2. What Direction Does the Ribosome Move?
Total Page：16
File Type：pdf, Size：1020Kb
BIO 313 SI Leader: WORKSHEET 18 Course: Supplemental Instruction Instructor: Iowa State University Date: 1. Define translation
2. What direction does the ribosome move?
3. What direction are proteins synthesized?
4. What is a ribosome?
5. Where does translation occur in eukaryotes? Prokaryotes?
6. What makes up the 70S ribosome? Is this prokaryotic or eukaryotic?
7. (#15) Using the genetic code. Give the amino acids specified by the following bacterial mRNA sequences, and indicate the amino and carboxyl ends of the polypeptide produced.
5’ – AUGUUUAAAUUUAAAUUUUGA -3’
5’ – AGGGAAAUCAGAUGUAUAUAUAUAUAUGA -3’
5’ – UUUGGAUUGAGUGAAACGAUGGAUGAAAGAUUUCUCGCUUGA -3’
5’ – GUACUAAGGAGGUUGUAUGGGUUAGGGGACAUCAUCAUUUUGA – 3’
1060 Hixson-Lied Student Success Center v 515-294-6624 v [email protected] v http://www.si.iastate.edu 8. A template strand of bacterial DNA has the following base sequence. What amino acid sequence will be encoded by this sequence?
5’ – CGAGCTACGGCACAACAGGCATT – 3’
9. (#17) The following amino acid sequence is found in a tripeptide: Met-Trp-His. Give all the possible nucleotide sequences on the mRNA, on the template strand of DNA, and on the non-template strand of DNA that can encode this tripeptide.
10. (#19) The following anticodons are found in a series of tRNAs. Refer to the genetic code and give the amino acid carried by each of these tRNAs.
a. 5’-GUA-3’
b. 5’-AUU-3’
c. 5’-GGU-3’
d. 5’-CCU-3’
11. (#20) Which of the following amino acid changes could result from a mutation that changed a single base? For each change that could result from the alteration of a single base, determine which position of the codon (1st, 2nd, 3rd nucleotide) in the mRNA must be altered for the change to result.
a. Leu -> Gln
b. Phe -> Ser c. Phe -> Ile
d. Pro -> Ala
e. Asn -> Lys
f. Ile -> Asn