Dna and Protein Synthesis

Total Page:16

File Type:pdf, Size:1020Kb

Dna and Protein Synthesis

DNA AND PROTEIN SYNTHESIS

 DNA is short for  DNA is a nucleic acid.  The subunits of nucleic acids are called  The each nucleotide of DNA has a , and a .  The nitrogen bases are A , T , G and C  The nitrogen bases always pair – T C –  The amount of adenine in a DNA molecule always equals the amount of .  The amount of guanine in a DNA molecule always the amount of cytosine.  The shape of a DNA molecule is a  How many strands make up a DNA molecule  The scientists who discovered the structure of the DNA molecule were and

BUILD A DNA MOLECULE http://learn.genetics.utah.edu/content/begin/dna/builddna/ Draw a diagram to show the molecule you built. Label your diagram and draw a line around one nucleotide.

DNA REPLICATION  Define replication.  Go to the website below and read the introduction.  http://www.pbs.org/wgbh/aso/tryit/dna/  Click on the site below  http://www.pbs.org/wgbh/aso/tryit/dna/shockwave.html  Click on DNA replication, unzip and follow the instructions. Draw the steps.  Replicate the following strands ATCGTACAGTACTAGACAA

GTACGACTAGCCATGGTAT

PROTEIN SYNTHESIS  Go to the website below, click on protein synthesis and read information  http://www.pbs.org/wgbh/aso/tryit/dna/  Click on site below  http://www.pbs.org/wgbh/aso/tryit/dna/shockwave.html  Click on protein synthesis and follow the instructions. Repeat the above process as needed, record the steps associated with protein synthesis, and answer the questions below. You may also need the book as a resource.

RNA  RNA is a nucleic acid  The subunits of RNA are  The subunits of RNA are composed of , , and .  The nitrogen bases in RNA are , , and .  The replaces the thymine in DNA.  The base pairing in RNA is A- and G-  RNA is composed of a strand.  There are three types of RNA: mRNA , tRNA and rRNA

TRANSCRIPTION  Define mRNA  Define transcription  Draw transcription process.  Where does transcription occur in the cell?  What happens to the mRNA produced during transcription?  Transcribe the following DNA strands: ATGCTTGACCGTATTGCGGAATC

TTCCGCAATTAACGGCATATGAC

TRANSLATION  Define tRNA  Draw a diagram to illustrate a tRNA molecule  Define rRNA  Define translation  Define codon  Define anticodon  What does each group of three nitrogen bases on the mRNA represent?  Explain how a codon chart is used to identify amino acids.  What amino acid is represented by each of the mRNA codons:  AUG UAG GCU CCC GAC  What anticodon matches each of these codons:  AAG UCG GAU AAU CUG  What transports the amino acids to the ribosome?  How does the tRNA know where to drop off an amino acid at the ribosome?

 Name the bond that forms between amino acids in the polypeptide/protein chain.

 Translate the following mRNA strands into amino acid strands

AUG-----GUC------AGC------UAC

UGA-----GCA------CAC------UGU

Recommended publications