2, ra29.

Chinchilla, P., Xiao, L., Kazanietz, M.G., and Riobo, N.A. (2010). Hedgehog proteins activate pro-angiogenic responses in endothelial cells through non-canonical signaling pathways. Cell Cycle Georget. Tex 9, 570–579.

Christ, A., Christa, A., Kur, E., Lioubinski, O., Bachmann, S., Willnow, T.E., and Hammes, A. (2012). LRP2 Is an Auxiliary SHH Receptor Required to Condition the Forebrain Ventral Midline for Inductive Signals. Dev. Cell 22, 268–278.

Chuang, P.T., and McMahon, A.P. (1999). Vertebrate Hedgehog signalling modulated by induction of a Hedgehog-binding protein. Nature 397, 617–621.

Chuang, P.T., Kawcak, T., and McMahon, A.P. (2003). Feedback control of mammalian Hedgehog signaling by the Hedgehog-binding protein, Hip1, modulates Fgf signaling during branching morphogenesis of the lung. Genes Dev 17, 342–347.

Cobourne, M.T., Miletich, I., and Sharpe, P.T. (2004). Restriction of sonic hedgehog signalling during early tooth development. Dev. Camb. Engl. 131, 2875–2885.

Cole, F., and Krauss, R.S. (2003). Microform holoprosencephaly in mice that lack the Ig superfamily member Cdon. Curr. Biol. CB 13, 411–415.

Cole, D.G., Diener, D.R., Himelblau, A.L., Beech, P.L., Fuster, J.C., and Rosenbaum, J.L. (1998). Chlamydomonas kinesin-II-dependent intraflagellar transport (IFT): IFT particles contain proteins required for ciliary assembly in Caenorhabditis elegans sensory neurons. J. Cell Biol. 141, 993–1008.

Cooper, A.F., Yu, K.P., Brueckner, M., Brailey, L.L., Johnson, L., McGrath, J.M., and Bale, A.E. (2005). Cardiac and CNS defects in a mouse with targeted disruption of suppressor of fused. Development 132, 4407–4417.

Cooper, M.K., Wassif, C.A., Krakowiak, P.A., Taipale, J., Gong, R., Kelley, R.I., Porter, F.D., and Beachy, P.A. (2003). A defective response to Hedgehog signaling in disorders of cholesterol biosynthesis. Nat Genet 33, 508–513.

Corbit, K.C., Aanstad, P., Singla, V., Norman, A.R., Stainier, D.Y.R., and Reiter, J.F. (2005). Vertebrate Smoothened functions at the primary cilium. Nature 437, 1018–1021.

Corcoran, R.B., and Scott, M.P. (2006). Oxysterols stimulate Sonic hedgehog signal transduction and proliferation of medulloblastoma cells. Proc Natl Acad Sci U S 103, 8408–8413.

Cowan, R., Hoban, P., Kelsey, A., Birch, J.M., Gattamaneni, R., and Evans, D.G. (1997). The gene for the naevoid basal cell carcinoma syndrome acts as a tumour-suppressor gene in medulloblastoma. Br. J. Cancer 76, 141–145.

Creanga, A., Glenn, T.D., Mann, R.K., Saunders, A.M., Talbot, W.S., and Beachy, P.A. (2012). Scube/You activity mediates release of dually lipid-modified Hedgehog signal in soluble form. Genes Dev. 26, 1312–1325.

Crowson, A.N. (2006). Basal cell carcinoma: biology, morphology and clinical implications. Mod. Pathol. 19, S127–S147.

Dahmane, N., Lee, J., Robins, P., Heller, P., and Altaba, A.R. i (1997). Activation of the transcription factor Gli1 and the Sonic hedgehog signalling pathway in skin tumours. Nature 389, 876–881.

Dai, P., Akimaru, H., Tanaka, Y., Maekawa, T., Nakafuku, M., and Ishii, S. (1999). Sonic Hedgehog-induced activation of the Gli1 promoter is mediated by GLI3. J. Biol. Chem. 274, 8143–8152.

Danaee, H., Karagas, M.R., Kelsey, K.T., Perry, A.E., and Nelson, H.H. (2006). Allelic loss at Drosophila patched gene is highly prevalent in Basal and squamous cell carcinomas of the skin. J. Invest. Dermatol. 126, 1152–1158.

Daya-Grosjean, L., and Sarasin, A. (2000). UV-specific mutations of the human patched gene in basal cell carcinomas from normal individuals and xeroderma pigmentosum patients. Mutat. Res. Mol. Mech. Mutagen. 450, 193–199.

Dennler, S., André, J., Alexaki, I., Li, A., Magnaldo, T., Dijke, P. ten, Wang, X.-J., Verrecchia, F., and Mauviel, A. (2007). Induction of Sonic Hedgehog Mediators by Transforming Growth Factor-β: Smad3-Dependent Activation of Gli2 and Gli1 Expression In vitro and In vivo. Cancer Res. 67, 6981–6986.

Dessaud, E., McMahon, A.P., and Briscoe, J. (2008). Pattern formation in the vertebrate neural tube: a sonic hedgehog morphogen-regulated transcriptional network. Dev. Camb. Engl. 135, 2489–2503.

Dierker, T., Dreier, R., Petersen, A., Bordych, C., and Grobe, K. (2009). Heparan sulfate- modulated, metalloprotease-mediated sonic hedgehog release from producing cells. J. Biol. Chem. 284, 8013–8022.

Ding, Q., Motoyama, J., Gasca, S., Mo, R., Sasaki, H., Rossant, J., and Hui, C.C. (1998). Diminished Sonic hedgehog signaling and lack of floor plate differentiation in Gli2 mutant mice. Dev. Camb. Engl. 125, 2533–2543.

Ding, Q., Fukami, S. i, Meng, X., Nishizaki, Y., Zhang, X., Sasaki, H., Dlugosz, A., Nakafuku, M., and Hui, C. c (1999). Mouse suppressor of fused is a negative regulator of sonic hedgehog signaling and alters the subcellular distribution of Gli1. Curr. Biol. CB 9, 1119–1122.

Donepudi, M., and Resh, M.D. (2008). c-Src trafficking and co-localization with the EGF receptor promotes EGF ligand-independent EGF receptor activation and signaling. Cell. Signal. 20, 1359–1367.

Dong, J., Gailani, M.R., Pomeroy, S.L., Reardon, D., and Bale, A.E. (2000). Identification of PATCHED mutations in medulloblastomas by direct sequencing. Hum. Mutat. 16, 89–90.

Dorn, K.V., Hughes, C.E., and Rohatgi, R. (2012). A Smoothened-Evc2 complex transduces the Hedgehog signal at primary cilia. Dev. Cell 23, 823–835.

Dubourg, C., Lazaro, L., Pasquier, L., Bendavid, C., Blayau, M., Duff, F.L., Durou, M.-R., Odent, S., and David, V. (2004). Molecular screening of SHH, ZIC2, SIX3, and TGIF genes in patients with features of holoprosencephaly spectrum: Mutation review and genotype–phenotype correlations. Hum. Mutat. 24, 43–51.

Dubourg, C., Bendavid, C., Pasquier, L., Henry, C., Odent, S., and David, V. (2007). Holoprosencephaly. Orphanet J. Rare Dis. 2, 8.

Dwyer, J.R., Sever, N., Carlson, M., Nelson, S.F., Beachy, P.A., and Parhami, F. (2007). Oxysterols are novel activators of the hedgehog signaling pathway in pluripotent mesenchymal cells. J. Biol. Chem. 282, 8959–8968.

Eaton, S. (2008). Multiple roles for lipids in the Hedgehog signalling pathway. Nat. Rev. Mol. Cell Biol. 9, 437–445.

Echelard, Y., Epstein, D.J., St-Jacques, B., Shen, L., Mohler, J., McMahon, J.A., and McMahon, A.P. (1993). Sonic hedgehog, a member of a family of putative signaling molecules, is implicated in the regulation of CNS polarity. Cell 75, 1417–1430.

Endoh-Yamagami, S., Evangelista, M., Wilson, D., Wen, X., Theunissen, J.-W., Phamluong, K., Davis, M., Scales, S.J., Solloway, M.J., de Sauvage, F.J., et al. (2009). The mammalian Cos2 homolog Kif7 plays an essential role in modulating Hh signal transduction during development. Curr. Biol. CB 19, 1320–1326.

Epstein, D.J., Marti, E., Scott, M.P., and McMahon, A.P. (1996). Antagonizing cAMP-dependent protein kinase A in the dorsal CNS activates a conserved Sonic hedgehog signaling pathway. Dev. Camb. Engl. 122, 2885–2894.

Etheridge, L.A., Crawford, T.Q., Zhang, S., and Roelink, H. (2010). Evidence for a role of vertebrate Disp1 in long-range Shh signaling. Dev. Camb. Engl. 137, 133–140.

Evangelista, M., Lim, T.Y., Lee, J., Parker, L., Ashique, A., Peterson, A.S., Ye, W., Davis, D.P., and de Sauvage, F.J. (2008). Kinome siRNA screen identifies regulators of ciliogenesis and hedgehog signal transduction. Sci. Signal. 1, ra7.

Evans, D.G., Ladusans, E.J., Rimmer, S., Burnell, L.D., Thakker, N., and Farndon, P.A. (1993). Complications of the naevoid basal cell carcinoma syndrome: results of a population based study. J. Med. Genet. 30, 460–464.

Evans, D.G., Howard, E., Giblin, C., Clancy, T., Spencer, H., Huson, S.M., and Lalloo, F. (2010). Birth incidence and prevalence of tumor-prone syndromes: estimates from a UK family genetic register service. Am. J. Med. Genet. A. 152A, 327–332.

Fan, Z., Li, J., Du, J., Zhang, H., Shen, Y., Wang, C.-Y., and Wang, S. (2008). A missense mutation in PTCH2 underlies dominantly inherited NBCCS in a Chinese family. J. Med. Genet. 45, 303–308.

Farndon, P.A., Del Mastro, R.G., Kilpatrick, M.W., and Evans, D.R.G. (1992). Location of gene for Gorlin syndrome. The Lancet 339, 581–582.

Feng, W., Choi, I., Clouthier, D., Niswander, L., and Williams, T. (2013). The Ptch1(DL) mouse: A new model to study lambdoid craniosynosytsosis and basal cell nevus syndrome associated skeletal defects. Genes. New York N 2000.

Fietz, M.J., Jacinto, A., Taylor, A.M., Alexandre, C., and Ingham, P.W. (1995). Secretion of the amino-terminal fragment of the hedgehog protein is necessary and sufficient for hedgehog signalling in Drosophila. Curr. Biol. CB 5, 643–650.

Flanagan, J.G., and Cheng, H.J. (2000). Alkaline phosphatase fusion proteins for molecular characterization and cloning of receptors and their ligands. Methods Enzymol. 327, 198–210.

Follit, J.A., Xu, F., Keady, B.T., and Pazour, G.J. (2009). Characterization of mouse IFT complex B. Cell Motil. Cytoskeleton 66, 457–468.

Fombonne, J., Bissey, P.-A., Guix, C., Sadoul, R., Thibert, C., and Mehlen, P. (2012). Patched dependence receptor triggers apoptosis through ubiquitination of caspase-9. Proc. Natl. Acad. Sci. 109, 10510–10515.

Fujii, K., Ohashi, H., Suzuki, M., Hatsuse, H., Shiohama, T., Uchikawa, H., and Miyashita, T. (2013). Frameshift mutation in the PTCH2 gene can cause nevoid basal cell carcinoma syndrome. Fam. Cancer.

Gailani, M.R., Bale, S.J., Leffell, D.J., DiGiovanna, J.J., Peck, G.L., Poliak, S., Drum, M.A., Pastakia, B., McBride, O.W., Kase, R., et al. (1992). Developmental defects in gorlin syndrome related to a putative tumor suppressor gene on chromosome 9. Cell 69, 111–117.

Gailani, M.R., Ståhle-Bäckdahl, M., Leffell, D.J., Glyn, M., Zaphiropoulos, P.G., Undén, A.B., Dean, M., Brash, D.E., Bale, A.E., and Toftgård, R. (1996). The role of the human homologue of Drosophila patched in sporadic basal cell carcinomas. Nat. Genet. 14, 78–81.

Galdzicka, M., Patnala, S., Hirshman, M.G., Cai, J.-F., Nitowsky, H., Egeland, J.A., and Ginns, E.I. (2002). A new gene, EVC2, is mutated in Ellis-van Creveld syndrome. Mol. Genet. Metab. 77, 291–295.

Garcia-Gonzalo, F.R., Corbit, K.C., Sirerol-Piquer, M.S., Ramaswami, G., Otto, E.A., Noriega, T.R., Seol, A.D., Robinson, J.F., Bennett, C.L., Josifova, D.J., et al. (2011). A Transition Zone Complex Regulates Mammalian Ciliogenesis and Ciliary Membrane Composition. Nat. Genet. 43, 776–784.

Goetz, S.C., and Anderson, K.V. (2010). The primary cilium: a signalling centre during vertebrate development. Nat. Rev. Genet. 11, 331–344.

Goodrich, L.V., Johnson, R.L., Milenkovic, L., McMahon, J.A., and Scott, M.P. (1996). Conservation of the hedgehog/patched signaling pathway from flies to mice: induction of a mouse patched gene by Hedgehog. Genes Dev. 10, 301–312.

Goodrich L V ilenković L Higgins K and Scott P (1997) Altered neural cell fates and medulloblastoma in mouse patched mutants. Science 277, 1109–1113.

Gorlin, R.J. (2004). Nevoid basal cell carcinoma (Gorlin) syndrome. Genet. Med. 6, 530–539.

Grachtchouk, M., Mo, R., Yu, S., Zhang, X., Sasaki, H., Hui, C.C., and Dlugosz, A.A. (2000). Basal cell carcinomas in mice overexpressing Gli2 in skin. Nat. Genet. 24, 216–217.

Grover, V.K., Valadez, J.G., Bowman, A.B., and Cooper, M.K. (2011). Lipid modifications of Sonic hedgehog ligand dictate cellular reception and signal response. PloS One 6, e21353.

Guy, C.T., Muthuswamy, S.K., Cardiff, R.D., Soriano, P., and Muller, W.J. (1994). Activation of the c-Src tyrosine kinase is required for the induction of mammary tumors in transgenic mice. Genes Dev. 8, 23–32.

Hahn, H., Wicking, C., Zaphiropoulos, P.G., Gailani, M.R., Shanley, S., Chidambaram, A., Vorechovsky, I., Holmberg, E., Unden, A.B., Gillies, S., et al. (1996). Mutations of the Human Homolog of Drosophila patched in the Nevoid Basal Cell Carcinoma Syndrome. Cell 85, 841– 851.

Hahn, H., Wojnowski, L., Zimmer, A.M., Hall, J., Miller, G., and Zimmer, A. (1998). Rhabdomyosarcomas and radiation hypersensitivity in a mouse model of Gorlin syndrome. Nat. Med. 4, 619–622.

Haycraft, C.J., Banizs, B., Aydin-Son, Y., Zhang, Q., Michaud, E.J., and Yoder, B.K. (2005). Gli2 and Gli3 localize to cilia and require the intraflagellar transport protein polaris for processing and function. PLoS Genet. 1, e53.

Hehr, U., Gross, C., Diebold, U., Wahl, D., Beudt, U., Heidemann, P., Hehr, A., and Mueller, D. (2004). Wide phenotypic variability in families with holoprosencephaly and a sonic hedgehog mutation. Eur. J. Pediatr. 163, 347–352.

Heitzer, E., Lassacher, A., Quehenberger, F., Kerl, H., and Wolf, P. (2007). UV fingerprints predominate in the PTCH mutation spectra of basal cell carcinomas independent of clinical phenotype. J. Invest. Dermatol. 127, 2872–2881.

Van den Heuvel, M., and Ingham, P.W. (1996). smoothened encodes a receptor-like serpentine protein required for hedgehog signalling. Nature 382, 547–551.

Hime, G.R., Lada, H., Fietz, M.J., Gillies, S., Passmore, A., Wicking, C., and Wainwright, B.J. (2004). Functional analysis in Drosophila indicates that the NBCCS/PTCH1 mutation G509V results in activation of smoothened through a dominant-negative mechanism. Dev. Dyn. Off. Publ. Am. Assoc. Anat. 229, 780–790.

Hollway, G.E., Maule, J., Gautier, P., Evans, T.M., Keenan, D.G., Lohs, C., Fischer, D., Wicking, C., and Currie, P.D. (2006). Scube2 mediates Hedgehog signalling in the zebrafish embryo. Dev. Biol. 294, 104–118.

Holtz, A.M., Peterson, K.A., Nishi, Y., Morin, S., Song, J.Y., Charron, F., McMahon, A.P., and Allen, B.L. (2013). Essential role for ligand-dependent feedback antagonism of vertebrate hedgehog signaling by PTCH1, PTCH2 and HHIP1 during neural patterning. Dev. Camb. Engl. 140, 3423–3434.

Hsu, S.-H.C., Zhang, X., Yu, C., Li, Z.J., Wunder, J.S., Hui, C.-C., and Alman, B.A. (2011). Kif7 promotes hedgehog signaling in growth plate chondrocytes by restricting the inhibitory function of Sufu. Development 138, 3791–3801.

Hu, Q., Milenkovic, L., Jin, H., Scott, M.P., Nachury, M.V., Spiliotis, E.T., and Nelson, W.J. (2010). A septin diffusion barrier at the base of the primary cilium maintains ciliary membrane protein distribution. Science 329, 436–439.

Huang, Y., Roelink, H., and McKnight, G.S. (2002). Protein kinase A deficiency causes axially localized neural tube defects in mice. J. Biol. Chem. 277, 19889–19896.

Huang, Y.S., Bu, D.F., Li, X.Y., Ma, Z.H., Yang, Y., Lin, Z.M., Lu, F.M., Tu, P., and Li, H. (2013). Unique features of PTCH1 mutation spectrum in Chinese sporadic basal cell carcinoma. J. Eur. Acad. Dermatol. Venereol. JEADV 27, 235–241.

Huangfu, D., and Anderson, K.V. (2005). Cilia and Hedgehog responsiveness in the mouse. Proc. Natl. Acad. Sci. U. S. A. 102, 11325–11330.

Huangfu, D., Liu, A., Rakeman, A.S., Murcia, N.S., Niswander, L., and Anderson, K.V. (2003). Hedgehog signalling in the mouse requires intraflagellar transport proteins. Nature 426, 83–87.

Humke, E.W., Dorn, K.V., Milenkovic, L., Scott, M.P., and Rohatgi, R. (2010). The output of Hedgehog signaling is controlled by the dynamic association between Suppressor of Fused and the Gli proteins. Genes Dev. 24, 670–682.

Incardona, J.P., Gruenberg, J., and Roelink, H. (2002). Sonic Hedgehog Induces the Segregation of Patched and Smoothened in Endosomes. Curr. Biol. 12, 983–995.

Ingham, P.W., Nakano, Y., and Seger, C. (2011). Mechanisms and functions of Hedgehog signalling across the metazoa. Nat. Rev. Genet. 12, 393–406.

Izzi, L., Lévesque, M., Morin, S., Laniel, D., Wilkes, B.C., Mille, F., Krauss, R.S., McMahon, A.P., Allen, B.L., and Charron, F. (2011). Boc and Gas1 each form distinct Shh receptor complexes with Ptch1 and are required for Shh-mediated cell proliferation. Dev. Cell 20, 788– 801.

Jenkins, D., Winyard, P.J.D., and Woolf, A.S. (2007). Immunohistochemical analysis of Sonic hedgehog signalling in normal human urinary tract development. J. Anat. 211, 620–629.

Jeong, J., and McMahon, A.P. (2005). Growth and pattern of the mammalian neural tube are governed by partially overlapping feedback activities of the hedgehog antagonists patched 1 and Hhip1. Development 132, 143–154.

Ji, Z., Mei, F.C., Xie, J., and Cheng, X. (2007). Oncogenic KRAS Activates Hedgehog Signaling Pathway in Pancreatic Cancer Cells. J. Biol. Chem. 282, 14048–14055.

Jia, J., Tong, C., Wang, B., Luo, L., and Jiang, J. (2004). Hedgehog signalling activity of Smoothened requires phosphorylation by protein kinase A and casein kinase I. Nature 432, 1045–1050.

Jia, J., Kolterud, A., Zeng, H., Hoover, A., Teglund, S., Toftgård, R., and Liu, A. (2009). Suppressor of Fused inhibits mammalian Hedgehog signaling in the absence of cilia. Dev. Biol. 330, 452–460.

Johnson, J.-L.F.A., Hall, T.E., Dyson, J.M., Sonntag, C., Ayers, K., Berger, S., Gautier, P., Mitchell, C., Hollway, G.E., and Currie, P.D. (2012). Scube activity is necessary for Hedgehog signal transduction in vivo. Dev. Biol. 368, 193–202.

Johnson, R.L., Rothman, A.L., Xie, J., Goodrich, L.V., Bare, J.W., Bonifas, J.M., Quinn, A.G., Myers, R.M., Cox, D.R., Epstein, E.H., et al. (1996). Human homolog of patched, a candidate gene for the basal cell nevus syndrome. Science 272, 1668–1671.

Johnson, R.L., Milenkovic, L., and Scott, M.P. (2000). In vivo functions of the patched protein: requirement of the C terminus for target gene inactivation but not Hedgehog sequestration. Mol. Cell 6, 467–478.

Jones, D.T., Jager, N., Kool, M., Zichner, T., Hutter, B., Sultan, M., Cho, Y.-J., Pugh, T.J., Hovestadt, V., Stutz, A.M., et al. (2012). ICGC PedBrain: Dissecting the genomic complexity underlying medulloblastoma. Nature 488, 100–105.

Jones, E.A., Sajid, M.I., Shenton, A., and Evans, D.G. (2011). Basal Cell Carcinomas in Gorlin Syndrome: A Review of 202 Patients. J. Skin Cancer 2011.

Kagawa, H., Shino, Y., Kobayashi, D., Demizu, S., Shimada, M., Ariga, H., and Kawahara, H. (2011). A novel signaling pathway mediated by the nuclear targeting of C-terminal fragments of mammalian Patched 1. PLoS ONE 6, e18638.

Kang, H.C., Wakabayashi, Y., Jen, K.-Y., Mao, J.-H., Zoumpourlis, V., Del Rosario, R., and Balmain, A. (2013). Ptch1 Overexpression Drives Skin Carcinogenesis and Developmental Defects in K14PtchFVB Mice. J. Invest. Dermatol. 133, 1311–1320.

Kang, J.S., Gao, M., Feinleib, J.L., Cotter, P.D., Guadagno, S.N., and Krauss, R.S. (1997). CDO: an oncogene-, serum-, and anchorage-regulated member of the Ig/fibronectin type III repeat family. J. Cell Biol. 138, 203–213.

Kang, J.-S., Mulieri, P.J., Hu, Y., Taliana, L., and Krauss, R.S. (2002). BOC, an Ig superfamily member, associates with CDO to positively regulate myogenic differentiation. EMBO J. 21, 114–124.

Kawakami, A., Nojima, Y., Toyoda, A., Takahoko, M., Satoh, M., Tanaka, H., Wada, H., Masai, I., Terasaki, H., Sakaki, Y., et al. (2005). The zebrafish-secreted matrix protein you/scube2 is implicated in long-range regulation of hedgehog signaling. Curr. Biol. CB 15, 480–488.

Kawakami, T., Kawcak, T., Li, Y.-J., Zhang, W., Hu, Y., and Chuang, P.-T. (2002). Mouse dispatched mutants fail to distribute hedgehog proteins and are defective in hedgehog signaling. Dev. Camb. Engl. 129, 5753–5765.

Kawamura, S., Hervold, K., Ramirez-Weber, F.-A., and Kornberg, T.B. (2008). Two patched protein subtypes and a conserved domain of group I proteins that regulates turnover. J. Biol. Chem. 283, 30964–30969.

Keady, B.T., Samtani, R., Tobita, K., Tsuchya, M., San Agustin, J.T., Follit, J.A., Jonassen, J.A., Subramanian, R., Lo, C.W., and Pazour, G.J. (2012). IFT25 links the signal-dependent movement of Hedgehog components to intraflagellar transport. Dev. Cell 22, 940–951.

Kenney, A.M., and Rowitch, D.H. (2000). Sonic hedgehog promotes G(1) cyclin expression and sustained cell cycle progression in mammalian neuronal precursors. Mol. Cell. Biol. 20, 9055– 9067.

Kenney, A.M., Cole, M.D., and Rowitch, D.H. (2003). Nmyc upregulation by sonic hedgehog signaling promotes proliferation in developing cerebellar granule neuron precursors. Dev. Camb. Engl. 130, 15–28.

Kim, H., Laing, M., and Muller, W. (2005). c-Src-null mice exhibit defects in normal mammary gland development and ERalpha signaling. Oncogene 24, 5629–5636.

Kim, J., Kato, M., and Beachy, P.A. (2009a). Gli2 trafficking links Hedgehog-dependent activation of Smoothened in the primary cilium to transcriptional activation in the nucleus. Proc. Natl. Acad. Sci. U. S. A. 106, 21666–21671.

Kim, L.C., Song, L., and Haura, E.B. (2009b). Src kinases as therapeutic targets for cancer. Nat. Rev. Clin. Oncol. 6, 587–595.

Kimura, H., Stephen, D., Joyner, A., and Curran, T. (2005). Gli1 is important for medulloblastoma formation in Ptc1+/- mice. Oncogene 24, 4026–4036.

Kise, Y., Morinaka, A., Teglund, S., and Miki, H. (2009). Sufu recruits GSK3beta for efficient processing of Gli3. Biochem. Biophys. Res. Commun. 387, 569–574.

Kogerman, P., Grimm, T., Kogerman, L., Krause, D., Undén, A.B., Sandstedt, B., Toftgård, R., and Zaphiropoulos, P.G. (1999). Mammalian suppressor-of-fused modulates nuclear-cytoplasmic shuttling of Gli-1. Nat. Cell Biol. 1, 312–319.

Kogerman, P., Krause, D., Rahnama, F., Kogerman, L., Undén, A.B., Zaphiropoulos, P.G., and Toftgård, R. (2002). Alternative first exons of PTCH1 are differentially regulated in vivo and may confer different functions to the PTCH1 protein. Oncogene 21, 6007–6016.

Kolpakova-Hart, E., Jinnin, M., Hou, B., Fukai, N., and Olsen, B.R. (2007). Kinesin-2 controls development and patterning of the vertebrate skeleton by Hedgehog- and Gli3-dependent mechanisms. Dev. Biol. 309, 273–284.

Kool, M., Koster, J., Bunt, J., Hasselt, N.E., Lakeman, A., van Sluis, P., Troost, D., Meeteren, N.S., Caron, H.N., Cloos, J., et al. (2008). Integrated genomics identifies five medulloblastoma subtypes with distinct genetic profiles, pathway signatures and clinicopathological features. PloS One 3, e3088.

Kool, M., Korshunov, A., Remke, M., Jones, D.T.W., Schlanstein, M., Northcott, P.A., Cho, Y.- J., Koster, J., Schouten-van Meeteren, A., van Vuurden, D., et al. (2012). Molecular subgroups of medulloblastoma: an international meta-analysis of transcriptome, genetic aberrations, and clinical data of WNT, SHH, Group 3, and Group 4 medulloblastomas. Acta Neuropathol. (Berl.) 123, 473–484.

Kovacs, J.J., Whalen, E.J., Liu, R., Xiao, K., Kim, J., Chen, M., Wang, J., Chen, W., and Lefkowitz, R.J. (2008). Beta-arrestin-mediated localization of smoothened to the primary cilium. Science 320, 1777–1781.

Larkins, C.E., Aviles, G.D.G., East, M.P., Kahn, R.A., and Caspary, T. (2011). Arl13b regulates ciliogenesis and the dynamic localization of Shh signaling proteins. Mol. Biol. Cell 22, 4694– 4703.

Lauth, M., Bergström, Å., Shimokawa, T., Tostar, U., Jin, Q., Fendrich, V., Guerra, C., Barbacid, M., and Toftgård, R. (2010). DYRK1B-dependent autocrine-to-paracrine shift of Hedgehog signaling by mutant RAS. Nat. Struct. Mol. Biol. 17, 718–725.

Law, K.K.L., Makino, S., Mo, R., Zhang, X., Puviindran, V., and Hui, C. (2012). Antagonistic and Cooperative Actions of Kif7 and Sufu Define Graded Intracellular Gli Activities in Hedgehog Signaling. PLoS ONE 7, e50193.

Lee, J.D., and Treisman, J.E. (2001). Sightless has homology to transmembrane acyltransferases and is required to generate active Hedgehog protein. Curr. Biol. CB 11, 1147–1152.

Lee, C.S., Buttitta, L., and Fan, C.M. (2001). Evidence that the WNT-inducible growth arrest- specific gene 1 encodes an antagonist of sonic hedgehog signaling in the somite. Proc. Natl. Acad. Sci. U. S. A. 98, 11347–11352.

Lee, J.J., Ekker, S.C., von Kessler, D.P., Porter, J.A., Sun, B.I., and Beachy, P.A. (1994). Autoproteolysis in hedgehog protein biogenesis. Science 266, 1528–1537.

Lee, Y., Miller, H.L., Russell, H.R., Boyd, K., Curran, T., and McKinnon, P.J. (2006). Patched2 modulates tumorigenesis in patched1 heterozygous mice. Cancer Res. 66, 6964–6971.

Lewis, P.M., Dunn, M.P., McMahon, J.A., Logan, M., Martin, J.F., St-Jacques, B., and McMahon, A.P. (2001). Cholesterol modification of sonic hedgehog is required for long-range signaling activity and effective modulation of signaling by Ptc1. Cell 105, 599–612.

Li, S.S.-C. (2005). Specificity and versatility of SH3 and other proline-recognition domains: structural basis and implications for cellular signal transduction. Biochem. J. 390, 641–653.

Li, Y., Zhang, H., Litingtung, Y., and Chiang, C. (2006). Cholesterol modification restricts the spread of Shh gradient in the limb bud. Proc. Natl. Acad. Sci. U. S. A. 103, 6548–6553.

Li, Z., Zhang, H., Denhard, L.A., Liu, L.-H., Zhou, H., and Lan, Z.-J. (2008a). Reduced white fat mass in adult mice bearing a truncated Patched 1. Int. J. Biol. Sci. 4, 29–36.

Li, Z., Zhang, H., Denhard, L.A., Liu, L.-H., Zhou, H., and Lan, Z.-J. (2008b). Reduced white fat mass in adult mice bearing a truncated Patched 1. Int. J. Biol. Sci. 4, 29–36.

Li, Z.J., Nieuwenhuis, E., Nien, W., Zhang, X., Zhang, J., Puviindran, V., Wainwright, B.J., Kim, P.C.W., and Hui, C. -c. (2012). Kif7 regulates Gli2 through Sufu-dependent and - independent functions during skin development and tumorigenesis. Development 139, 4152– 4161.

Liem, K.F., Jr, He, M., Ocbina, P.J.R., and Anderson, K.V. (2009). Mouse Kif7/Costal2 is a cilia-associated protein that regulates Sonic hedgehog signaling. Proc. Natl. Acad. Sci. U. S. A. 106, 13377–13382.

Liem, K.F., Jr, Ashe, A., He, M., Satir, P., Moran, J., Beier, D., Wicking, C., and Anderson, K.V. (2012). The IFT-A complex regulates Shh signaling through cilia structure and membrane protein trafficking. J. Cell Biol. 197, 789–800.

Lim, W.A., Richards, F.M., and Fox, R.O. (1994). Structural determinants of peptide-binding orientation and of sequence specificity in SH3 domains. Nature 372, 375–379.

Lindström, E., Shimokawa, T., Toftgård, R., and Zaphiropoulos, P.G. (2006). PTCH mutations: distribution and analyses. Hum. Mutat. 27, 215–219.

Lipinski, R.J., Gipp, J.J., Zhang, J., Doles, J.D., and Bushman, W. (2006). Unique and complimentary activities of the Gli transcription factors in Hedgehog signaling. Exp. Cell Res. 312, 1925–1938.

Litingtung, Y., Dahn, R.D., Li, Y., Fallon, J.F., and Chiang, C. (2002). Shh and Gli3 are dispensable for limb skeleton formation but regulate digit number and identity. Nature 418, 979– 983.

Liu, A., Wang, B., and Niswander, L.A. (2005). Mouse intraflagellar transport proteins regulate both the activator and repressor functions of Gli transcription factors. Development 132, 3103– 3111.

Liu, B.A., Engelmann, B.W., and Nash, P.D. (2012). The language of SH2 domain interactions defines phosphotyrosine-mediated signal transduction. FEBS Lett. 586, 2597–2605.

Lo, J.S., Snow, S.N., Reizner, G.T., Mohs, F.E., Larson, P.O., and Hruza, G.J. (1991). Metastatic basal cell carcinoma: report of twelve cases with a review of the literature. J. Am. Acad. Dermatol. 24, 715–719.

López-Martínez, A., Chang, D.T., Chiang, C., Porter, J.A., Ros, M.A., Simandl, B.K., Beachy, P.A., and Fallon, J.F. (1995). Limb-patterning activity and restricted posterior localization of the amino-terminal product of Sonic hedgehog cleavage. Curr. Biol. CB 5, 791–796.

Lu, X., Liu, S., and Kornberg, T.B. (2006). The C-terminal tail of the Hedgehog receptor Patched regulates both localization and turnover. Genes Dev. 20, 2539–2551.

Lü, Y., Zhu, H., Ye, W., Zhang, M., He, D., and Chen, W. (2008). A new mutation of PTCH gene in a Chinese family with nevoid basal cell carcinoma syndrome. Chin. Med. J. (Engl.) 121, 118–121.

Ma, Y., Erkner, A., Gong, R., Yao, S., Taipale, J., Basler, K., and Beachy, P.A. (2002). Hedgehog-mediated patterning of the mammalian embryo requires transporter-like function of dispatched. Cell 111, 63–75.

Maity, T., Fuse, N., and Beachy, P.A. (2005). Molecular mechanisms of Sonic hedgehog mutant effects in holoprosencephaly. Proc. Natl. Acad. Sci. U. S. A. 102, 17026–17031.

Makino, S., Masuya, H., Ishijima, J., Yada, Y., and Shiroishi, T. (2001). A spontaneous mouse mutation, mesenchymal dysplasia (mes), is caused by a deletion of the most C-terminal cytoplasmic domain of patched (ptc). Dev. Biol. 239, 95–106.

Mancuso, M., Pazzaglia, S., Tanori, M., Hahn, H., Merola, P., Rebessi, S., Atkinson, M.J., Di Majo, V., Covelli, V., and Saran, A. (2004). Basal cell carcinoma and its development: insights from radiation-induced tumors in Ptch1-deficient mice. Cancer Res. 64, 934–941.

Mancuso, M., Leonardi, S., Tanori, M., Pasquali, E., Pierdomenico, M., Rebessi, S., Di Majo, V., Covelli, V., Pazzaglia, S., and Saran, A. (2006). Hair cycle-dependent basal cell carcinoma tumorigenesis in Ptc1neo67/+ mice exposed to radiation. Cancer Res. 66, 6606–6614.

Mannock, D.A., McIntosh, T.J., Jiang, X., Covey, D.F., and McElhaney, R.N. (2003). Effects of natural and enantiomeric cholesterol on the thermotropic phase behavior and structure of egg sphingomyelin bilayer membranes. Biophys. J. 84, 1038–1046.

Marcotte, R., Smith, H.W., Sanguin-Gendreau, V., McDonough, R.V., and Muller, W.J. (2012). Mammary epithelial-specific disruption of c-Src impairs cell cycle progression and tumorigenesis. Proc. Natl. Acad. Sci. U. S. A. 109, 2808–2813.

Marigo, V., Davey, R.A., Zuo, Y., Cunningham, J.M., and Tabin, C.J. (1996). Biochemical evidence that patched is the Hedgehog receptor. Nature 384, 176–179.

Marsh, A., Wicking, C., Wainwright, B., and Chenevix-Trench, G. (2005). DHPLC Analysis of patients with Nevoid Basal Cell Carcinoma Syndrome reveals novel PTCH missense mutations in the sterol-sensing domain. Hum. Mutat. 26, 283–283.

Martí, E., Bumcrot, D.A., Takada, R., and McMahon, A.P. (1995). Requirement of 19K form of Sonic hedgehog for induction of distinct ventral cell types in CNS explants. Nature 375, 322– 325.

art n V Carrillo G Torroja C and Guerrero I (2 1) The sterol-sensing domain of Patched protein seems to control Smoothened activity through Patched vesicular trafficking. Curr. Biol. 11, 601–607.

Martinelli, D.C., and Fan, C.-M. (2007). Gas1 extends the range of Hedgehog action by facilitating its signaling. Genes Dev. 21, 1231–1243.

Martinelli, D.C., and Fan, C.-M. (2009). A sonic hedgehog missense mutation associated with holoprosencephaly causes defective binding to GAS1. J. Biol. Chem. 284, 19169–19172.

Matsuzawa, N., Nagao, T., Shimozato, K., Niikawa, N., and Yoshiura, K. (2006). Patched homologue 1 mutations in four Japanese families with basal cell nevus syndrome. J. Clin. Pathol. 59, 1084–1086.

McCarthy, R.A., Barth, J.L., Chintalapudi, M.R., Knaak, C., and Argraves, W.S. (2002). Megalin functions as an endocytic sonic hedgehog receptor. J. Biol. Chem. 277, 25660–25667.

McDermott, A., Gustafsson, M., Elsam, T., Hui, C.-C., Emerson, C.P., Jr, and Borycki, A.-G. (2005). Gli2 and Gli3 have redundant and context-dependent function in skeletal muscle formation. Dev. Camb. Engl. 132, 345–357.

Mehlen, P., and Bredesen, D.E. (2004). The dependence receptor hypothesis. Apoptosis Int. J. Program. Cell Death 9, 37–49.

Meloni, A.R., Fralish, G.B., Kelly, P., Salahpour, A., Chen, J.K., Wechsler-Reya, R.J., Lefkowitz, R.J., and Caron, M.G. (2006). Smoothened signal transduction is promoted by G protein-coupled receptor kinase 2. Mol. Cell. Biol. 26, 7550–7560.

Micchelli, C.A., The, I., Selva, E., Mogila, V., and Perrimon, N. (2002). Rasp, a putative transmembrane acyltransferase, is required for Hedgehog signaling. Dev. Camb. Engl. 129, 843– 851.

Milenkovic, L., Goodrich, L.V., Higgins, K.M., and Scott, M.P. (1999). Mouse patched1 controls body size determination and limb patterning. Dev. Camb. Engl. 126, 4431–4440.

Milenkovic, L., Scott, M.P., and Rohatgi, R. (2009). Lateral transport of Smoothened from the plasma membrane to the membrane of the cilium. J. Cell Biol. 187, 365–374.

Millard, E.E., Gale, S.E., Dudley, N., Zhang, J., Schaffer, J.E., and Ory, D.S. (2005). The sterol- sensing domain of the Niemann-Pick C1 (NPC1) protein regulates trafficking of low density lipoprotein cholesterol. J. Biol. Chem. 280, 28581–28590.

Mille, F., Thibert, C., Fombonne, J., Rama, N., Guix, C., Hayashi, H., Corset, V., Reed, J.C., and Mehlen, P. (2009). The Patched dependence receptor triggers apoptosis through a DRAL- caspase-9 complex. Nat. Cell Biol. 11, 739–746.

Miller, D.L., and Weinstock, M.A. (1994). Nonmelanoma skin cancer in the United States: incidence. J. Am. Acad. Dermatol. 30, 774–778.

Ming, J.E., Kaupas, M.E., Roessler, E., Brunner, H.G., Golabi, M., Tekin, M., Stratton, R.F., Sujansky, E., Bale, S.J., and Muenke, M. (2002). Mutations in PATCHED-1, the receptor for SONIC HEDGEHOG, are associated with holoprosencephaly. Hum. Genet. 110, 297–301.

Mo, R., Freer, A.M., Zinyk, D.L., Crackower, M.A., Michaud, J., Heng, H.H., Chik, K.W., Shi, X.M., Tsui, L.C., Cheng, S.H., et al. (1997). Specific and redundant functions of Gli2 and Gli3 zinc finger genes in skeletal patterning and development. Dev. Camb. Engl. 124, 113–123.

Moraes, R.C., Chang, H., Harrington, N., Landua, J.D., Prigge, J.T., Lane, T.F., Wainwright, B.J., Hamel, P.A., and Lewis, M.T. (2009). Ptch1 is required locally for mammary gland morphogenesis and systemically for ductal elongation. Dev. Camb. Engl. 136, 1423–1432.

Motoyama, J., Liu, J., Mo, R., Ding, Q., Post, M., and Hui, C.C. (1998a). Essential function of Gli2 and Gli3 in the formation of lung, trachea and oesophagus. Nat. Genet. 20, 54–57.

Motoyama, J., Takabatake, T., Takeshima, K., and Hui, C. (1998b). Ptch2, a second mouse Patched gene is co-expressed with Sonic hedgehog. Nat. Genet. 18, 104–106.

Motoyama, J., Milenkovic, L., Iwama, M., Shikata, Y., Scott, M.P., and Hui, C. (2003). Differential requirement for Gli2 and Gli3 in ventral neural cell fate specification. Dev. Biol. 259, 150–161.

Mukhopadhyay, S., Wen, X., Ratti, N., Loktev, A., Rangell, L., Scales, S.J., and Jackson, P.K. (2013). The ciliary G-protein-coupled receptor Gpr161 negatively regulates the Sonic hedgehog pathway via cAMP signaling. Cell 152, 210–223.

Murone, M., Rosenthal, A., and de Sauvage, F.J. (1999). Sonic hedgehog signaling by the patched-smoothened receptor complex. Curr. Biol. CB 9, 76–84.

Muthuswamy, S.K., Siegel, P.M., Dankort, D.L., Webster, M.A., and Muller, W.J. (1994). Mammary tumors expressing the neu proto-oncogene possess elevated c-Src tyrosine kinase activity. Mol. Cell. Biol. 14, 735–743.

Nachtergaele, S., Mydock, L.K., Krishnan, K., Rammohan, J., Schlesinger, P.H., Covey, D.F., and Rohatgi, R. (2012). Oxysterols are allosteric activators of the oncoprotein Smoothened. Nat. Chem. Biol. 8, 211–220.

Nagano, T., Bito, T., Kallassy, M., Nakazawa, H., Ichihashi, M., and Ueda, M. (1999). Overexpression of the human homologue of Drosophila patched (PTCH) in skin tumours: specificity for basal cell carcinoma. Br. J. Dermatol. 140, 287–290.

Nagao, K., Toyoda, M., Takeuchi-Inoue, K., Fujii, K., Yamada, M., and Miyashita, T. (2005a). Identification and characterization of multiple isoforms of a murine and human tumor suppressor, patched, having distinct first exons. Genomics 85, 462–471.

Nagao, K., Togawa, N., Fujii, K., Uchikawa, H., Kohno, Y., Yamada, M., and Miyashita, T. (2005b). Detecting tissue-specific alternative splicing and disease-associated aberrant splicing of the PTCH gene with exon junction microarrays. Hum. Mol. Genet. 14, 3379–3388.

Nakamura, M., and Tokura, Y. (2009). A novel missense mutation in the PTCH1 gene in a premature case of nevoid basal cell carcinoma syndrome. Eur. J. Dermatol. EJD 19, 262–263.

Nedelcu, D., Liu, J., Xu, Y., Jao, C., and Salic, A. (2013). Oxysterol binding to the extracellular domain of Smoothened in Hedgehog signaling. Nat. Chem. Biol.

Nieuwenhuis, E., Motoyama, J., Barnfield, P.C., Yoshikawa, Y., Zhang, X., Mo, R., Crackower, M.A., and Hui, C. (2006). Mice with a Targeted Mutation of Patched2 Are Viable but Develop Alopecia and Epidermal Hyperplasia. Mol Cell Biol 26, 6609–6622.

Nieuwenhuis, E., Barnfield, P.C., Makino, S., and Hui, C.-C. (2007). Epidermal hyperplasia and expansion of the interfollicular stem cell compartment in mutant mice with a C-terminal truncation of Patched1. Dev. Biol. 308, 547–560.

Niewiadomski, P., Zhujiang, A., Youssef, M., and Waschek, J.A. (2013). Interaction of PACAP with Sonic hedgehog reveals complex regulation of the Hedgehog pathway by PKA. Cell. Signal.

Nilsson, M., Undèn, A.B., Krause, D., Malmqwist, U., Raza, K., Zaphiropoulos, P.G., and Toftgård, R. (2000). Induction of basal cell carcinomas and trichoepitheliomas in mice overexpressing GLI-1. Proc. Natl. Acad. Sci. U. S. A. 97, 3438–3443.

Nolan-Stevaux, O., Lau, J., Truitt, M.L., Chu, G.C., Hebrok, M., Fernández-Zapico, M.E., and Hanahan, D. (2009). GLI1 is regulated through Smoothened-independent mechanisms in neoplastic pancreatic ducts and mediates PDAC cell survival and transformation. Genes Dev. 23, 24–36.

Northcott, P.A., Hielscher, T., Dubuc, A., Mack, S., Shih, D., Remke, M., Al-Halabi, H., Albrecht, S., Jabado, N., Eberhart, C.G., et al. (2011). Pediatric and adult sonic hedgehog medulloblastomas are clinically and molecularly distinct. Acta Neuropathol. (Berl.) 122, 231– 240.

Ocbina, P.J.R., and Anderson, K.V. (2008). Intraflagellar transport, cilia, and mammalian Hedgehog signaling: analysis in mouse embryonic fibroblasts. Dev. Dyn. Off. Publ. Am. Assoc. Anat. 237, 2030–2038.

Ocbina, P.J.R., Eggenschwiler, J.T., Moskowitz, I., and Anderson, K.V. (2011). Complex interactions between genes controlling trafficking in primary cilia. Nat. Genet. 43, 547–553.

Ohlig, S., Farshi, P., Pickhinke, U., van den Boom, J., Höing, S., Jakuschev, S., Hoffmann, D., Dreier, R., Schöler, H.R., Dierker, T., et al. (2011). Sonic hedgehog shedding results in functional activation of the solubilized protein. Dev. Cell 20, 764–774.

Ohlig, S., Pickhinke, U., Sirko, S., Bandari, S., Hoffmann, D., Dreier, R., Farshi, P., Goetz, M., and Grobe, K. (2012). An emerging role of Sonic hedgehog shedding as a modulator of heparan sulfate interactions. J. Biol. Chem.

Okada, A., Charron, F., Morin, S., Shin, D.S., Wong, K., Fabre, P.J., Tessier-Lavigne, M., and McConnell, S.K. (2006). Boc is a receptor for sonic hedgehog in the guidance of commissural axons. Nature 444, 369–373.

Oliver, T.G., Read, T.A., Kessler, J.D., Mehmeti, A., Wells, J.F., Huynh, T.T.T., Lin, S.M., and Wechsler-Reya, R.J. (2005). Loss of patched and disruption of granule cell development in a pre- neoplastic stage of medulloblastoma. Development 132, 2425–2439.

Oro, A.E., Higgins, K.M., Hu, Z., Bonifas, J.M., Epstein, E.H., Jr, and Scott, M.P. (1997). Basal cell carcinomas in mice overexpressing sonic hedgehog. Science 276, 817–821.

Pan, Y., and Wang, B. (2007). A novel protein-processing domain in Gli2 and Gli3 differentially blocks complete protein degradation by the proteasome. J. Biol. Chem. 282, 10846–10852.

Pan, Y., Bai, C.B., Joyner, A.L., and Wang, B. (2006). Sonic hedgehog Signaling Regulates Gli2 Transcriptional Activity by Suppressing Its Processing and Degradation. Mol. Cell. Biol. 26, 3365–3377.

Park, H.L., Bai, C., Platt, K.A., Matise, M.P., Beeghly, A., Hui, C.C., Nakashima, M., and Joyner, A.L. (2000). Mouse Gli1 mutants are viable but have defects in SHH signaling in combination with a Gli2 mutation. Dev. Camb. Engl. 127, 1593–1605.

Pazzaglia, S., Mancuso, M., Atkinson, M.J., Tanori, M., Rebessi, S., Majo, V.D., Covelli, V., Hahn, H., and Saran, A. (2002). High incidence of medulloblastoma following X-ray-irradiation of newborn Ptc1 heterozygous mice. Oncogene 21, 7580–7584.

Pazzaglia, S., Tanori, M., Mancuso, M., Gessi, M., Pasquali, E., Leonardi, S., Oliva, M.A., Rebessi, S., Di Majo, V., Covelli, V., et al. (2006). Two-hit model for progression of medulloblastoma preneoplasia in Patched heterozygous mice. Oncogene 25, 5575–5580.

Pepinsky, R.B., Zeng, C., Wen, D., Rayhorn, P., Baker, D.P., Williams, K.P., Bixler, S.A., Ambrose, C.M., Garber, E.A., Miatkowski, K., et al. (1998). Identification of a palmitic acid- modified form of human Sonic hedgehog. J. Biol. Chem. 273, 14037–14045.

Pernot, F., Dorandeu, F., Beaup, C., and Peinnequin, A. (2010). Selection of reference genes for real-time quantitative reverse transcription-polymerase chain reaction in hippocampal structure in a murine model of temporal lobe epilepsy with focal seizures. J. Neurosci. Res. 88, 1000– 1008.

Philipp, M., Fralish, G.B., Meloni, A.R., Chen, W., MacInnes, A.W., Barak, L.S., and Caron, M.G. (2008). Smoothened signaling in vertebrates is facilitated by a G protein-coupled receptor kinase. Mol. Biol. Cell 19, 5478–5489.

Pietsch, T., Waha, A., Koch, A., Kraus, J., Albrecht, S., Tonn, J., Sörensen, N., Berthold, F., Henk, B., Schmandt, N., et al. (1997). Medulloblastomas of the desmoplastic variant carry mutations of the human homologue of Drosophila patched. Cancer Res. 57, 2085–2088.

Pineda-Alvarez, D.E., Roessler, E., Hu, P., Srivastava, K., Solomon, B.D., Siple, C.E., Fan, C.- M., and Muenke, M. (2012). Missense substitutions in the GAS1 protein present in holoprosencephaly patients reduce the affinity for its ligand, SHH. Hum. Genet. 131, 301–310.

Pogoriler, J., Millen, K., Utset, M., and Du, W. (2006). Loss of cyclin D1 impairs cerebellar development and suppresses medulloblastoma formation. Dev. Camb. Engl. 133, 3929–3937.

Polizio, A.H., Chinchilla, P., Chen, X., Manning, D.R., and Riobo, N.A. (2011). Sonic Hedgehog activates the GTPases Rac1 and RhoA in a Gli-independent manner through coupling of smoothened to Gi proteins. Sci. Signal. 4, pt7.

Porter, J.A., von Kessler, D.P., Ekker, S.C., Young, K.E., Lee, J.J., Moses, K., and Beachy, P.A. (1995). The product of hedgehog autoproteolytic cleavage active in local and long-range signalling. Nature 374, 363–366.

Porter, J.A., Ekker, S.C., Park, W.J., von Kessler, D.P., Young, K.E., Chen, C.H., Ma, Y., Woods, A.S., Cotter, R.J., Koonin, E.V., et al. (1996a). Hedgehog patterning activity: role of a lipophilic modification mediated by the carboxy-terminal autoprocessing domain. Cell 86, 21– 34.

Porter, J.A., Young, K.E., and Beachy, P.A. (1996b). Cholesterol modification of hedgehog signaling proteins in animal development. Science 274, 255–259.

Pugh, T.J., Weeraratne, S.D., Archer, T.C., Pomeranz Krummel, D.A., Auclair, D., Bochicchio, J., Carneiro, M.O., Carter, S.L., Cibulskis, K., Erlich, R.L., et al. (2012). Medulloblastoma exome sequencing uncovers subtype-specific somatic mutations. Nature 488, 106–110.

Qin, J., Lin, Y., Norman, R.X., Ko, H.W., and Eggenschwiler, J.T. (2011). Intraflagellar transport protein 122 antagonizes Sonic Hedgehog signaling and controls ciliary localization of pathway components. Proc. Natl. Acad. Sci. 108, 1456–1461.

Raffel, C., Jenkins, R.B., Frederick, L., Hebrink, D., Alderete, B., Fults, D.W., and James, C.D. (1997). Sporadic medulloblastomas contain PTCH mutations. Cancer Res. 57, 842–845.

Rahimov, F., Ribeiro, L.A., de Miranda, E., Richieri-Costa, A., and Murray, J.C. (2006). GLI2 mutations in four Brazilian patients: How wide is the phenotypic spectrum? Am. J. Med. Genet. A. 140A, 2571–2576.

Rahnama, F., Toftgard, R., and Zaphiropoulos, P.G. (2004). Distinct roles of PTCH2 splice variants in Hedgehog signalling. Biochem. J. 378, 325–334.

Rahnama, F., Shimokawa, T., Lauth, M., Finta, C., Kogerman, P., Teglund, S., Toftgård, R., and Zaphiropoulos, P.G. (2006). Inhibition of GLI1 gene activation by Patched1. Biochem. J. 394, 19–26.

Regl, G., Kasper, M., Schnidar, H., Eichberger, T., Neill, G.W., Philpott, M.P., Esterbauer, H., Hauser-Kronberger, C., Frischauf, A.-M., and Aberger, F. (2004). Activation of the BCL2 promoter in response to Hedgehog/GLI signal transduction is predominantly mediated by GLI2. Cancer Res. 64, 7724–7731.

Reifenberger, J., Wolter, M., Weber, R.G., Megahed, M., Ruzicka, T., Lichter, P., and Reifenberger, G. (1998). Missense mutations in SMOH in sporadic basal cell carcinomas of the skin and primitive neuroectodermal tumors of the central nervous system. Cancer Res. 58, 1798– 1803.

Reifenberger, J., Wolter, M., Knobbe, C.B., Köhler, B., Schönicke, A., Scharwächter, C., Kumar, K., Blaschke, B., Ruzicka, T., and Reifenberger, G. (2005). Somatic mutations in the PTCH, SMOH, SUFUH and TP53 genes in sporadic basal cell carcinomas. Br. J. Dermatol. 152, 43–51.

Ribeiro, L.A., Murray, J.C., and Richieri-Costa, A. (2006). PTCH mutations in four Brazilian patients with holoprosencephaly and in one with holoprosencephaly-like features and normal MRI. Am. J. Med. Genet. A. 140A, 2584–2586.

De Rivoyre, M., Ruel, L., Varjosalo, M., Loubat, A., Bidet, M., Thérond, P., and Mus-Veteau, I. (2006). Human receptors patched and smoothened partially transduce hedgehog signal when expressed in Drosophila cells. J. Biol. Chem. 281, 28584–28595.

Robinson, G., Parker, M., Kranenburg, T.A., Lu, C., Chen, X., Ding, L., Phoenix, T.N., Hedlund, E., Wei, L., Zhu, X., et al. (2012). Novel mutations target distinct subgroups of medulloblastoma. Nature 488, 43–48.

Roessler, E., and Muenke, M. (2010). The molecular genetics of holoprosencephaly. Am. J. Med. Genet. C Semin. Med. Genet. 154C, 52–61.

Roessler, E., Du, Y.-Z., Mullor, J.L., Casas, E., Allen, W.P., Gillessen-Kaesbach, G., Roeder, E.R., Ming, J.E., Ruiz i Altaba, A., and Muenke, M. (2003). Loss-of-function mutations in the human GLI2 gene are associated with pituitary anomalies and holoprosencephaly-like features. Proc. Natl. Acad. Sci. U. S. A. 100, 13424–13429.

Roessler, E., El-Jaick, K.B., Dubourg, C., Vélez, J.I., Solomon, B.D., Pineda-Álvarez, D.E., Lacbawan, F., Zhou, N., Ouspenskaia, M., Paulussen, A., et al. (2009a). The mutational spectrum of holoprosencephaly-associated changes within the SHH gene in humans predicts loss-of-function through either key structural alterations of the ligand or its altered synthesis. Hum. Mutat.

Roessler, E., Ma, Y., Ouspenskaia, M.V., Lacbawan, F., Bendavid, C., Dubourg, C., Beachy, P.A., and Muenke, M. (2009b). Truncating loss-of-function mutations of DISP1 contribute to holoprosencephaly-like microform features in humans. Hum. Genet. 125, 393–400.

Rohatgi, R., Milenkovic, L., and Scott, M.P. (2007). Patched1 Regulates Hedgehog Signaling at the Primary Cilium. Science 317, 372–376.

Rohatgi, R., Milenkovic, L., Corcoran, R.B., and Scott, M.P. (2009). Hedgehog signal transduction by Smoothened: pharmacologic evidence for a 2-step activation process. Proc. Natl. Acad. Sci. U. S. A. 106, 3196–3201.

Romer, J.T., Kimura, H., Magdaleno, S., Sasai, K., Fuller, C., Baines, H., Connelly, M., Stewart, C.F., Gould, S., Rubin, L.L., et al. (2004). Suppression of the Shh pathway using a small molecule inhibitor eliminates medulloblastoma in Ptc1+/−p53−/− mice Cancer Cell 6, 229–240.

Ruiz-Perez, V.L., Ide, S.E., Strom, T.M., Lorenz, B., Wilson, D., Woods, K., King, L., Francomano, C., Freisinger, P., Spranger, S., et al. (2000). Mutations in a new gene in Ellis-van Creveld syndrome and Weyers acrodental dysostosis. Nat. Genet. 24, 283–286.

Ruiz-Perez, V.L., Blair, H.J., Rodriguez-Andres, M.E., Blanco, M.J., Wilson, A., Liu, Y.-N., Miles, C., Peters, H., and Goodship, J.A. (2007). Evc is a positive mediator of Ihh-regulated bone growth that localises at the base of chondrocyte cilia. Development 134, 2903–2912.

Ruppert, J.M., Kinzler, K.W., Wong, A.J., Bigner, S.H., Kao, F.T., Law, M.L., Seuanez, H.N., O’Brien S J and Vogelstein B (1988) The GLI-Kruppel family of human genes. Mol. Cell. Biol. 8, 3104–3113.

Rutkowski, S., von Hoff, K., Emser, A., Zwiener, I., Pietsch, T., Figarella-Branger, D., Giangaspero, F., Ellison, D.W., Garre, M.-L., Biassoni, V., et al. (2010). Survival and prognostic factors of early childhood medulloblastoma: an international meta-analysis. J. Clin. Oncol. Off. J. Am. Soc. Clin. Oncol. 28, 4961–4968.

Saksela K and Permi P (2 12) SH3 domain ligand binding: What’s the consensus and where’s the specificity? FEBS Lett 586, 2609–2614.

Sandilands, E., Cans, C., Fincham, V.J., Brunton, V.G., Mellor, H., Prendergast, G.C., Norman, J.C., Superti-Furga, G., and Frame, M.C. (2004). RhoB and Actin Polymerization Coordinate Src Activation with Endosome-Mediated Delivery to the Membrane. Dev. Cell 7, 855–869.

Sandilands, E., Akbarzadeh, S., Vecchione, A., McEwan, D.G., Frame, M.C., and Heath, J.K. (2007). Src kinase modulates the activation, transport and signalling dynamics of fibroblast growth factor receptors. EMBO Rep. 8, 1162–1169.

Sasaki, H., Hui, C., Nakafuku, M., and Kondoh, H. (1997). A binding site for Gli proteins is essential for HNF-3beta floor plate enhancer activity in transgenics and can respond to Shh in vitro. Dev. Camb. Engl. 124, 1313–1322.

Sasaki, H., Nishizaki, Y., Hui, C., Nakafuku, M., and Kondoh, H. (1999). Regulation of Gli2 and Gli3 activities by an amino-terminal repression domain: implication of Gli2 and Gli3 as primary mediators of Shh signaling. Dev. Camb. Engl. 126, 3915–3924.

Seppala, M., Depew, M.J., Martinelli, D.C., Fan, C.-M., Sharpe, P.T., and Cobourne, M.T. (2007). Gas1 is a modifier for holoprosencephaly and genetically interacts with sonic hedgehog. J. Clin. Invest. 117, 1575–1584.

Seto, M., Ohta, M., Asaoka, Y., Ikenoue, T., Tada, M., Miyabayashi, K., Mohri, D., Tanaka, Y., Ijichi, H., Tateishi, K., et al. (2009). Regulation of the hedgehog signaling by the mitogen- activated protein kinase cascade in gastric cancer. Mol. Carcinog. 48, 703–712.

Shimokawa, T., Rahnama, F., and Zaphiropoulos, P.G. (2004). A novel first exon of the Patched1 gene is upregulated by Hedgehog signaling resulting in a protein with pathway inhibitory functions. FEBS Lett. 578, 157–162.

Shimokawa, T., Svärd, J., Heby-Henricson, K., Teglund, S., Toftgård, R., and Zaphiropoulos, P.G. (2007). Distinct roles of first exon variants of the tumor-suppressor Patched1 in Hedgehog signaling. Oncogene 26, 4889–4896.

Silva, C.M. (2004). Role of STATs as downstream signal transducers in Src family kinase- mediated tumorigenesis. Oncogene 23, 8017–8023.

Smyth, I., Narang, M.A., Evans, T., Heimann, C., Nakamura, Y., Chenevix-Trench, G., Pietsch, T., Wicking, C., and Wainwright, B.J. (1999). Isolation and characterization of human patched 2 (PTCH2), a putative tumour suppressor gene inbasal cell carcinoma and medulloblastoma on chromosome 1p32. Hum. Mol. Genet. 8, 291–297.

Songyang, Z., Shoelson, S.E., Chaudhuri, M., Gish, G., Pawson, T., Haser, W.G., King, F., Roberts, T., Ratnofsky, S., and Lechleider, R.J. (1993). SH2 domains recognize specific phosphopeptide sequences. Cell 72, 767–778.

Songyang, Z., Carraway, K.L., 3rd, Eck, M.J., Harrison, S.C., Feldman, R.A., Mohammadi, M., Schlessinger, J., Hubbard, S.R., Smith, D.P., and Eng, C. (1995). Catalytic specificity of protein- tyrosine kinases is critical for selective signalling. Nature 373, 536–539.

Spoelgen, R., Hammes, A., Anzenberger, U., Zechner, D., Andersen, O.M., Jerchow, B., and Willnow, T.E. (2005). LRP2/megalin is required for patterning of the ventral telencephalon. Development 132, 405–414.

Stehelin, D., Varmus, H.E., Bishop, J.M., and Vogt, P.K. (1976). DNA related to the transforming gene(s) of avian sarcoma viruses is present in normal avian DNA. Nature 260, 170– 173.

Stone, D.M., Hynes, M., Armanini, M., Swanson, T.A., Gu, Q., Johnson, R.L., Scott, M.P., Pennica, D., Goddard, A., Phillips, H., et al. (1996). The tumour-suppressor gene patched encodes a candidate receptor for Sonic hedgehog. Nature 384, 129–134.

Strutt, H., Thomas, C., Nakano, Y., Stark, D., Neave, B., Taylor, A.M., and Ingham, P.W. (2001). Mutations in the sterol-sensing domain of Patched suggest a role for vesicular trafficking in Smoothened regulation. Curr. Biol. 11, 608–613.

Suzuki, T. (2013). How is digit identity determined during limb development? Dev. Growth Differ. 55, 130–138.

Svard, J., Rozell, B., Toftgard, R., and Teglund, S. (2009). Tumor suppressor gene co-operativity in compound Patched1 and Suppressor of fused heterozygous mutant mice. Mol. Carcinog. 48, 408–419.

Svärd, J., Heby-Henricson, K., Henricson, K.H., Persson-Lek, M., Rozell, B., Lauth, M., Bergström, A., Ericson, J., Toftgård, R., and Teglund, S. (2006). Genetic elimination of Suppressor of fused reveals an essential repressor function in the mammalian Hedgehog signaling pathway. Dev. Cell 10, 187–197.

Sweet, H.O., Bronson, R.T., Donahue, L.R., and Davisson, M.T. (1996). Mesenchymal dysplasia: a recessive mutation on chromosome 13 of the mouse. J. Hered. 87, 87–95.

Taipale, J., Chen, J.K., Cooper, M.K., Wang, B., Mann, R.K., Milenkovic, L., Scott, M.P., and Beachy, P.A. (2000). Effects of oncogenic mutations in Smoothened and Patched can be reversed by cyclopamine. Nature 406, 1005–1009.

Taipale, J., Cooper, M.K., Maiti, T., and Beachy, P.A. (2002). Patched acts catalytically to suppress the activity of Smoothened. Nature 418, 892–896.

Takeya, T., and Hanafusa, H. (1982). DNA sequence of the viral and cellular src gene of chickens. II. Comparison of the src genes of two strains of avian sarcoma virus and of the cellular homolog. J. Virol. 44, 12–18.

Tang, J.Y., Xiao, T.Z., Oda, Y., Chang, K.S., Shpall, E., Wu, A., So, P.-L., Hebert, J., Bikle, D., and Epstein, E.H. (2011). Vitamin D3 Inhibits Hedgehog Signaling and Proliferation in Murine Basal Cell Carcinomas. Cancer Prev. Res. Phila. Pa 4, 744–751.

Taschner, M., Bhogaraju, S., and Lorentzen, E. (2012). Architecture and function of IFT complex proteins in ciliogenesis. Differentiation 83, S12–S22.

Taylor, F.R., Wen, D., Garber, E.A., Carmillo, A.N., Baker, D.P., Arduini, R.M., Williams, K.P., Weinreb, P.H., Rayhorn, P., Hronowski, X., et al. (2001). Enhanced Potency of Human Sonic Hedgehog by Hydrophobic Modification. Biochemistry (Mosc.) 40, 4359–4371.

Taylor, M.D., Liu, L., Raffel, C., Hui, C., Mainprize, T.G., Zhang, X., Agatep, R., Chiappa, S., Gao, L., Lowrance, A., et al. (2002). Mutations in SUFU predispose to medulloblastoma. Nat. Genet. 31, 306–310.

Teh, M.-T., Wong, S.-T., Neill, G.W., Ghali, L.R., Philpott, M.P., and Quinn, A.G. (2002). FOXM1 Is a Downstream Target of Gli1 in Basal Cell Carcinomas. Cancer Res. 62, 4773–4780.

Tempe, D., Casas, M., Karaz, S., Blanchet-Tournier, M.-F., and Concordet, J.-P. (2006). Multisite Protein Kinase A and Glycogen Synthase Kinase 3? Phosphorylation Leads to Gli3 Ubiquitination by SCFβTrCP ol Cell Biol 26, 4316–4326.

Tenzen, T., Allen, B.L., Cole, F., Kang, J.-S., Krauss, R.S., and McMahon, A.P. (2006). The cell surface membrane proteins Cdo and Boc are components and targets of the Hedgehog signaling pathway and feedback network in mice. Dev. Cell 10, 647–656.

Thibert, C., Teillet, M.-A., Lapointe, F., Mazelin, L., Douarin, N.M.L., and Mehlen, P. (2003). Inhibition of Neuroepithelial Patched-Induced Apoptosis by Sonic Hedgehog. Science 301, 843– 846.

Traiffort, E., Dubourg, C., Faure, H., Rognan, D., Odent, S., Durou, M.-R., David, V., and Ruat, M. (2004). Functional characterization of sonic hedgehog mutations associated with holoprosencephaly. J. Biol. Chem. 279, 42889–42897.

Tsai, M.-T., Cheng, C.-J., Lin, Y.-C., Chen, C.-C., Wu, A.-R., Wu, M.-T., Hsu, C.-C., and Yang, R.-B. (2009). Isolation and characterization of a secreted, cell-surface glycoprotein SCUBE2 from humans. Biochem. J. 422, 119–128.

Tseng, T.T., Gratwick, K.S., Kollman, J., Park, D., Nies, D.H., Goffeau, A., and Saier, M.H., Jr (1999). The RND permease superfamily: an ancient, ubiquitous and diverse family that includes human disease and development proteins. J. Mol. Microbiol. Biotechnol. 1, 107–125.

Tukachinsky, H., Lopez, L.V., and Salic, A. (2010). A mechanism for vertebrate Hedgehog signaling: recruitment to cilia and dissociation of SuFu-Gli protein complexes. J. Cell Biol. 191, 415–428.

Tukachinsky, H., Kuzmickas, R.P., Jao, C.Y., Liu, J., and Salic, A. (2012). Dispatched and scube mediate the efficient secretion of the cholesterol-modified hedgehog ligand. Cell Reports 2, 308– 320.

Tuson, M., He, M., and Anderson, K.V. (2011). Protein kinase A acts at the basal body of the primary cilium to prevent Gli2 activation and ventralization of the mouse neural tube. Development 138, 4921–4930.

Uchikawa, H., Toyoda, M., Nagao, K., Miyauchi, H., Nishikawa, R., Fujii, K., Kohno, Y., Yamada, M., and Miyashita, T. (2006). Brain- and heart-specific Patched-1 containing exon 12b is a dominant negative isoform and is expressed in medulloblastomas. Biochem. Biophys. Res. Commun. 349, 277–283.

Uhmann, A., Niemann, H., Lammering, B., Henkel, C., Heß, I., Nitzki, F., Fritsch, A., Prüfer, N., Rosenberger, A., Dullin, C., et al. (2011). Antitumoral Effects of Calcitriol in Basal Cell Carcinomas Involve Inhibition of Hedgehog Signaling and Induction of Vitamin D Receptor Signaling and Differentiation. Mol. Cancer Ther. 10, 2179–2188.

Unden, A.B., Holmberg, E., Lundh-Rozell, B., Stähle-Bäckdahl, M., Zaphiropoulos, P.G., Toftgård, R., and Vorechovsky, I. (1996). Mutations in the human homologue of Drosophila patched (PTCH) in basal cell carcinomas and the Gorlin syndrome: different in vivo mechanisms of PTCH inactivation. Cancer Res. 56, 4562–4565.

Undén, A.B., Zaphiropoulos, P.G., Bruce, K., Toftgård, R., and Ståhle-Bäckdahl, M. (1997). Human patched (PTCH) mRNA is overexpressed consistently in tumor cells of both familial and sporadic basal cell carcinoma. Cancer Res. 57, 2336–2340.

Vaillant, C., and Monard, D. (2009). SHH pathway and cerebellar development. Cerebellum Lond. Engl. 8, 291–301.

Varjosalo, M., Li, S.-P., and Taipale, J. (2006). Divergence of hedgehog signal transduction mechanism between Drosophila and mammals. Dev. Cell 10, 177–186.

Villani, R.M., Adolphe, C., Palmer, J., Waters, M.J., and Wainwright, B.J. (2010). Patched1 inhibits epidermal progenitor cell expansion and basal cell carcinoma formation by limiting Igfbp2 activity. Cancer Prev. Res. Phila. Pa 3, 1222–1234.

Wakabayashi, Y., Mao, J.-H., Brown, K., Girardi, M., and Balmain, A. (2007). Promotion of Hras-induced squamous carcinomas by a polymorphic variant of the Patched gene in FVB mice. Nature 445, 761–765.

Waksman, G., Kominos, D., Robertson, S.C., Pant, N., Baltimore, D., Birge, R.B., Cowburn, D., Hanafusa, H., Mayer, B.J., Overduin, M., et al. (1992). Crystal structure of the phosphotyrosine recognition domain SH2 of v-src complexed with tyrosine-phosphorylated peptides. Nature 358, 646–653.

Walling, H.W., Fosko, S.W., Geraminejad, P.A., Whitaker, D.C., and Arpey, C.J. (2004). Aggressive basal cell carcinoma: presentation, pathogenesis, and management. Cancer Metastasis Rev. 23, 389–402.

Wang, B., and Li, Y. (2006). Evidence for the direct involvement of βTrCP in Gli3 protein processing. Proc. Natl. Acad. Sci. U. S. A. 103, 33–38.

Wang, B., Fallon, J.F., and Beachy, P.A. (2000). Hedgehog-Regulated Processing of Gli3 Produces an Anterior/Posterior Repressor Gradient in the Developing Vertebrate Limb. Cell 100, 423–434.

Wang, C., Pan, Y., and Wang, B. (2010). Suppressor of fused and Spop regulate the stability, processing and function of Gli2 and Gli3 full-length activators but not their repressors. Dev. Camb. Engl. 137, 2001–2009.

Wang, G.Y., Wang, J., Mancianti, M.-L., and Epstein Jr., E.H. (2011). Basal Cell Carcinomas Arise from Hair Follicle Stem Cells in Ptch1+/− ice Cancer Cell 19, 114–124.

Wang, Y., Zhou, Z., Walsh, C.T., and McMahon, A.P. (2009). Selective translocation of intracellular Smoothened to the primary cilium in response to Hedgehog pathway modulation. Proc. Natl. Acad. Sci. U. S. A. 106, 2623–2628.

Wassif, C.A., Maslen, C., Kachilele-Linjewile, S., Lin, D., Linck, L.M., Connor, W.E., Steiner, R.D., and Porter, F.D. (1998). Mutations in the human sterol delta7-reductase gene at 11q12-13 cause Smith-Lemli-Opitz syndrome. Am. J. Hum. Genet. 63, 55–62.

Waterham, H.R., Koster, J., Romeijn, G.J., Hennekam, R.C., Vreken, P., Andersson, H.C., FitzPatrick, D.R., Kelley, R.I., and Wanders, R.J. (2001). Mutations in the 3beta-hydroxysterol Delta24-reductase gene cause desmosterolosis, an autosomal recessive disorder of cholesterol biosynthesis. Am. J. Hum. Genet. 69, 685–694.

Watkin, H., Richert, M.M., Lewis, A., Terrell, K., McManaman, J.P., and Anderson, S.M. (2008). Lactation failure in Src knockout mice is due to impaired secretory activation. BMC Dev. Biol. 8, 6.

Webster, M.A., Cardiff, R.D., and Muller, W.J. (1995). Induction of mammary epithelial hyperplasias and mammary tumors in transgenic mice expressing a murine mammary tumor virus/activated c-src fusion gene. Proc. Natl. Acad. Sci. U. S. A. 92, 7849–7853.

Te Welscher, P., Zuniga, A., Kuijper, S., Drenth, T., Goedemans, H.J., Meijlink, F., and Zeller, R. (2002). Progression of vertebrate limb development through SHH-mediated counteraction of GLI3. Science 298, 827–830.

Wen, X., Lai, C.K., Evangelista, M., Hongo, J.-A., de Sauvage, F.J., and Scales, S.J. (2010). Kinetics of hedgehog-dependent full-length Gli3 accumulation in primary cilia and subsequent degradation. Mol. Cell. Biol. 30, 1910–1922.

Westover, E.J., Covey, D.F., Brockman, H.L., Brown, R.E., and Pike, L.J. (2003). Cholesterol depletion results in site-specific increases in epidermal growth factor receptor phosphorylation due to membrane level effects. Studies with cholesterol enantiomers. J. Biol. Chem. 278, 51125– 51133.

Wetmore, C., Eberhart, D.E., and Curran, T. (2000). The normal patched allele is expressed in medulloblastomas from mice with heterozygous germ-line mutation of patched. Cancer Res. 60, 2239–2246.

Wetmore, C., Eberhart, D.E., and Curran, T. (2001). Loss of p53 but not ARF Accelerates Medulloblastoma in Mice Heterozygous for patched. Cancer Res. 61, 513–516.

Wheeler, D.L., Iida, M., and Dunn, E.F. (2009). The Role of Src in Solid Tumors. Oncologist 14, 667–678.

Wicking, C., Shanley, S., Smyth, I., Gillies, S., Negus, K., Graham, S., Suthers, G., Haites, N., Edwards, M., Wainwright, B., et al. (1997). Most germ-line mutations in the nevoid basal cell carcinoma syndrome lead to a premature termination of the PATCHED protein, and no genotype-phenotype correlations are evident. Am. J. Hum. Genet. 60, 21–26.

Wijgerde, M., McMahon, J.A., Rule, M., and McMahon, A.P. (2002). A direct requirement for Hedgehog signaling for normal specification of all ventral progenitor domains in the presumptive mammalian spinal cord. Genes Dev. 16, 2849–2864.

Willnow, T.E., Hilpert, J., Armstrong, S.A., Rohlmann, A., Hammer, R.E., Burns, D.K., and Herz, J. (1996). Defective forebrain development in mice lacking gp330/megalin. Proc. Natl. Acad. Sci. 93, 8460–8464.

Wilson, C.W., Chen, M.-H., and Chuang, P.-T. (2009). Smoothened adopts multiple active and inactive conformations capable of trafficking to the primary cilium. PloS One 4, e5182.

Wolter, M., Reifenberger, J., Sommer, C., Ruzicka, T., and Reifenberger, G. (1997). Mutations in the human homologue of the Drosophila segment polarity gene patched (PTCH) in sporadic basal cell carcinomas of the skin and primitive neuroectodermal tumors of the central nervous system. Cancer Res. 57, 2581–2585.

Wong, S.Y., and Reiter, J.F. (2011). Wounding mobilizes hair follicle stem cells to form tumors. Proc. Natl. Acad. Sci. U. S. A.

Wong, C.S.M., Strange, R.C., and Lear, J.T. (2003). Basal cell carcinoma. BMJ 327, 794–798.

Woods, I.G., and Talbot, W.S. (2005). The you gene encodes an EGF-CUB protein essential for Hedgehog signaling in zebrafish. PLoS Biol. 3, e66.

Wu, V.M., Chen, S.C., Arkin, M.R., and Reiter, J.F. (2012). Small molecule inhibitors of Smoothened ciliary localization and ciliogenesis. Proc. Natl. Acad. Sci. U. S. A. 109, 13644– 13649.

Xie, J., Murone, M., Luoh, S.M., Ryan, A., Gu, Q., Zhang, C., Bonifas, J.M., Lam, C.W., Hynes, M., Goddard, A., et al. (1998). Activating Smoothened mutations in sporadic basal-cell carcinoma. Nature 391, 90–92.

Xue, Y., Liu, Z., Cao, J., Ma, Q., Gao, X., Wang, Q., Jin, C., Zhou, Y., Wen, L., and Ren, J. (2011). GPS 2.1: enhanced prediction of kinase-specific phosphorylation sites with an algorithm of motif length selection. Protein Eng. Des. Sel. PEDS 24, 255–260.

Yam, P.T., Langlois, S.D., Morin, S., and Charron, F. (2009). Sonic hedgehog guides axons through a noncanonical, Src-family-kinase-dependent signaling pathway. Neuron 62, 349–362.

Yang, C., Chen, W., Chen, Y., and Jiang, J. (2012). Smoothened transduces Hedgehog signal by forming a complex with Evc/Evc2. Cell Res. 22, 1593–1604.

Yang, Z.-J., Ellis, T., Markant, S.L., Read, T.-A., Kessler, J.D., Bourboulas, M., Schüller, U., Machold, R., Fishell, G., Rowitch, D.H., et al. (2008). Medulloblastoma can be initiated by deletion of Patched in lineage-restricted progenitors or stem cells. Cancer Cell 14, 135–145.

Yoon, J.W., Kita, Y., Frank, D.J., Majewski, R.R., Konicek, B.A., Nobrega, M.A., Jacob, H., Walterhouse, D., and Iannaccone, P. (2002). Gene expression profiling leads to identification of GLI1-binding elements in target genes and a role for multiple downstream pathways in GLI1- induced cell transformation. J. Biol. Chem. 277, 5548–5555.

Yoon, J.W., Gallant, M., Lamm, M.L., Iannaccone, S., Vieux, K.-F., Proytcheva, M., Hyjek, E., Iannaccone, P., and Walterhouse, D. (2013). Noncanonical Regulation of the Hedgehog Mediator GLI1 by c-MYC in Burkitt Lymphoma. Mol. Cancer Res. 11, 604–615.

Youssef, K.K., Van Keymeulen, A., Lapouge, G., Beck, B., Michaux, C., Achouri, Y., Sotiropoulou, P.A., and Blanpain, C. (2010). Identification of the cell lineage at the origin of basal cell carcinoma. Nat. Cell Biol. 12, 299–305.

Yu, H., Chen, J.K., Feng, S., Dalgarno, D.C., Brauer, A.W., and Schreiber, S.L. (1994). Structural basis for the binding of proline-rich peptides to SH3 domains. Cell 76, 933–945.

Zeng, H., Jia, J., and Liu, A. (2010). Coordinated translocation of mammalian Gli proteins and suppressor of fused to the primary cilium. PLoS ONE 5, e15900.

Zhang, Q., Seo, S., Bugge, K., Stone, E.M., and Sheffield, V.C. (2012). BBS proteins interact genetically with the IFT pathway to influence SHH-related phenotypes. Hum. Mol. Genet. 21, 1945–1953.

Zhang, W., Kang, J.-S., Cole, F., Yi, M.-J., and Krauss, R.S. (2006). Cdo functions at multiple points in the Sonic Hedgehog pathway, and Cdo-deficient mice accurately model human holoprosencephaly. Dev. Cell 10, 657–665.

Zhang, W., Hong, M., Bae, G., Kang, J.-S., and Krauss, R.S. (2011). Boc modifies the holoprosencephaly spectrum of Cdo mutant mice. Dis. Model. Mech. 4, 368–380.

Zhang, X., Harrington, N., Moraes, R.C., Wu, M.-F., Hilsenbeck, S.G., and Lewis, M.T. (2009). Cyclopamine inhibition of human breast cancer cell growth independent of Smoothened (Smo). Breast Cancer Res. Treat. 115, 505–521.

Zhang, X.M., Ramalho-Santos, M., and McMahon, A.P. (2001). Smoothened mutants reveal redundant roles for Shh and Ihh signaling including regulation of L/R symmetry by the mouse node. Cell 106, 781–792.

Zhao, Y., Tong, C., and Jiang, J. (2007). Hedgehog regulates smoothened activity by inducing a conformational switch. Nature 450, 252–258.

Zhou, X., Liu, Z., Jang, F., Xiang, C., Li, Y., and He, Y. (2012). Autocrine Sonic Hedgehog Attenuates Inflammation in Cerulein-Induced Acute Pancreatitis in Mice via Upregulation of IL- 10. PLoS ONE 7, e44121.

Zibat, A., Uhmann, A., Nitzki, F., Wijgerde, M., Frommhold, A., Heller, T., Armstrong, V., Wojnowski, L., Quintanilla-Martinez, L., Reifenberger, J., et al. (2009). Time-point and dosage of gene inactivation determine the tumor spectrum in conditional Ptch knockouts. Carcinogenesis 30, 918–926.

Zurawel, R.H., Allen, C., Chiappa, S., Cato, W., Biegel, J., Cogen, P., de Sauvage, F., and Raffel, C. (2000a). Analysis of PTCH/SMO/SHH pathway genes in medulloblastoma. Genes. Chromosomes Cancer 27, 44–51.

Zurawel, R.H., Allen, C., Wechsler-Reya, R., Scott, M.P., and Raffel, C. (2000b). Evidence that haploinsufficiency of Ptch leads to medulloblastoma in mice. Genes. Chromosomes Cancer 28, 77–81.