Single Nucleotide Polymorphism Detection by Real Time Polymerase Chain Reaction and High

GENOTYPING OF SINGLE NUCLEOTIDE POLYMORPHISMS

USING LIGHTCYCLER GREEN-1

Michael Liew1, Robert Pryor2, Robert Palais2, Cindy Meadows1, Maria Erali1, Elaine Lyon1, 2 and Carl Wittwer1, 2. 1Institute for Clinical and Experimental Pathology, ARUP, Salt Lake City UT 84108- 1221, USA. 2Department of Pathology, University of Utah School of Medicine, Salt Lake City, UT 84132.

Address for correspondence:

Michael Liew ARUP Institute for Clinical and Experimental Pathology 500 Chipeta Way Salt Lake City, UT 84108-1221 USA Phone: (801) 583 2787 ext. 2179 Fax: (801) 584 5114 E-mail: [email protected]

Running title: SNP genotyping using LCG-I Keywords: PCR, MTHFR, Prothrombin, Factor V, Hemochromatosis

1 ABSTRACT

Up until now genotyping single nucleotide polymorphisms (SNPs) by melting curve analysis has only been possible by using probes. The recent invention of the fluorescent dye, LightCycler Green I (LCG-I), that enables heteroduplex visualization during melting curve analysis now makes it possible to identify SNPs using real time technology and high resolution melting analysis. The aim of this study was to determine how effective LightCycler Green I is at identifying the different combinations of SNPs. Four combinations of SNPs were determined to cover all possible combinations; A/C, A/G, A/T and C/G. These changes were covered by the following cases; MTHFR1298 (A/C), Factor II, Factor V, MTHFR677 (A/G), hemoglobin (A/T) and H63D (C/G). Genotypes of all samples were previously identified by an alternative method of genotyping based upon methods utilising labelled probes. In all cases it was possible to distinguish the heterozygotes from the wild type and homozygous samples based upon the heteroduplex peak that is detected. Homozygotes and wild type samples were possible to differentiate based upon melting temperature, however the A/T and

C/G transitions were not differentiable unless spiked with a wild type sample and a heteroduplex peak called. This procedure simplifies and reduces the cost of genotyping

SNPs by melting curve analysis.

2 INTRODUCTION

It has become increasingly clear that certain single nucleotide polymorphisms (SNPs) are often associated with an increased risk for certain diseases. For example, the SNP

G1691A in Factor V (Leiden factor) leads to an increased risk of thromboembolic disease

[1, 2]. Another example is SNP C677T found in methylenetetrahydrofolate reductase

(MTHFR), where homozygosity is associated with intermediate and mild hyperhomocystinemia and an increased risk for premature cardiovascular disease [3-5].

There are a variety of ways to identify SNPs [6]. Restriction fragment length polymorphism (RFLP) has probably been around the longest and is still currently widely used [7-9]. Real time polymerase chain reaction (PCR) and labelled probes have been used extensively and successfully [10, 11]. Heteroduplex analysis using denaturing high performance liquid chromatography (dHPLC)[12, 13] and temperature gradient capillary electophoresis (TGCE)[14] has also provided a good screening tool for SNP detection.

Direct sequencing is also an option, although is not a good tool for high throughput approaches. Similarly, pyrosequencing is another novel method of SNP genotyping [15-

17]. Finally SNPs have also been detected using mass spectrometry, in particular with matrix assisted laser desorption/ionization time-of-flight (MALDI-TOF) instrumentation

[18, 19].

With regards to genotyping by real time PCR using labelled probes, the greatest advantage it has is that the signal is very specific. The biggest disadvantage is the cost of

3 the labelled probes. With the advent of better discriminating DNA dyes, there is the real possibility that genotyping can be performed without labelled probes. This would make the assays more affordable. The disadvantages of dyes though is that it makes it more difficult to perform multiplex analysis and non specific products such as primer dimers can still be seen and can make data interpretation more difficult.

LightCycler Green 1 is a new DNA dye that unlike SYBR green I is able to identify heteroduplexes by melting curve analysis [20]. Therefore it makes it possible to genotype SNPs by heteroduplex detection present in heterozygous samples. If amplicons are designed to maximize the difference in melting temperature of wild type and homozygous samples, these also can be genotyped by melting curve analysis. The first aim of this project was to characterize the melting curves of different combinations of

SNPs. The second aim was to design the amplicons as small as possible to maximize the difference between wild type and homozygous samples. The amplicons were designed using software specifically written to choose primers that flank the known SNP, therefore keeping the amplicon size limited to about 50bp.

METHODS

Human samples

Anti-coagulated human blood was collected and shipped to ARUP at 2-8ºC. Once obtained, DNA was extracted from the blood using the MagnaPure instrument according to the manufacturer’s instructions. All samples that were obtained were de-identified according to HIPAA regulations. Some of the samples used in this study were submitted

4 to ARUP Laboratories for mutation detection in the following markers; prothrombin

G20210A, Leiden factor (factor V) G1691A, methylenetetrahydrofolate reductase

(MTHFR) A1298C, and hemochromatosis C187G (H63D). Some of the samples were submitted to ARUP for hemoglobin S assessment, while the remaining samples were dried bloodspots obtained from NeoGen screening (Pittsburgh, PA). The last set of samples were used for the detection of the SNPs G16A (HbC) and A17T (HbS) found in

-globin. It was possible to obtain DNA samples from at least three different individuals for each genotype for each marker. The only exception was for the -globin markers.

No samples were identified that were mutant for HbC, and there were only single samples available that were HbS mutant and compound heterozygotes for both. 104 samples (35 wild type, 35 heterozygote, 34 mutant) previously tested for factor V at

ARUP obtained for a concordance study.

Primer design

To make primer design as automated, standardized and rigorous as possible, primers were designed using the software called SNPWizard. Sequence information regarding the SNP is input into the program. The software than chooses primers that immediately flank the

SNP. Primer design is based upon primer melting temperature and mispriming parameters. Misprimes are determined by two conditions. The first condition ensures that the designed primers will not re-anneal with any section of the input sequence to prevent the formation of alternative amplicons. The second condition ensures that the designed primers will not form primer dimers that would interfere with the assay.

Melting temperature calculations are based upon implementation of the nearest-neighbor

5 thermodynamic models described previously [21-28]. Oligonucleotides were obtained from Integrated DNA Technologies (Coralville, IA), Idaho Technologies Biochem (Salt

Lake City, UT), and Qiagen Operon (Alameda, CA).

Systematic study of SNP genotyping with plasmids

Engineered plasmids were used to systematically study melting curve genotyping of all possible single base changes. The plasmids (DNA Toolbox, BioWhitaker Molecular

Applications, Rockland, ME) contained either A, C, G, or T at a defined position amid

40% GC content [29]. Primers with a Tm of 60 +/- 1°C were immediately adjacent to the polymorphic position. Reaction conditions consisted of 50mM Tris, pH 8.3, 500 g/ml

BSA, 3 mM MgCl2, 200 M of each dNTP, 0.4 U Taq Polymerase (Roche), 1x

LightCycler Green I (LCG-I)(Idaho Technologies, Salt Lake City, UT) and 0.5 M each primer with water up to 10l. The DNA templates were used at 108 copies and PCR was performed with 35 cycles of 95°C with no hold, 55°C for 1s.

SNP genotyping of genomic DNA from clinical samples

PCR was performed in 10l volumes in a LightCycler (Roche Applied Systems,

Indianapolis, IN) with programmed transitions of 20°C/s unless otherwise indicated.

Samples were amplified using the LightCycler FastStart DNA Master Hybridization

Probe kit (Roche) according to manufacturer’s instructions. Reaction mixtures consisted of approximately 25-50ng of genomic DNA as template, 3mM MgCl2, 1xLightCycler

FastStart DNA Master Hybridization Probes, 1xLightCycler Green I (Idaho

Technologies), 0.5M forward and reverse primers and 0.01U/l Escherichia coli (E.

6 coli) uracil N-glycosylase (Roche) with water up to 10l. Reactions were also overlayed with 5l of molecular grade mineral oil to minimize evaporation. It also was important to keep the volume of template limited to 10% of the reaction mix to minimize the variation seen in the melting curves. In the case of -globin, the reaction mixture was the same used for amplification of the plasmids. See Table 1 for the list of primers, amplicon sizes and specific detail on cycle number and annealing temperature used for each SNP.

For all of the SNPs amplified except -globin, the following specifics applied. The PCR was initiated with a 10min hold at 50C for contamination control by UNG and a 10min hold at 95C for activation of the hot-start Taq. The numbers of cycles were kept between 31 and 40 cycles. The thermal cycles consisted of 2 steps between 85C and the appropriate annealing temperature without any holds. The thermal cycling conditions for

-globin amplification were initiated using a 10sec hold at 94C followed by cycling between 90C for 0sec and 60C for 1sec. The ramp rates were kept at 20C/s unless otherwise stated.

Melting Curve Acquisition

Melting analysis was performed either on the LightCycler immediately after cycling, or on a high-resolution melting instrument (HR-1, Idaho Technology, Salt Lake City, UT).

When the LightCycler was used, the samples were first heated to 94°C C at 20°C/s, cooled to 40°C at 20°C/s and held at 65°C for 20s, then melted at 0.05°C/s with continuous acquisition of fluorescence until 85°C and rapidly cooled to 40°C at 20°C/s.

The HR-1 is a single sample instrument that surrounds one LightCycler capillary with an

7 aluminum cylinder. The system is heated by Joule heating through a coil wound around the outside of the cylinder. Sample temperature is monitored with a thermocouple also placed within the cylinder and converted to a 16-bit digital signal. Fluorescence is monitored by epi-illumination of the capillary tip [18] that is positioned at the bottom of the cylinder and also converted to a 16-bit signal. Approximately 50 data points are acquired for every C. Prior to high-resolution melting, samples amplified in the

LightCycler were heated to 94°C at 20°C/s in the LightCycler and rapidly cooled to 40°C at 20°C/s unless stated otherwise. The LightCycler capillaries were then transferred one at a time to the HR1 and heated at 0.3°C/s. Plasmid samples were analyzed between

72C and 88C, -globin analyzed between 67C and 81C and all remaining SNPs between 65C and 85C.

Melting Curve Analysis

LightCycler and high-resolution melting data were analyzed with custom software written in LabView. Fluorescence vs temperature plots were normalized between 0 and

100 percent by first defining linear baselines before and after the melting transition of each sample. Within each sample, the fluorescence of each acquisition was calculated as the percent fluorescence between the top and bottom baselines at the acquisition temperature. In some cases, derivative melting curve plots were calculated from the

Savitsky-Golay polynomials at each point [19]. Savitsky-Golay analysis used a second- degree polynomial and a data window including all points within a 1°C interval. Melting temperatures were obtained by finding the highest dF/dT value on the derivative plots.

All curves were plotted using Microsoft Excel.

8 Spiking experiments

Due to the difficulty in discriminating H63D wild type from mutant, heteroduplex formation had to be induced by spiking amplicon with H63D wild type amplicon.

Therefore, if a mutant was present heteroduplexes would be seen during analysis of the melting curves. Spiking was carried out in two ways. The first way was to add spike to the amplicons once the PCR reactions were complete. In this case 1l of a known H63D wild type was added to the PCR reactions of samples that looked like either a wild type or mutant. The mixtures were then heated to 94°C C at 20°C/s and cooled to 40°C at

20°C/s using the LightCycler and analyzed on the HR1.

The second method was to add the spike to the PCR reaction. In this method, approximately 5ng of genomic DNA from a H63D wild type sample was added to the

PCR reactions. A duplicate set of samples without spike needs to be run at the same time. PCR amplifications are done as described followed by melting curve analysis.

Then melting curves with and without spike need to be compared in order to be genotyped. Samples with no heteroduplexes in either are wild type, samples with heteroduplexes only in the presence of spike are mutants, and samples with heteroduplexes in both are heterozygous.

Genotyping using the normalized melting curves

To determine if the HR1 assay was comparable to the assays currently used, 104 samples of factor V were tested and compared to results from real time PCR assays used at ARUP

9 laboratories for mutation detection. A smaller group of 19 samples (6 wild type, 7 heterozygotes, 6 mutants) were used to determine how much variation could be seen within each genotype. Then samples were chosen from each of the genotypes to use as a cutoff control using the normalized melting curves (Figure 1). In the case of the wild type and mutant genotypes, controls were chosen such that they were as close together as possible. Then, to make the genotype call, the unknown curves had to firstly have the same shape as one of the controls. Wild type genotypes were called if the curves were closest to or had a higher melting temperature than the wild type control. Mutant genotypes were called if the curves were closest to or had a lower melting temperature than the mutant control. Heterozygote genotypes were called based upon being parallel with the heterozygote control, and could fall on either side of it. Derivative curves were also used to see heteroduplex peaks in the heterozygous samples.

RESULTS

SNP analysis of the DNA toolbox

SNP analysis of the results from the DNA toolbox demonstrate that each type of heterozygous SNPs and homozygous SNPs has a distinctive normalized melting curve on the HR1 (Figure 2). The homozygous SNPs separate very well. The AA homozygous

SNP melts first followed by TT, GG then CC (Figure 2A). In addition, there is a greater separation between the AA/TT homozygous SNPs when compared to the GG/CC homozygous SNPs. There is one AA SNP that overlaps the TT SNPs. The normalization process amplifies subtle differences seen in the different melting curves, so this is believed to be caused by sample to sample variation.

10 With the exception of 2 SNPs, the heterozygous SNPs separated very well from each other (Figure 2B). The AT heterozygous SNP melted first, followed by the GT. The AG and CT SNPs melted next and had overlapping curves. These were then followed by AC, and finally by CG. It is also possible to differentiate a homozygous SNP from a heterozygous SNP based upon curve shape (Figure 2C). The normalized curves of homozygous SNPs, has only homoduplexes which leads them to maintain a relatively flat plateau prior to melting. In contrast, the heterozygous SNPs has a more rapid decrease in fluorescence initially caused by the melting of heteroduplex DNA followed by the melting of the homoduplex DNA.

SNP analysis of clinical samples

The data acquired using the HR-1 was of a better resolution when compared to the data acquired by the LightCycler (Figure 3). In addition, the HR1 was far better at detecting heteroduplexes. In the figure shown, the the heteroduplexes detected by the LightCycler were distinctive 1 cycle later than the HR1. In other cases, where the heteroduplex is only a slight shoulder, the LightCycler has difficulty picking those up (data not shown).

One of the disadvantages that was observed using this method is that of contamination.

Since the amplicons are so small, preventing contamination was a challenge, and was difficult to eliminate.

With the exception of H63D, all genotypes were distinguishable from each other in the

SNPs genotyped (Figure 4). In all six cases, the heterozygotes were very distinguishable

11 from the mutant and wild type samples. In addition, for -globin, a sample that was a compound heterozygote for HbC and HbS was distinguishable as well (Figure 4E). With the exception of the H63D, wild type and mutant samples were very well separated and could be genotyped. In addition, for -globin, a sample that was a mutant for HbS was clearly distinguishable as well (Figure 4E). SNP analysis of the 104 factor V samples and all of the markers genotyped using LightCycler Green I and HR-1 were 100% concordant with the results obtained by ARUP (Table 2).

The most difficult marker to differentiate wild type from mutant was H63D. Based upon the DNA toolbox result it should have been resolvable, but nearest neighbour thermodynamics also has a role to play. This appears to be the case because the H63D wild type (CC) has a slightly lower melting temperature compared to the mutant (GG)

(Figure 4D), which is contradictory to the DNA toolbox result (Figure 2A).

In order to discriminate the H63D wild type and mutant samples, 2 approaches were implemented. The first approach involved spiking the wild type or mutant samples with a known wild type sample following PCR amplification. The presence of a heteroduplex can be clearly seen when the wild type and mutant amplicons are mixed together (Figure

5A). The second approach involved spiking the PCR reaction mixture with a known amount of wild type sample then proceeding with amplification (Figure 5B). Samples are easily genotyped either having no heteroduplex curves (wild type), one heteroduplex curve (mutant) or 2 heteroduplex curves (heterozygous).

12 DISCUSSION

In this report we expand on what has previously been found using LightCycler Green I and the HR1 instrument for SNP genotyping. Keeping the amplicon limited to 40-50bp by using primers that immediately flank the known SNP we were able to successfully discriminate different combinations of SNP using engineered plasmids from a DNA toolbox [29]. The results compare favorably with what is known about the expected behaviour of nucleotides when melted. It has been known for a long time that adenine and thymine have a lower melting temperature when compared to guanine and cytosine and this was reflected in the high resolution melting curves of homozygous SNPs (ref).

Heterozygotes were also melted previously, and these results were in agreement with those (ref).

We were also able to successfully genotype the following SNPs that are used as clinical markers; G20210A in prothrombin, G1691A in factor V, A1298C in MTHFR and C187G in hemochromatosis. These results were 100% concordant with tests that ARUP routinely performs. These SNPs have been extensively studied using real time PCR and fluorescent probes (ref). All of these studies have demonstrated 100% concordance when compared to established methods of SNP genotyping.

It appears that a substitution involving a G↔C or an A↔T may make it more difficult to distinguish a wild type from a mutant sample in this study. The additional approaches used in this report were both successful, but each has their own disadvantages. The disadvantage for spiking post-amplification was that the PCR tubes require opening and

13 therefore contamination is an issue. The disadvantage for spiking pre-amplification is that the number of tubes needed per run is doubled, therefore increasing cost and reducing throughput. However, the advantages and benefits would have to be weighed up to decide which approach would be used by a particular laboratory.

The results here describe a rapidly developing method for genotyping SNPs. The design, methodology and analysis are simple and can be applied to a wide variety of targets. The greatest advantages of this assay are that the amplification is rapid due to the small amplicon sizes, there is high resolution between wild type, heterozygous and homozygous mutant samples and is inexpensive due to the elimination of labelled probes.

The biggest disadvantage encountered with this particular study were problems with contamination. This problem can be greatly reduced by ensuring that purified template

DNA has a concentration of at least 50ng/l, optimizing the annealing temperature and by adjusting the number of cycles to reduce the contamination while amplifying enough product to obtain distinct melting curves for each genotype. In addition, in this study, by using a fluorescence intensity cutoff it was possible to distinguish it from a specimen that does contain template DNA.

There is no question about the importance of SNP genotyping. The assay described here provides a simple, rapid and inexpensive method for doing so. It provides a solid assay for genotyping SNPs, but also could be applied to high throughput screening of SNPs.

This is a useful tool that will greatly help in the detection of SNPs.

14 ACKNOWLEDGEMENTS

The authors would like to thank Jamie Williams for her technical assistance.

REFERENCES

1. Bertina, R.M., et al., Mutation in blood coagulation factor V associated with resistance to activated protein C. Nature, 1994. 369(6475): p. 64-7. 2. Voorberg, J., et al., Association of idiopathic venous thromboembolism with single point-mutation at Arg506 of factor V. Lancet, 1994. 343(8912): p. 1535-6. 3. Deloughery, T.G., et al., Common mutation in methylenetetrahydrofolate reductase. Correlation with homocysteine metabolism and late-onset vascular disease. Circulation, 1996. 94(12): p. 3074-8. 4. den Heijer, M. and M.B. Keijzer, Hyperhomocysteinemia as a risk factor for venous thrombosis. Clin Chem Lab Med, 2001. 39(8): p. 710-3. 5. Kluijtmans, L.A., et al., Thermolabile methylenetetrahydrofolate reductase in coronary artery disease. Circulation, 1997. 96(8): p. 2573-7. 6. Kwok, P.Y. and X. Chen, Detection of single nucleotide polymorphisms. Curr Issues Mol Biol, 2003. 5(2): p. 43-60. 7. Ochi, M., et al., The absence of evidence for major effects of the frequent SNP +299G>A in the resistin gene on susceptibility to insulin resistance syndrome associated with Japanese type 2 diabetes. Diabetes Res Clin Pract, 2003. 61(3): p. 191-8. 8. Ronai, Z., M. Sasvari-Szekely, and A. Guttman, Miniaturized SNP detection: quasi-solid-phase RFLP analysis. Biotechniques, 2003. 34(6): p. 1172-3. 9. Woo, J.G., et al., The -159 C-->T polymorphism of CD14 is associated with nonatopic asthma and food allergy. J Allergy Clin Immunol, 2003. 112(2): p. 438-44. 10. Lay, M.J. and C.T. Wittwer, Real-time fluorescence genotyping of factor V Leiden during rapid-cycle PCR. Clin Chem, 1997. 43(12): p. 2262-7. 11. von Ahsen, N., et al., Rapid detection of prothrombotic mutations of prothrombin (G20210A), factor V (G1691A), and methylenetetrahydrofolate reductase (C677T) by real-time fluorescence PCR with the LightCycler. Clin Chem, 1999. 45(5): p. 694-6. 12. Lilleberg, S.L., In-depth mutation and SNP discovery using DHPLC gene scanning. Curr Opin Drug Discov Devel, 2003. 6(2): p. 237-52. 13. Wolford, J.K., et al., High-throughput SNP detection by using DNA pooling and denaturing high performance liquid chromatography (DHPLC). Hum Genet, 2000. 107(5): p. 483-7. 14. Li, Q., et al., Integrated platform for detection of DNA sequence variants using capillary array electrophoresis. Electrophoresis, 2002. 23(10): p. 1499-511. 15. Fakhrai-Rad, H., N. Pourmand, and M. Ronaghi, Pyrosequencing: an accurate detection platform for single nucleotide polymorphisms. Hum Mutat, 2002. 19(5): p. 479-85.

15 16. Ronaghi, M., Pyrosequencing for SNP genotyping. Methods Mol Biol, 2003. 212: p. 189-95. 17. Hochberg, E.P., et al., A novel rapid single nucleotide polymorphism (SNP)-based method for assessment of hematopoietic chimerism after allogeneic stem cell transplantation. Blood, 2003. 101(1): p. 363-9. 18. Sauer, S. and I.G. Gut, Genotyping single-nucleotide polymorphisms by matrix- assisted laser-desorption/ionization time-of-flight mass spectrometry. J Chromatogr B Analyt Technol Biomed Life Sci, 2002. 782(1-2): p. 73-87. 19. Wise, C.A., et al., A standard protocol for single nucleotide primer extension in the human genome using matrix-assisted laser desorption/ionization time-of- flight mass spectrometry. Rapid Commun Mass Spectrom, 2003. 17(11): p. 1195- 202. 20. Wittwer, C.T., et al., High-resolution genotyping by amplicon melting analysis using LCGreen. Clin Chem, 2003. 49(6 Pt 1): p. 853-60. 21. Allawi, H.T. and J. SantaLucia, Jr., Nearest neighbor thermodynamic parameters for internal G.A mismatches in DNA. Biochemistry, 1998. 37(8): p. 2170-9. 22. Allawi, H.T. and J. SantaLucia, Jr., Thermodynamics of internal C.T mismatches in DNA. Nucleic Acids Res, 1998. 26(11): p. 2694-701. 23. Allawi, H.T. and J. SantaLucia, Jr., Nearest-neighbor thermodynamics of internal A.C mismatches in DNA: sequence dependence and pH effects. Biochemistry, 1998. 37(26): p. 9435-44. 24. Allawi, H.T. and J. SantaLucia, Jr., Thermodynamics and NMR of internal G.T mismatches in DNA. Biochemistry, 1997. 36(34): p. 10581-94. 25. Bommarito, S., N. Peyret, and J. SantaLucia, Jr., Thermodynamic parameters for DNA sequences with dangling ends. Nucleic Acids Res, 2000. 28(9): p. 1929-34. 26. Peyret, N., et al., Nearest-neighbor thermodynamics and NMR of DNA sequences with internal A.A, C.C, G.G, and T.T mismatches. Biochemistry, 1999. 38(12): p. 3468-77. 27. SantaLucia, J., Jr., H.T. Allawi, and P.A. Seneviratne, Improved nearest-neighbor parameters for predicting DNA duplex stability. Biochemistry, 1996. 35(11): p. 3555-62. 28. SantaLucia, J., Jr., A unified view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics. Proc Natl Acad Sci U S A, 1998. 95(4): p. 1460-5. 29. Highsmith, W.E., Jr., et al., Use of a DNA toolbox for the characterization of mutation scanning methods. I: construction of the toolbox and evaluation of heteroduplex analysis. Electrophoresis, 1999. 20(6): p. 1186-94.

16 FIGURE LEGEND

Figure 1. Schematic representation of method used to confirm genotypes of concordance study. Thick line-wild type (WT), thin line-mutant (MUT), and open squares- heterozygous (HET). The labelled arrows indicate where curves must lie in order to be designated a specific genotype.

Figure 2. Normalized high resolution melting curves of different types of SNPs amplified from the DNA toolbox. A) Homozygous SNPs, B) Heterozygous SNPs and C)

Homozygous and heterozygous SNPs. Curves are all shown in triplicate.

Figure 3. Derivatized melting curve analysis of Factor V samples comparing the

LightCycler (A) to the HR1 (B). Thick line: wild type(wt), thin line: heterozygous(het), line with squares: mutant(mut) and gray line: no template control.

Figure 4. Normalized high resolution melting curves from prothrombin(A), factor V(B),

MTHFR1298(C), H63D(D) and HbC/HbS(E). Each genotype is shown in triplicate, with each replicate represented by either a square, triangle or diamond. Grey filled symbols denote wild type samples, black filled symbols denote mutant samples and the open symbols denote the heterozygous samples.

17 Table 1. Primer sequences, amplicon size and thermal cycling conditions used for each clinical marker. SNP 5’3’ PRIMER SEQUENCE (AMPLICON THERMAL SIZE) CYCLING Prothrombin 5’3’ GTTCCCAATAAAAGTGACTCTCAG Ta=63ºC, 39 3’5’ GCACTGGGAGCATTGAGG (45bp) cycles.

Factor V 5’3’ CAGATCCCTGGACAGG Ta=55ºC, 32 3’5’ CAAGGACAAAATACCTGTATTC cycles. (43bp)

MTHFR A1298C 5’3’ GGAGGAGCTGACCAGTGAA Ta=55ºC, 35 3’5’ AAGAACAAAGACTTCAAAGACACTT cycles. (46bp)

H63D 5’3’ CCAGCTGTTCGTGTTCTATGAT Ta=63ºC, 35 3’5’ CACACGGCGACTCTCAT(40bp) cycles.

-globin 5’3’ Ta=60ºC, 35 3’5’ cycles.

Table 2. Marker list with number of samples within each genotype and genotypes identified by ARUP and using LightCycler Green I (LCG-I) and the HR1 instrument(HR1).

MARKER GENOTYPES ARUPa LCG-I/HR1b Factor V Wild type 35 35 Heterozygous 35 35 Mutant 34 34

Prothrombin Wild type 8 8 Heterozygous 3 3 Mutant 11 11

MTHFR1298 Wild type 7 7 Heterozygous 7 7 Mutant 7 7

H63D Wild type 6 6 Heterozygous 6 6 Mutant 6 6 a Number of samples identified by ARUP as a particular genotype b Number of samples identifed as a particular genotype using LightCycler Green I and HR1 instrument.