<p>Name: ______Date: ______DNA Analysis Notes</p><p>Where do we find DNA?  DNA can be found in almost every cell in your body (except red blood cells)  DNA can be found in any bodily fluids such as saliva, semen, and blood.  DNA can be found in hair, but only if the hair was pulled out at the root.  DNA can NOT be found in fingernail clipping, fingerprints, or cut pieces of hair. Blood Type Analysis:  A blood sample can be analyzed to determine its type (A, B, AB, O, and + or -).  We do this by dropping the blood into three different wells.  We add the three different antibodies to each well (antibody A, antibody B, and Rh factor)  If the blood clumps up, then that is the blood type.  So, if the blood in well A and B clumps, but does not in the Rh factor well, what is our suspect’s blood type? ______DNA Fingerprinting:  Humans have about 99.9% of their DNA in common.  But that 0.1% that is different is unique to every person, like a fingerprint.  Finding DNA evidence is just as useful as finding a fingerprint because we have discovered ways to quickly analyze DNA to determine your fingerprint. Gel Electrophoresis:  We can analyze DNA using a technique called gel electrophoresis.  We do this by using certain restriction enzymes to cut each sample of DNA.  Since everyone’s DNA is different the restriction enzymes will cut it in different areas creating different size pieces.  The more places we cut the DNA, the more accurate or specific our results will be to a specific person.  Where will the DNA be cut if I add an enzyme that cuts between the A and T every time it sees AATT</p><p>GCAATTGCCATGGGCAATTCCGACATGC</p><p>GCAATGCCAATTGGCAATTGGCAATTGC</p><p> What this cutting does is creates uniquely sized pieces of DNA for each person  Family members will have pieces in common, but not all pieces will be the same length.  DNA is far too small to look at the sizes of the pieces, so we use gel electrophoresis  After the DNA is cut, we put it into wells in the gel.  The gel looks like jello, but it has pores in it that the DNA can move through.  We put the gel into the electrophoresis box and turn on an electric current  The end opposite the DNA is positively charged, and since DNA is negatively charged, the DNA is attracted to that end and move there  The smaller pieces are able to move much more quickly through the gel than the larger pieces  So, the smaller pieces move farther  Then we place the gel in dye and the DNA shows up in bands.  The smaller segments of DNA will be the bands farther from the wells.  What do you think we can tell from these bands? </p><p>Who is Luna’s Father? ______Name: ______Date: ______DNA Analysis Notes</p><p>Where do we find DNA?  DNA can be found in ______every cell in your body (except ______blood cells)  DNA can be found in any bodily ______such as ______, semen, and ______ DNA can be found in ______, but only if the hair was pulled out at the ______ DNA can ______be found in ______clipping, fingerprints, or cut pieces of hair. Blood Type Analysis:  A blood sample can be analyzed to determine its ______(A, B, AB, O, and + or -).  We do this by dropping the blood into ______different wells.  We add the three different ______to each well (antibody A, antibody B, and Rh factor)  If the blood ______up, then that is the blood type.  So, if the blood in well A and B clumps, but does not in the Rh factor well, what is our suspect’s blood type? ______DNA Fingerprinting:  Humans have about ______of their DNA in common.  But that 0.1% that is different is unique to every person, like a ______ Finding DNA evidence is just as useful as finding a fingerprint because we have discovered ways to quickly analyze DNA to determine your fingerprint. Gel Electrophoresis:  We can analyze DNA using a technique called ______ We do this by using certain ______enzymes to cut each sample of DNA.  Since everyone’s DNA is different the restriction enzymes will cut it in different areas creating different ______pieces.  The more places we cut the DNA, the more ______or specific our results will be to a specific person.  Where will the DNA be cut if I add an enzyme that cuts between the A and T every time it sees AATT</p><p>GCAATTGCCATGGGCAATTCCGACATGC</p><p>GCAATGCCAATTGGCAATTGGCAATTGC  What this cutting does is creates uniquely sized pieces of DNA for each person  Family members will have pieces in ______, but not all pieces will be the same length.  DNA is far too ______to look at the sizes of the pieces, so we use gel electrophoresis  After the DNA is cut, we put it into ______in the gel.  The gel looks like jello, but it has ______in it that the DNA can move through.  We put the gel into the electrophoresis box and turn on an ______current  The end opposite the DNA is positively charged, and since DNA is ______charged, the DNA is ______to that end and move there  The ______pieces are able to move much more ______through the gel than the larger pieces  So, the smaller pieces move ______ Then we place the gel in ______and the DNA shows up in ______ The ______segments of DNA will be the bands ______from the ______ What do you think we can tell from these bands? </p><p>Who is Luna’s Father? ______</p>