Table S1. Design of Shrna Targeting on Porcine CTSB Gene

Total Page:16

File Type:pdf, Size:1020Kb

Table S1. Design of Shrna Targeting on Porcine CTSB Gene

Supplementary data Table S1. Design of ShRNA targeting on porcine CTSB gene ShRNA Synthesized oligonucleotides

ShRNA1 5'- GATCCGCCCGACCATCAAAGAGATCACTCGAGTGATCTCTTTGATGGTCGGGCTTTTTC-3'

5'- TCGAGAAAAAGCCCGACCATCAAAGAGATCACTCGAGTGATCTCTTTGATGGTCGGGCG-3'

ShRNA2 5'- GATCCGCCTGGAACTTCTGGACAAAGCTCGAGCTTTGTCCAGAAGTTCCAGGCTTTTTC-3'

5'-TCGAGAAAAAGCCTGGAACTTCTGGACAAAGCTCGAGCTTTGTCCAGAAGTTCCAGGCG-3'

ShRNA3 5'-GATCCGGAACGAGAAGGAGATCATGGCTCGAGCCATGATCTCCTTCTCGTTCCTTTTTC-3'

5'-TCGAGAAAAAGGAACGAGAAGGAGATCATGGCTCGAGCCATGATCTCCTTCTCGTTCCG-3'

Scrambled 5'- GATCCGACACCTACGCAAAACCCTCTCGAGAGGGTTTTGCGTAGGTGTCTTTTTC-3'

5'- TCGAGAAAAAGACACCTACGCAAAACCCTCTCGAGAGGGTTTTGCGTAGGTGTCG-3'

Fig.S1 Construction and infection of Ad-CTSB.(A). pAd-CTSB was digested with PacⅠ (2,4,6: three clones of pAd-CTSB, all of them released a 4.5kb fragment after PacⅠ digestion; 1,3,5: negative clone; M: λHind Ⅲ marker). (B). 293A cells transfected by pAd-CTSB(a. 293A cells transfected by pAd-CTSB for 2 days, the GFP began to expression. b. The virus release 3 days post transfection, the GFP expression incteased rapidly. c-e. The GFP expression at the 5-8 days post transfection, the fluorescence of GFP together. f. 293A cells transfected by pAd-CTSB for 9 days, above 95% cells appeared CPE). (C). Porcine preadipocytes infected by Ad-CTSB(a. Normal porcine preadipocytes. b. Porcine preadipocytes infected by Ad-GFP, as control. c. Porcine preadipocytes infected by Ad-CTSB for 48h, about 90% cells could express GFP).

Fig.S2 Construction and infection of Sh-CTSB.(A). The anneal of four pairs of oligonucleotides(1-4: Sh1,Sh2,Sh3,SCR; M: Trans 2K marker). (B). The annealed nucleotides were subcloned into pLenti-H1 lentiviral vectors(3,4,6,8,9: five clones of pLenti-H1-Sh-CTSB, all of them released a 59bp fragment after BamHⅠ and XhoⅠ digestion; 1,2,5,7,10: negative clones; M: DNA Marker Ⅰ marker). (C). Production and identification of recombinant lentivirus. GFP expression at 48h, more than 90% cells expressed GFP(Above: 100x; below: 200x). (D). Porcine preadipocytes infected by Sh-CTSB(a. Normal porcine preadipocytes. b. Porcine preadipocytes infected by Sh-CTSB for 48h, about 90% cells could express GFP. c. Porcine preadipocytes infected by SCR, as control).

Fig.S3 Expression patterns of CTSB in porcine various tissues.(A). CTSB mRNA expression levels in different tissues of 180-day-old pigs by real-time PCR. (B).CTSB mRNA levels in different tissues of 3-day-old piglets(n=3).

Fig.S4 The influence of LiCl to preadipocyte differentiation in different concentration.(A):Oil Red O displayed that LiCl could suppress cell differentiation and showed obviously dosage-dependent effects(From left to right: NaCl as the control; 5mMLiCl; 10 mMLiCl;15 mMLiCl).(B): Overdose of LiCl could impaire cell proliferation(25 mMLiCl).

Recommended publications