Nakada Et Al. Supplemental Material

Nakada et al. S1

Nakada et al. Supplemental Material

Materials and Methods

Plasmids

To construct YIp-TEL1-HA, the 5’-noncoding and N-terminal region of the HA-TEL1 gene from YEp-TEL1-HA (Nakada et al., 2003) was cloned into pRS306 (Sikorski and

Hieter, 1989). The ADH4cs::HIS2 cassette was constructed as follows. First, the 5’- and

3’-regions of the ADH4 locus were amplified by PCR, and cloned into pFA6a (Wach et al., 1994). Next, a fragment containing the HO cleavage site at the MATa locus and another 500 bp-fragment containing HIS2 were obtained by PCR. These PCR fragments were cloned into the pFA6 plasmid containing the ADH4 locus, generating pADH4cs::HIS2. To construct YCpA-GAL-HO, the GAL-HO fusion gene from pGAL-

HO (Kondo et al., 2001) and the fragment containing ADE1 were subsequently cloned into pRS313 (Sikorski and Hieter, 1989). To construct pGBDU-TEL1, a fragment containing amino acids 2 to 1979 of Tel1 was obtained by PCR using pDM198 as a template, and then cloned into pGBDm (Wakayama et al., 2001). YCpT-RAD53-HA was described (Kondo et al., 2001).

Strains

The TEL1-HA::TRP1 strains were obtained by transforming YIp-TEL1-HA after treatment with RsrII and replacing the URA3 marker with TRP1. To obtain the xrs2-

11::KanMX strains, a termination codon was inserted into the corresponding region of Nakada et al. S2

XRS2 by transforming with a PCR product using pFA6a-KanMX4 (Wach et al., 1994) as a template. To integrate the HO cleavage site at the ADH4 locus, the pADH4cs::HIS2 plasmid was treated with NotI and SalI and transformed into cells. Cells containing the

MATa-inc allele were constructed using pUraSupMata-inc (Sweetser et al., 1994). The

XRS2-HA::KanMX, XRS2-myc::TRP1, xrs2-11-HA::KanMX and xrs2-11-myc::TRP1 strains were constructed as described (Knop et al., 1999). The resulting cells were found to exhibit the same DNA damage sensitivity as wild-type and xrs2-11 mutant cells, respectively. The sae2::URA3 and xrs2::hisG constructs were obtained from K. Ohta and T. Ogawa, respectively. The sml1::LEU2, tel1::KanMX, and mec1-81 mutations were described previously (Wakayama et al., 2001; Nakada et al., 2003).

Oligonucleotides

The sequences of oligonucleotide probes to examine the 5’ to 3’ or 3’ to 5’ degradation are 5’-

CACCATATTAAAGCATGACTTTTGCATGACTATTTTTCAGTCTTAAATGCTTCA

AAGCCAACAGTATGTCAGTAATTAAGTCCA-3’, or 5’-

ACTTAATTACTGACATACTGTTGGCTTTGAAGCATTTAAGACTGAAAAATAGT

CATGCAAAAGTCATGCTTTAATATGGTGGGT-3’, respectively.

The sequence of primers for the HO1 set at the ADH4 locus are 5’-

TCTATTAATGAGCCGAGACCGGTA-3’ and 5’-

CGCATGTGAATGACACACGAAAGT-3’, for the HO2 set at the ADH4 locus are 5’-

CATTATTCTCGGAAGTAGAGTCGA-3’ and 5’- Nakada et al. S3

TTCGCGAGAAGAAGGTACATGATC-3’, and for the SMC2 locus are 5’-

AAGAGAAACTTTAGTCAAAACATGGG-3’ and 5’-

CCATCACATTATACTAACTACGG-3’.

Supplementary Table 1. List of strains used in this study

______KSC1560 sml1::LEU2 KSC1561 mec1::LEU2 sml1::LEU2 KSC1562 xrs2::hisG sml::LEU2 KSC1563 xrs2-11::KanMX sml1::LEU2 KSC1564 mec1-81 tel1::KanMX sml1 ::LEU2 KSC1565 mec1-81 xrs2-11::KanMX sml1 ::LEU2 KSC1566 mec1-81 tel1::KanMX xrs2-11::KanMX sml1 ::LEU2 KSC1567 sae2::URA3 sml1::LEU2 KSC1594 tel1::KanMX sae2::URA3 sml1::LEU2 KSC1595 xrs2-11::KanMX sae2::URA3 sml1::LEU2 KSC1596 mec1-81 tel1::KanMX sae2::URA3 sml1::LEU2 KSC1597 mec1-81 xrs2-11::KanMX sae2::URA3 sml1::LEU2 KSC1620 xrs2::hisG KSC1621 xrs2-11::KanMX KSC1662 mec1-81 sml1::LEU2 KSC1661 tel1::KanMX sml1::LEU2 KSC1701 mec1::LEU2 sae2::URA3 sml::LEU2 KSC1775 mec1-81 sae2::URA3 sml1::LEU2 KSC1744 XRS2-HA::KanMX KSC1798 XRS2-HA::KanMX sae2::URA3 KSC1799 XRS2-HA::KanMX tel1::KanMX KSC1863 XRS2-HA::KanMX sml1::LEU2 KSC1864 XRS2-HA::KanMX mec1::LEU2 sml1::LEU2 Nakada et al. S4

KSC1869 xrs2-11-HA::KanMX KSC1785 TEL1-HA::TRP1 KSC1786 TEL1-HA::TRP1 sae2::URA3 KSC1873 TEL1-HA::TRP1 mec1::LEU2 sae2::URA3 sml1::LEU2 KSC1874 TEL1-HA::TRP1 sml1::LEU2 KSC1875 TEL1-HA::TRP1 mec1::LEU2 sml1::LEU2 KSC1881 TEL1-HA::TRP1 xrs2::hisG KSC1882 TEL1-HA::TRP1 xrs2-11::KanMX KSC1904 XRS2-myc::TRP1 KSC1905 xrs2-11-myc::TRP1 KSC1906 TEL1-HA::TRP1 XRS2-myc::TRP1 KSC1907 TEL1-HA::TRP1 xrs2-11-myc::TRP1 ______All the strains are isogenic to KSC1516 (MATa-inc ADH4cs::HIS2 ade1 his2 leu2 trp1 ura3).

Figure Legends

Supplementary Figure 1. Cell viability after phleomycin treatment (A) and UV irradiation (B). Cells were grown exponentially and then incubated with 0.1 mg/ml phleomycin at the indicated time, or irradiated at the indicated doses with UV. Cells viability was determined as described in Shimomura et al. (1998). Cells used are the same as in Fig. 1A and 1B.

Supplementary Figure 2. Rad53 kinase activity after HO expression. Cells, carrying

YCpT-RAD53-HA and YCpA-GAL-HO, were treated as in Fig. 2D. Extracts were Nakada et al. S5

prepared from cells, and subjected to immunoprecipitation with anit-HA-antibodies.

The immunoprecipitated Rad53 proteins were assayed for kinase activity using histone

H1 as a substrate (Sun et al., 1996; Sugimoto et al., 1997). Autoradiogram shows 32P incorporation into histone H1 (Top). Immunoblotting with anti-HA antibodies indicates the amount of the Rad53 proteins used for the kinase assay (Bottom). Electrophoresis was performed on 12% of SDS-polyacrylamide gels shortly to compact the phosphoforms of Rad53 (Bottom). Cells used are the same as in Fig. 2D.

Supplementary Figure 3. Cellular localization and expression level of Tel1 in xrs2 and xrs2-11 mutants. Cells expressing Tel1-HA were harvested and spheroplasted.

Spheroplasts were then homogenized to prepare whole cell extract (W) and then separated into the cytoplasmic (C) and nuclear (N) fractions as described (Wakayama et al., 2001). Aliquots were analyzed on immunoblots with anti-HA, anti-glucose-6-P dehydrogenase (G6PD) and anti-nuclear pore complex (NPC) antibodies. Cells used are the same as in Fig. 3C.

Supplementary References

Knop, M., Siegers, K., Pereira, G., Zachariae, W., B, B.W., Nasmyth, K. and Schiebel,E.

1999. Epitope tagging of yeast genes using a PCR-based strategy: more tags

and improved practical routines. Yeast, 15, 963-972. Nakada et al. S6

Shimomura, T., Ando, S., Matsumoto, K. and Sugimoto, K. 1998. Functional and

physical interaction between Rad24 and Rfc5 in the yeast checkpoint pathways.

Mol. Cell. Biol. 18:5485-5491.

Sikorski, R.S. and Hieter, P. 1989. A system of shuttle vectors and yeast host strains

designed for efficient manipulation of DNA in Saccharomyces cerevisiae.

Genetics, 122, 19-27.

Sugimoto, K., S. Ando, T. Shimomura, and K. Matsumoto. 1997. Rfc5, replication

factor C component, is required for regulation of Rad53 protein kinase in the

yeast checkpoint pathway. Mol. Cell. Biol. 17: 5905-5914.

Sun, Z., D.S. Fay, F. Marini, M. Foiani, and D.F. Stern. 1996. Spk1/Rad53 is regulated

by Mec1-dependent protein phosphorylation in DNA replication and damage

checkpoint pathways. Genes & Dev. 10: 395-406.

Wach, A., Brachat, A., Pohlmann, R. and Philippsen, P. 1994. New heterologous

modules for classical or PCR-based gene disruptions in Saccharomyces

cerevisiae. Yeast, 13, 1793-1808.