Horke Et Al. Paraoxonase-2 and Vascular Oxidative Stress 11

Paraoxonase-2 reduces oxidative stress in vascular cells and decreases

endoplasmic reticulum stress-induced apoptosis

Horke et al.: Paraoxonase-2 and vascular oxidative stress

Sven Horke, PhD1,*; Ines Witte, PhD1; Petra Wilgenbus, MS1; Maximilian Krüger, BS1;

Dennis Strand, PhD2; Ulrich Förstermann, MD, PhD1

1Department of Pharmacology and 2I.Department of Internal Medicine, Johannes Gutenberg

University, Mainz, Germany Horke et al. Paraoxonase-2 and vascular oxidative stress 2

Methods Supplement

Insertion of human PON2 cDNA into expression plasmids

Total RNA was extracted from EA.hy 926 cells using the TriPure reagent (Roche, Germany).

The RNA was subjected to RT-PCR using the Superscript-II one step RT-PCR system

(Invitrogen, Germany) with the primer sequences 5’-

GAGAGAGGTACCATGGGGCGGCTGGTGGCTGT-3’ (Kpn-I site underlined, PON2 start-ATG bold) and 5’-GAGAGAGGATCCGCGAGTTCACAATACAAGGCTCTG-3’

(BamH-I site underlined, last PON2-coding triplet bold). The gel-extracted (QIAquick Gel

Extraction, Qiagen, Germany) full-length products were digested with Kpn-I and BamH-I

(both New England Biolabs, Germany). pEGFP-N1 (Clonetech, Germany) was digested likewise, dephosphorylated by shrimps alkaline phosphatase (Promega, Germany) and gel- extracted. After ligation (T4 DNA ligase, MBI Fermentas, Germany) and transformation into

E.coli DH5, positive clones were confirmed by complete sequencing. A similar strategy was used for the insertion of PON2 cDNA into pCDNA3 (Invitrogen, Germany). Here, a hemagglutinin (HA)-tag sequence for C-terminal fusion was inserted into the plasmid beforehand. This was done by an EcoR-I / Not-I (New England Biolabs) restriction digestion of the plasmid pCDNA3 and the annealed primers 5’-

GGAGAATTCTACCCATACGATGTTCCAGATTACGCTTAAGCGGCCGCGAG-3’ and 5’-

CTCGCGGCCGCTTAAGCGTAATCTGGAACATCGTATGGGTAGAATTCTCC-3’

(encoding for an EcoR-I site (underlined), HA-tag (italic), stop-codon (italic and bold) and

Not-I site (bold and underlined)). After ligation of digested plasmid and primers and transformation into E.coli DH5α, positive clones were identified by sequencing before PON2 cDNA was inserted as mentioned above. pEGFP-N1-PON2-iso2 was generated using the

Mid-Range PCR system (PeqLab, Germany) with pEGFP-N1-PON2-iso1 (see above) as template and the primers 5’-GAATTCAAGAATACAGTG-3’ (sense) and 5’- Horke et al. Paraoxonase-2 and vascular oxidative stress 3

GTTGTCTATGAAAGTGCTG-3’ (antisense), followed by standard cloning procedures. All primers were synthesized by MWG, Germany.

Cell culture and transfection of cells

Human umbilical vein endothelial cells (HUVEC)-derived EA.hy 926 cells 1 were cultured as reported previously 2. SMCs and AoAFs were purchased from PromoCell and Cambrex, respectively, and cultured using media provided by the suppliers in a humidified atmosphere with 5% CO2 at 37°C. EA.hy 926 cells, HUVECs, SMCs and AoAF cells were utilized up to passages 25, 4, 10 and 10, respectively. For transfection purposes, EA.hy 926 cells were generally seeded with 8 x 104 cells per 24-well; next day, 1 µg DNA was transfected with

Nanofectin (PAA) as transfection reagent according to the manufacturers’ instructions. Stable cell lines were generated using the aminoglycoside G418 (Invitrogen, 300 µg/ml) for selection. The cell lines HeLa, HEK293T, Huh7, and U2OS were kindly provided by T.

Heise (Heinrich-Pette-Institute, Hamburg, Germany) and cultured like EA.hy 926 cells but under 5% CO2.

Cloning of a reporter plasmid containing the putative PON2 promoter

Due to rather inefficient amplification of the putative PON2 promoter sequence by direct

PCR, the region was cloned by a series of subcloning steps. Initially, we used genomic DNA from human A549 cells (kindly provided by H. Kleinert, University of Mainz) and oligonucleotides with the sequence 5’-GATAGAGGTACCCTTAACCCAGTGGTCCATTG-

3’ (KpnI-site underlined) and 5’-GATAGACTCGAGACCTACCTGAGTGCCAGAAGC-3’

(XhoI-site underlined) as follows: a 25 µl reaction contained 250 ng genomic DNA, 0.35 mmol/l dNTPs, 0.5 % DMSO, 10 pmole per oligonucleotide, 2 U DNA polymerase and the

1x reaction buffer contained in the Sawady MidRange PCR system (Peqlab Biotechnology, Horke et al. Paraoxonase-2 and vascular oxidative stress 4

Germany). Using an iCycler (BioRad, Germany), the amplification protocol was (95°C

2min)1x, (95°C 40sec, 66°C (1°C decrement / cycle) 50sec, 68°C 3min 15sec (10sec increment

/ cycle))8x, (95°C 40sec, 58°C 50sec, 68°C 4min 30sec (10sec increment / cycle))30x, (68°C

20min)1x. This generates a product representing the region -2249 to +112 of human PON2 gene. This was gel-purified, and inserted into pGL4.10[luc2] plasmid (Promega, Germany) by standard cloning procedures using KpnI and XhoI restriction enzymes (New England

Biolabs). Using the resulting plasmid as template together with the primers 5’-

GATAGAGGTACCCTTAACCCAGTGGTCCATTG-3’ (KpnI-site underlined) and 5’-

GATAGAGCTAGCGCCTGGCCAGCAGCTCCGTG-3’ (NheI-site underlined), the region

-2249 to -1 of PON2 gene was amplified in a PCR with the following protocol: a 25 µl reaction volume contained 50 ng template DNA, 0.4% DMSO, 0.4 mmol/l dNTPs, 20 pmol per oligonucleotide, 1.5 U DNA polymerase and the 1x reaction buffer contained in the

Sawady MidRange PCR kit mentioned above. Amplification profile of this reaction was

(95°C 2min)1x, (95°C 50sec, 52°C 50sec, 68°C 2min 20sec (10sec increment / cycle))38x,

(68°C 7min)1x. The amplified DNA was gel-purified, treated with Klenow enzyme (MBI

Fermentas) according to the suppliers instructions and inserted into pCR4-TOPO plasmid contained in the Zero Blunt Cloning kit (Invitrogen) following the manufacturers instructions.

Finally, the putative promoter region -2249 to -1 of PON2 was cut out of this plasmid by digestion with KpnI and NheI restriction enzymes (New England Biolabs) and inserted into

KpnI / NheI linearized plasmid pGL4.10[luc2] using standard procedures. All cloning steps were controlled by sequencing.

Promoter reporter studies

EA.hy 926 cells were plated for transfection as mentioned above. Next day, 1 µg DNA was transfected (see above), consisting of a 20:1 ratio of aforementioned PON2 promoter Horke et al. Paraoxonase-2 and vascular oxidative stress 5 construct and a renilla luciferase encoding control plasmid (a kind gift of H. Kleinert,

University of Mainz), respectively. Four hours after start, the transfection procedure was finished by medium replacement. Specific 16h treatment with tunicamycin (various concentrations; in medium) or DMSO (0.1%; solvent control) occurred after finishing transfection procedure. Then, firefly and renilla luciferase activities were recorded using the dual-luciferase reporter assay system (Promega) according to the manufacturer’s instructions using a Centro LB960 plate luminometer (Berthold Technologies, Germany). Finally, firefly activity was normalized for renilla activity to account for transfection efficiency and was calculated as fold-increase. Experiments were performed at least four times, each at least in duplicates.

Detection of PON2 mRNA variants in EA.hy926 cells by RT-PCR

Four different RT-PCRs were performed to detect PON2 mRNA variants in EA.hy 926 cells.

Oligonucletides were designed according to information in public databases that reported the existence of two PON2 mRNA splice-variants (accession numbers NM_000305.2 and

NM_001018161). The four different reactions were as follows: (i) as control, primers 5’-

GAGAGAGGTACCATGGGGCGGCTGGTGGCTGT-3’ and 5’-

GAGAGAGAATTCGAGTTCACAATACAAGGCTCTG-3’ will generate a product representing full-length human PON2 mRNA; (ii) primers 5’-

GGGTGGTTTACAACAAAGAG-3’ were designed such that they hybridize with the longer

PON2 mRNA variant, only, as the antisense primer hybridizes to a region absent in the shorter mRNA variant; (iii) primers 5’-

CTTGAATTCGTTGTCTATG-3’ were designed such that they may amplify the shorter Horke et al. Paraoxonase-2 and vascular oxidative stress 6

PON2 mRNA only, because the antisense primer completely covers the putative splicing site;

(iv) the primers 5’-CAATCCACATGGCATCAG-3’ and 5’-AATGTGCCGGTCCAACAG-

3’ will not differentiate between putative PON2 mRNA variants because they cover a region that flanks the putative splicing site on both sites and, hence should raise a double band in case two PON2 mRNAs were expressed. The amplification protocol was as follows: a 25 µl reaction contained 12.5 µl of 2x Superscript-II one step RT-PCR system reaction buffer

(Invitrogen), 5 pmole per oligonucleotide, 0.5 µl of reverse transcriptase / Taq-polymerase enzyme mix and 0.25 µg of DNase-I treated total RNA from EA.hy 926 cells. Reaction profile was (50°C 30min)1, (94°C 2min)1, (94°C 25sec, 50°C 30sec, 72°C 30sec)40, (72°C

10min)1. 2% agarose gel electrophoresis verified that the length of amplified cDNAs corresponded to the predicted sizes. Further, in case of reaction (iv), the resulting two bands were gel-purified and sequenced.

Cell extracts, SDS-PAGE, Western blotting and immunodetection

Cells were washed twice with chilled PBS (137 mmol/l NaCl, 3 mmol/l KCl, 10 mmol/l

Na2HPO4, 2 mmol/l KH2PO4, pH 7.4) and lysed in chilled RIPA-buffer (100 mmol/l Tris-HCl pH 7.4, 150 mmol/l NaCl, 1% Triton X-100, 1% Na-deoxycholate, 1% SDS, 1 mmol/l DTT, protease-inhibitor cocktail Complete (Roche)) followed by shaking for 20 min at 4°C. To decrease viscosity, 50 U/ml of Benzonase (Novagen, Germany) was added. Protein concentration was determined using BCA protein assay reagent (Pierce, Germany). 110 x 160 mm 12.5% SDS-PAGEs and electrophoretic transfer of proteins was done by standard procedures using a discontinuous buffer system described elsewhere 3. Membranes were incubated with 5% milk powder in TBS (10 mmol/l Tris-HCl pH 7.6, 100 mmol/l NaCl,

0.18% Tween-20) for 1h, with primary antibody (12 h, 4°C), washed (TBS), incubated with secondary HRPO-conjugated antibody (1 h) and washed. Immunodetected proteins were Horke et al. Paraoxonase-2 and vascular oxidative stress 7 visualized by Western-Lightning chemiluminescence kit (Perkin Elmer, Germany) and X-ray film exposure. Quantity One 4.6.2 software (Bio-Rad) was used for densitometric quantification.

Microscopy of live cells and immunocytochemistry

Live cells grown on glass-bottomed chamber slides (Nunc, Germany) were rinsed with

Hanks’ Balanced Salt Solution (HBSS, with calcium and magnesium; Gibco, Germany).

Staining for nuclei and ER was achieved by incubating the cells (30min, 37°C) with pre- warmed staining solution containing 4',6-diamidino-2-phenylindole (DAPI; Roche) and ER- tracker dye red (Molecular Probes, Leipzig, Germany) in HBSS. After replacement by growth medium, cells were analyzed with a Zeiss 510 confocal laser scanning microscope equipped with a UV laser (Zeiss, Germany). Images were collected with a 1.4 oil/DIC 63x

Zeiss Plan apochromatic lens. A (red) emission of the ER-dye following GFP-excitation was excluded (and vice versa; not shown).

For fixation, cells grown on coverslips were placed on ice, washed twice with chilled PBS, incubated 5 min with methanol and 30s with acetone (both -20°C), washed (PBS), pre- absorbed for 1 h with normal serum (Santa Cruz, Germany) derived from the same species as the primary antibody, incubated (1 h) with primary antibody, to what? washed (3 x 10 min,

PBS), incubated with secondary antibody and DAPI-staining solution (Roche) (1 h), washed

(3 x 10 min, PBS) and mounted with Permafluor (Beckmann Coulter, France). It was verified that staining with secondary antibody alone gave no signal (not shown).

Biochemical fractionation of EA.hy 926 cells

For purification of ER, an ER isolation kit (Sigma, Germany) was used. Briefly, approximately 6 x 108 EA.hy 926 cells were trypsinized, resuspended in complete growth medium, pelleted (800 x g, 4°C, 8 min), washed with chilled PBS, re-centrifuged, suspended Horke et al. Paraoxonase-2 and vascular oxidative stress 8 in isotonic buffer supplied with the kit and homogenized using a Dounce homogenizer

(Sigma). After centrifugation of the homogenate (1000 x g, 4°C, 10 min), the supernatant was re-centrifuged (4°C) at 12,000 x g for 15 min and at 100,000 x g for 60 min, giving rise to the nuclear pellet (NP), the mitochondrial pellet (MP) and the 100,000 x g pellet (P100) and supernatant (S100), respectively. The P100 fraction was transferred into a Potter-Elvehjem pestle homogenizer (Sigma) and resuspended in isotonic buffer. Then, 60% Optiprep solution was added to result in 2 ml with a 20% final Optiprep concentration. In an 8 ml ultracentrifuge tube, this was layered on top of 2 ml 30% Optiprep solution and covered with

4 ml of 15% Optiprep, followed by a centrifugation for 3 h with 150,000 x g at 4°C. Finally, fractions were withdrawn, protein content was determined and equal amounts were loaded for

Western blotting. If needed, samples were concentrated using Vivaspin 500 concentrators

(Sartorius, Germany).

Proteinase K treatment of cells

EA.hy 926 cells were washed twice with PBS-CM (PBS + 3 mmol/l CaCl2 and 1 mmol/l

MgCl2) and incubated at 37°C with PBS-CM plus Proteinase K (see Figure 3A). Afterwards, cells were suspended in PBS containing protease inhibitor phenylmethylsulfonyl fluoride

(PMSF, 5 mmol/l), centrifuged (5min, 4°C, 800 x g), washed twice with this solution and lysed in RIPA buffer. As control, cells were washed, incubated with PBS-CM (30 min, 37°C) and lysed in RIPA buffer after aspiration of the PBS-CM.

Real-time, quantitative RT-PCR (qRT-PCR) qRT-PCR was performed as reported elsewhere 4 with the following modifications: Total

RNA was prepared with RNeasy RNA isolation kit (Qiagen) and used with 10 ng per reaction; pre-designed Taqman hybridization probes for human PON2, RNA polymerase IIa Horke et al. Paraoxonase-2 and vascular oxidative stress 9 or GAPDH were purchased from Applied Biosystems (Germany); experimental reactions were performed in duplicates. Relative expression of PON2 was calculated by the 2 [-∆∆ C(T)] method 5.

RNA interference (RNAi)

Cells were plated in 24-wells with 5 x 104 cells per well the day before treatment. 50nmol/l pre-designed Stealth-Select siRNA oligos (Invitrogen) targeting the human PON2 mRNA were transfected using RNAifect (Qiagen) according to the instructions supplied. A Stealth- siRNA oligo with a scrambled sequence (50 nmol/l, Invitrogen) but with a similar G/C- content served as negative control. Six hours after transfection, cells were washed, trypsinized, pooled within each series of treatment and seeded in appropriate culture dishes.

This procedure ensured that cells used for Western blotting and functional assays received the same treatment. Transfection efficiency estimated from fluorescent Block-iT siRNA

(Invitrogen) was approx. ≥ 85% (not shown).

Generation of a rabbit polyclonal anti-human PON2 antibody

PON2 peptide antibody was generated by Eurogentec, Belgium. The peptide

CKPRARELRISRGFDL (corresponding to residues 94 - 108 of human PON2; first C added for coupling purposes) was synthesized, coupled to a keyhole limpet hemocyanin-carrier and used for immunization of rabbits. The antibody was affinity purified using immobilized peptide.

Commercial antibodies

The following primary antibodies (all anti human) were used: mouse anti-GFP (monoclonal mixture, Roche), mouse anti-calnexin (Affinity BioReagents, USA), mouse monoclonal-anti- Horke et al. Paraoxonase-2 and vascular oxidative stress 10

α-tubulin (Ab-2 DM1a, Dianova, Germany), goat anti-glucose regulated protein (GRP78; antibody C-20), mouse anti-hemagglutinin (HA, antibody F-7), rabbit anti-angiotensin II receptor 1 (AT1, antibody N-10; all Santa Cruz). The following secondary antibodies were used: Cy2-/or Cy-3-conjugated AffiniPure goat-anti-rabbit IgG (H and L) and FITC- conjugated AffiniPure donkey-anti-mouse IgG (H and L) (Jackson ImmunoResearch, USA), peroxidase-conjugated goat-anti-rabbit IgG and rabbit-anti-mouse IgG (Sigma). Antibodies were diluted in TBS with 5% milk powder for Western blotting and in PBS for immunocytochemistry.

Detection of reactive oxygen species (ROS)

Cells were plated in 96-well plates (2.5 x 104 cells/well). After one day, cells were washed

(HBSS) and incubated with 500 µmol/l of the luminol derivative L-012 (Wako Chemicals,

Germany) in HBSS at 37°C for 15 min before addition of 2,3-dimethoxy-1,4-naphthoquinone

(DMNQ, 10µmol/l, Calbiochem, Germany) or its solvent DMSO (control). Both were added in cell culture medium. Then ROS-induced chemiluminescence was determined every 5 min for a total of two hours using a Centro LB960 plate luminometer (Berthold Technologies,

Germany). Alternatively, cells were pre-incubated for 24 h with tunicamycin (Sigma), thapsigargin (Molecular Probes) or transforming growth factor β 1 (TGF β 1; Strathmann

Biotech, Germany) in cell culture medium. Likewise, cells were pre-incubated in medium for

24h with ascorbic acid (vitamin C; Sigma) or 4h with water-soluble vitamin E derivative (±)-

6-hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid (Trolox; Sigma). Trolox was dissolved as described elsewhere 6. Then ROS was detected as above. Each data point of a single curve consisted of at least 5 individual values and was verified in 3 to 4 independent experiments. Horke et al. Paraoxonase-2 and vascular oxidative stress 11

Results were confirmed using 5-(and-6)-carboxy-2',7'-dichlorodihydrofluorescein diacetate

(carboxy-H2DCFDA, Molecular Probes). For this purpose, cells were plated and washed as before, incubated for 30 min at 37°C with 2.5 nmol/l carboxy-H2DCFDA, washed with

HBSS, and treated as above followed by fluorescence recording (480 nm / 510 nm) at 37°C using a Fluostar Optima fluometer (BMG Labtechnologies, Germany).

Results were evaluated with Graph Pad Prism Software 3.04 by subtracting base-line values and calculating relative increase of signals. Analysis of statistically significant differences of curve maxima occurred by subsequent nonlinear regression curve fit. Although levels of

ROS-induction varied within experiments, relative differences remained unchanged.

Determination of caspase activity

Cells plated in 96-well microplates were treated with the indicated reagents in medium.

Caspase activity was assessed using Caspase-Glo 3/7 system (Promega) according to the manufacturer’s instructions. Data were obtained in quadruplicate in three independent experiments. Luminescence was recorded as described before. Data were transferred to

Graph Pad Prism 3.04 Software, values of mock-treated cells were subtracted and results were tested for statistically significant differences using by 2-way analysis of variance.

Statistics

In Figs. 4 and 5 non-linear regression curve fits were used and maxima analyzed for statistically significant differences. In Figs. 7 and 8, statistical significance was tested using

2-way analysis of variance. A P value of <0.05 was considered significant.

The authors had full access to and take full responsibility for the integrity of the data. All authors have read and agree on the manuscript as written. Horke et al. Paraoxonase-2 and vascular oxidative stress 12

References 1. Edgell CJ, McDonald CC, Graham JB. Permanent cell line expressing human factor VIII-related antigen established by hybridization. Proc Natl Acad Sci U S A. 1983;80:3734-7. 2. Li H, Forstermann U. Structure-activity relationship of staurosporine analogs in regulating expression of endothelial nitric-oxide synthase gene. Mol Pharmacol. 2000;57:427-35. 3. Kyhse-Andersen J. Electroblotting of multiple gels: a simple apparatus without buffer tank for rapid transfer of proteins from polyacrylamide to nitrocellulose. J Biochem Biophys Methods. 1984;10:203-9. 4. Linker K, Pautz A, Fechir M, Hubrich T, Greeve J, Kleinert H. Involvement of KSRP in the post-transcriptional regulation of human iNOS expression-complex interplay of KSRP with TTP and HuR. Nucleic Acids Res. 2005;33:4813-27. Print 2005. 5. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25:402-8. 6. Forrest VJ, Kang YH, McClain DE, Robinson DH, Ramakrishnan N. Oxidative stress-induced apoptosis prevented by Trolox. Free Radic Biol Med. 1994;16:675-84.