A Gene Encoding a New Cold-Active Lipase 1 from an Antarctic Isolate of Penicillium Expansum

A gene encoding a new cold-active lipase1 from an Antarctic isolate of

Penicillium expansum

Suja Mohammed1*, Junior Te’o2 and Helena Nevalainen2

1Australian School of Advanced Medicine, Macquarie University, Sydney, NSW

2109, Australia

2Department of Chemistry and Biomolecular Sciences, Biomolecular Frontiers

Research Centre, Macquarie University, Sydney, NSW 2109, Australia

*Corresponding author

Mailing address: Australian School of Advanced Medicine, Faculty of Human

Sciences, Macquarie University Sydney NSW, 2109 Australia.

Phone: +61 2 9812 3562, Fax: +61 2 9850 8313. E-mail: [email protected]

1 Nucleotide sequence data reported in this study are available in the GenBank database under the accession number KC195873 Supplementary Table 1. Primers used for the isolation of a lipase gene (lipPE) from

P. expansum SM3

Degenerate base abbreviation: R = a or g; K = g or t; S = g or c; W = a or t; D = g, a or t; Y = t or c; H = a, t or c; M = a or c; N = g, a, c or t

Annealing Primer Sequence (5´ to 3´) temperature (C)

Degenerate primers AsF1 ggS caY WSY YtS ggS ggS 58.4 AsF2 ggS caY WSY YtS ggS gcH 57.9 FoxF4 atc ggc atc RSN ttN MgN gg 54 FoxF tS gYN StN RYH WtS cgS gg 55 AsR1 Scc Scc SaR RSW Rtg Scc 58.4 AsR2 Dgc Scc SaR RSW Rtg Scc 57.9 PeyR Rgt Rat cca Rta Ytc Dgg 43.1 Genomic Walking primers GWP1F GCCAGGCGTTTTGGCATGAG 55 GWP1R GGAGCAGTTCTCCTGTTCCAGG 54.6 GWP2F GGATGCGACTCCGTGATCCG 55.3 GWP2R CGTCACTGCTTCCGGTCCCG 58 GWP3F GGCCAGTCATATGCCTGAGGG 55 GWP3R GCCGTGCGACAACCTTGCGCG 61.8 ActF GGACATTCCCTCGGTGGTGCC 57.8 ActR GGCACCACCGAGGGAATGTCC 57.8 Linker specific primers DS43 CGCGTCCTTTGTCGATACTGGCCA 69 Berg41 CATGGCGCAGGAAACAGCTATGACCGT 73 GWSR GTCCTTTGTCGATACTGG 54 GWSF GCAGGAAACAGCTATGAC 54 Primers used for standard PCR and RT-PCR PELIPF2 CCTCATACATAGTTTCAAGATG 41 PELIPR1 ATTTAGCTCAGGTAGCCACAG 49.4 Supplementary Fig. 1 Multiple sequence alignment of LipPE with known fungal lipases, P. cyclopium (AAF82375), P. expansum (AAF99329 and AAK07480), T. lanuginosus (O59952) and R. miehei (A34959). ‘Antarctic’ represents P. expansum SM3. The conserved amino-acid residues obtained from the alignment are highlighted in reverse font Supplementary Fig. 2 Activity of the recombinant MBP-LipPE against p-nitrophenyl laurate (C12) at pH 8. Specific activity was defined as the amount of enzyme required to release 1 µM of p-nitrophenol in one min per milligram of protein under the reaction conditions. The bars represent specific activity and the line represents activity in µM/min