2. What Direction Does the Ribosome Move?

Total Page:16

File Type:pdf, Size:1020Kb

Load more

BIO 313 SI Leader: WORKSHEET 18 Course: Supplemental Instruction Instructor: Iowa State University Date: 1. Define translation

2. What direction does the ribosome move?

3. What direction are proteins synthesized?

4. What is a ribosome?

5. Where does translation occur in eukaryotes? Prokaryotes?

6. What makes up the 70S ribosome? Is this prokaryotic or eukaryotic?

7. (#15) Using the genetic code. Give the amino acids specified by the following bacterial mRNA sequences, and indicate the amino and carboxyl ends of the polypeptide produced.

5’ – AUGUUUAAAUUUAAAUUUUGA -3’

5’ – AGGGAAAUCAGAUGUAUAUAUAUAUAUGA -3’

5’ – UUUGGAUUGAGUGAAACGAUGGAUGAAAGAUUUCUCGCUUGA -3’

5’ – GUACUAAGGAGGUUGUAUGGGUUAGGGGACAUCAUCAUUUUGA – 3’

1060 Hixson-Lied Student Success Center v 515-294-6624 v [email protected] v http://www.si.iastate.edu 8. A template strand of bacterial DNA has the following base sequence. What amino acid sequence will be encoded by this sequence?

5’ – CGAGCTACGGCACAACAGGCATT – 3’

9. (#17) The following amino acid sequence is found in a tripeptide: Met-Trp-His. Give all the possible nucleotide sequences on the mRNA, on the template strand of DNA, and on the non-template strand of DNA that can encode this tripeptide.

10. (#19) The following anticodons are found in a series of tRNAs. Refer to the genetic code and give the amino acid carried by each of these tRNAs.

a. 5’-GUA-3’

b. 5’-AUU-3’

c. 5’-GGU-3’

d. 5’-CCU-3’

11. (#20) Which of the following amino acid changes could result from a mutation that changed a single base? For each change that could result from the alteration of a single base, determine which position of the codon (1st, 2nd, 3rd nucleotide) in the mRNA must be altered for the change to result.

a. Leu -> Gln

b. Phe -> Ser c. Phe -> Ile

d. Pro -> Ala

e. Asn -> Lys

f. Ile -> Asn

Recommended publications