Electronic Supplementary Material s17

Electronic supplementary material

Accumulation and biological effects of metals in wild rats in mining areas of Zambia

Shouta M.M. Nakayamaa*, Yoshinori Ikenakaa*, Kyohei Hamadaa, Kaampwe Muzandub, Kennedy Choongob, John Yabec, Takashi Umemurac, Mayumi Ishizukaa aLaboratory of Toxicology, Department of Environmental Veterinary Sciences, Graduate School of Veterinary Medicine, Hokkaido University, Kita 18, Nishi 9, Kita-ku, Sapporo 060-0818, Japan bDepartment of Biomedical Sciences, School of Veterinary Medicine, University of Zambia, P.O. Box 32379, Lusaka, Zambia cLaboratory of Comparative Pathology, Graduate School of Veterinary Medicine, Hokkaido University, Kita 18, Nishi 9, Kita-ku, Sapporo 060-0818, Japan

Corresponding author Mayumi Ishizuka Email address: [email protected] Tel: +81-11-706-6949 Fax: +81-11-706-5105

Fig. S1 Map of Zambia. Wild rats were collected in three sites; Kabwe: Pb-Zn mine, Chingola: Cu- Co mine in the Copperbelt Province, Lusaka: reference (control) site N

150 km

Chingola Copperbelt Province Kafue River

Kafue National Park Kabwe

Lusaka

Lake Itezhi-tezhi

Table S1 Primer sets for species identification and mRNA expression assay

Gene name Forward Reverse cyt-b CAGCATTTAACTGTGACTAATGAC TACACCTAGGAGGTCTTTAATTG MT-1 CACCGTTGCTCCAGATTCAC AGGAGCAGCAGCTCTTCTTG MT-2 ATCTCCAACTGCCGCCTCC TGCACTTGTCCGAAGCCTCT GAPDH AACCTGCCAAGTATGATG GGAGTTGCTGTTGAAGTC Table S2 Sequence information of cytochrome b (cyt-b) gene. The cyt-b gene sequences for major Rattus species, Mus musculus and Homo sapiens were retrieved from the GenBank database

Rattus species Accession No. R. andamanensis HM217396 R. argentiventer AB033701 R. everetti DQ191485 R. exulans EU273709 R. fuscipes EF186438 R. hoffmanni EF186443 R. leucopus EU349781 R. losea HM217454 R. nitidus HM217479 R. norvegicus NC001665 R. praetor EU273708 R. rattus EU273707 R. sordidus EF186438 R. tanezumi EU273712 R. tiomanicus HM217391 R. tunneyi EU186518 R. villosissimus EU349783 Other species Accession No. Mus musculus domesticus AY057807 Mus musculus musculus AY057804 Mastomys natalensis HM635886 Homo sapience EU545465