Supplementary Data s10

Supplementary data

A llama-derived gelsolin single domain antibody blocks gelsolin – G-actin interaction in

vitro and in vivo.

Anske Van den Abbeele1,2, Sarah De Clercq1,2, Ariane De Ganck1,2, Veerle De Corte1,2,

Berlinda Van Loo1,2, Sameh Hamdy Soror3,4, Vasundara Srinivasan3,4, Jan Steyaert3,4, Joël

Vandekerckhove1,2, and Jan Gettemans1,2,5.

1Department of Medical Protein Research, VIB, B-9000 Ghent, Belgium and 2Department of

Biochemistry, Ghent University, Faculty of Medicine and Health Sciences, Albert Baertsoenkaai

3, B-9000 Ghent, Belgium. 3 Structural Biology, Free University of Brussels, Pleinlaan 2, B-1050

Brussels, Belgium and 4 Department of Molecular and Cellular Interactions, VIB, B-1050

Brussels, Belgium.

5 Address correspondence to: Jan Gettemans, Department of Medical Protein Research, Flanders

Interuniversity Institute for Biotechnology, Ghent University, Faculty of Medicine and Health

Sciences, Albert Baertsoenkaai 3, B-9000 Ghent, Belgium. Tel: +3292649340. Fax:

+3292649490.

Tel: 00 32 9 2649340.

Fax: 00 32 9 2649490.

E-mail: [email protected] Supplementary Materials and methods

cDNA cloning of V5 epitope-tagged VHHs in the pHEN6c vector.

Two complementary oligonucleotides containing a V5- and His6-tag, with 5’ and 3’

EcoRI/BstEII restriction sites, were cloned into the pHEN6c vector that already contained the

GFP VHH, GsnVHH11 or GsnVHH13. The following primers were used; fwd: 5’

GTCACCGTCTCCTCAGGTGGTGGTGGTTCTGGTGGTGGTAAGCCTATCCCTAACCCTC

TCCTCGGTCTCGATTCTACGCGTACCGGTCATCATCACCATCACCATTGAG 3’ and rev:

5’AATTCTCAATGGTGATGGTGATGATGACCGGTACGCGTAGAATCGAGACCGAGGA

GAGGGTTAGGGATAGGCTTACCACCACCAGAACCACCACCACCTGAGGAGACG 3’.

Expression and purification of recombinant V5-/His6- tagged VHHs

pHEN6c-VHH plasmids were transformed in E. coli WK6 cells and a freshly transformed colony was grown overnight in LB medium containing ampicilin (100 µg/ml) and 1% glucose.

The next day, 1 ml of pre-culture was added to 330 ml of TB medium supplemented with ampicillin, 2 mM MgCl2 and 0.1% glucose and grown at 37°C with shaking until an OD600 of 0.6-

0.9 was reached. VHH expression was induced by addition of IPTG (1mM) and incubation at

28°C with shaking overnight. Recombinant V5/His6-tagged VHHs were extracted from the periplasm by osmotic shock of E. coli WK6 cells and further purified by Ni2+-chelating beads.

VHHs were recovered from the beads by elution with 500 mM imidazole pH 8.25. The VHHs were further dialysed against 20 mM Tris-HCl pH 7.5, 150 mM NaCl, pooled and stored at

-20°C. High speed co-sedimentation assay

GsnVHH11 and gelsolin G2-G3-GST were subjected to high speed centrifugation at 100,000g before starting the experiment. G-actin was polymerized overnight at 4°C in F-buffer (2 mM

Tris-HCL, PH 7.6, 100 µM CaCl2, 100 mM KCl, 1 mM MgCl2, 200 µM ATP, 200 µM DTT) and incubated for 30 min at room temperature in the presence of gelsolin S2S3-GST and GsnVHH11.

Sedimentation of actin filaments and S2S3-GST was achieved by high speed centrifugation at

100,000×g for 30 min. Proteins in pellets were separated by SDS-PAGE and visualised by

Coomassie staining.

Pull down experiments with V5-tagged VHHs.

MDA-MB-231 and MCF-7 cells were disrupted in ice-cold lysis buffer, with or without 1 mM

EGTA, and the extract was centrifuged at 4°C for 10 min (20000g). 800μg total protein was incubated with 3 μg V5-tagged VHHs and immunoprecipitated overnight at 4°C using anti-V5

IgG-Sepharose. The beads were washed 4 times with lysis buffer, boiled for 5 min in Laemmli sample buffer and proteins were analyzed by SDS-PAGE and western blotting.

Gel filtration of gelsolin:actin complexes with VHHs.

Analytical gel filtration was performed using a Superdex 200 H/R 10/30 column (GE

Healthcare). To prepare the gelsolin:actin complexes, different amounts of G-actin (42 kDa) were mixed with 200 μg of gelsolin (85 kDa) and 34 μg of GsnVHH13 (15 kDa) in G-buffer, and Ca2+ was adjusted to 0.2 mM. In one experiment F-buffer was used. The mixtures were applied onto the column and eluted with G- or F-buffer, pH 7.5, in the presence of 0.2 mM CaCl2, 50mM NaCl, with or without 1 mM EGTA as indicated. Peak fractions were analyzed by SDS–PAGE and visualized by Coomassie staining.

Legend to supplementary figures

Suppl. Figure S1. GsnVHH13 interacts with complexes between gelsolin and actin (as well as actin oligomers) in calcium but not in EGTA. (A) Superdex 200 gelfiltration of 1:1 gelsolin:actin and GsnVHH13 in the presence of G-buffer with calcium and 50 mM NaCl. Proteins eluting from the column were analysed by SDS-PAGE and Coomassie staining (right). The slight excess of free gelsolin elutes as a separate peak together with GsnVHH13 (peak 2). Note that

GsnVHH13 co-elutes with gelsolin:actin (peak 1). Excess GsnVHH13 elutes as peak 4. (B)

Superdex gelfiltration of a 1:3 gelsolin-actin complex and GsnVHH13 in the same buffer as in

(A). (C) Superdex gelfiltration of a 1:5 gelsolin-actin complex with GsnVHH13 as in (A). Excess actin begins to polymerize and elutes as a complex that is larger than gelsolin:actin:GsnVHH13

(peak 1). This fraction also contains trace amounts of gelsolin. (D) Superdex gelfiltration of 1:5 gelsolin-actin complex and GsnVHH13 in F-buffer. The result is similar to (C) except that more actin has polymerized (peak 1). (E) Superdex gelfiltration of a 1:1 gelsolin-actin complex and

GsnVHH13 in G-buffer with 1 mM EGTA. GsnVHH13 (peak 2) does not co-elute with gelsolin:actin (peak 1).

Suppl. Figure S2. Relative amounts of free gelsolin or actin-bound gelsolin complexes are not drastically perturbed following expression of VHHs in the cytoplasm. In this experiment proteins were immunoprecipitated from cell lysates as compared to expression of VHHs in cells followed by immunoprecipitation (Figure 1D-E in the manuscript). (A) SDS-PAGE and Coomassie staining of purified recombinant V5 and His6-tagged VHHs. (B-C) Cytoplasmic extracts of

MDA-MB-231 (B) or MCF-7 (C) cells were incubated with 3 μg V5/His6-tagged VHHs and then immunoprecipitated using anti-V5 IgG-Sepharose. Western blots show the presence of gelsolin, actin and VHHs in immunoprecipitates without EGTA in the lysis buffer (left) or with EGTA in the lysis buffer (right). In the absence of EGTA GsnVHH13 binds the gelsolin:actin complex;

GsnVHH11 binds to gelsolin. In the presence of EGTA, GsnVHH13 does not bind gelsolin whereas GsnVHH11 binds free gelsolin (right panels). In panel (B), trace amounts of actin that binds non-specifically to the agarose can be seen/ *=IgG heavy chain; **=IgG light chain.

Protein size markers are indicated at the left.

Suppl. Figure S3. GsnVHH11 does not prevent association of gelsolin G2-G3 domains with actin filaments. Cosedimentation assay. Actin (8 µM) in F-buffer was sedimented for 30 min at

100,000  g with or without recombinant GST-G2-G3 gelsolin (0.8 µM) and GsnVHH11 (8µM).

Pellets were solubilized in Laemmli sample buffer and sedimented proteins were resolved by

SDS-PAGE and Coomassie staining. Lane 1: F-actin alone; lane 2: F-actin with GST-G2-G3; lane 3: F-actin with GST-G2-G3 and GsnVHH11 (notice that both GST-G2-G3 and GsnVHH11 sediment with F-actin); lane 4: GST-G2-G3 input; lane 5: GsnVHH11 input; lane 6: input of unpolymerized G-actin in G-buffer (1/10th of the total volume).