DNA Analysis Notes
Total Page:16
File Type:pdf, Size:1020Kb
Name: ______Date: ______DNA Analysis Notes
Where do we find DNA? DNA can be found in almost every cell in your body (except red blood cells) DNA can be found in any bodily fluids such as saliva, semen, and blood. DNA can be found in hair, but only if the hair was pulled out at the root. DNA can NOT be found in fingernail clipping, fingerprints, or cut pieces of hair. Blood Type Analysis: A blood sample can be analyzed to determine its type (A, B, AB, O, and + or -). We do this by dropping the blood into three different wells. We add the three different antibodies to each well (antibody A, antibody B, and Rh factor) If the blood clumps up, then that is the blood type. So, if the blood in well A and B clumps, but does not in the Rh factor well, what is our suspect’s blood type? ______DNA Fingerprinting: Humans have about 99.9% of their DNA in common. But that 0.1% that is different is unique to every person, like a fingerprint. Finding DNA evidence is just as useful as finding a fingerprint because we have discovered ways to quickly analyze DNA to determine your fingerprint. Gel Electrophoresis: We can analyze DNA using a technique called gel electrophoresis. We do this by using certain restriction enzymes to cut each sample of DNA. Since everyone’s DNA is different the restriction enzymes will cut it in different areas creating different size pieces. The more places we cut the DNA, the more accurate or specific our results will be to a specific person. Where will the DNA be cut if I add an enzyme that cuts between the A and T every time it sees AATT
GCAATTGCCATGGGCAATTCCGACATGC
GCAATGCCAATTGGCAATTGGCAATTGC
What this cutting does is creates uniquely sized pieces of DNA for each person Family members will have pieces in common, but not all pieces will be the same length. DNA is far too small to look at the sizes of the pieces, so we use gel electrophoresis After the DNA is cut, we put it into wells in the gel. The gel looks like jello, but it has pores in it that the DNA can move through. We put the gel into the electrophoresis box and turn on an electric current The end opposite the DNA is positively charged, and since DNA is negatively charged, the DNA is attracted to that end and move there The smaller pieces are able to move much more quickly through the gel than the larger pieces So, the smaller pieces move farther Then we place the gel in dye and the DNA shows up in bands. The smaller segments of DNA will be the bands farther from the wells. What do you think we can tell from these bands?
Who is Luna’s Father? ______Name: ______Date: ______DNA Analysis Notes
Where do we find DNA? DNA can be found in ______every cell in your body (except ______blood cells) DNA can be found in any bodily ______such as ______, semen, and ______ DNA can be found in ______, but only if the hair was pulled out at the ______ DNA can ______be found in ______clipping, fingerprints, or cut pieces of hair. Blood Type Analysis: A blood sample can be analyzed to determine its ______(A, B, AB, O, and + or -). We do this by dropping the blood into ______different wells. We add the three different ______to each well (antibody A, antibody B, and Rh factor) If the blood ______up, then that is the blood type. So, if the blood in well A and B clumps, but does not in the Rh factor well, what is our suspect’s blood type? ______DNA Fingerprinting: Humans have about ______of their DNA in common. But that 0.1% that is different is unique to every person, like a ______ Finding DNA evidence is just as useful as finding a fingerprint because we have discovered ways to quickly analyze DNA to determine your fingerprint. Gel Electrophoresis: We can analyze DNA using a technique called ______ We do this by using certain ______enzymes to cut each sample of DNA. Since everyone’s DNA is different the restriction enzymes will cut it in different areas creating different ______pieces. The more places we cut the DNA, the more ______or specific our results will be to a specific person. Where will the DNA be cut if I add an enzyme that cuts between the A and T every time it sees AATT
GCAATTGCCATGGGCAATTCCGACATGC
GCAATGCCAATTGGCAATTGGCAATTGC What this cutting does is creates uniquely sized pieces of DNA for each person Family members will have pieces in ______, but not all pieces will be the same length. DNA is far too ______to look at the sizes of the pieces, so we use gel electrophoresis After the DNA is cut, we put it into ______in the gel. The gel looks like jello, but it has ______in it that the DNA can move through. We put the gel into the electrophoresis box and turn on an ______current The end opposite the DNA is positively charged, and since DNA is ______charged, the DNA is ______to that end and move there The ______pieces are able to move much more ______through the gel than the larger pieces So, the smaller pieces move ______ Then we place the gel in ______and the DNA shows up in ______ The ______segments of DNA will be the bands ______from the ______ What do you think we can tell from these bands?
Who is Luna’s Father? ______