Isolation and Characterization of Mscs

Isolation and characterization of MSCs

Clinical-grade MSCs were generated under good manufacturing practice conditions.

Human bone marrow samples donated from healthy donors were used to isolate and expand MSCs after informed consent.

Human MSCs were isolated and cultured as previously described1-3. In brief, 20-30ml bone marrow was diluted 1:1 with human MSC growth medium (consisting of low glucose Dulbecco’s modified Eagle’s medium (L-DMEM; Hyclone, Logan, UT, USA) and 10% fetal bovine serum (FBS; Hyclone)). Marrow mononuclear cells were separated by Ficoll-Paque (1.077 g/mL; Amersham Biosciences, Uppsala, Sweden) density gradient centrifugation and seeded at a density of 1x105/cm2 into T75 cell culture flasks. When cells grew to 80% confluence, they were detached by trypsin-

EDTA designated as passage 1. These cells were further passaged at a ratio of 1:3.

The culture-expanded MSCs expressed CD29, CD44, CD73, CD90, CD105 and

CD166, but not CD34 or CD45. They could be induced to differentiate into cells of osteogenic, adipogenic lineages under proper induction medium (Figure S1). All the cells have shown a normal karyotype at passage 3 and 6, were clinically used at passage 4 or 5. Cells at passage 4 or 5 were used in this study.

To examine the proliferation capacity of MSCs in vitro, the population doubling time(PDT) was measured at passage 3 and 6. In brief, 2ml of cell suspension was plated onto a 6-well plate at 2×104 cells/well and cultured for 7-10 days. Viable cells

(as determined by trypan blue exclusion) were counted by Cellometer Auto T4 automated cell counters (Nexcelom Bioscience, Lawrence, MA, USA). Cell counts were performed at each passage and population doublings calculated using the

formula (t−t0)∙log2/(logN−logN0), where t−t0 is culture time (h), N is the number of

harvested cells and N0 is the number of cells in the initial. The population doubling time (PDT) of MSCs was 33.1±3.88 hrs at passage 3 and 36.7±5.07 hrs at passage 6

(Figure S2).

Criteria for release of mesenchymal stem cells for clinical use included: normal karyotypes, absence of visible clumps, sterility - negative for bacteria and fungi, no detectable mycoplasma and endotoxin, cell viability greater than 95%, cell purity- the expression of CD29, CD44, CD73, CD90, CD105 and CD166 ( >90%) and the lack of CD34 and CD45 (<5%).

Assessment of cGVHD patients

In 2005, the National Institutes of Health (NIH) developed a cGVHD score which used a score of 0 to 3 from mild to severe, and this was validated in a subsequent study4. In the present study, the NIH’s consensus criteria was also used for cGVHD diagnosis, organ scoring, and global assessment of chronic

GVHD status before the MSCs treatment and each follow-up visit 5. The evaluations of seven organs (skin, mouth, eye, gastrointestinal [GI] tract, liver, lung and joints) were carried out at least two clinicians independently.The average score of seven organs (average NIH score) was calculated as evaluation of the global severity of the disease. Objective assessment of cGVHD severity including ocular and modified oral Schirmer tests, oral mucosal scoring 6, the NIH skin response scale according to percentage of body surface area (BSA) involved with erythematous rash, movable sclerosis and non movable sclerosis7, pulmonary function tests, liver function tests and radiographic measurements.

Additionally, all recipients were required to complete a validated self- administered symptom scale assessment8.

The response to MSC treatment was defined as follows: CR was defined as the resolution of all clinical manifestations and laboratory data of the involved organs; PR was defined as improvement by at least one point in the involved organ or more than 50% improvement of clinical laboratory data of the involved organs without CR; minor partial response (mPR) was defined as improvement less than one point in the involved organ or less than 50% but more than 25% improvement of laboratory data; NR was defined as deterioration, no improvement of clinical manifestations, or less than 25% improvement of laboratory data.

Proliferation assay Isolated CD3+ T lymphocytes were stained using the CellTrace™ CFSE Cell

Proliferation kit (stain concentration of 5 μΜ; Invitrogen) according to the manufacturer’s instructions. Sorted CD5+ B cells were cultured in replicate wells either alone or in the presence of LPS (10 μg/ml) for 24 hours. Labeled CD3+ T cells were cultured in triplicate in 96-well plates. The culture conditions included labeled CD3+ T cells alone, labeled CD3+ T cells in the presence of isolated B cells (2:1 ratio), or labeled CD3+ T cells in the presence of LPS-activated B cells (2:1 ratio). All T cells were stimulated with an anti-CD3 mAb(0.2 μg/ml, BD Biosciences Pharmingen) and an anti-CD28 mAb (1 μg/ml, BD Biosciences Pharmingen) for 96 hours. T cell proliferation was evaluated by flow cytometric analysis of CFSE dilutions.

CD5+ B cells and CD5- B from healthy donors were isolated and stimulated by LPS

(10μg/ml, Sigma) in the absent or present of MSCs. Cells were stained with the Click- iT® EdU Alexa Fluor® 647 Cell Proliferation Assay Kit (stain concentration of

10μΜ;Molecular Probes, Invitrogen) according to the manufacturer’s instructions.

After cultured for 96 hours, CD5+ B cells and CD5- B were analyzed by flow cytometry.

Survival assay

CD5+CD19+ B cells and CD5-CD19+ B cells were separately isolated from healthy donors and cGVHD patients using an Influx cell sorter. Sorted cells were divided into two groups and were either cultured alone or co-cultured with MSCs at a 1:4 ratio in

24-well plates. After 96 hours of culture, the extent of B cell survival was measured by the flow cytometric analysis of annexin V and propidium iodide (PI) staining (BD

Biosciences Pharmingen). The data were analyzed using FlowJo 7.6 software. Blocking experiments were performed by culturing the cells with 10 μg/ml anti-IL-10 mAb

(R&D Systems), 10 μg/ml anti-IL-6 mAb (R&D Systems), 1 mM 1-methyl-DL- tryptophan (DL-1 MT, Sigma), 1 mM 1-methyl-D-tryptophan (D-1 MT, Sigma), 1 mM 1-methyl-L-tryptophan (L-1 MT, Sigma), or 1 μM NS398 (Sigma). High-performance liquid chromatography (HPLC)

MSCs were cultured in L-DMEM without or with 2.5 ng/ml IFN-γ for 72h, IDO enzyme activity of MSCs was measured by high-performance liquid chromatography

(HPLC; Alliance Separations Module 2690; Waters,Milford, MA). In addition, IDO activity was quantified in CD5+ B cell/MSC and CD5- B cell/MSC coculture systems by HPLC. Tryptophan was detected by fluorescence at 285-nm excitation and 365-nm emission wavelengths, kynurenine was detected by UV absorption at 360 nm. Peak area values for kynurenine and tryptophan were determined and the results for IDO activity were shown as a kynurenine/tryptophan ratio.

Western blot

After cultured for 72h in different conditions (alone, with IFN-γ, with resting CD5+ B cells, with activated CD5+ B cells by LPS, with resting CD5- B cells or with activated CD5- B cells by LPS), MSCs lysates were prepared and centrifuged at 4°C.

The proteins were separated by SDS-PAGE and transferred to PVDF membrane. After blocking, the membrane was incubated with rabbit anti-IDO1 antibody (Cell

Signaling Technology), and then incubated at room temperature with secondary antibodies. Antigen–antibody complexes were detected by enhanced chemiluminescence (GE Healthcare Biosciences, USA).

Silencing of IDO1 in MSCs in vitro using IDO-siRNA

To knockdown IDO1, the target sequence of IDO mRNA sequence (UUAACUUCUCAACUCUUUCUC) was selected on the basis of unique sequence and transfection of siRNA was processed as described previously9. In brief, 50 μl of

OptiMEM I® was combined with 1μl LIPOFECTAMINE 2000™. 50 μl of OptiMEM

I® was combined with 1.25μl of 20μM IDO1 siRNA. These two solutions were then combined and complexed (all transfection materials from Invitrogen).After 20 min of complexing, the 100μl OptiMEM I®/IDO siRNA/LIPOFECTAMINE 2000™ mixture was added to the culture per well. The sequences were listed as follows: sense,5′-TTAACTTCTCAACTCTTTCTC-3′, antisense,5′- GAAAGAGTTGAGAAGTTAAAC-3′;

Non targeting control (NTC) sequence: sense,5’-AACAAGATGAAGAGCACCAA-3’, antisense,5’-

TTGGTGCTCTTCATCTTGTT-3’.

Transfected MSCs were plated into 6-well plates for 12 hours, then co-cultured with

CD5+ B cells or CD5- B cells for additional 60 hours. MSCs and B cells were harvested respectively. The knockdown efficiency of IDO1 in MSCs was validated by qRT-PCR; the proliferation or survival of CD5+ B cells or CD5- B cells was measured by flow cytometry.

References

1. Weng JY, Du X, Geng SX, Peng YW, Wang Z, Lu ZS, et al.Mesenchymal stem cell

as salvage treatment for refractory chronic GVHD. Bone Marrow Transplant

2010; 45(12): 1732-1740.

2. Yu W, Chen Z, Zhang J, Zhang L, Ke H, Huang L, et al. Critical role of phosphoinositide 3-kinase cascade in adipogenesis of human mesenchymal stem

cells. Mol Cell Biochem 2008; 310(1-2): 11-18.

3. Zhang AX, Yu WH, Ma BF, Yu XB, Mao FF, Liu W, et al. Proteomic identification

of differently expressed proteins responsible for osteoblast differentiation from

human mesenchymal stem cells. Mol Cell Biochem 2007; 304(1-2): 167-179.

4. Baird K, Steinberg SM, Grkovic L, Pulanic D, Cowen EW, Mitchell SA, et al.

National Institutes of Health chronic graft-versus-host disease staging in severely

affected patients: organ and global scoring correlate with established indicators of

disease severity and prognosis. Biol Blood Marrow Transplant 2013; 19(4): 632-

5. Filipovich AH, Weisdorf D, Pavletic S, Socie G, Wingard JR, Lee SJ, et al.

National Institutes of Health consensus development project on criteria for

clinical trials in chronic graft-versus-host disease: I. Diagnosis and staging

working group report. Biol Blood Marrow Transplant 2005; 11(12): 945-956.

6. Piboonniyom SO, Treister N, Pitiphat W, Woo SB. Scoring system for monitoring

oral lichenoid lesions: a preliminary study. Oral Surg Oral Med Oral Pathol Oral

RadiolEndod 2005; 99(6): 696-703.

7. Pavletic SZ, Martin P, Lee SJ, Mitchell S, Jacobsohn D, Cowen EW, et al.

Measuring therapeutic response in chronic graft-versus-host disease: National

Institutes of Health Consensus Development Project on Criteria for Clinical Trials

in Chronic Graft-versus-Host Disease: IV. Response Criteria Working Group

report.Biol Blood Marrow Transplant 2006; 12(3): 252-266. 8. Lee S, Cook EF, Soiffer R, Antin JH. Development and validation of a scale to

measure symptoms of chronic graft-versus-host disease.Biol Blood Marrow

Transplant 2002; 8(8): 444-452.

9. Ohki EC, Tilkins ML, Ciccarone VC, Price PJ. Improving the transfection

efficiency of post-mitotic neurons. J Neurosci Methods 2001; 112(2): 95-99.