
<p>BIO 313 SI Leader: WORKSHEET 18 Course: Supplemental Instruction Instructor: Iowa State University Date: 1. Define translation</p><p>2. What direction does the ribosome move?</p><p>3. What direction are proteins synthesized?</p><p>4. What is a ribosome?</p><p>5. Where does translation occur in eukaryotes? Prokaryotes?</p><p>6. What makes up the 70S ribosome? Is this prokaryotic or eukaryotic?</p><p>7. (#15) Using the genetic code. Give the amino acids specified by the following bacterial mRNA sequences, and indicate the amino and carboxyl ends of the polypeptide produced.</p><p>5’ – AUGUUUAAAUUUAAAUUUUGA -3’</p><p>5’ – AGGGAAAUCAGAUGUAUAUAUAUAUAUGA -3’</p><p>5’ – UUUGGAUUGAGUGAAACGAUGGAUGAAAGAUUUCUCGCUUGA -3’</p><p>5’ – GUACUAAGGAGGUUGUAUGGGUUAGGGGACAUCAUCAUUUUGA – 3’</p><p>1060 Hixson-Lied Student Success Center v 515-294-6624 v [email protected] v http://www.si.iastate.edu 8. A template strand of bacterial DNA has the following base sequence. What amino acid sequence will be encoded by this sequence?</p><p>5’ – CGAGCTACGGCACAACAGGCATT – 3’ </p><p>9. (#17) The following amino acid sequence is found in a tripeptide: Met-Trp-His. Give all the possible nucleotide sequences on the mRNA, on the template strand of DNA, and on the non-template strand of DNA that can encode this tripeptide. </p><p>10. (#19) The following anticodons are found in a series of tRNAs. Refer to the genetic code and give the amino acid carried by each of these tRNAs.</p><p> a. 5’-GUA-3’</p><p> b. 5’-AUU-3’</p><p> c. 5’-GGU-3’</p><p> d. 5’-CCU-3’ </p><p>11. (#20) Which of the following amino acid changes could result from a mutation that changed a single base? For each change that could result from the alteration of a single base, determine which position of the codon (1st, 2nd, 3rd nucleotide) in the mRNA must be altered for the change to result.</p><p> a. Leu -> Gln</p><p> b. Phe -> Ser c. Phe -> Ile</p><p> d. Pro -> Ala</p><p> e. Asn -> Lys</p><p> f. Ile -> Asn</p>
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages3 Page
-
File Size-