Supplementary Information, Methods

Human foreskin fibroblasts (HFF1) were obtained from ATCC. HFF1 cells stably expressing

-PIX-silencing, -PIX-silencing, and non-silencing shRNAs were generated using a lentiviral shRNA system and selected with puromycin (Open Biosystems/Thermo Fisher). Transient transfections were performed by Nucleofection (Amaxa) with the human dermal fibroblast kit and program U-024. GFP-positive cells were isolated by fluorescence-activated cell sorting.

DMSO vehicle was used as a control for drug studies.

Materials

Expression silencing of the following proteins was achieved with constructs obtained from

Open Biosystems (catalog numbers and hairpin sequence for shRNA in parentheses): -PIX: -

PIX #1 (RHS4430-99160647,

TGCTGTTGACAGTGAGCGCCCTGCCTCTTGCAGTTCATTATAGTGAAGCCACAGATGTA

TAATGAACTGCAAGAGGCAGGTTGCCTACTGCCTCGGA) and -PIX#2 (RHS4430-

99615836,

TGCTGTTGACAGTGAGCGACCTTGGAGCCTCCTCAAATTATAGTGAAGCCACAGATGTA

TAATTTGAGGAGGCTCCAAGGGTGCCTACTGCCTCGGA); -PIX-PIX#1 (RHS4430-

98895196,

TGCTGTTGACAGTGAGCGCGGTAGTAAGAGCAAAGTTTAATAGTGAAGCCACAGATGTATT

AAACTTTGCTCTTACTACCATGCCTACTGCCTCGGA) and -PIX#2 (RHS4430-98911853,

TGCTGTTGACAGTGAGCGACCTCATTCAGTGCCATCTCATTAGTGAAGCCACAGATGTA

ATGAGATGGCACTGAATGAGGCTGCCTACTGCCTCGGA); non-silencing control (RHS4348).

Expression constructs: pEGFP-C2--Pix and myc--Pix (J. Peterson, Fox Chase Cancer

Center); pEGFP-paxillin (R. Horwitz, University of Virginia); mApple-paxillin (Mike Davidson,

Florida State). Antibodies (catalog numbers and dilution in parentheses): mouse anti-paxillin (610052; 1/10000(WB); 1/1000(IF)), mouse anti-Hic5 (TGFl1) (611164; 1/250(WB)), mouse anti-

LAR (PTPRF) (610350; 1/250(WB)) and mouse anti-actin (612656; 1/5000(WB),obtained from

BD); mouse anti-vinculin (V4505; 1/1000(WB); 1/50(IF)), mouse anti-tubulin (T6199;

1/5000(WB)), mouse anti-vimentin (V6630; 1/200(WB)) and rabbit anti--actinin (A2543:

1/500(WB)) obtained from Sigma; mouse anti-talin1 (MAB1676; 1/1000(WB); 1/100(IF)), mouse anti-Rac1 (05-389; 1/1000(WB)) and rabbit anti--Pix (AB3829; 1/1000(WB); 1/500(IF)) obtained from Millipore; rabbit anti-cyclophilin B (PPIB) (TAB1002; 1/200(WB)) and rabbit-anti-

GAPDH (TAB1001; 1/100(WB)) obtained from Open Biosystems; rabbit anti-calnexin (SPA-860;

1/2000(WB)) obtained from Stressgen; mouse anti-pY (9411; 1/400(IF)), rabbit anti-cortactin

(3503; 1/100(IF)), rabbit anti--PIX (4573; 1/1000(WB)), rabbit anti-Akt (9272; 1/1000(WB)) and rabbit anti-VASP (3132; 1/1000(WB); 1/100(IF)) obtained from Cell Signaling; rabbit anti-FGFR

(sc-124; 1/100(WB)), rabbit anti-paxillin (sc-5574; 1/50(WB)), rabbit anti-GIT2 (sc-100674;

1/100(WB)), agarose-conjugated goat anti-actin (sc-1616AC) and agarose-conjugated mouse anti-fibronectin (sc-8422AC) obtained from Santa Cruz; rabbit anti-pY118-paxillin (44-722G;

1/1000(WB)) and rabbit anti-pY397-FAK (44-625G; 1/100(WB)) obtained from Invitrogen; rabbit anti-shroom3 (1/100(WB)) (J.Hildebrand, University of Pittsburgh); rabbit anti-zyxin (1/1000(IF);

1/500(IF))(M. Beckerle, Huntsman Cancer Institute). Alexa Fluor 488 phalloidin (A12379;

1/400(IF)) obtained from Invitrogen. Blebbistatin obtained from Toronto Research Chemicals, and Y-27632 ROCK inhibitor obtained from EMD.

FA isolation

A detailed description will be published elsewhere1. Briefly, HFF1 cells were plated (24 hr ,

50% confluence) on100mm dishes coated with 15g/ml fibronectin and hypotonically shocked with TEA-containing low-ionic-strength buffer (2.5mM triethanolamine in water, pH 7.0, 3 min).

Cell bodies were removed by pulsed hydrodynamic force with 50ml PBS containing protease inhibitors (Roche) using a Waterpik (setting “3”, Interplak dental water jet WJ6RW, Conair) held

~0.5cm and ~90o to the surface and scanning the entire dish in ~10s two times. The 50ml of buffer was collected after triturating each dish and recycled for use in trituration of the next dish, and was collected after the final dish to serve as the “cell body fraction” for western blot. FAs remaining bound to the dish were rinsed using the Waterpik with 400ml buffer, collected and denatured by scraping with a rubber policeman in 1X RIPA buffer (50mM Tris-HCl, pH 8.0,

150mM NaCl, 1.0 % NP-40, 0.5% sodium deoxycholate) containing 1% SDS, and sonicated for

15 sec on ice. This yielded ~0.13g FA protein/cm2 of culture dish for control cells, and

0.08g/cm2 for blebbistatin-treated cells (2hr, 50M blebbistatin). Total protein requirement for analyses was: 4g for western blot, 400g for 2-D DIGE, 60g for MudPit Mass spectrometry.

Protein concentrations were measured by BCA (Pierce).

Protein Identification by MudPIT MS analysis.

To improve the dynamic range of the mass spectrum, high-abundance proteins fibronectin and actin were removed from the FA fraction by immunodepletion using agarose-conjugated antibodies rotated overnight (1:1:1 fibronectin antibody: actin antibody: FA total protein), followed by protein concentration by ethanol precipitation and pelleting by centrifugation. Protein pellets (~60 g) were resuspended in digestion buffer (8M urea, 100mM Tris, pH 8.5), reduced and alkylated with tris(2-carboxyethyl)phosphine (TCEP, 5 mM, 15 min, followed by 10mM,

20min),diluted to 2M urea with 100mM Tris pH 8.5, and CaCl2 added to 1mM. Proteins were trypsin-digested (1:50 enzyme:protein , 37°C overnight) followed by termination with 5% formic acid.

For MudPIT MS analysis, digested peptides were pressure-loaded onto a Kasil-fritted fused silica capillary column (250-µm i.d.) packed with 3cm of 5-µm Partisphere cation exchange resin and 3 cm of 5-µm Aqua C18 resin and desalted (95% water, 5% acetonitrile, 0.1% formic acid) connected through a zero-dead-volume union to a capillary column (100-µm i.d., 5-µm tip) packed with 10 cm 3-µm Aqua C18. This three-phase column was placed in line with an Agilent 1100 quaternary HPLC and a modified 12-step MudPIT analysis was performed with three buffers: 5% acetonitrile/0.1% formic acid (buffer A); 80% acetonitrile/0.1% formic acid (buffer B), and 500 mM ammonium acetate/5% acetonitrile/0.1% formic acid (buffer C). Step 1: 70 min gradient from 0 to 100% buffer B. Steps 2-12: 3 min of 100% buffer A, 5 min of X% buffer C, a

10 min gradient from 0 to 10% buffer B, a 70 min gradient from 10 to 45% buffer B, a 10 min gradient from 45% to 100% buffer B, and a 10 min equilibration of 100% buffer A. The 5 min buffer C percentages (X) were 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, and 100%, respectively.

Eluted peptides were electrosprayed (distal 2.5 kV spray voltage) into an LTQ linear ion trap mass spectrometer. A cycle of one full-scan mass spectrum (400-1400 m/z) followed by 5 data- dependent tandem mass (MS/MS) spectra at a 35% normalized collision energy was repeated continuously throughout each step of the multidimensional separation. Tandem mass spectra were generated and systems were controlled by the Xcalibur data system2. SEQUEST3 was used for MS/MS database searching against the EBI International Protein Index (IPI) protein database version 3.30 (June 2007) concatenated to a decoy database (Target-Decoy approach) in which the sequence for each entry in the original database was reversed4. Digestion enzyme specificity was not considered for any search, while a fixed modification (+57.02146 Da) on cysteines, introduced by reduction and alkylation, was considered. SEQUEST results were assembled and filtered using DTASelect (version 2.0)5 with a false positive rate of 1% at the protein level. Proteins identified by the same peptide sets were clustered together by DTASelect

2.0 using a parsimony principle in which the minimum set of proteins accounts for all the observed peptides. Finally, the protein list contained protein IDs with spectrum counts1,6-8.

Western blot analysis and 2D-DIGE analysis.

For western blot, the concentrated cell body fraction was diluted 50-100-fold, and equal total protein (4g) of the FA and cell body fractions were loaded and separated by SDS-PAGE, blotted to Immobilon, and probed and visualized using enhanced chemiluminscence (Millipore). Bands were quantified after local background subtraction. The western blot analyses of PP2AA,

PP1A, PP1G, and ILK were performed by Kinexus Bioinformatics Corporation.

For 2D-DIGE, 50 g of control and blebbistatin-treated FA fractions were labeled on lysine residues with Cy3 and Cy5, respectively. Equal amounts of protein (total 50 g) from both fractions was pooled and labeled with Cy2 to serve as an internal standard9,10, and additional unlabeled protein (total 350g) from both fractions was added to increase the detection efficiency of individual spots. The proteins were separated on IPG strips (pH 3-10 NL) and a 10-

15% gradient SDS-PAGE gel in the first and second dimension isoelectric focusing, respectively. Image analysis was performed using Progenesis SameSpots software. The protein abundance for each spot in each sample was expressed as a ratio relative to the internal standard to calculate the relative abundance between control and blebbistatin-treated FA fractions. Protein identification was achieved using an Ettan Spot Handling Workstation and nanoLC-ESI-MS/MS with LTQ Orbitrap XL9.

Functional classification of proteins in the FA proteome.

Proteins that were reproducibly identified in isolated FAs were characterized by their interacting proteins and biological functions using Ingenuity System (IPA) and classified as follows. Proteins related to or known to interact with proteins in the Integrin Adhesome were classified into the expected FA list and depicted in the FA interactome (Supplemental Fig. 2)

Proetins were further categorized within the FA interactome. Proteins with known enzymatic activity were categorized as GEF/GAP/GDI, GTPase, Metalloproteinase,

SerThrPhosphatase/Tyrphosphatase, SerThrKinase/TyrKinase/PtInsKinase, or Other Enzyme.

Adapters contained LIM, SH2, or SH3 domains; Scaffold Proteins can tether or localize signaling enzymes to specific subcellular regions, but lack LIM, SH2, or SH3 domains; ECM

Receptors bind to ECM ligands; Membrane Proteins localize at the plasma membrane and interact with integrins or ECM; Actin Binding Proteins bind directly to actin; Protein Folding and

Protein Degradation function in folding or degradation; Endocytosis Proteins function in endocytosis; MT-based Movement Proteins function in microtubule-based movement;

Chaperone/Exchanger/Transporter Proteins function as chaperone, exchanger, or transporter;

RNA Metabolism proteins were grouped into RNA Metabolism. Proteins not included in the

Expected FA List were classified into 8 additional categories: Cytoskeleton included actin-, intermediate filament-, or microtubule associated proteins; Transporter/Channel Proteins included ATPase transporters, channels, and transporters; Membrane Systems and Trafficking

Proteins function in endocytosis, ER-Golgi transport, exocytosis, and nucleocytoplasmic transport, or localize to the ER, mitochondria, plasma membrane, or lysosomes; Protein

Folding/Degradation Proteins function in folding and degradation; DNA/RNA Processing

Proteins include DNA/RNA enzymes, DNA/RNA-binding proteins, and proteins mediating transcription/translation; Signalling Proteins function in cell cycle/growth/apoptosis control or cytoplasmic signaling; Metabolism Proteins included proteins in metabolic pathways;

Uncharacterized Proteins have unknown functions.

Quantitation of Protein Abundance and Development of the MyosinII Dependence Ratio

For quantitative comparison of protein abundance between FA from control and blebbistatin-treated cells, equal total protein from each condition was analyzed as above. The

MyosinII Dependence Ratio (MDR) was calculated as the ratio of normalized protein abundance in control FAs to that in FAs from blebbistatin-treated cells. Abundance was approximated as the sum of normalized spectrum counts for each protein from all experimental runs for each condition. Normalization was applied to account for variability between experimental runs of the same condition and between experimental conditions (Fig 3b). To normalize between runs, the total spectrum counts for a protein in the run was normalized to the total spectrum counts of all proteins in the run (Fig 3b). Because the total FA protein per cell was quite different between blebbistatin-treated and control cells, we additionally normalized each protein’s abundance between conditions relative to the level of a protein whose FA abundance was insensitive to blebbistatin. Western blot analysis of isolated FAs indicated that the proportion of paxillin relative to total FA protein was unchanged by blebbistatin treatment (Fig 3b), and paxillin density in FAs is unaltered by myosinII perturbation11,12 (Fig.6c). Therefore, the sum of spectrum counts of paxillin in control FAs was used as the normalization standard between experimental conditions. The ratio of the doubly-normalized spectrum counts for each protein was then calculated to give its MDR, such that an MDR <1 indicates FA abundance is enhanced by blebbistatin treatment, an MDR close to 1 indicates myosinII-independent FA association, and an MDR >1 indicates FA abundance is reduced by blebbistatin treatment.

Immunofluorescence

Fixation and immunostaining of coverslips with bound cells or isolated FAs was performed as described in12. For confocal, samples were mounted with Dako mounting medium and imaged with a 40X 1.0NA or 60X 1.49NA objective lens on the spinning disk confocal/TIRF microscope system described in13. Images were captured with a Coolsnap HQ2 CCD (Photometrics).

Lamellipodial or FA area were determined by thresholding only lamellipodia or FA and recording the region areas. ForTIRF13, cells were mounted with PBS containing N-propyl gallate. Images were obtained on the same microscope using a 100X 1.49NA Plan objective (Nikon) with an

~100 nm evanescent field depth on a Cascade II:1024 EMCCD (Photometrics)13. The relative abundance of -PIX, paxillin, vinculin, zyxin, talin, phospho-tyrosine and VASP in FA was determined exactly as described previously12.

Time-lapse microscopy

To analyze the dynamics of PIX and paxillin or paxillin, cells co-expressing pEGFP--PIX / mApple-paxillin or pEGFP-paxillin were mounted on slides with double-stick tape or in a perfusion chamber (Warner Instruments) in phenol red-free culture medium with 25 mM Hepes

(pH= 7.4) and 10units/ml Oxyrase and imaged by TIRF as above13. Temperature was maintained at 37oC with an airstream incubator (Nevtek) and focus was maintained using

PerfectFocus(TM) (Nikon). Pairs of TIRF images of EGFP--PIX and mApple-paxillin were captured at 10s intervals using a 512B EMCCD (Photometrics).

To analyze pEGFP--PIX and mApple-paxillin intensity during FA turnover, single FAs were hand-outlined in the paxillin channel over time, and regions transferred to the-PIX channel. The background-subtracted, photobleach-corrected and normalized (to max) integrated intensity values for each area were plotted as a function of time. For analysis of cell migration, phase-contrast images were collected on an inverted microscope (TE-2000 E2,

Nikon) with a 10X 0.25NA PH objective lens and an 0.57NA LWD condenser at 10min internals for 4h with a Coolsnap HQ2 CCD at 10min internals for 4h. Cell nuclei were manually tracked in image series and velocity was calculated as the total length of the migration path divided by migration duration.

Polyacrylamide substrates

Fibronectin-coupled flexible polyacrylamide substrates were generated as previously described14.

Rac activity assay

GST-PAK-CRIB (Ruey-Hwa Chen, Academica Sinica) was used to detect GTP-bound Rac as described previously15.

Statistical analysis

Statistical significance was measured by a two-tailed student’s t-test. Supplementary Information, References

1. Kuo, J. C., Han, X., Yates, J. R. & Waterman, C. M. Isolation of focal adhesion proteins for biochemical and proteomic analysis. "Integrin and Cell Adhesion Molecules: Methods and Protocols" Methods inMolecular Biology, Humana Press (Motomu Shimaoka, Editor). 2010. Ref Type: In Press

2. Bern, M., Goldberg, D., McDonald, W. H. & Yates, J. R., III Automatic quality assessment of peptide tandem mass spectra. Bioinformatics. 20 Suppl 1, i49-i54 (2004).

3. Eng, J. K., McCormack, A. L. & Yates, J. R., III An approach to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database. J. Am. Soc. Mass Spectrom. 5, 976-989 (94 A.D.).

4. Elias, J. E., Haas, W., Faherty, B. K. & Gygi, S. P. Comparative evaluation of mass spectrometry platforms used in large-scale proteomics investigations. Nat. Methods 2, 667-675 (2005).

5. Sadygov, R. G. et al. Code developments to improve the efficiency of automated MS/MS spectra interpretation. J. Proteome. Res. 1, 211-215 (2002).

6. Ambatipudi, K. S., Lu, B., Hagen, F. K., Melvin, J. E. & Yates, J. R. Quantitative analysis of age specific variation in the abundance of human female parotid salivary proteins. J. Proteome. Res. 8, 5093-5102 (2009).

7. Chen, E. I. et al. Adaptation of energy metabolism in breast cancer brain metastases. Cancer Res. 67, 1472-1486 (2007).

8. Tabb, D. L., McDonald, W. H. & Yates, J. R., III DTASelect and Contrast: tools for assembling and comparing protein identifications from shotgun proteomics. J. Proteome. Res. 1, 21-26 (2002).

9. Hoffert, J. D., van Balkom, B. W., Chou, C. L. & Knepper, M. A. Application of difference gel electrophoresis to the identification of inner medullary collecting duct proteins. Am. J. Physiol Renal Physiol 286, F170-F179 (2004).

10. Marouga, R., David, S. & Hawkins, E. The development of the DIGE system: 2D fluorescence difference gel analysis technology. Anal. Bioanal. Chem. 382, 669-678 (2005).

11. Choi, C. K. et al. Actin and alpha-actinin orchestrate the assembly and maturation of nascent adhesions in a myosin II motor-independent manner. Nat. Cell Biol. 10, 1039- 1050 (2008). 12. Pasapera, A. M., Schneider, I. C., Rericha, E., Schlaepfer, D. D. & Waterman, C. M. Myosin II activity regulates vinculin recruitment to focal adhesions through FAK-mediated paxillin phosphorylation. J. Cell Biol. 188, 877-890 (2010).

13. Shin, W. et al. A versatile, multi-color total internal reflection fluorescence and spinning disk confocal microscope system for high-resolution live cell imaging. In Live Cell Imaging. A laboratory Manual. R. D. Goldman, J. Swedlow, and D. L. Spector, editors. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 119-138 (2010).

14. Pelham, R. J., Jr. & Wang, Y. Cell locomotion and focal adhesions are regulated by substrate flexibility. Proc. Natl. Acad. Sci. U. S. A 94, 13661-13665 (1997).

15. Ren, X. D. & Schwartz, M. A. Determination of GTP loading on Rho. Methods Enzymol. 325, 264-272 (2000).