Induction of Vascular Inflammation by Sphingosine-1-Phosphate Receptor 2

Critical Role of Sphingosine-1-Phosphate Receptor 2 (S1PR2) in Acute Vascular

Inflammation

Short title: S1PR2 regulates vascular inflammation

Guoqi Zhang1, Li Yang1, Gab Seok Kim1, Kieran Ryan1, Shulin Lu2, Rebekah O’Donnell3,

Katherine Spokes3, William C Aird3, Nathan Shapiro2, Kiichiro Yano2, # and Teresa Sanchez1*.

1Departments of Surgery and Emergency Medicine,

2Department of Emergency Medicine,

3Department of Medicine,

1, 2, 3 Departments of Surgery and Emergency Medicine, The Center for Vascular Biology

Research, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, MA, USA

#Current affiliation: Cardiovascular-Metabolic Research Laboratories Daiichi-Sankyo, Tokyo

140-8710, Japan.

Correspondence: Teresa Sanchez, PhD, Beth Israel Deaconess Medical Center, 99 Brookline

Ave, Boston, MA 02215, USA; email: [email protected] ; phone: 617-667-1601,

FAX: 617-667-2913

Text word count:

Abstract word count: 200

Number of Figures: 7

Number of Tables: 1

Number of References: 50

Scientific Category: Vascular Biology

1 KEY POINTS

Endothelial S1PR2 plays a critical role in the induction of vascular permeability and vascular inflammation during endotoxemia.

S1PR2 could be a novel therapeutic target to promote vascular integrity in inflammatory vascular disorders.

ABSTRACT

The endothelium, as the interface between blood and all tissues, plays a critical role in inflammation. Sphingosine-1-phosphate (S1P) is a bioactive sphingolipid highly abundant in plasma, which potently regulates endothelial responses through the interaction with its receptors

(S1PR). Here, we aimed to study the role of S1PR2 in the regulation of the proadhesion and proinflammatory phenotype of the endothelium.

Using genetic approaches and a S1PR2 specific antagonist (JTE013), we found that

S1PR2 is essential for the permeability and inflammatory responses of the vascular endothelium during endotoxemia. Experiments with bone marrow chimeras (S1pr2+/+ to S1pr2+/+, S1pr2+/+ to

S1pr2-/- and S1pr2-/- to S1pr2+/+) indicate the critical role of S1PR2 in the stromal compartment, in the regulation of vascular permeability and vascular inflammation. In vitro, JTE013 potently inhibited TNF--induced endothelial inflammation. Lastly, we provide detailed mechanisms on the downstream signaling of S1PR2 in vascular inflammation: the novel activation of the stress activated protein kinase pathway by S1PR2 in the endothelium, which, together with the Rho

Kinase-Nuclear Factor Kappa B pathway, is required for S1PR2-mediated endothelial inflammation. Our data indicate that S1PR2 is a key regulator of the proinflammatory phenotype of the endothelium and identify S1PR2 as a novel therapeutic target for vascular disorders.

2 INTRODUCTION

Sphingosine-1-phosphate (S1P), a bioactive sphingolipid present at high levels (within the range of several hundred nanomolar) in plasma and lymph, is generated from the metabolism of sphingomyelin through the actions of sphingomyelinase, ceramidase and sphingosine kinase (SPHK)1. Although platelets store high amounts of S1P, it has recently been shown that the main sources of plasma S1P are erythrocytes 2 and endothelial cells3. Both cell types exhibit high levels of SPHK activity. S1P mediates multiple cellular responses in many different cell types by activating the endothelial differentiation gene family of G protein-coupled receptors (GPCR), renamed as S1PR1-5. S1P receptors (S1PR) bind their ligand within the low nanomolar range (the KD of S1P for S1PR ranges from 8-27nM). Since endothelial cells express

S1PR1, S1PR2 and S1PR3, plasma S1P can bind and activate these receptors in the endothelium. In addition, the fact that endothelial cells are one of the main sources of plasma

S1P suggests that cell-autonomous S1P signaling may play a role in vascular homeostasis. The role of S1P in vascular development is well illustrated by the SphK-1 and -2 null mice, which lack S1P and exhibit severely disturbed angiogenesis resulting in embryonic lethality 7 and by the

S1pr1 null mice, which exhibit a defect in vascular maturation8. In adult mice and humans,

S1PR1 is critical for the regulation of vascular permeability and lymphocyte trafficking 11. In fact, the recently FDA-approved Fingolimod, is a potent immunosuppressant which targets S1PR1. In contrast to S1PR1, S1PR2 is not required for embryonic vascular development and S1pr2-/- mice are viable and develop normally12. However, S1pr2 null mice exhibit hearing impairment and vestibular defects. In addition, S1PR2 plays a critical role in pathological angiogenesis in mouse ischemic retinas15.

S1PR activate different intracellular signaling pathways and differentially regulate endothelial cell function. S1PR1 couples to Gi and activates the phosphatidylinositol-3-kinase

(PI3K) pathway16, Rac, cortical actin assembly and cell migration17. This pathway is essential for vascular stabilization8 and inhibition of vascular permeability . In sharp contrast, we recently 3 found that S1PR2 antagonizes S1PR1-Gi-PI3K signaling in the endothelium through activation of the G12/13-Rho-Rho kinase (ROCK)-PTEN pathway. Indeed, the Rho-ROCK-PTEN pathway is critical for the inhibition of endothelial cell migration and the induction of vascular permeability by

S1PR218. These studies indicate that the balance between S1PR1 and S1PR2 signaling in a specific vascular bed will determine the endothelial responses to S1P. Therefore, a better understanding of how S1P receptor signaling is regulated in health and disease should provide an important foundation for developing novel therapies for vascular disorders.

During inflammation, the endothelium becomes activated and orchestrates a series of responses to adapt and to promote the innate immune response. One such early response is permeability, which is an important component of angiogenesis and inflammation. In addition, endothelial cells acquire a procoagulant phenotype in order to help limit the spread of the injury.

If the injury persists, uncontrolled responses will result in endothelial dysfunction, which plays a critical role in the pathophysiology of sepsis, diabetic vasculopathy, atherosclerosis, ischemia- reperfusion injury and allograft rejection, among others. Our previous work demonstrates that

S1PR play a critical role in the regulation of the permeability responses of the endothelium. In this study, we aimed to investigate the role of S1PR2 in acute vascular inflammation. We characterize S1PR2 as a novel regulator of vascular inflammation that is critical for the induction of the permeability and proadhesion phenotypes of the endothelium during endotoxemia. Our findings emphasize the critical role of S1PR2 in endothelial responses to injury and highlight the potential utility of pharmacologic targeting of S1PR2 in the therapy of vascular inflammatory disorders.

4 MATERIALS AND METHODS

Mice, generation of bone marrow chimeras, plasma isolation, vascular permeability assay, peripheral cell blood counts, tissue digestion and flow cytometry, RNA isolation and quantitative

TaqMan PCR analysis, preparation of frozen tissue, sectioning and immunohistochemistry, endothelial cell isolation, culture and adenoviral transduction, Western Blot analysis, monocyte adhesion assays and statistical analysis are described in detail in the supplementary information.

5 RESULTS

S1PR2 deficiency results in lower expression of inflammatory and coagulation mediators during endotoxemia.

To study the role of S1PR2 in vascular inflammation we used a mouse model of severe, sublethal, lipopolysaccharides (LPS) challenge. S1pr2+/+ and S1pr2-/- mice were administered

LPS intraperitoneally to induce endotoxemia and systemic inflammation. Plasma was collected

2, 6 and 18 hours after LPS injection. Lack of S1PR2 had no effect on LPS-mediated induction of plasma levels of the inflammatory cytokine, IL-6, at early time points (Figure 1A). However, cytokine levels fell more rapidly in S1pr2-/- mice compared to their wild type littermates (12.9±2.5 and 47.2±8.6 ng/mL in S1pr2-/- and S1pr2+/+, respectively, at 18 hours). Interestingly, lack of

S1PR2 blunted the induction of vascular permeability by LPS in the lung, kidney, spleen and heart vascular beds, as assessed by the Evans Blue Dye (EBD) extravasation assay (Figure 1B,

6 hours after LPS injection).

Peripheral blood cell counts were also determined under basal conditions, 4 hours and

18 hours after LPS injection in wild type and S1PR2 null mice (Supplementary Figure 1). In wild type mice, total leukocyte, neutrophil, monocyte and lymphocyte counts decreased 4 hours after

LPS injection, due to the recruitment of leukocytes to sites of inflammation. 18 hours after LPS injection, peripheral neutrophil and monocyte numbers increased (due to mobilization of cells from the bone marrow) while lymphocyte numbers remained low. In S1pr2-/- mice, no differences in cell blood counts were observed under basal conditions and 4 hours after LPS injection, compared to S1pr2+/+ mice. However, 18 hours after LPS injection, total leukocyte, neutrophil and monocyte counts were lower in S1pr2 null mice compared to wild type mice, consistent with the faster resolution of the inflammatory response observed in mice lacking S1PR2. Lymphocyte numbers were similar in S1pr2-/- compared to S1pr2+/+ mice 18 hours after LPS injection.

(Supplementary Figure 1). Flow cytometry analysis of minced and digested organs showed little difference in CD45+ leukocyte presence in the liver, kidney, or bronchoalveolar lavage of 6 wildtype or S1pr2 null animals 16 hours after LPS injection (Supplementary Figure 2A). Lungs of

S1pr2-/- animals treated with LPS showed a significant decrease in the percentage of CD45+ cells. The composition of the leukocyte infiltrate was altered 16 hours post-LPS injection in both

S1pr2+/+ and S1pr2-/- animals, with significant increases in neutrophils in liver, lung, and kidney.

(Supplementary Figure 2B). Lungs of wild type animals treated with LPS displayed a decrease in F4/80+CD11b+CD11c- macrophages/monocytes, with an increase in this population in the bronchoalveolar lavage (Supplementary Figure 2C). There were no significant changes in alveolar macrophages (F4/80+CD11b+CD11c+) in lung or bronchoalveolar lavage (data not shown). Kidneys in both groups showed a decrease in F4/80+CD11b+ macrophages. Altogether these data indicate that circulating leukocytes from both wild type and S1pr2 null mice similarly respond to the LPS challenge by infiltrating into the tissues. However, rebound neutrophilia and monocytosis were significantly decreased in S1pr2-/- mice. In addition, the permeability response of the vascular endothelium was blunted in mice lacking S1PR2.

Intraperitoneal injection of LPS resulted in increased mRNA levels of proinflammatory (E- selectin, vascular cell adhesion molecule [VCAM]-1, intercellular adhesion molecule [ICAM]-1, and monocyte chemotactic protein [MCP]-1]) and procoagulation (tissue factor [TF]) mediators in several organs, including the liver, lung and kidney, 18 hours after LPS injection. Compared to wild type, S1pr2 null mice exhibited significantly lower mRNA levels of adhesion molecules, coagulation and inflammatory markers. In the liver, knockout of S1pr2 significantly attenuated the effect of endotoxemia on mRNA expression of E-selectin, VCAM-1 and MCP-1 (66.1%,

40.9%, and 62.5% inhibition, respectively; figure 1C). In the lungs, LPS-mediated induction of

VCAM-1, ICAM-1, TF and MCP-1 expression was significantly decreased in S1pr2-/- compared to wild type (63.6%, 55.4%, 42.1% and 79.6% inhibition; respectively, figure 1D). Finally, in the kidney, lack of S1PR2 resulted in decreased mRNA levels of E-selectin, VCAM-1, ICAM-1, TF and MCP-1 compared to their wild type littermates (45.6%, 56.2%, 61.6%, 59.5% and 76.2% inhibition, respectively; figure 1E). Without LPS administration, there was no difference in 7 baseline gene expression between wild type and S1pr2 null mice. Altogether, these data indicate that lack of S1PR2 results in a dramatic decrease in vascular permeability, a faster drop in cytokine levels and lower expression of adhesion molecules, proinflammatory and procoagulant mediators in several organs during systemic inflammation.

Immunohistochemical analysis of wild type kidneys showed upregulation of adhesion molecules 18 hours after LPS injection. More specifically, we observed E-selectin immunoreactivity in arteriolar, glomerular and peritubular capillary endothelium. However, very low levels of E-selectin were detected in the S1pr2-/- kidneys (Figure 2A). VCAM-1 expression was induced in arterioles, glomeruli, peritubular capillaries and venules in wild type kidneys, while much lower VCAM-1 immunoreactivity was found in S1pr2-/- kidneys, especially in the peritubular capillaries and glomeruli (Figure 2B). ICAM-1 was upregulated in arterioles, glomeruli, peritubular capillaries and venules in wild type kidneys 18 hours after LPS injection.

However, much less intense ICAM-1 immunoreactivity was found in glomeruli and peritubular capillaries of S1pr2-/- kidneys (Figure 2C). Consistent with previous reports, increased TF immunoreactivity was observed in tubular epithelial cells, infiltrating leukocytes, as well as in arteriolar endothelium in wild type kidneys 18 hours after LPS injection, while much lower levels were detected in S1pr2-/- kidneys (Figure 2D). TF was not detected in glomeruli. Finally, MCP-1 immunoreactivity was detected in a characteristic dot-like pattern mainly in glomeruli, infiltrating leukocytes and endothelial and vascular smooth muscle cells from arterioles upon LPS injection

(Figure 2E). In contrast, in S1pr2-/- kidneys, MCP-1 immunoreactivity was markedly reduced in all these cellular compartments.

In the liver, 18 hours after LPS injection, E-selectin immunoreactivity was found mainly in venules, while VCAM-1 and ICAM-1 were detected in venules and liver sinusoids

(Supplementary Figure 3). Immunoreactivity for these three markers was markedly reduced in

S1pr2-/- livers compared to wild type. Consistent with previous findings 23, TF was not detected in endothelial cells in the liver. TF positive cells in livers from LPS-treated mice were mainly 8 leukocytes and immunoreactivity was less intense in S1pr2-/- compared to wild type. MCP-1 immunoreactivity was increased in hepatocytes, some venules and infiltrating leukocytes in wild type mice after LPS treatment, while much lower levels were detected in S1pr2-/- mice.

Altogether, our data indicate that the levels of proinflammatory and procoagulant markers in the vascular endothelium, parenchymal cells and leukocytes are significantly lower in S1pr2 null mice 18 hours after LPS injection.

Pharmacologic inhibition of S1PR2 signaling by JTE013 results in lower expression of inflammatory and coagulation mediators during endotoxemia

Next, we tested the effects of pharmacological inhibition of S1PR2 on vascular inflammation during endotoxemia. Wild type C57BL/6 mice were administered by gavage, 30 mg/kg of the S1PR2 antagonist, JTE013, just before intraperitoneal administration of LPS. 18 hours after LPS administration, plasma was collected for assessment of IL-6 levels. In agreement with our data in S1pr2 null mice, JTE013 administration resulted in more rapid recovery of plasma IL-6 levels (24.02±3.84 ng/mL and 62.96±4.32 ng/mL in JTE013-treated and vehicle-treated mice, respectively, at 18 hours; Figure 3A). In addition, pharmacological inhibition of S1PR2 abrogated the induction of vascular permeability in lung, kidneys, spleen and heart, 6 hours after LPS injection, as assessed by the EBD extravasation assay (Figure

3B). We also measured the mRNA levels of adhesion molecules, inflammatory and coagulation markers by quantitative PCR analysis. JTE013-treated mice displayed lower mRNA levels of adhesion molecules, inflammatory and coagulation markers in liver, lungs and kidneys. More specifically, in liver, JTE013 treatment resulted in decreased expression of E-selectin (72% inhibition) and MCP-1 (81.1% inhibition) (Figure 3C). VCAM-1, ICAM-1, TF and MCP-1 levels were significantly lower in lungs from JTE013-treated mice compared to vehicle-treated mice

(32%, 40%, 30.7% and 81.7% of inhibition, respectively, Figure 3D). Finally, E-selectin, VCAM-

1, ICAM-1, TF and MCP-1 mRNA levels were lower in S1pr2-/- kidneys compared to wild type

(41%, 40%, 61%, 87.2% and 85.7% inhibition, respectively). Immunohistochemical analysis of 9 kidneys and livers from JTE013 and LPS-treated mice indicates lower expression of proinflammatory molecules compared to mice treated with LPS alone (Supplementary Figures 4 and 5), similar to S1pr2 null mice.

Altogether our data indicate that genetic deletion or pharmacological inhibition of S1PR2 abrogates the permeability responses of the vascular endothelium and results in a significant decrease in endothelial adhesion molecule expression as well as proinflammatory and procoagulation markers 18 hours after LPS injection.

Critical role of S1PR2 in the stromal compartment in the permeability and inflammatory phenotype of the endothelium during endotoxemia

In order to elucidate the contribution of S1PR2 in the hematopoietic and stromal compartments to acute vascular inflammation we reconstituted irradiated S1pr2-/- mice with wild type bone marrow (S1pr2+/+  S1pr2-/-) and wild type mice with S1pr2-/- bone marrow (S1pr2-/- 

S1pr2+/+). S1pr2+/+ mice reconstituted with S1pr2+/+ bone marrow (S1pr2+/+  S1pr2+/+) were used as controls. S1pr2+/+  S1pr2+/+, S1pr2+/+  S1pr2-/- and S1pr2-/-  S1pr2+/+ chimeras equally developed systemic inflammation 2 hours after LPS injection, as assessed by the levels of IL-6 in plasma (Figure 4A). Similar to S1pr2-/- mice, in the S1pr2+/+  S1pr2-/- chimeric mice, inflammation resolved faster compared to S1pr2+/+  S1pr2+/+ or to S1pr2-/-  S1pr2+/+ chimeras

(Fig. 4A, 18 h after LPS injection). Despite high plasma IL-6 levels in all three groups of mice 2 hours after LPS injection (Figure 4A), vascular permeability was significantly lower in liver, lung and heart only in the S1pr2+/+  S1pr2-/- chimeric mice compared to the control chimeras

(S1pr2+/+  S1pr2+/+) (Figure 4B). Less vascular leakage was observed in the spleen of S1pr2-/-

 S1pr2+/+ chimeras. No differences in vascular permeability were found in kidney among these three groups, possibly due to the development of radiation induced nephropathy and the lack of involvement of S1PR2 in this condition, which progressively develops after total body irradiation25. These data indicate the critical role of S1PR2 signaling in the stromal compartment

10 in the regulation of vascular permeability and resolution of systemic inflammation during endotoxemia.

Next, we measured the mRNA levels of proinflammatory and procoagulation mediators in liver, lung and kidney. In the liver, the S1pr2+/+  S1pr2-/- chimeric mice exhibited significantly lower expression of E-selectin, ICAM-1, TF and MCP-1, compared to S1pr2+/+  S1pr2+/+ (Figure

4C). On the contrary, the levels of these proinflammatory markers were similar in S1pr2-/- 

S1pr2+/+ mice compared to S1pr2+/+  S1pr2+/+. In the lungs, similar to what we observed in

S1pr2-/- mice, lower levels of VCAM-1, ICAM-1, TF and MCP-1 were observed in the S1pr2+/+ 

S1pr2-/- chimeras compared to S1pr2+/+  S1pr2+/+ (Figure 5D). In contrast, only lower levels of

ICAM-1 and TF were observed in the S1pr2-/-  S1pr2+/+ chimeric mice. Finally, in the kidneys, we found significantly lower expression of ICAM-1, TF and MCP-1 in the S1pr2+/+  S1pr2-/- chimeras, while in the S1pr2-/-  S1pr2+/+ cohort, the levels of all these proinflammatory markers were similar to the S1pr2+/+  S1pr2+/+ group (Figure 4E).

Immunohistochemical analysis of livers from chimeric mice revealed markedly less immunoreactivity for adhesion molecules in venules and liver sinusoids only in the S1pr2+/+ 

S1pr2-/- mice compared to S1pr2+/+  S1pr2+/+ (Figure 5A, B and C). TF immunoreactivity was also significantly lower in infiltrating leukocytes from the S1pr2+/+  S1pr2-/- chimeras (Figure

5D). Finally, significantly lower levels of MCP-1 were detected only in hepatocytes and leukocytes from S1pr2+/+  S1pr2-/- mice (Figure 5E) compared to S1pr2+/+  S1pr2+/+.

In the kidney, significantly lower levels of E-selectin were detected in glomeruli, arterioles, venules and peritubular capillaries only in the S1pr2+/+  S1pr2-/- mice compared to S1pr2+/+ 

S1pr2+/+ (Supplementary Figure 6). Strong immunoreactivity for VCAM-1 and ICAM-1 was observed in all chimeric mice although ICAM-1 staining was less intense in S1pr2+/+  S1pr2-/- chimeras. TF immunoreactivity in kidney epithelial cells was also markedly reduced in S1pr2+/+

11  S1pr2-/- mice. In contrast to non-chimeric mice, TF was not detected in endothelial cells from arterioles in any of the three groups of chimeric mice. Finally, MCP-1 immunoreactivity in arteriolar endothelium, glomeruli and infiltrating leukocytes was significantly less intense in

S1pr2+/+  S1pr2-/- mice compared to S1pr2+/+  S1pr2+/+ or S1pr2-/-  S1pr2+/+.

Altogether, our data indicate that S1PR2 expression in the stromal/endothelial compartment is critical for the induction of vascular permeability, and the sustained expression of proinflammatory and procoagulation markers in several vascular beds during endotoxemia.

S1PR2 plays a critical role in the inflammatory responses of the endothelium in vitro

Given our in vivo findings, we next set out to establish an in vitro model to further assess the role of S1PR2 in the inflammatory responses of the vascular endothelium. Given that Tumor

Necrosis Factor (TNF)- is a critical inflammatory mediator during endotoxemia, we tested the inflammatory responses of HUVEC to TNF-. We found that S1PR2 mRNA was induced upon stimulation with TNF- (4.1±0.5 fold) but not with bFGF (Figure 6A). We also observed a modest increase in S1PR1 levels upon TNF- stimulation (1.9±0.2 fold) and no significant changes in S1PR3 mRNA levels (Figure 6A). In order to study the role of S1PRs in endothelial inflammation, we first analyzed the expression of adhesion molecules (E-selectin, VCAM-1,

ICAM-1), coagulation (TF) and proinflammatory (MCP-1) markers in endothelial cells 12 hours after TNF- stimulation in the absence or the presence of specific S1PR antagonists. We used the specific S1PR2 antagonist, JTE-013, the S1PR1 and S1PR3 antagonist, VPC 23019 26 and the S1PR1-specific antagonist, W14610. Inhibition of S1PR2 signaling during TNF- stimulation by JTE013 potently inhibited the induction of E-selectin, VCAM-1, TF and MCP-1 at 12 hours

(89.3%±1, 59.5% ± 5.3, 73.4%±6.2, 70%±1.5 inhibition, respectively) (Figure 6B, C, E and F). A modest but significant inhibition of ICAM-1 expression was observed (15%±8.4) (Figure 6D). In contrast, the specific S1PR1 antagonist, W146 and the S1PR1 and S1PR3 antagonist, VPC

23019 did not significantly affect the expression levels of these activation markers.

12 Given that our in vitro model demonstrated similar S1PR2-mediated inflammatory responses as to those observed in vivo, we next investigated the functional role of endothelial

S1PR2 in monocyte adhesion to endothelial monolayers, a critical step for the recruitment of leukocytes to sites of inflammation. In agreement with our gene expression data, we found that blockade of S1PR2 signaling by JTE013 during activation of HUVEC with TNF- potently inhibited U937 monocyte adhesion to endothelial monolayers (60±8.4% inhibition, Figure 6G). In contrast, the specific S1PR1 antagonist, W146 and the S1PR1 and S1PR3 antagonist, VPC

23019 did not significantly affect TNF--induced adhesion. Altogether our gene expression data and monocyte adhesion functional data indicate the critical role for S1PR2 in mediating endothelial inflammatory responses.

Activation of the p38 SAPK and NFB pathways by S1PR2 in endothelial cells

Given the critical role of S1PR2 in endothelial inflammation both in vivo and in vitro, we next set out to investigate the biochemical pathways downstream of S1PR2. We have previously shown the strong activation of the Rho GTPase by S1PR2 in endothelial cells18. The

Rho-ROCK pathway has been shown to play a critical role during vascular remodeling and inflammation through the activation of the Stress Activated Protein Kinase (SAPK) and the

Nuclear Factor Kappa B (NFB) pathways31. Given these previously published results, we first tested the activation of p38 SAPK32 by S1PR2 in endothelial cells. First, we upregulated S1PR2 levels in HUVEC by adenoviral transduction to achieve similar mRNA S1PR2 levels compared to S1PR1 in order to counteract S1PR1 signaling, as we have previously described. -

Galactosidase adenovirus (Ad) was used as control. Next, we treated Ad--Galactosidase- or

Ad-S1PR2-transduced HUVEC with several doses of S1P for 10 minutes. We found that S1P did not induce p38 phosphorylation in control adenovirus-transduced HUVEC. However, when

S1PR2 was upregulated, S1P treatment induced dual phosphorylation of p38 SAPK (Thr180 and Tyr182), which is known to result in increased kinase activity33 (Figure 7A). We observed

13 significant upregulation of phospho-p38 SAPK levels at physiological S1P concentrations 34

(3±0.2 fold induction at 100 nM S1P and 9±0.8 fold at 1000 nM for 10 minutes). The extent of phosphorylation of p38 SAPK by S1PR2 activation was similar to that obtained by stimulation with high dose of TNF- (10 ng/mL) for 10 minutes (6.8±1.02 fold, Figure 7A). p38 SAPK phosphorylation peaked after 10 minutes of S1PR2 activation and diminished 30 minutes after ligand stimulation (Figure 7B), in agreement with GPCR receptor internalization and desensitization dynamics. In contrast to a recent report37, S1P did not activate p38 SAPK in

HUVEC even at high doses (up to 10M), unless S1PR2 was upregulated. (Supplementary

Figure 7A).

We also used the axillary lymph node vascular endothelial cell line, SVEC 38, to study

S1PR2 signaling in endothelial cells. SVEC express high levels of endogenous S1PR2 transcript and much lower levels of S1PR1 and S1PR3 (Supplementary Figure 8A). We found that S1P stimulation in the mouse endothelial cell line SVEC resulted in dual Thr180 and Tyr182 p38 phosphorylation (Figure 7C). Pre-incubation with JTE013 abrogated the ability of S1P to induce p38 phosphorylation, indicating that the activation of the p38 SAPK signaling pathway in

SVEC cells is mediated by S1PR2. Altogether our data indicate that activation of S1PR2 in human and mouse endothelial cells results in activation of the p38 SAPK pathway.

Since several reports indicate the role of the GTPase Rho and its effector ROCK in the activation of SAPK39, we aimed to investigate if ROCK was involved in p38 activation by S1PR2 in endothelial cells. In order to study if the activation of p38 SAPK is downstream of the Rho-

ROCK pathway, we used the ROCK pharmacological inhibitor, Y-2763240. As shown in

Supplementary Figure 8B and C, Y-27632 pre-treatment did not inhibit S1P-induced p38 SAPK phosphorylation in S1PR2 transduced HUVEC or SVEC cells, while it efficiently blocked S1P- induced stress fiber formation (data not shown). Consistent with these findings, using a functional assay, we also found that these two pathways are independent and required for the

14 induction of the proadhesion adhesion phenotype of endothelial cells by S1PR2 (Supplementary

Figure 8D).

In order to investigate the role of endothelial S1PR2 in the activation of SAPK pathway during endotoxemia, mouse heart and lung endothelial cells from wild type and S1pr2-/- mice were isolated. In wild type primary mouse heart endothelial cells, S1PR1 transcript was abundantly expressed (79.5 ± 7.8 copies per 106 18S, which is equivalent to approximately 79.5

± 7.8 copies per cell41). In addition, lower levels of S1PR2 transcript were detected (2.25 ± 0.25 copies per cell) (Supplementary Figure 9A). Stimulation with S1P did not significantly induce

SAPK phosphorylation in mouse heart endothelial cells, which is consistent with the high levels of S1PR1 relative to S1PR2. On the contrary, stimulation with plasma from wild type endotoxemic mice for 15 minutes potently induced activation of the p38 SAPK pathway in wild type endothelial cells (Supplementary Figure 9B). In agreement with our in vivo data, we observed a significant decrease in p38 SAPK phosphorylation in S1pr2-/- cells compared to

S1pr2+/+ (25% inhibition). Interestingly, exogenous S1P did not significantly alter the activation of the p38 SAPK pathway by septic plasma, consistent with the activation of SPHK by proinflammatory cytokines and the autocrine actions of S1P in this setting. Altogether our in vitro data indicate that S1PR2 is a critical modulator of the p38 SAPK pathway during inflammation in human and mouse endothelial cells.

Lastly, we investigated the activation of the NF-B pathway by S1PR2, since this pathway has been shown to be activated by several GPCR ligands in a Rho-ROCK dependent manner31. Activation of the NF-B protein complex by inflammatory stimuli requires the degradation of the Inhibitor of κB (IB) proteins, which keep NF- B proteins sequestered in the cytoplasm in an inactive state42. In HUVEC, we found that upregulation of S1PR2 resulted in a modest activation of the NF-B pathway, assessed by degradation of IB-. Ad-S1PR2- transduced HUVEC exhibited lower basal levels of IB- compared to -Galactosidase controls

15 (Figure 7D). Interestingly, in contrast to p38 activation, activation of the NFB pathway by

S1PR2 was dependent on ROCK activity and it was inhibited by Y-27632 (Figure 7D). The

ROCK inhibitor, Y-27632, did not significantly affect I-B- levels in -Galactosidase transduced

HUVEC (data not shown).

Upregulation of S1PR2 levels in HUVEC by adenoviral transduction also resulted in increased expression of adhesion, procoagulant and proinflammatory molecules in a ROCK-,

NFB- and p38-dependent way (Supplementary Figure 10). Next, in order to investigate the functional role of the p38 SAPK, Rho-ROCK and NFB pathways in S1PR2-induced endothelial inflammation we used the in vitro monocyte adhesion assay. We found that, in the absence of

TNF-, upregulation of S1PR2 in HUVEC dramatically increased U937 monocyte adhesion to

HUVEC monolayers (Figure 7E). S1PR2-induced monocyte adhesion was dependent on

ROCK, NFB- and p38 SAPK pathways. Altogether these data indicate that upregulation of

S1PR2 in endothelial cells activates the p38 SAPK and the ROCK-NFkappaB pathways. Both pathways are critical for the induction of vascular inflammation by S1PR2 (Figure 7F).

16 DISCUSSION

The vascular endothelium, as the interface between blood and all tissues plays a critical role in inflammation. During inflammation, cytokines confer a permeability, proadhesive and prothrombotic phenotype in the endothelium. These endothelial responses are carefully orchestrated in order to neutralize the source of injury. However, if the injury persists, these responses may become uncontrolled, resulting in endothelial dysfunction, which plays a critical role in the pathophysiology of vascular disease. The role of the bioactive sphingolipid, S1P, and its receptor, S1PR2 in the regulation of endothelial responses to injury is just beginning to be understood. The first S1P receptor cloned and characterized, S1PR1, is highly expressed in the endothelium under basal conditions, both in vitro and in vivo, and promotes vascular integrity 8-

10. Much less is known about the role of S1PR2 in the vascular endothelium. S1PR2 cooperates with S1PR1 in vascular development12 and it induces vascular permeability18 and pathological angiogenesis15. In this report, we have described the critical role of S1PR2 in endothelial inflammation both in vivo and in vitro.

Using a mouse model of endotoxemia, we have shown by pharmacologic and genetic approaches that S1PR2 plays a critical role in acute vascular inflammation. Wild type and

S1pr2-/- mice similarly responded to LPS injection by increasing plasma levels of proinflammatory cytokines and recruiting leukocytes into the tissues. However, during the early stages of the inflammatory response (3-6 hours after LPS injection), inhibition of S1PR2 signaling dramatically decreased vascular permeability in several vascular beds. This blunted permeability response could contribute to the faster resolution of vascular inflammation observed in the S1pr2-/- mice and wild type mice treated with the S1PR2 specific antagonist

JTE013. In addition, our in vivo data using bone marrow chimeras indicate the critical role of stromal S1PR2 in the regulation of vascular permeability and inflammation during endotoxemia, which is consistent with the role of endothelial S1PR2 in vascular inflammation. Although a recent study demonstrates the role of hematopoietic S1PR2 in the development of 17 atherosclerosis44 the contribution of stromal S1PR2 to acute vascular inflammation has not been investigated. Our in vivo findings, together with our in vitro data indicate the critical role of

S1PR2 in the permeability and inflammatory responses of the endothelium to injury and warrant further investigations into the potential use of a specific S1PR2 antagonist in a number of pathological conditions involving localized or systemic vascular permeability and inflammation, such as sepsis, ischemia-reperfusion injury, diabetic vasculopathy or atherosclerosis.

Our in vitro data indicates that S1PR2 signaling is critical for TNF--induced expression of adhesion and procoagulant molecules and for monocyte adhesion to endothelial monolayers.

Since TNF- is known to activate sphingosine kinase in endothelial cells45 our data are consistent with a model where upon TNF- stimulation, endothelial-generated S1P activates

S1PR2 in an autocrine or paracrine way, contributing to the TNF--induced pro-adhesion and proinflammatory phenotype (Figure 6). In fact, endothelial cells exhibit high sphingosine kinase activity and they are one of the main sources of plasma S1P . In addition, we have previously described the autocrine/paracrine activation of S1PR2 in HUVEC18. Further studies are needed in order to understand the molecular mechanisms that control S1PR2 expression and signaling in the endothelium during inflammation, such as the characterization of the S1PR2 promoter, the post-transcriptional regulation of S1PR2 mRNA, as well as the post-translational modifications of S1PR2 that could regulate receptor signaling, trafficking and localization.

The role of S1P in endothelial inflammation has been controversial. The rate limiting enzyme involved in S1P generation, SPHK-1, is activated in endothelial cells by both proinflammatory mediators such as TNF-45, Thrombin or LPS47, and anti-inflammatory molecules, such as Activated Protein C48and Angiopoietin-149, among others. Although early studies suggested the proinflammatory actions of S1P and SPHK-1 in endothelial cells 45, more recent studies highlight the role of the SPHK-1-S1P-S1PR1 axis in the maintenance of the integrity of the endothelium, which could serve as a negative feedback mechanism to limit the

18 permeability responses of the endothelium to inflammatory stimuli. Our present data address the role of S1PR2 in endothelial inflammation and indicates that S1PR2 plays a critical role in the induction of vascular permeability, which is the early response of the endothelium to injury, as well as in the proadhesion and procoagulant phenotype of the endothelium during inflammation.

Our in vitro data also shed light into the mechanisms whereby S1PR2 contributes to endothelial inflammation. We previously found that S1PR2 strongly activates the GTPase Rho in endothelial cells and increases endothelial permeability by inducing stress fiber formation and disassembly of adherens junctions, in a Rho-ROCK dependent way 18. In addition to its role in actin cytoskeleton dynamics, the Rho-ROCK pathway has also been implicated in vascular remodeling and inflammation through the regulation of gene expression by transcriptional and post-transcriptional mechanisms. For instance, Rho Kinases have been involved in transcriptional regulation of proinflammatory genes during hyperglycemia 28 and to activate both

SAPK and NF--B pathways 29-31. In addition, the GTPase Rho and its effector ROCK have been shown to decrease eNOS mRNA stability, as well as eNOS phosphorylation at Ser-1177 and activity27. In agreement with these findings, we also previously observed the downregulation of eNOS by S1PR2 in endothelial cells15. Our current data describes the activation of the SAPK and ROCK-NFB pathways by S1PR2, which result in endothelial inflammation. Similar to TNF-

-induced expression of proinflammatory molecules in the endothelium, we found that the SAPK and NFB pathways play a critical role in the induction of endothelial inflammation by S1PR2.

Therefore, the regulation of endothelial function by S1PR2 involves not only Rho-ROCK- mediated early changes in permeability but also the regulation of proinflammatory gene expression via SAPK and ROCK-NFB pathways (Figure 7F).

Altogether our present studies indicate that S1PR2 plays a critical role in the permeability, proadhesion and prothrombotic phenotype of the endothelium during systemic inflammation. Therefore, S1PR2 could be a potential new therapeutic target in vascular disease.

19 20 ACKNOWLEDGEMENTS

This work is supported by AHA SDG grant 0630384N and NIH grant HL094465 (to TS).

We would like to thank Dan Li and Dr. Shou-ching Jaminet from the Multi-Gene Transcriptional

Profiling Core Facility at the Center for Vascular Biology Research for the quantitative PCR analysis, Dr. Richard Proia (NIDDK) for providing the S1pr2-/- mice, Dr. Timothy Hla (Cornell

University) for the -Galactosidase and S1PR2 adenoviruses, Dr. Paola Mina-Osorio (The

Feinstein Institute for Medical Research) for technical help with the monocyte adhesion assays and Dr. Michael J Kluk (Brigham and Women’s Hospital, Harvard Medical School) for help with the immunohistochemical analysis.

AUTHORSHIP CONTRIBUTIONS

G.Z. and K.R. performed research, collected data, analyzed data and wrote the manuscript.

L.Y., S.L., R.O. and K.Y. performed research, collected data and analyzed data. K.S. and

G.S.K. performed research. K.Y., N.S. and W.A. designed experiments and edited the manuscript. T.S. designed experiments, performed research, analyzed data, interpreted data and wrote the manuscript.

DISCLOSURE OF CONFLICTS OF INTEREST

The authors declare no competing financial interest.

21 Table 1. Primer sequences for quantitative PCR analysis

Target Genes Sequence of Primers

Mouse E-selectin F: CCGTCCCTTGGTAGTTGCA R: CAAGTAGAGCAATGAGGACGATGT Mouse VCAM1 F: GGAGAGACAAAGCAGAAGTGGAA R: ACAACCGAATCCCCAACTTG Mouse ICAM1 F: GGCACCCAGCAGAAGTTGTT R: GCCTCCCAGCTCCAGGTATAT Mouse Tissue Factor F: ACCGAGTGCGACCTCACAG R: CTCCGTGGGACAGAGAGGAC Mouse MCP-1 F: GCTTCTGGGCCTGCTGTTC R: GTGAATGAGTAGCAGCAGGTGAGT Human S1PR1 F: GCTGCTCAAGACCGTAATTATCG R: ACCAGGAAGTACTCCGCTCTGA Human S1PR2 F: TGGCCGCCTCCGATCT R: GAGAGCAAGGTATTGGCTACGAA Human S1PR3 F: GCCATCGAGCGGCACTT R: GCCTCTTGTTGGCGTCGTAA Human E-selectin F: CTGCCAAGTGGTAAAATGTTCAAG R: CTTGCACACAGTGCCAAACAC Human VCAM1 F: GAATGGGAGCTCTGTCACTGTAAG R: ATTCAATCTCCAGCCGGTCA Human ICAM1 F: CTCCAATGTGCCAGGCTTG R: CAGTGGGAAAGTGCCATCCT Human Tissue Factor F: CAACAGACACAGAGTGTGACCTCA R: AGGAGAAGACCCGTGCCAA Human MCP-1 F: AACCCAAGAATCTGCAGCTAACTT R: GGCATAATGTTTCACATCAACAAAC

22 FIGURE LEGENDS

Figure 1. S1pr2 null mice display decreased inflammation during endotoxemia. A)

Reduced late-stage inflammation in S1pr2-/- mice (KO) compared to wild type (WT) documented by plasma IL-6 levels at various time points following LPS administration. Data are mean ±

SEM, n=4-14. B) LPS-induced vascular permeability is abrogated in mice lacking S1PR2. 6 hours after injection of vehicle (-) or LPS (+), vascular permeability was measured in liver (Li), lungs (Lu), kidneys (Kid), spleen (Spl), heart and brain by EBD extravasation assay. Values are mean ± SEM, n=4. *, P  0.05 compared to the respective untreated controls and where indicated between wild type and S1pr2-/-. C, D and E) Tissue mRNA expression levels of proinflammatory and procoagulant molecules in S1pr2+/+ (WT) and S1pr2-/- (KO) mice 18 hours after vehicle (C) or LPS (LPS) challenge. C) Liver, D) Lung, E) Kidney. The results of quantitative real time PCR analyses (mRNA copy number per 106 copies of 18s rRNA) of E- selectin, VCAM-1, ICAM-1, TF and MCP-1 are shown. Data are mean ± SEM (n=4-5) of one representative experiment out of three with similar results. *, P  0.05 compared to the respective untreated controls (C vs LPS) and where indicated between wild type and S1pr2-/-.

Figure 2. S1pr2 null mice exhibit less vascular inflammation during endotoxemia.

Expression of adhesion molecules, procoagulant and proinflammatory markers in kidneys from control wild type (WT), LPS-treated wild type (WT+LPS) and LPS-treated S1pr2-/- (KO+LPS) mice 18 hours after administration of vehicle or LPS. Immunostaining for E-selectin (A), VCAM-1

(B), ICAM-1 (C), TF (D) and MCP-1 (E). Scale Bar, 50m. Representative fields from n=3-5 mice are shown. a, arteriolar endothelium, g, glomerulus, ptc, peritubular capillary, v, venule, e, epithelial cell, le, leukocyte, vs, vascular smooth muscle cell. Images were captured with the

Axio Imager A1 microscope, using AxioCam MRc camera and the AxioVision 4.8 program (Carl

Zeiss Inc.) (original magnification, 40x).

23 Figure 3. Pharmacological inhibition of S1PR2 by JTE013 results in decreased inflammation during endotoxemia. (A) Reduced plasma IL-6 levels in LPS and JTE013- treated mice (30 mg/kg) (LPS, white bars) compared to LPS and vehicle-treated mice (LPS, black bars). Data are mean ± SEM, n=18. B) LPS-induced vascular permeability is abrogated

JTE013-treated mice. 6 hours after injection of vehicle (-) or LPS (+), vascular permeability was measured in liver (Li), lungs (Lu), kidneys (Kid), spleen (Spl), heart and brain by EBD extravasation assay. Values are mean ± SEM, n=4. *, P  0.05 compared to the respective untreated controls and where indicated between vehicle (V) and JTE013-treated (JTE013) mice.

C, D and E) Tissue mRNA expression levels of proinflammatory and procoagulant molecules in

Vehicle Control (V) and JTE013-treated mice (JTE013) 18 hours after vehicle (C) or LPS (LPS) challenge. C) Liver, D) Lung, E) Kidney. The results of quantitative real-time PCR analyses

(mRNA copy number per 106 copies of 18s rRNA) of E-selectin, VCAM-1, ICAM-1, TF and

MCP-1 are shown. Data are mean ± SEM (n=4-5) of one representative experiment out of three with similar results. *, P  0.05 compared to the respective untreated controls (C vs LPS) and where indicated between V and JTE013.

Figure 4. Critical role of stromal S1PR2 in the permeability and inflammatory phenotype of the endothelium during endotoxemia. A) Reduced late-stage inflammation in S1pr2+/+ 

S1pr2-/- chimeric mice (white bars) compared to S1pr2+/+  S1pr2+/+ (black bars) and to S1pr2-/-

 S1pr2+/+ (grey bars). Plasma IL-6 levels were measured 2 and 18 hours after LPS injection.

Data are mean ± SEM, n=4-7. B) LPS-induced vascular permeability is inhibited in liver, lung and heart of mice lacking S1PR2 in stromal cells (S1pr2+/+  S1pr2-/- ) compared to S1pr2+/+ 

S1pr2+/+, but not in mice lacking S1PR2 in the hematopoietic compartment (S1pr2-/-  S1pr2+/+).

3 hours after injection of LPS, vascular permeability was measured in liver, lungs, kidneys, spleen, heart and brain by EBD extravasation assay. Values are mean ± SEM, n=4-5. *, P 

24 0.05 compared to S1pr2+/+  S1pr2+/+. C, D and E) Tissue mRNA levels of proinflammatory and procoagulant molecules in S1pr2+/+  S1pr2+/+, S1pr2+/+  S1pr2-/- and S1pr2-/-  S1pr2+/+ mice

18 hours after LPS challenge. C) Liver, D) Lung, E) Kidney. The results of quantitative real time

PCR analyses (mRNA copy number per 106 copies of 18s rRNA) of E-selectin, VCAM-1, ICAM-

1, TF and MCP-1 are shown. Data are mean ± SEM (n=6-7). *, P0.05 compared to S1pr2+/+ 

S1pr2+/+.

Figure 5. Immunohistochemical analysis of pro-inflammatory markers in livers from chimeric mice. Immunostaining for E-selectin (A), VCAM-1 (B), ICAM-1 (C), TF (D) and MCP-1

(E) in livers from LPS-treated S1pr2+/+  S1pr2+/+, S1pr2+/+  S1pr2-/- and S1pr2-/-  S1pr2+/+, 18 hours after LPS injection. Scale Bar, 50m. Representative fields from n=3-5 mice are shown. v, venule, s, sinusoid, le, leukocyte, h, hepatocyte. Images were captured with the Axio Imager A1 microscope, using AxioCam MRc camera and the AxioVision 4.8 program (Carl Zeiss Inc.)

(original magnification, 40x).

Figure 6. Critical role of S1PR2 in endothelial inflammation in vitro. A) S1PR1, S1PR2 and

S1PR3 mRNA levels in HUVEC. HUVEC were incubated with Vehicle (-), TNF- or bFGF in

0.5% FBS EBM-2 for 12 hours. Shown are the results of quantitative real time PCR analyses

(Fold induction treated vs non-treated cells). Data are mean ± SEM of three independent experiments. * P  0.05 treated vs non-treated cells. B, C, D, E, and F) mRNA levels of E- selectin, VCAM-1, ICAM-1, TF and MCP-1 in HUVEC. HUVEC were incubated with Vehicle (V) or TNF- (TNF) in the absence or presence of the S1PR2 specific antagonist, JTE013 (JTE), the S1PR1 specific antagonist, W146 (W146) or the S1PR1 and S1PR3 antagonist, VPC 23019

(VPC). All S1PR antagonists were used at 30M. Shown are the results of quantitative real time

PCR analyses (Fold induction TNF--treated vs non-treated cells). G) Blockade of S1PR2 signaling in HUVEC inhibits U937 monocyte adhesion. HUVEC were treated with Vehicle (V) or

TNF- (TNF) in the absence or presence of the S1PR2 specific antagonist, JTE013 (JTE), the

25 S1PR1 specific antagonist, W146 (W146) or the S1PR1 and S1PR3 antagonist, VPC 23019

(VPC). All S1PR antagonists were used at 30M concentration. Results are mean ± SEM of quadruplets of one representative experiment of three experiments with similar results. * P 

0.05 TNF--treated vs non-treated cells and when indicated, between TNF--treated and TNF-

+antagonist-treated cells.

Figure 7. Activation of the p38 SAPK and NFB pathways by S1PR2 in endothelial cells.

A) Western Blot of Phospho-p38 (p-p38) and total VE-Cadherin (VE-Cad) levels in adenovirus control (-Gal) and Ad-S1PR2-transduced HUVEC (S1PR2) stimulated with S1P for 10 minutes

(lanes 1-8), and naïve HUVEC treated with vehicle or 10ng/mL TNF- for 10 minutes (lanes 9 and 10). B) Phospho-p38 SAPK (p-p38) and total p38 SAPK levels in adenovirus control (-Gal) and Ad-S1PR2-transducedc HUVEC (S1PR2) stimulated with 100nM S1P for the times indicated. C) Western Blot of Phospho-p38 SAPK and total p38 SAPK from SVEC cells stimulated with 100 nM S1P in the absence or the presence of JTE013. D) The activation of the

NF- B pathway by S1PR2 is dependent on ROCK activity. Lanes 1-6: Adenovirus control (-

Gal) and Ad-S1PR2-transduced HUVEC (S1PR2) were pre-treated with vehicle (C) or 10M Y-

27632 (Y) and treated with 100nM S1P for 10 minutes when indicated (+). Lanes 7-8: Naïve

HUVEC were treated with vehicle (C) or 10ng/mL TNF- for 10 minutes. A, B, C and D: Fold induction vs non-treated cells is plotted. Values are mean ± SEM of 3-5 independent experiments. One representative Western Blot is shown. * P  0.05 treated vs non-treated cells.

E) Upregulation of S1PR2 in HUVEC induces U937 monocyte adhesion in a ROCK-, p38- and

NFB-dependent way. 20 hours after transduction, adenovirus control (-Gal) and Ad-S1PR2-

HUVEC (S1PR2) were incubated with 10M Y-27632 (Y), 10M SB203580 (SB), 5 M BAY 11-

7085 (BAY) or 10 M JTE013 (JTE) for 4 hours. Then, monocyte adhesion assays were conducted as described. Adhesion to naïve HUVEC stimulated with 2 ng/mLTNF- is shown for

26 comparison. Results are mean ± SEM (n=4) of one representative experiment of three experiments with similar results. * P  0.05 -Gal vs S1PR2 and when indicated, between vehicle-treated and inhibitor-treated S1PR2 HUVEC. F) Diagram summarizing our findings

(black) together with other published data by us and other groups (blue). Upon endothelial cell activation by pro-inflammatory stimuli, SPHK-1 is activated and S1P is released 46. Blockade of

S1PR2 signaling results in inhibition of the expression of proinflammatory and procoagulant molecules by TNF-. Upregulation of S1PR2 induces endothelial permeability, which is dependent on the Rho-ROCK pathway 18. In addition, S1PR2 induces endothelial inflammation and the activation of the SAPK-p38 and Rho-ROCK-NFB pathways. Both pathways are activated in parallel by S1PR2 and play a critical role in the induction of proinflammatory molecules.

27 REFERENCES

1. Liu H, Chakravarty D, Maceyka M, Milstien S, Spiegel S. Sphingosine kinases: A novel family of lipid kinases. Prog Nucleic Acid Res Mol Biol. 2002;71:493-511. 2. Pappu R, Schwab SR, Cornelissen I, Pereira JP, Regard JB, Xu Y, Camerer E, Zheng YW, Huang Y, Cyster JG, Coughlin SR. Promotion of lymphocyte egress into blood and lymph by distinct sources of sphingosine-1-phosphate. Science. 2007;316:295-298 3. Venkataraman K, Lee YM, Michaud J, Thangada S, Ai Y, Bonkovsky HL, Parikh NS, Habrukowich C, Hla T. Vascular endothelium as a contributor of plasma sphingosine 1- phosphate. Circ Res. 2008;102:669-676 4. Lee MJ, Van Brocklyn JR, Thangada S, Liu CH, Hand AR, Menzeleev R, Spiegel S, Hla T. Sphingosine-1-phosphate as a ligand for the g protein-coupled receptor edg-1. Science. 1998;279:1552-1555 5. Sanchez T, Hla T. Structural and functional characteristics of s1p receptors. J Cell Biochem. 2004;92:913-922 6. Kon J, Sato K, Watanabe T, Tomura H, Kuwabara A, Kimura T, Tamama K, Ishizuka T, Murata N, Kanda T, Kobayashi I, Ohta H, Ui M, Okajima F. Comparison of intrinsic activities of the putative sphingosine 1-phosphate receptor subtypes to regulate several signaling pathways in their cdna-transfected chinese hamster ovary cells. J Biol Chem. 1999;274:23940-23947 7. Mizugishi K, Yamashita T, Olivera A, Miller GF, Spiegel S, Proia RL. Essential role for sphingosine kinases in neural and vascular development. Mol Cell Biol. 2005;25:11113- 11121 8. Liu Y, Wada R, Yamashita T, Mi Y, Deng CX, Hobson JP, Rosenfeldt HM, Nava VE, Chae SS, Lee MJ, Liu CH, Hla T, Spiegel S, Proia RL. Edg-1, the g protein-coupled receptor for sphingosine-1-phosphate, is essential for vascular maturation. J Clin Invest. 2000;106:951-961 9. Sanchez T, Estrada-Hernandez T, Paik JH, Wu MT, Venkataraman K, Brinkmann V, Claffey K, Hla T. Phosphorylation and action of the immunomodulator fty720 inhibits vascular endothelial cell growth factor-induced vascular permeability. J Biol Chem. 2003;278:47281-47290 10. Sanna MG, Wang SK, Gonzalez-Cabrera PJ, Don A, Marsolais D, Matheu MP, Wei SH, Parker I, Jo E, Cheng WC, Cahalan MD, Wong CH, Rosen H. Enhancement of capillary leakage and restoration of lymphocyte egress by a chiral s1p1 antagonist in vivo. Nat Chem Biol. 2006;2:434-441 11. Brinkmann V, Davis MD, Heise CE, Albert R, Cottens S, Hof R, Bruns C, Prieschl E, Baumruker T, Hiestand P, Foster CA, Zollinger M, Lynch KR. The immune modulator fty720 targets sphingosine 1-phosphate receptors. J Biol Chem. 2002;277:21453-21457. 12. Kono M, Mi Y, Liu Y, Sasaki T, Allende ML, Wu YP, Yamashita T, Proia RL. The sphingosine-1-phosphate receptors s1p1, s1p2, and s1p3 function coordinately during embryonic angiogenesis. J Biol Chem. 2004;279:29367-29373 13. MacLennan AJ, Benner SJ, Andringa A, Chaves AH, Rosing JL, Vesey R, Karpman AM, Cronier SA, Lee N, Erway LC, Miller ML. The s1p2 sphingosine 1-phosphate receptor is essential for auditory and vestibular function. Hear Res. 2006;220:38-48 14. Kono M, Belyantseva IA, Skoura A, Frolenkov GI, Starost MF, Dreier JL, Lidington D, Bolz SS, Friedman TB, Hla T, Proia RL. Deafness and stria vascularis defects in s1p2 receptor null mice. J Biol Chem. 2007

28 15. Skoura A, Sanchez T, Claffey K, Mandala SM, Proia RL, Hla T. Essential role of sphingosine 1-phosphate receptor 2 in pathological angiogenesis of the mouse retina. J Clin Invest. 2007;117:2506-2516 16. Igarashi J, Michel T. Sphingosine 1-phosphate and isoform-specific activation of phosphoinositide 3-kinase beta. Evidence for divergence and convergence of receptor- regulated endothelial nitric-oxide synthase signaling pathways. J Biol Chem. 2001;276:36281-36288 17. Lee MJ, Thangada S, Claffey KP, Ancellin N, Liu CH, Kluk M, Volpi M, Sha'afi RI, Hla T. Vascular endothelial cell adherens junction assembly and morphogenesis induced by sphingosine-1-phosphate. Cell. 1999;99:301-312 18. Sanchez T, Skoura A, Wu MT, Casserly B, Harrington EO, Hla T. Induction of vascular permeability by the sphingosine-1-phosphate receptor-2 (s1p2r) and its downstream effectors rock and pten. Arterioscler Thromb Vasc Biol. 2007;27:1312-1318 19. Sanchez T, Thangada S, Wu MT, Kontos CD, Wu D, Wu H, Hla T. Pten as an effector in the signaling of antimigratory g protein-coupled receptor. Proc Natl Acad Sci U S A. 2005;102:4312-4317 20. Cines DB, Pollak ES, Buck CA, Loscalzo J, Zimmerman GA, McEver RP, Pober JS, Wick TM, Konkle BA, Schwartz BS, Barnathan ES, McCrae KR, Hug BA, Schmidt AM, Stern DM. Endothelial cells in physiology and in the pathophysiology of vascular disorders. Blood. 1998;91:3527-3561 21. Aird WC. The role of the endothelium in severe sepsis and multiple organ dysfunction syndrome. Blood. 2003;101:3765-3777 22. Luther T, Flossel C, Mackman N, Bierhaus A, Kasper M, Albrecht S, Sage EH, Iruela- Arispe L, Grossmann H, Strohlein A, Zhang Y, Nawroth PP, Carmeliet P, Loskutoff DJ, Muller M. Tissue factor expression during human and mouse development. Am J Pathol. 1996;149:101-113 23. Mackman N, Sawdey MS, Keeton MR, Loskutoff DJ. Murine tissue factor gene expression in vivo. Tissue and cell specificity and regulation by lipopolysaccharide. Am J Pathol. 1993;143:76-84 24. Osada M, Yatomi Y, Ohmori T, Ikeda H, Ozaki Y. Enhancement of sphingosine 1- phosphate-induced migration of vascular endothelial cells and smooth muscle cells by an edg-5 antagonist. Biochem Biophys Res Commun. 2002;299:483-487 25. Gronroos MH, Bolme P, Winiarski J, Berg UB. Long-term renal function following bone marrow transplantation. Bone Marrow Transplant. 2007;39:717-723 26. Foss FW, Jr., Snyder AH, Davis MD, Rouse M, Okusa MD, Lynch KR, Macdonald TL. Synthesis and biological evaluation of gamma-aminophosphonates as potent, subtype- selective sphingosine 1-phosphate receptor agonists and antagonists. Bioorg Med Chem. 2007;15:663-677 27. Laufs U, Liao JK. Post-transcriptional regulation of endothelial nitric oxide synthase mrna stability by rho gtpase. J Biol Chem. 1998;273:24266-24271 28. Rikitake Y, Liao JK. Rho-kinase mediates hyperglycemia-induced plasminogen activator inhibitor-1 expression in vascular endothelial cells. Circulation. 2005;111:3261-3268 29. Marinissen MJ, Chiariello M, Tanos T, Bernard O, Narumiya S, Gutkind JS. The small gtp-binding protein rhoa regulates c-jun by a rock-jnk signaling axis. Mol Cell. 2004;14:29-41 30. Marinissen MJ, Servitja JM, Offermanns S, Simon MI, Gutkind JS. Thrombin protease- activated receptor-1 signals through gq- and g13-initiated mapk cascades regulating c- jun expression to induce cell transformation. J Biol Chem. 2003;278:46814-46825 31. Anwar KN, Fazal F, Malik AB, Rahman A. Rhoa/rho-associated kinase pathway selectively regulates thrombin-induced intercellular adhesion molecule-1 expression in

29 endothelial cells via activation of i kappa b kinase beta and phosphorylation of rela/p65. J Immunol. 2004;173:6965-6972 32. Rincon M, Davis RJ. Regulation of the immune response by stress-activated protein kinases. Immunol Rev. 2009;228:212-224 33. Kumar S, Boehm J, Lee JC. P38 map kinases: Key signalling molecules as therapeutic targets for inflammatory diseases. Nat Rev Drug Discov. 2003;2:717-726 34. Yatomi Y, Igarashi Y, Yang L, Hisano N, Qi R, Asazuma N, Satoh K, Ozaki Y, Kume S. Sphingosine 1-phosphate, a bioactive sphingolipid abundantly stored in platelets, is a normal constituent of human plasma and serum. J Biochem. 1997;121:969-973 35. Liu CH, Thangada S, Lee MJ, Van Brocklyn JR, Spiegel S, Hla T. Ligand-induced trafficking of the sphingosine-1-phosphate receptor edg-1. Mol Biol Cell. 1999;10:1179- 1190 36. Sibley DR, Benovic JL, Caron MG, Lefkowitz RJ. Regulation of transmembrane signaling by receptor phosphorylation. Cell. 1987;48:913-922 37. Fernandez-Pisonero I, Duenas AI, Barreiro O, Montero O, Sanchez-Madrid F, Garcia- Rodriguez C. Lipopolysaccharide and sphingosine-1-phosphate cooperate to induce inflammatory molecules and leukocyte adhesion in endothelial cells. J Immunol. 2012;189:5402-5410 38. O'Connell KA, Edidin M. A mouse lymphoid endothelial cell line immortalized by simian virus 40 binds lymphocytes and retains functional characteristics of normal endothelial cells. J Immunol. 1990;144:521-525 39. Nishida M, Tanabe S, Maruyama Y, Mangmool S, Urayama K, Nagamatsu Y, Takagahara S, Turner JH, Kozasa T, Kobayashi H, Sato Y, Kawanishi T, Inoue R, Nagao T, Kurose H. G alpha 12/13- and reactive oxygen species-dependent activation of c-jun nh2-terminal kinase and p38 mitogen-activated protein kinase by angiotensin receptor stimulation in rat neonatal cardiomyocytes. J Biol Chem. 2005;280:18434-18441 40. Kimura K, Ito M, Amano M, Chihara K, Fukata Y, Nakafuku M, Yamamori B, Feng J, Nakano T, Okawa K, Iwamatsu A, Kaibuchi K. Regulation of myosin phosphatase by rho and rho-associated kinase (rho-kinase). Science. 1996;273:245-248 41. Shih SC, Smith LE. Quantitative multi-gene transcriptional profiling using real-time pcr with a master template. Exp Mol Pathol. 2005;79:14-22 42. Baldwin AS, Jr. The nf-kappa b and i kappa b proteins: New discoveries and insights. Annu Rev Immunol. 1996;14:649-683 43. Brownlee M. Biochemistry and molecular cell biology of diabetic complications. Nature. 2001;414:813-820 44. Skoura A, Michaud J, Im DS, Thangada S, Xiong Y, Smith JD, Hla T. Sphingosine-1- phosphate receptor-2 function in myeloid cells regulates vascular inflammation and atherosclerosis. Arterioscler Thromb Vasc Biol. 2011;31:81-85 45. Xia P, Gamble JR, Rye KA, Wang L, Hii CS, Cockerill P, Khew-Goodall Y, Bert AG, Barter PJ, Vadas MA. Tumor necrosis factor-alpha induces adhesion molecule expression through the sphingosine kinase pathway. Proc Natl Acad Sci U S A. 1998;95:14196-14201. 46. Fukuhara S, Simmons S, Kawamura S, Inoue A, Orba Y, Tokudome T, Sunden Y, Arai Y, Moriwaki K, Ishida J, Uemura A, Kiyonari H, Abe T, Fukamizu A, Hirashima M, Sawa H, Aoki J, Ishii M, Mochizuki N. The sphingosine-1-phosphate transporter spns2 expressed on endothelial cells regulates lymphocyte trafficking in mice. J Clin Invest. 2012;122:1416-1426 47. Tauseef M, Kini V, Knezevic N, Brannan M, Ramchandaran R, Fyrst H, Saba J, Vogel SM, Malik AB, Mehta D. Activation of sphingosine kinase-1 reverses the increase in lung vascular permeability through sphingosine-1-phosphate receptor signaling in endothelial cells. Circ Res. 2008;103:1164-1172 30 48. Feistritzer C, Riewald M. Endothelial barrier protection by activated protein c through par1-dependent sphingosine 1-phosphate receptor-1 crossactivation. Blood. 2005;105:3178-3184 49. Li X, Stankovic M, Bonder CS, Hahn CN, Parsons M, Pitson SM, Xia P, Proia RL, Vadas MA, Gamble JR. Basal and angiopoietin-1-mediated endothelial permeability is regulated by sphingosine kinase-1. Blood. 2008;111:3489-3497 50. Bolick DT, Srinivasan S, Kim KW, Hatley ME, Clemens JJ, Whetzel A, Ferger N, Macdonald TL, Davis MD, Tsao PS, Lynch KR, Hedrick CC. Sphingosine-1-phosphate prevents tumor necrosis factor-{alpha}-mediated monocyte adhesion to aortic endothelium in mice. Arterioscler Thromb Vasc Biol. 2005;25:976-981