The Transcriptional Regulation and the Functional Consequences of Osteopontin by Aldosterone

Osteopontin in rat renal fibroblasts: functional properties and transcriptional regulation by aldosterone.

Jun Irita, M.D., Takafumi Okura, M.D., Ph.D., Mie Kurata, M.D., Ph.D., Ken-ichi Miyoshi,

M.D., Ph.D., Tomikazu Fukuoka, M.D., Ph.D., and Jitsuo Higaki, M.D., Ph.D.

Department of Integrated Medicine and Informatics Ehime University Graduate School of

Medicine, Shitsukawa, Toon City, Ehime, 791-0295, Japan

Runnning/short title: Regulation of osteopontin gene by aldosterone

Supplemental manuscript; 760 words.

Send all correspondence to: Takafumi Okura, M.D., Ph.D.

Mailing address: Department of Integrated Medicine and Informatics Ehime University

Graduate School of Medicine, Shitsukawa, Toon City, Ehime, 791-0295, Japan

Direct phone: +81-89-960-5303

Fax: +81-89-960-5306

E-mail address: [email protected] Online data supplement

Expanded methods

Materials

Aldosterone, spironolactone, and actinomycin D were purchased from Sigma-Aldrich.

Affinity-purified antibodies for c-Fos, c-Jun, p50, and p65 were from Santa Cruz

Biotechnology.

mRNA and protein analysis

Total RNA was prepared according to the previously described method1. The mRNA expression levels of osteopontin (OPN), collagens type I, III, IV and glyceraldehyde-3- phosphate dehydrogenase (GAPDH) were analyzed by real time polymerase chain reaction

(PCR) using fluorescent SYBR green technology (LightCycler, Roche Molecular

Biochemicals). GAPDH cDNA was amplified and quantitated in each cDNA preparation to normalize the relative amounts of OPN, collagen types I, III and IV. The primer sequences were as follows: OPN (forward 5 -CCAGCACACAAGCAGACGTT-3 , reverse 5 -

TCAGTCCATAAGCCAAGCTATCAC-3 ); type I collagen (forward 5 -

TCACCTACAGCACGCTTG-3 , reverse 5 -GGTCTGTTTCCAGGGTTG-3 ); type III collagen (forward 5 -ATATCAAACACGCAAGGC-3 , reverse 5 -

1 GATTAAAGCAAGAGGAACAC-3 ); type IV collagen (forward 5 -

GAGGGTGCTGGACAAGCTCTT-3 , reverse 5 -TAAATGGACTGGCTCGGAATTC-3 );

GAPDH (forward 5 -TCCACCACCCTGTTGCTGTA-3 , reverse 5 -

ACCACAGTCCATGCCATCCAC-3 ). Western blotting analysis was performed as previously described1. OPN antibody was purchased from Immuno-Biological Laboratories.

Plasmid construction used for promoter assay

Serial 5' deletions of the rat OPN promoter (GenBankTM accession number AF017274) were prepared by selective PCR. Seven 5' deletions, which had nucleotide sequences starting at the indicated positions were selected. These DNA fragments were inserted into the firefly luciferase vector, pGL4.10 [luc2] (Promega). Resultant plasmids were designed as Luc-2153,

Luc-1839, Luc-1758, Luc-1563, Luc-1091, Luc-621 and Luc-174. In addition, point mutations for the activator protein-1 (AP-1) or nuclear factor kappa B (NFB) binding motifs were performed by a PCR technique with use of Luc-2153 as a template. The mutated AP-1 or NFB primer used for PCR was generated as shown in Figure 2-B.

Transient DNA transfection and luciferase assay

Renal fibroblasts were transfected with 0.8 µg DNA using LipofectAMINE 2000

(Invitrogen). Eight hours after transfection, cells were cultured in Dulbecco’s modified

Eagle’s medium (DMEM) supplemented with 0.1% Fatal bovine serum (FBS) for 24 hours

2 before aldosterone stimulation. Luciferase activity was assayed 24 hours after stimulation using the Dual-GloTM Luciferase Assay System (Promega). Promoter activity was calculated as firefly/renilla luciferase activity ratio and was finally expressed as a fold-activation compared to the baseline level.

Electrophoretic mobility shift assay (EMSA)

Functional promoter analysis was performed by EMSA and supershift assay as previously described2. For binding assays, probe 1 containing the AP-1 potential site was 5'-

TTCGTGTTGAGTCATTCCTGT -3' and probe 2 containing the NFB potential site was 5'-

GGATTTGTGGAATTTCCCTGCA -3'. Nuclear extract (5 g) was incubated with radiolabeled probes for 20 minutes at room temperature. For competitive assays, 100-fold excess of unlabeled specific probe or non specific probe was added to the nuclear extracts 20 minutes before the addition of the radiolabeled probe. Supershift assays were performed by incubating 5 g of nuclear extract with 0.5 g of the indicated antibody for 60 minutes at room temperature before the addition of the radiolabeled probe.

RNA interference of OPN

For the small interfering RNA (siRNA) assay, renal fibroblasts were transiently transfected with lamin A/C siRNA as a control or OPN-specific siRNA, a cocktail of the 3 siRNAs

3 (designed by B-Bridge) using Lipofectamine RNAiMax (Invitrogen). Twenty-four hours after transfection, cells were treated with or without aldosterone (100 nmol/L).

Cell proliferation assay

Cell proliferation was examined by cell proliferation reagent WST-1 (Roche) as described in our previous report3. The 96-well plate was read on an Enzyme-linked immunosorbent assay reader at 450 nm with a reference wavelength of 650 nm. Data were expressed as the percentage absorbance relative to untreated controls.

Inhibition of AP-1 and NFB

The decoy oligodeoxynucleotide (ODN) technique was used to inhibit nuclear translocation of AP-1 or NFB. EMSA confirmed that decoy ODN against AP-1 or NFB binding sites specifically competed whereas control decoy ODN did not (data not shown). The decoy

ODN (2.5 mol/L) was added to renal fibroblasts 6 hour before stimulation by aldosterone

(100 nmol/L). Sense and antisense strands of decoy ODN as well as its scrambled decoy

ODN were designed and synthesized by Gene Design, Inc.

4 References

1. Fukuoka T, Kitami Y, Okura T, Hiwada, K. Transcriptional regulation of the platelet- derived growth factor alpha receptor gene via CCAAT/enhancer-binding protein-delta in vascular smooth muscle cells. J Biol Chem. 1999; 274: 25576-25582.

2. Takata Y, Kitami Y, Fukuoka T, Okura T, Hiwada K. Novel cis element for tissue-specific transcription of rat platelet-derived growth factor beta-receptor gene. Hypertension. 1999;

33: 298-302.

5 3. Okura T, Igase M, Kitami Y, Fukuoka T, Maguchi M, Kohara K, Hiwada K. Platelet- derived growth factor induces apoptosis in vascular smooth muscle cells: roles of the Bcl-2 family. Biochim Biophys Acta. 1998; 1403: 245-253.