Deoxyguanosine Triphosphate Analogue Inhibitors of HIV Reverse Transcriptase with Human Mitochondrial DNA Polymerase Γ

Anderson 16/2/07 15:13 Page 25

Antiviral Chemistry & Chemotherapy 18:25–33 Interaction of 2′-deoxyguanosine triphosphate analogue inhibitors of HIV reverse transcriptase with human mitochondrial DNA polymerase γ

Adrian S Ray1†, Joy Y Feng1‡, Eisuke Murakami1§, Chung K Chu2, Raymond F Schinazi3 and Karen S Anderson1*

1Department of Pharmacology, Yale University School of Medicine, New Haven, CT, USA 2Department of Pharmacology and Biomedical Sciences, College of Pharmacy, The University of Georgia, Athens, GA, USA 3Laboratory of Biochemical Pharmacology, Emory University/Veterans Affairs Medical Center, Decatur, GA USA †Current address: Gilead Sciences Inc., Foster City, CA, USA ‡Current address: Gilead Sciences Inc., Durham, NC, USA §Current address: Pharmasset Inc., Princeton, NJ, USA

*Corresponding author: Tel: +1 203 785 4526; Fax: +1 203 785 7670; E-mail: [email protected]

Mitochondrial toxicity is a limiting factor in the use transcriptase showed CBV-TP to be approximately of some nucleoside reverse transcriptase inhibitors 800–8,000-fold more selective for its antiviral target of HIV. To further understand the impact of struc- over pol γ relative to the other guanosine analogues. tural features on the incorporation and exonuclease However, DXG-TP and d4G-TP were found to be removal of nucleoside monophosphate (MP) much more selective than previously reported analogues by human mitochondrial DNA poly- values for mitochondrial toxic nucleoside analogues. merase (pol γ), transient kinetic studies were done Structural modelling based on sequence homology with analogues of 2′-deoxyguanosine triphosphate. with other polymerase A family members suggests The kinetic parameters for the incorporation and that an interaction between the ribose oxygen and removal of carbovir (CBV)-MP, dioxolane guanosine arginine 853 in pol γ may play a critical role in (DXG)-MP and 2′,3′-dideoxy-2′,3′-didehydroguano- causing this differential incorporation. Exonuclease sine (d4G)-MP were studied with pol γ holoenzyme. removal of a chain-terminating CBV-MP was also The importance of the ribose oxygen in incorpora- found to be more efficient by pol γ. These results tion by pol γ was illustrated by an approximate help to further elucidate the structure activity rela- 3,000-fold decrease in the incorporation efficiency tionships for pol γ and should aid in the design of of an analogue lacking the ribose oxygen (CBV-TP) more selective antiviral agents. relative to those containing a ribose oxygen (DXG- TP and d4G-TP). As a result, a comparison with Keywords: abacavir, cyclo-d4G, DAPD, HIV, mito- previous data for the incorporation by HIV reverse chondrial DNA polymerase γ

Introduction

Despite the success of antiviral therapies at decreasing the triphosphate (d4G-TP, structures shown in Figure 1) have morbidity and mortality associated with HIV infection, been found to be potent inhibitors of HIV reverse transcrip- antiviral treatment is still limited by drug interactions (Back tase (RT; White et al., 1989; Ray et al., 2002b; Jeffrey et al., et al., 2005; Ray, 2005), development of resistance (Larder, 2003). To improve pharmacokinetic parameters, six substi- 1995; Naeger & Miller, 2001; Ray et al., 2002b) and toxic side tuted prodrugs of the nucleoside forms of these analogues effects (Nolan & Mallal, 2004). Mitochondrial toxicity has have been explored as drug candidates (Daluge et al., 1997; been identified as a key mediator of many unwanted side Furman et al., 2001; Ray et al., 2002a). Abacavir ((-)- effects associated with nucleoside/ tide reverse transcriptase (1S,4R)-4-[2-amino-6-(cyclopropylamino)-9H-purin-9- inhibitors (NRTIs; Parker & Cheng, 1994; White, 2001). yl]-2-cyclopentene-1-methanol; Ziagen®), DAPD The 2′-deoxyguanosine triphosphate (dGTP) ((-)-β-D-2,6-diaminopurine dioxolane or (2R,4R)-4-(2,6- nucleotide analogues carbovir-triphosphate (CBV-TP), diamino-9H-purin-9-yl)-1,3-dioxolan-2-yl)methanol; dioxolane guanosine ((2R,4R)-4-(2-amino-6-oxo-9H- Amdoxovir®) and cyclo-d4G (9-amino-6-cycloporpy- purin-9-yl)-1,3-dioxolan-2-yl)methanol)-triphosphate; lamino-(9)-(2,3-dideoxy-β-D-glycero-pent-2-enofuranosyl) DXG-TP) and 2′3′-dideoxy-2′,3′-didehydro guanosine- purine) are dependent on deamination as part of the meta-

AS Ray et al.

Figure 1. Structures of dGTP and its analogues An important part of predicting the toxicity profile of potential NRTI drug candidates is by assessing their A O interaction with pol γ. Furthermore, building structure N NH activity relationships for modified nucleotide analogues with pol γ may help in the design of less toxic and more O NH specific inhibitors of HIV RT and other viral poly- O O O NN 2 merases. Here, we used in depth kinetic analyses with P P O P O - O purified pol γ holoenzyme to study the interaction of O - O- O- O HO three dGTP analogue inhibitors of HIV RT with the pol γ polymerase and exonuclease active sites. We also B O employed molecular modelling based upon sequence homology and the known crystal structures of other poly- N NH merases in the same family as pol γ to provide a structural O NH insight into our biochemical data. O O R NN 2 P P O P O - O Materials and methods O - O- O- O Reagents C O dGTP was purchased from Amersham Biosciences 32 N NH (Pittsburgh, PA, USA). Redivue [g- P]ATP was obtained from Amersham Biosciences. d4G-TP and DXG-TP were O NH synthesized as previously described (Furman et al., 2001; Ray O O O NN 2 et al., 2002b). Oligonucleotides used as primers and templates P P O P O - O were obtained from the Keck DNA synthesis facility at O O- O- O O- Yale University and purified using 20% polyacrylamide denaturing gel electrophoresis. (A) 2′-Deoxyguanosine triphosphate (dGTP); (B) 2′3′-dideoxy-2′,3′- didehydroguanosine-triphosphate (d4G-TP; R=O), carbovir-triphosphate (CBV-TP; R=CH ); (C) (2R,4R)-4-(2-amino-6-oxo-9H-purin-9-yl)- 2 Purification of pol and its accessory subunit. 1,3-dioxolan-2-yl)methanol)-triphosphate (DXG-TP). γ Wild-type and exonuclease-deficient pol γ catalytic subunits were expressed using a baculovirus expression system in insect Sf9 cells essentially as previously bolic processes involved in the formation of their respective described (Graves et al., 1998). An accessory subunit to biologically active dGTP analogue species (Faletto et al., pol γ has been identified (Wang et al., 1997) and shown 1997; Furman et al., 2001; Ray et al., 2005). Abacavir has to markedly alter the kinetics of incorporation. Over- received approval by the U.S. Food and Drug expression of the accessory subunit of pol γ was carried Administration as part of current anti-HIV treatment regi- out as described (Carrodeguas et al., 1999; Johnson et al., mens, and DAPD has been the subject of several clinical 2000). The holoenzyme was reconstituted by incubating trials and is currently in Phase IIb. a 1:5 mixture of the catalytic and accessory subunits A good correlation between incorporation by the human (between 50–100 nM and 250–500 nM, respectively) on mitochondrial polymerase γ (pol γ) in enzymatic assays ice for 10 min. ( Johnson et al., 2001; Lim & Copeland, 2001; Lee et al., 2003) and depletion of mitochondrial DNA in in vitro DNA prime-templates whole-cell systems (Martin et al., 1997; Birkus et al., 2002; Studies were done using the following 30-mer DNA primer Ray et al., 2002a; Ray et al., 2005) has been observed for and 45-mer DNA template: 5′-GCCTCGCAGCCGTC- most NRTIs. Due to the difficulty in purifying the large CAACCAACTCAACCTC-3′ and 3′-CGGAGCGTCG- quantities of pol γ needed for structural elucidation, our GCAGGTTGGTTGAGTTGGAGCTAGGTTACGGC understanding of its active site is limited to the following: AGG-5′ (i) analysis of sequence homology with other polymerase A The dCMP templating dGMP incorporation is high- (pol A) family members, (ii) mutagenesis and (iii) the struc- lighted in bold italics. The 5′-end of the primer was radio- ture activity relationships for the incorporation of alternative labelled using T4 polynucleotide kinase (obtained from substrates. A better understanding of pol γ interaction with New England Biolabs, Ipswich, MA, USA) and [g- alternate nucleotide substrates is needed to aid in the design 32P]ATP as previously described (Kati et al., 1992). The of antiviral therapies with improved toxicity profiles. primer/template was annealed by adding a 1:1.4 molar ratio

Incorporation of guanosine analogues by pol γ

of radiolabelled D30-mer primer to D45-mer template at steady-state conditions with 1.5 μM primer/template and 90˚C for 5 min, at 50˚C for 10 min and in ice for 10 min. 20 nM enzyme. Exonuclease reactions were stopped by the Complete annealing was verified by analysing an aliquot of addition of 0.3 mM EDTA. The D31-mer substrate and the annealed material on a 15% non-denaturing polyacry- D30-mer product were then separated, and quantitated by lamide gel to insure complete annealing. For studying gel electrophoresis and phosphorimaging as described for exonuclease removal, primers were generated containing a the polymerase reaction. 3′-terminal DXG-monophosphate (MP) or d4G-MP as previously described ( Johnson et al., 2001) using exo– poly- Sequence alignment and structural analysis merase γ holoenzyme and standard reaction conditions Sequences of members of the pol A family including pol γ (described below). For comparison, a D31-mer primer was from distant organisms were obtained from the ExPASy synthesized with a terminal dGMP to study the removal of proteomic server (http://npsa-pbil.ibcp.fr/cgi-bin/ a natural nucleotide. npsa_automat.pl?page=npsa_prosite.html). Dual and multiple protein sequence alignments were done using the Pre-steady-state kinetic incorporation assays SIM alignment tool (Swiss Institute of Bioinformatics; Incorporation studies were done with either the wild-type available from http://au.expasy.org/tools/sim-prot.html) or exonuclease-deficient holoenzyme. The exonuclease- and DIALIGN on the Bielefeld University Bioinformatics deficient enzyme has been shown to be kinetically Server (available from http://bibiserv.techfak.uni-bielefeld. similar during the polymerase reaction to wild type de/dialign/submission.html), respectively. Structural ( Johnson et al., 2001) and can be used to simplify kinetic analysis of the pol A family active site was done for residues observations when slow incorporation rates are encoun- with observed sequence homology using the structure of tered. Pre-steady-state kinetics were performed using a the ternary complex of T7 DNA polymerase with primer- KinTek Corporation (Austin, TX, USA) model RQF-3 template and ddGTP (Doublie & Ellenberger, 1998). rapid-quench-flow apparatus essentially as previously Structural features were viewed using Swiss PDB Viewer described ( Johnson et al., 2001). Incorporation studies (GlaxoSmithKline & Swiss Institute of Bioinformatics; were done at 37˚C in buffer containing 50 mM Tris-Cl available from http://www.expasy.org/spdbv/) and images

(pH 7.5), 100 mM NaCl and 2.5 mM MgCl2. Either generated using Mega-Pov (Persistence of Vision Raytracer pre-steady-state burst or single turnover conditions were Pty. Ltd; available from www.povray.org). used to determine the incorporation of DXG-MP or d4G-MP into the D30-mer/D45-mer primer/template. Data analysis Pre-steady-state burst experiments were done with a Data from incorporation experiments were fit by non-linear fivefold excess of D30-mer/D45-mer (250 nM final) to regression using the program KaleidaGraph (Synergy pol γ holoenzyme (50 nM final). Single-turnover condi- Software, Reading, PA, USA). The observed first-order rate

tions were done using pol γ holoenzyme concentrations constants for incorporation (kobsd) at different nucleotide of 100 nM and 90 nM D30-mer/D45-mer. Reactions concentration were determined using the equation [D31-

were initiated by rapidly mixing a solution of nucleotide mer] = A[1-exp(-kobsdt)] for single-turnover experiments.

and magnesium with pol γ and primer/template. The kobsd and steady-state rate (kss) of nucleotide incorpora- Reactions were quenched at desired times by the addition tion were determined from pre-steady-state burst experi-

of 0.3 mM ethylenediaminetetraacetic acid (EDTA). ments using the equations [D31-mer] = A[1-exp(-kobsdt) +

Elongated primer was separated from the substrate by ksst]. In these equations, A represents the amplitude of 15% polyacrylamide sequencing gels and quantitated using product formation and t equals time. The observed first- a BioRad Laboratories (Hercules, CA, USA) GS525 order rate constants for each nucleotide at different concen- phosphorimager and Molecular Analyst software. trations were then used to determine the maximum rate of

incorporation (kpol) and the dissociation constant for the

Studies of the exonuclease removal of terminal nucleotide (Kd) by fitting the data to the hyperbolic equa-

dGMP and its analogues tion kobsd = (kpol[dNTP])/(Kd + [dNTP]). The efficiency of

The exonuclease removal of a D31-mer primer containing incorporation was calculated by dividing kpol by Kd. The a 3′-terminal dGMP, DXG-MP or d4G-MP was studied selectivity of the enzyme for the natural dGTP substrate by mixing the different D31-mer/D45-mer primer/ over the analogue was calculated by comparing the effi- templates and pol γ holoenzyme with a solution of ciency of incorporation of dGTP with that of the analogue

2.5 mM magnesium at 37˚C in the presence of 50 mM (selectivity = efficiencydGTP/efficiencyanalogue). A comparison Tris-Cl (pH 7.5) and 100 mM NaCl. Excision rates were of the selectivity of pol γ to that of RT was then calculated

measured either under single-turnover conditions with (therapeutic index = selectivitypol γ/selectivityHIV RT) as previ- 75 nM primer/template and 100 nM enzyme, or under ously described ( Johnson et al., 2001).

Antiviral Chemistry & Chemotherapy 18.1 27 Anderson 16/2/07 15:13 Page 28

AS Ray et al.

Figure 2. Pre-steady-state incorporation of DXG-MP Figure 3. Pre-steady state incorporation of d4G-MP by pol γ by pol γ

A 50 A 50

40 40

30 30

20 20 D31-mer, nM D31-mer, D31-mer, nM D31-mer,

10 10

0 0 0 5 10 15 20 25 30 35 01020304050 Time, s Time, s B B 0.5 0.25

0.4 0.2 -1

0.3 -1 0.15 S S , , d d s s b b o o k 0.2 k 0.1

0.1 0.05

0 0 0246 81012 1416 012345 6 DXG-TP, μM d4G-TP, μM

(A) Holoenzyme (50 nM) was preincubated with 250 nM D30-mer/ (A) Holoenzyme (100 nM) was preincubated with 90 nM D30-mer/ 45-mer primer/template, and then rapidly mixed with magnesium D45-mer DNA, and then rapidly mixed with magnesium and 1 μM and 15 μM dioxolane guanosine-triphosphate (DXG-TP; concentra- 2′3′-dideoxy-2′,3′-didehydroguanosine-triphosphate (d4G-TP; con- tion final after mixing). Reactions were quenched at indicated time centration final after mixing). Reactions were quenched at indi- points and D31-mer product formation determined by gel elec- cated time points and D31-mer product formation determined by trophoresis. Fitting obtained data to a single exponential burst gel electrophoresis. Fitting obtained data to a single exponential equation yielded an amplitude of 20 ±1 nM, observed first-order burst equation yielded an amplitude of 38 ±1 nM and observed –1 first-order rate constants for incorporation (k ) =0.19 0.01 s–1. rate constants for incorporation (kobsd) =0.402 ±0.048 s and steady- obsd ± –1 (B) Incorporation rates were obtained and plotted as a function state rate (kss) =0.046 ±0.006 s . (B) Incorporation rates were obtained and plotted as a function of DXG-TP concentration. The fit of dioxolane guanosine-triphosphate concentration. The fit of of the data to a hyperbola yielded an equilibrium dissociation con- the data to a hyperbola yielded an equilibrium dissociation constant (K ) =0.61 0.13 M and a maximum polymerization rate stant (Kd) =0.97 ±0.09 μM and a maximum polymerization rate d ± μ –1 (k ) =0.27 0.02 s–1. Pol , polymerase . (kpol)=0.44 ±0.10 s . Pol γ, polymerase γ. pol ± γ γ

Rate of exonuclease removal (kexo) were determined by Results plotting the amount of full length substrate versus time and fitting the data to a single exponential decay Incorporation of the natural substrate, dGTP

([D31-mer] = A*exp(-kexot)) for single turnover conditions and its analogues by pol γ

or a line ([D31-mer] = -([enzyme]*kexo)t + 1,500 nM) for Pre-steady-state kinetics were used to gain an understanding steady-state conditions. Reported error represents the of the incorporation of DXG-MP and d4G-MP (triphos- deviation of points from the curve fit generated by phate structures shown in Figure 1) into a D30-mer/D45- KaleidaGraph. mer primer/template by pol γ holoenzyme. Data collected

Incorporation of guanosine analogues by pol γ

Table 1. Kinetic parameters for the incorporation of dGTP analogues into DNA/DNA 30/45-mer primer/template by mitochondrial pol γ

-1 -1 -1 † dNTP kpol, s Kd, μM Efficiency* , μM s Selectivity

dGTP‡ 175 ±10 1.4 ±0.3 125 – DXG-TP 0.44 ±0.10 0.97 ±0.09 0.45 278 d4G-TP 0.27 ±0.02 0.61 ±0.13 0.44 282 CBV-TP‡ 0.0018 ±0.0001 13 ±1.5 0.00014 892,857

† *Efficiency = maximum rate of incorporation (kpol)/dissociation constant for the nucleotide (Kd). Selectivity = efficiency of incorporation of dGTP/efficiency of incorporation of analogue. ‡Values reported previously (Johnson et al., 2001). CBV-TP, carbovir-triphosphate; dGTP, 2′- deoxyguanosine triphosphate; dNTP, deoxyribonucleotide triphosphate; DXG-TP, dioxolane guanosine-triphosphate; d4G-TP, 2′3′-dideoxy-2′,3′- didehydroguanosine-triphosphate. Pol γ, polymerase γ

Table 2. Comparison of the kinetic parameters for the incorporation of dGTP analogues by HIV-1 RT and pol γ

Selectivity* Therapeutic index† HIV RT HIV RT dNTP Pol γ DNA-dependent‡ RNA-dependent‡ DNA-dependent RNA-dependent

DXG-TP 278 2.9 18 96 15 d4G-TP 282 1.5 2.2 188 128 CBV-TP 892,857§ 34 7.4 26,261 120,656

† *Selectivity = efficiency of incorporation of dGTP (efficiencydGTP)/efficiency of incorporation of analogue (efficiencyanalogue). Therapeutic index = selectivity of pol γ/selectivity of HIV reverse transcriptase (RT). ‡Values for HIV RT selectivity reported previously (Ray et al., 2002b; Jeffrey et al., 2003). §Value reported previously (Johnson et al., 2001). CBV-TP, carbovir-triphosphate; dGTP, 2′-deoxyguanosine triphosphate; dNTP, deoxyribonucleotide triphosphate; DXG-TP, dioxolane guanosine-triphosphate; d4G-TP, 2′3′-dideoxy-2′,3′-didehydroguanosine-triphosphate; pol γ, polymerase γ.

included the maximum rate of incorporation (kpol) and the selectivity for their viral target relative to pol γ was obtained

equilibrium dissociation constant (Kd). Combining these (which was calculated as a therapeutic index). Despite two parameters allowed for the calculation of the efficiency similar incorporation by pol γ, it was found that d4G-TP

of incorporation (kpol/Kd) and a comparison of the enzyme’s was 2- and 8.5-fold more selective for HIV RT than ability to incorporate nucleotide analogues. Results for DXG-TP during DNA- and RNA-directed RT incorpo- DXG-TP and d4G-TP utilization by pol γ were then ration, respectively. The enhanced selectivity of d4G-TP compared with those previously obtained for dGTP and was due to its improved incorporation efficiency by HIV CBV-TP under the same experimental conditions RT. The selectivity of both DXG-TP and d4G-TP were ( Johnson et al., 2001). much less than that observed for CBV-TP (Table 2). Pre-steady-state burst and single turnover experiments allowed for measurement of incorporation rate at different Active site residues involved in differential concentrations of DXG-TP and d4G-TP. Plotting the incorporation of dGTP analogues by pol γ

observed rate (kobsd) versus DXG-TP or d4G-TP concen- To understand the structural basis for differences in tration, and fitting to a hyperbolic equation led to the incorporation of dGTP and its analogues, an analysis of the

determination of kpol and Kd for both analogues (Figures 2 pol γ active site based on homology modelling and protein and 3). Results showed that DXG-TP and d4G-TP are sequence alignment with other pol A family members with

incorporated similarly with kpol,Kd and efficiencies of available structural information was used. Previous sequence incorporation within twofold of one another. Relative to homology and mutagenesis studies have shown a similar role dGTP, both DXG-TP and d4G-TP were found to be for residues in the O-helix of pol A family members incorporated 278- and 282-fold less efficiently, respectively. including pol γ (Ponamarev et al., 2002; Graziewicz et al., However, these guanosine nucleotide analogues were 2004).The similar incorporation of DXG-MP and d4G-MP, incorporated approximately 3,000-fold more efficiently despite differential modification of the 2′ and 3′ positions of than the carbocyclic analogue, CBV-TP (Table 1). the ribose ring, and the markedly decreased incorporation of Using previously obtained kinetic values for DNA- and the carbocyclic analogue CBV-TP led us to look for differen- RNA-directed incorporation by HIV RT for DXG-MP tial contacts between active site residues and the ribose ( Jeffrey et al., 2003) and d4G-MP (Ray et al., 2002b), their oxygen. Polymerase structures have shown a general topology

Antiviral Chemistry & Chemotherapy 18.1 29 Anderson 16/2/07 15:13 Page 30

AS Ray et al.

Figure 4. Pol γ active site residues involved in dNTP recognition

A O-helix β-Sheets

6 7 8 T7 DNA pol 411-AEDGKIHGSVNPNGAVTGRATHAFPNLA Taq pol 1 555-PRTGRLHTRFNQTATATGRLSSSDPNLQ E.coli pol 1 650-PKTGRVHTSYHQAVTATGRLSSTDPNLQ Human 835-GLYGAILPQVVTAGTITRRAVEPTWLTA 638-NDLAIIIPKIVPMGTITRRAVENAWLTA pol γ Yeast Neurospora 685-PIGGFVLPQVIPMGTITRRAVERTWLTA Homology -* * * ** **** **

(A) Position of key residues in the T7 DNA polymerase (pol) active site (Doublie & Ellenberger, 1998) and residues predicted to be homologous in the mitochondrial polymerase (pol) γ active site. β-Sheets 7 and 8 and the O-helix are shown. Homology of residues in the O-helix (T7 Tyr 530/pol γ Tyr 955 and T7 Arg 518/pol γ Arg 943) have been established by previous sequence alignment and mutagenesis studies (Ponamarev et al., 2002; Lim et al., 2003). Homology is also predicted between a residue in the connecting region between β-sheet 7 and 8 (T7 Arg 429/pol γ Arg 853) and the steric gate residue (T7 Glu 480/pol γ Glu 895) that may play critical roles in differentiating carbocyclic from ribose containing nucleotide analogues. (B) Sequence alignment of palm region containing β-sheets 6, 7 and 8 between other pol A family members and DNA pol γ sequences from evolutionarily distinct species. Alignment of pol A family members based on structural and sequence homology (Joyce & Steitz, 1994; Li et al., 1998). Sequence alignments based on multiple single and multiple alignments and spacing from regions of high homology within pol A family members. Sites of high amino acid side chain homology are highlighted with an asterisk and the Arg coming in close proximity to the ribose oxygen in available pol A crystal structures are boxed (T7 Arg 429/pol γ Arg 853).

commonly described based on the analogy of a right hand Exonuclease excision of terminal dGMP, and its with fingers, thumb and palm subdomains ( Joyce & Steitz, analogues by the pol γ exonuclease proofreading 1994). Residues from the palm β-sheets 7 and 8, and residues domain. from the fingers O-helix in pol A family members make Pol γ has a 3′ to 5′ exonuclease domain and when considering contacts with the incoming nucleotide. In the T7 polymerase the toxicity of chain-terminating nucleotide analogues it is active site, two residues are found within 4 Å of the 4′ ribose important to assess the ability of pol γ’s exonuclease to oxygen including Glu 480, the steric gate residue known to remove a chain-terminator, thereby, potentially rescuing limit rNTP incorporation in pol A family members (Astatke mitochondrial DNA synthesis. The removal of terminal et al., 1998), and Arg 429 extending between β-sheets 7 and DXG-MP and d4G-MP were studied using the D31- 8 (Figure 4A). Similarly, sequence alignments suggest that mer/D45-mer primer/template. As summarised in Table 3, pol γ Glu 895 plays a homologous role as T7 Glu 480 (align- removal rates of >1,400-, 52- and 14-fold slower than the ment not shown) and that pol γ residue Arg 853 plays a natural analogue dGMP were observed for DXG-MP, homologous role as T7 Arg 429 (Figure 4B). d4G-MP and CBV-MP, respectively.

Incorporation of guanosine analogues by pol γ

Table 3. Kinetic parameters for exonuclease removal of terminal dNMPs from DNA/DNA 30-dNMP/45-mer have a specific mechanism for recognizing the ribose primer template by mitochondrial pol γ oxygen not present in HIV RT. Structural analysis of the region around the ribose oxygen in pol A family members D30-dNMP k , min-1 exo with available crystallographic data showed the presence of a potential hydrogen bond with the Arg side chain arising dGMP 1.4 ±0.1 from the linker between sheets 7 and 8 in the polymerase DXG-MP* <0.001 d4G-MP 0.027 ±0.002 palm. While sequence homology is not as strong between CBV-MP† 0.098 ±0.001 pol γ and other pol A family members in this region as for the catalytic Asp residues and the O-helix, it is proposed *Rate based on the lack of cleavage product observed after a 12 h incubation. †Value reported previously (Johnson et al., 2001). CBV- that Arg 853 in pol γ may play a homologous role. MP, carbovir-monophosphate; dNMP, deoxyribonucleoside Mutation of this Arg to Ala in the Klenow fragment of monophosphate; dGMP, 2′-deoxyguanosine monophosphate; DXG- MP, dioxolane guanosine-monophosphate; d4G-MP, 2′3′-dideoxy- DNA pol I (residue 668) causes a large decrease in the rate

2′,3′-didehydroguanosine-monophosphate; kexo, rate of exonuclease of deoxyribonucleoside monophosphate incorporation removal; pol γ, polymerase γ. (Polesky et al., 1990; Polesky et al., 1992). Similarly, data generated for the incorporation of guanosine nucleotides shows a 150-fold decrease in the incorporation rate Discussion between CBV-MP and d4G-MP. Taken together these results suggest that loss of the interaction between this Arg Structural studies of pol γ have been hampered by the and the ribose oxygen in Pol A family members either by difficulties encountered when trying to produce the large mutagenesis or removal of the ribose oxygen causes a quantities of protein required for structural elucidation. A marked decrease in the rate of catalysis. Similar decreases in high degree of structural homology observed within the incorporation rates between D- and L-nucleotide analogues active sites of other pol A family members suggest that pol have been noted previously (Feng et al., 2001; Feng et al., γ may have a similar active site topology (Delarue et al., 2004; Murakami et al., 2004) and may be related to the loss 1990; Joyce & Steitz, 1994). A structural model, based of the interaction of this Arg with the ribose ring or a steric upon sequence homology between pol γ and other pol A clash. These data suggest that the poor incorporation family members for which structural information is avail- observed for CBV-MP and L-nucleotide analogues may in able, has allowed for many insights into residues critical in part be mediated by Arg 853. Another factor that may play determining the substrate specificity of pol γ. For example, a role in the selectivity of pol γ for nucleotide analogues is an understanding of the underlying molecular mechanism the conformation of the ribose ring. The potential for for a mutant form of pol γ containing a mutation of Tyr ribose conformation to have an effect on incorporation of 955, which is associated with the heritable disorder d4G-MP and CBV-MP by HIV RT has been discussed in progressive external opthalmoplegia, has been established detail elsewhere (Ray et al., 2002b). by a combination of sequence/structural homology analysis An interesting parallel has been observed for some and mutagenesis. Sequence alignment showed that Tyr 955 NRTIs between incorporation by pol γ and sensitivity to a is homologues to a residue in the O-helix that is highly specific resistance mutation within the HIV RT active site. conserved in pol A family members and contacts the base Better substrates for pol γ including DXG-TP and d4G- of the incoming nucleotide. Mutagensis of this residue TP have not been found to be affected by the Met to Val caused error prone incorporation by pol γ (Ponamarev et al., mutation at position 184 (M184V) in HIV RT, whereas 2002; Graziewicz et al., 2004). Tyr 955 has also been impli- exceedingly poor substrates for pol γ including CBV-TP cated in the poor selectivity against incorporation of 2′,3′- and 3TC-TP are sensitive to the M184V mutation dideoxynucleotides by pol γ by being able to partially (Schinazi et al., 1993; Tisdale et al., 1993; Tisdale et al., compensate for the lack of a 3′-hydroxyl (Lim et al., 2003). 1997; Ray et al., 2002b; Jeffrey et al., 2003). The mechanism Here we show that pol γ incorporates a chain-terminating of resistance for the M184V mutation has been shown to DXG-MP and d4G-MP more than 3,000-fold more effi- be a steric hindrance for analogues with structural features ciently than the carbocyclic analogue CBV-MP.The differ- extending beyond the normal position of the ribose oxygen ence in the interaction of pol γ with d4G-TP and CBV-TP in the HIV RT active site (Sarafianos et al., 1999). The is especially surprising because the only difference between similarities in HIV RT M184V resistance and pol γ incor- the two analogues is the isosteric replacement of the ribose poration further support the hypothesis that contacts oxygen with carbon. This result is in contrast to the smaller around the ribose oxygen may be critical in dictating difference observed for HIV RT where d4G-MP is incorpo- incorporation by pol γ. rated 5- to 10-fold more efficiently than CBV-MP (Ray et al., Inhibition of mitochondrial DNA synthesis by chain- 2002b). Taken together, these results indicate that pol γ may terminating nucleotide analogues is likely a balance

Antiviral Chemistry & Chemotherapy 18.1 31 Anderson 16/2/07 15:13 Page 32

AS Ray et al.

between incorporation efficiency by the polymerase active Acknowledgements site and removal by the exonuclease active site. As these two enzymatic activities are catalysed by distinct regions of We would like to thank Kenneth A. Johnson for the the protein, differences in substrate specificity are likely. clones for expression of mitochondrial polymerase and its For example, the high mitochondrial toxicity of 2′,3′- accessory subunit. dideoxycytidine is likely due to its efficient incorporation Work supported by NIH grants GM49551 (KSA), and poor excision, causing it to be a highly effective 5R37-AI-41980 (RFS), 5R37-AI-25899 (RFS, CKC), inhibitor of mitochondrial DNA synthesis (Feng et al., 5P30-AI-50409 (RFS), the Department of Veterans 2001; Johnson et al., 2001). Therefore, it is critical when Affairs (RFS) and National Research Service Award 5 T32 assessing the potential for mitochondrial toxicity of a chain- GM07223 from the National Institute of General Medical terminating analogue to study both the processes of incorpo- Sciences (ASR). ration and excision. Here we demonstrated that in contrast to incorporation, CBV-MP is removed more efficiently than References either d4G-MP or DXG-MP. The poor incorporation and efficient removal of CBV-MP is likely the reason for the lack Astatke M, Ng K, Grindley ND & Joyce CM (1998) A single side chain prevents Escherichia coli DNA polymerase I (Klenow frag- of observed mitochondrial damage with abacavir. ment) from incorporating ribonucleotides. Proceedings of the National It should be noted that while DXG-TP and d4G-TP Academy of Sciences of the United States of America 95:3402–3407. were more efficiently incorporated and their respective Back DJ, Burger DM, Flexner CW & Gerber JG (2005) The monophosphates less efficiently removed by pol γ relative pharmacology of antiretroviral nucleoside and nucleotide reverse transcriptase inhibitors: implications for once-daily dosing. Journal to CBV-TP, these dGTP analogues did not show nearly of Acquired Immune Deficiency Syndromes 39 Suppl 1:S1–S23. the potential for inhibition of pol γ as the triphosphate Birkus G, Hitchcock MJ & Cihlar T (2002) Assessment of mitochon- forms of NRTIs with clinically manifested mitochondrial drial toxicity in human cells treated with tenofovir: comparison with toxicity: ddC-TP, ddA-TP or d4T-TP, shown in previous other nucleoside reverse transcriptase inhibitors. Antimicrobial Agents transient kinetic studies (Feng et al., 2001; Johnson et al., and Chemotherapy 46:716–723. 2001; Lim & Copeland, 2001). Consistent with the find- Carrodeguas JA, Kobayashi R, Lim SE, Copeland WC & Bogenhagen DF (1999) The accessory subunit of Xenopus laevis ings from these enzyme assays, cyclo-d4G has shown mitochondrial DNA polymerase gamma increases processivity of reduced potential for mitochondrial DNA depletion rela- the catalytic subunit of human DNA polymerase gamma and is tive to ddC and d4T (Ray et al., 2002a; Ray et al., 2005), related to class II aminoacyl-tRNA synthetases. Molecular and Cellular Biology 19:4039–4046. and DAPD has shown no mitochondrial depletion in cellular assays (Furman et al., 2001). The low capacity for Daluge SM, Good SS, Faletto MB, Miller WH, St Clair MH, Boone LR, Tisdale M, Parry NR, Reardon JE, Dornsife RE, DAPD to cause mitochondrial damage has been further Averett DR & Krenitsky TA (1997) 1592U89, a novel carbo- supported by findings in clinical studies (Thompson et al., cyclic nucleoside analogue with potent, selective anti-human 2005; Gripshover et al., 2006). immunodeficiency virus activity. Antimicrobial Agents and Chemotherapy 41:1082–1093. In conclusion, a study examining the incorporation of Delarue M, Poch O, Tordo N, Moras D & Argos P (1990) An these dGTP analogues by pol γ, has implicated the impor- attempt to unify the structure of polymerases. Protein tance of alterations around the ribose oxygen in dictating the Engineering 3:461–467. efficiency of incorporation. The high sensitivity of pol γ to Doublie S & Ellenberger T (1998) The mechanism of action of T7 these structural changes is illustrated by the approximate DNA polymerase. Current Opinion in Structural Biology 8:704–712. 3,000-fold decrease in incorporation efficiency observed Faletto MB, Miller WH, Garvey EP, St Clair MH, Daluge SM & between DXG-TP/d4G-TP (analogues containing the Good SS (1997) Unique intracellular activation of the potent anti- human immunodeficiency virus agent 1592U89. Antimicrobial ribose oxygen) and CBV-TP (an analogue lacking the ribose Agents and Chemotherapy 41:1099–1107. oxygen). It was also found that the 3′ to 5′ exonuclease Feng JY, Johnson AA, Johnson KA & Anderson KS (2001) Insights possesses unique structure activity relationships and that its into the molecular mechanism of mitochondrial toxicity by AIDS catalytic rate is highly sensitive to structural alterations drugs. Journal of Biological Chemistry 276:23832–23837. present in these dGTP analogues. Furthermore, we suggest a Feng JY, Murakami E, Zorca SM, Johnson AA, Johnson KA, key role of residue Arg 853 in substrate specificity for incor- Schinazi RF, Furman PA & Anderson KS (2004) Relationship between antiviral activity and host toxicity: comparison of the poration by the polymerase active site of pol γ. These results incorporation efficiencies of 2′,3′-dideoxy-5-fluoro-3′-thiacyti- combined with previous observations help elucidate and dine-triphosphate analogs by human immunodeficiency virus extend the structure activity relationship for pol γ’s interaction type 1 reverse transcriptase and human mitochondrial DNA polymerase. Antimicrobial Agents and Chemotherapy 48:1300–1306. with alternative substrates. These analyses serve to provide a Furman PA, Jeffrey J, Kiefer LL, Feng JY, Anderson KS, Borroto- better understanding of the mechanism of toxicity caused by Esoda K, Hill E, Copeland WC, Chu CK, Sommadossi JP, some current nucleoside analogues and may potentially aid in Liberman I, Schinazi RF & Painter GR (2001) Mechanism of the design of future more selective antiviral agents. action of 1-beta-D-2,6-diaminopurine dioxolane, a prodrug of the

Incorporation of guanosine analogues by pol γ

human immunodeficiency virus type 1 inhibitor 1-beta-D-dioxolane Parker WB & Cheng Y-C (1994) Mitochondrial toxicity of antiviral guanosine. Antimicrobial Agents and Chemotherapy 45:158–165. nucleoside analogs. Journal of NIH Research 6:57–61. Graves SW, Johnson AA & Johnson KA (1998) Expression, purifi- Polesky AH, Dahlberg ME, Benkovic SJ, Grindley ND & Joyce CM cation, and initial kinetic characterization of the large subunit of the (1992) Side chains involved in catalysis of the polymerase reaction human mitochondrial DNA polymerase. Biochemistry 37:6050–6058. of DNA polymerase I from Escherichia coli. Journal of Biological Chemistry 267:8417–8428. Graziewicz MA, Longley MJ, Bienstock RJ, Zeviani M & Copeland WC (2004) Structure-function defects of human mitochondrial Polesky AH, Steitz TA, Grindley ND & Joyce CM (1990) DNA polymerase in autosomal dominant progressive external oph- Identification of residues critical for the polymerase activity of the thalmoplegia. Nature Structural & Molecular Biology 11:770–776. Klenow fragment of DNA polymerase I from Escherichia coli. Journal of Biological Chemistry 265:14579–14591. Gripshover BM, Ribaudo H, Santana J, Gerber JG, Campbell TB, Hogg E, Jarocki B, Hammer SM & Kuritzkes DR (2006) Ponamarev MV, Longley MJ, Nguyen D, Kunkel TA & Copeland WC Amdoxovir versus placebo with enfuvirtide plus optimized back- (2002) Active site mutation in DNA polymerase gamma associated ground therapy for HIV-1-infected subjects failing current therapy with progressive external ophthalmoplegia causes error-prone (AACTG A5118). Antivirial Therapy 11:619–623. DNA synthesis. Journal of Biological Chemistry 277:15225–15228. Jeffrey JL, Feng JY, Qi CC, Anderson KS & Furman PA (2003) Ray AS (2005) Intracellular interactions between nucleos(t)ide Dioxolane guanosine 5′-triphosphate, an alternative substrate inhibitors of HIV reverse transcriptase. AIDS Review 7:113–125. inhibitor of wild-type and mutant HIV-1 reverse transcriptase. Ray AS, Hernandez-Santiago BI, Mathew JS, Murakami E, Steady state and pre-steady state kinetic analyses. Journal of Bozeman C, Xie MY, Dutschman GE, Gullen E, Yang Z, Hurwitz Biological Chemistry 278:18971–18979. S, Cheng YC, Chu CK, McClure H, Schinazi RF & Anderson KS Johnson AA, Ray AS, Hanes J, Suo Z, Colacino JM, Anderson KS (2005) Mechanism of anti-human immunodeficiency virus activity & Johnson KA (2001) Toxicity of antiviral nucleoside analogs and of beta-D-6-cyclopropylamino-2′,3′-didehydro-2′,3′-dideoxyguano- the human mitochondrial DNA polymerase. Journal of Biological sine. Antimicrobial Agents and Chemotherapy 49:1994–2001. Chemistry 276:40847–40857. Ray AS, Yang Z, Chu CK & Anderson KS (2002a) Novel use of a Johnson AA, Tsai Y, Graves SW & Johnson KA (2000) Human guanosine prodrug approach to convert 2′,3′-didehydro-2′,3′- mitochondrial DNA polymerase holoenzyme: reconstitution and dideoxyguanosine into a viable antiviral agent. Antimicrobial Agents characterization. Biochemistry 39:1702–1708. and Chemotherapy 46:887–891. Joyce CM & Steitz TA (1994) Function and structure relationships Ray AS, Yang Z, Shi J, Hobbs A, Schinazi RF, Chu CK & in DNA polymerases. Annual Review of Biochemistry 63:777–822. Anderson KS (2002b) Insights into the molecular mechanism of inhibition and drug resistance for HIV-1 RT with carbovir Kati WM, Johnson KA, Jerva LF & Anderson KS (1992) triphosphate. Biochemistry 41:5150–5162. Mechanism and fidelity of HIV reverse transcriptase. Journal of Biological Chemistry 267:25988–25997. Sarafianos SG, Das K, Clark AD, Jr., Ding J, Boyer PL, Hughes SH & Arnold E (1999) Lamivudine (3TC) resistance in HIV-1 Larder BA (1995) Viral resistance and the selection of antiretroviral reverse transcriptase involves steric hindrance with beta-branched combinations. Journal of Acquired Immune Deficiency Syndromes and amino acids. Proceedings of the National Academy of Sciences of the Human Retrovirology 10 Suppl 1:S28–S33. United States of America 96:10027–10032. Lee H, Hanes J & Johnson KA (2003) Toxicity of nucleoside ana- Schinazi RF, Lloyd RM, Jr., Nguyen MH, Cannon DL, McMillan A, logues used to treat AIDS and the selectivity of the mitochondrial Ilksoy N, Chu CK, Liotta DC, Bazmi HZ & Mellors JW (1993) DNA polymerase. Biochemistry 42:14711–14719. Characterization of human immunodeficiency viruses resistant to Li Y, Korolev S & Waksman G (1998) Crystal structures of open oxathiolane-cytosine nucleosides. Antimicrobial Agents and Chemotherapy 37:875–881. and closed forms of binary and ternary complexes of the large fragment of Thermus aquaticus DNA polymerase I: structural basis for Thompson MA, Kessler HA, Eron JJ, Jr., Jacobson JM, Adda N, nucleotide incorporation. Embo Journal 17:7514–7525. Shen G, Zong J, Harris J, Moxham C & Rousseau FS (2005) Short-term safety and pharmacodynamics of amdoxovir in HIV- Lim SE & Copeland WC (2001) Differential incorporation and infected patients. AIDS 19:1607–1615. removal of antiviral deoxynucleotides by human DNA polymerase gamma. Journal of Biological Chemistry 276:23616–23623. Tisdale M, Alnadaf T & Cousens D (1997) Combination of mutations in human immunodeficiency virus type 1 reverse transcriptase Lim SE, Ponamarev MV, Longley MJ & Copeland WC (2003) required for resistance to the carbocyclic nucleoside 1592U89. Structural determinants in human DNA polymerase gamma Antimicrobial Agents and Chemotherapy 41:1094–1098. account for mitochondrial toxicity from nucleoside analogs. Journal of Molecular Biology 329:45–57. Tisdale M, Kemp SD, Parry NR & Larder BA (1993) Rapid in vitro selection of human immunodeficiency virus type 1 resistant to Martin LT, Faraj A, Schinazi RF, Gosselin G, Mathe C, Imbach JL 3′-thiacytidine inhibitors due to a mutation in the YMDD region & Sommadossi JP (1997) Effect of stereoisomerism on the cellular of reverse transcriptase. Proceedings of the National Academy of pharmacology of beta-enantiomers of cytidine analogs in Hep-G2 Sciences of the United States of America 90:5653–5656. cells. Biochemical Pharmacology 53:75–87. Wang Y, Farr CL & Kaguni LS (1997) Accessory subunit of mito- Murakami E, Ray AS, Schinazi RF & Anderson KS (2004) chondrial DNA polymerase from Drosophila embryos. Cloning, Investigating the effects of stereochemistry on incorporation and molecular analysis, and association in the native enzyme. Journal of removal of 5-fluorocytidine analogs by mitochondrial DNA poly- Biological Chemistry 272:13640–13646. merase gamma: comparison of D- and L-D4FC-TP. Antiviral Research 62:57–64. White AJ (2001) Mitochondrial toxicity and HIV therapy. Sexually Transmitted Infections 77:158–173. Naeger LK & Miller MD (2001) Mechanisms of HIV-1 nucleoside reverse transcriptase inhibitor resistance: is it all figured out? White EL, Parker WB, Macy LJ, Shaddix SC, McCaleb G, Current Opinion in Investigational Drugs 2:335–339. Secrist JA, 3rd, Vince R & Shannon WM (1989) Comparison of the effect of Carbovir, AZT, and dideoxynucleoside triphosphates Nolan D & Mallal S (2004) Complications associated with NRTI on the activity of human immunodeficiency virus reverse transcrip- therapy: update on clinical features and possible pathogenic tase and selected human polymerases. Biochemical and Biophysical mechanisms. Antiviral Therapy 9:849–863. Research Communications 161:393–398. Received 25 September 2006, accepted 20 November 2006

Antiviral Chemistry & Chemotherapy 18.1 33