Interactome Mapping of the Mitochondrial Intermembrane Space Proteases Identifies a Novel Function of HTRA2

Aaron Botham

A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Department of Medical Biophysics University of Toronto

Aaron Botham

Doctor of Philosophy

Department of Medical Biophysics University of Toronto

2020 Abstract

Mitochondrial proteases are enzymes responsible for the breakdown of proteins within the mitochondria. A number of these unique proteases localize to specific sub-compartments of the mitochondria, but the functions of these enzymes are poorly defined. To better characterize these proteases, I used proximity-dependent biotinylation (BioID) to map the interactomes of seven proteases localized to the mitochondrial intermembrane space (IMS). In total, I identified 802 high confidence proximity interactions with 342 unique proteins. While all seven proteases co- localized with the IMS markers OPA1 and CLPB, 230 of the interacting partners were unique to just one or two protease bait proteins, highlighting the ability of BioID to differentiate unique interactomes within the confined space of the IMS. Notably, high temperature requirement peptidase 2 (HTRA2) interacted with eight of 13 components of the mitochondrial intermembrane space bridging (MIB) complex, a multiprotein assembly essential for the maintenance of mitochondrial cristae structure. Knockdown of HTRA2 disrupted cristae in HEK

293 and OCI-AML2 cells and led to increased intracellular levels of the MIB subunit IMMT.

Using a cell-free assay, we demonstrated that HTRA2 could degrade recombinant IMMT, while two additional core MIB complex subunits, SAMM50 and CHCHD3 remained undegraded.

Based on these findings, I further investigated the role of HTRA2 in acute myeloid leukemia

(AML). Knockdown of HTRA2 in OCI-AML2 cells showed a decrease in cell growth and an increase in cell differentiation. Additionally, mice injected with HTRA2 knockdown AML cells displayed reduced engraftment, highlighting the role for HTRA2 in tumour cell growth in vivo.

Lastly, I collaborated in the development of additional mitochondrial BioID datasets to help characterize the potential functions of these mitochondrial proteins.

Overall, my characterization of the IMS protease interactome provides important biological context to an understudied class of proteins and represents a rich dataset that can be further mined to uncover novel IMS protease biology.

iii

Acknowledgements

I was lucky enough to have not one, but two fantastic supervisors and mentors to guide me throughout the course of my degree. Both Dr. Aaron Schimmer and Dr. Brian Raught continually kept me on track and focused. They provided continual support and ensured I had everything I needed. I could not have asked for two better supervisors to go through my PhD with. I cannot thank them enough for all their effort in helping me to get where I am today.

I would like to thank the entirety of the Schimmer and Raught labs for making these past four and a half years special. Specifically, Marcela, Rose, Neil, Yulia, Sanjit, Estelle, Etienne, Jon, Faith and Benoit for their support in teaching me everything I know in the wet lab to date, helping plan various experiments, and answering my endless amounts of questions. My fellow students within these labs Tonny, Deb, Meg, Diana, Adam, Sara, Ayesh and Samir who got me through the long days in the lab. Special mentions to Tonny with who I shared a small L shaped desk for over two years where it felt like we developed our own little civilization.

I would next like to thank my family for always supporting me whether it was advice, watching to Jays/Leafs games, or sending me home with a week’s worth of leftovers. You never failed to ask when I was going to graduate or if I had cured cancer yet. At least now I can say I have completed one of those things.

Thanks to my friends who were always willing to grab a drink after a long day. Leslie, Vinny, Laura, Jenna, Meg, May, Matt, Erin and Graham you guys created some of my favourite memories over the past 5 years from cottage weekends to game nights to melted ice cube trays.

Last but not least, I would like to thank my wonderful girlfriend Ariana whom I met at the start of my PhD and who has been by my side ever since. Your support has kept me sane throughout this whole process and I couldn’t imagine doing it without you. There is no question in what I value most about my time as a grad student.

I could not have done any of this without and each and every one of you. This thesis is as much an accomplishment of the people mentioned above as it is mine. Thank you all so much!

Table of Contents

Abstract ...... ii

Acknowledgements ...... iv

Table of Contents ...... v

List of Tables ...... ix

List of Figures ...... xi

Glossary ...... xiv

Chapter 1 Introduction ...... 1

Introduction ...... 1

1.1 Mitochondria ...... 1

1.1.1 Origin of the Mitochondrion ...... 2

1.1.2 Mitochondrial Structure ...... 2

1.1.3 Function of the Mitochondrion ...... 4

1.2 Mitochondrial Proteases ...... 13

1.2.1 Biological Function of Mitochondrial Proteases ...... 14

1.2.2 Mitochondrial Proteases within the Intermembrane Space ...... 14

1.2.3 Mitochondrial Proteases in Health and Disease ...... 19

1.3 Identifying Protein-Protein Interactions ...... 21

1.3.1 Proximity-Dependent Biotinylation (BioID) ...... 21

1.3.2 Other Methods to Identify Protein-Protein Interactions ...... 24

1.3.3 Mass Spectrometry (MS) ...... 26

1.3.4 Analysis of BioID-MS Data ...... 28

1.4 Thesis Rationale and Outline ...... 28

Chapter 2 ...... 30

IMS Protease Interactome Identifies Novel Function of HTRA2 ...... 30

2.1 Chapter Overview ...... 31 v

2.2 Methods ...... 31

2.2.1 Cloning ...... 31

2.2.2 Generation of Stable Inducible Cell Lines and Cell Culture ...... 32

2.2.3 Proximity-Dependent Biotinylation ...... 32

2.2.4 Liquid Chromatography-Electrospray Ionization-Mass Spectrometry ...... 33

2.2.5 Mass Spectrometry Data Analysis ...... 33

2.2.6 Enrichment Analysis and Annotation ...... 34

2.2.7 shRNA Knockdown of HTRA2 ...... 34

2.2.8 Immunofluorescence Confocal Microscopy ...... 34

2.2.9 Electron Microscopy ...... 35

2.2.10 Immunoblotting ...... 35

2.2.11 Cell-free Protease Assay ...... 35

2.2.12 Statistical Analysis and Densitometry ...... 36

2.2.13 Immunoprecipitation Coupled with Mass Spectrometry (IP-MS) ...... 36

2.3 Results ...... 37

2.3.1 BioID identifies unique interactomes for mitochondrial IMS proteases ...... 37

2.3.2 HTRA2 interacts with the MIB complex ...... 40

2.3.3 HTRA2 is required to maintain mitochondrial cristae structure ...... 48

2.3.4 The MIB complex subunit IMMT is an HTRA2 substrate ...... 50

2.3.5 The G399S Parkinson’s associated HTRA2 mutant loses a specific subset of interactors ...... 54

2.3.6 Other IMS Protease BioIDs ...... 57

2.4 Discussion ...... 82

Chapter 3 ...... 86

Effects of HTRA2 on Acute Myeloid Leukemia ...... 86

3.1 Introduction ...... 87

3.2 Methods ...... 87

3.2.1 Cell Culture (Growth Curves) ...... 87

3.2.2 Seahorse Analyzer ...... 88

3.2.3 Mitochondrial ROS Analysis ...... 89

3.2.4 Colony-Forming Unit Assay ...... 89

3.2.5 ATRA-Treated NB4 Cells and CD11b Staining ...... 89

3.2.6 Non-Specific Esterase Staining ...... 90

3.2.7 Engraftment of HTRA2 Knockdown TEX cells ...... 91

3.2.8 RNA-sequencing ...... 91

3.3 Results ...... 91

3.3.1 HTRA2 Knockdown Reduces the Growth of AML Cell Lines and Increases Their Differentiation ...... 91

3.3.2 HTRA2 Knockdown Reduces Engraftment of TEX Cells in Mice ...... 95

3.3.3 Altered Gene Expression in HTRA2 Knockdown OCI-AML2 Cells ...... 96

3.4 Conclusions and Future Directions ...... 99

Chapter 4 BioID of other Mitochondrial Proteins ...... 100

BioID of other Mitochondrial Proteins ...... 100

4.1 Neurolysin (NLN) ...... 100

4.2 Leucine zipper-EF-hand containing transmembrane protein 1 (LETM1) ...... 104

4.3 Signal transducer and activator of transcription 3 (STAT3) ...... 115

4.4 ATP synthase subunit e (ATP5I) ...... 121

4.5 Hexokinase (HK2) ...... 123

4.6 Importin 11 (IPO11) ...... 127

4.7 Mitochondrial Proteomes ...... 128

Chapter 5 Discussion ...... 129

Discussion ...... 129

vii

5.1 Interactome of Seven IMS Proteases ...... 129

5.2 HTRA2 G399S Mutant Interactome ...... 133

5.3 Identification of Matrix Interactors with IMMP2L ...... 133

5.4 Identification of TIMM22 Chaperone Proteins with PARL ...... 134

5.5 Limitations of BioID ...... 135

5.6 Effect of HTRA2 Knockdown in AML ...... 135

References ...... 138

viii

List of Tables

Chapter 2

Table 2.1 Top 20 GO cellular compartment annotations for all IMS protease interactors. Annotations were generated using Toppgene ...... 40

Table 2.2 Complete list of interactors identified by BioID for HTRA2 ...... 43

Table 2.3 IP-MS interactor list for HTRA2 ...... 45

Table 2.4 Complete list of interactors identified by BioID for HTRA2 G399S ...... 55

Table 2.5 Complete list of interactors identified by BioID for HTRA2 S306A ...... 56

Table 2.6 Complete list of interactors identified by BioID for YME1L1 ...... 58

Table 2.7 Complete list of interactors identified by BioID for OMA1 ...... 59

Table 2.8 Complete list of interactors identified by BioID for IMMP1L ...... 62

Table 2.9 Complete list of interactors identified by BioID for IMMP2L ...... 65

Table 2.10 IP-MS interactor list for IMMP1L ...... 69

Table 2.11 IP-MS interactor list for IMMP2L ...... 72

Table 2.12 Complete list of interactors identified by BioID for PARL ...... 76

Table 2.13 Complete list of interactors identified by BioID for LACTB ...... 80

Chapter 4

Table 4.1 Complete list of interactors identified by BioID for NLN ...... 102

Table 4.2 Complete list of interactors identified by BioID for LETM1 ...... 107

Table 4.3 Complete list of interactors identified by BioID for MLS-STAT3 ...... 116

Table 4.4 Complete list of interactors identified by BioID for ATP5I ...... 121

Table 4.5 Complete list of interactors identified by BioID for HK2 ...... 124

Table 4.6 Complete list of interactors identified by BioID for PKK-HK2 ...... 124

Table 4.7 Complete list of interactors identified by BioID for PAA-HK2 ...... 125

Table 4.8 Complete list of interactors identified by BioID for PAA-BirA-PAA-HK2 ...... 126

Table 4.9 Complete list of interactors identified by BioID for IPO11 ...... 127

List of Figures

Chapter 1

Figure 1.1 Mitochondrial Structure ...... 3

Figure 1.2 Summary of the TCA cycle ...... 7

Figure 1.3 Signaling cascade of the mammalian mitochondrial unfolded protein response (mtUPR) ...... 9

Figure 1.4 Summary of the intrinsic cell death pathway ...... 11

Figure 1.5 Regulation of mitochondrial function through mitochondrial proteases ...... 14

Figure 1.6 Proximity-dependent biotinylation (BioID) ...... 22

Chapter 2

Figure 2.1 BioID identifies proximity interactors of the seven human IMS proteases ...... 38

Figure 2.2 The seven IMS proteases are correctly localized within the IMS ...... 39

Figure 2.3 BioID of HTRA2 identifies proximity interactions with the MIB complex ...... 42

Figure 2.4 Schematic of the MIB complex ...... 48

Figure 2.5 Mitochondrial ultra-structure in Flp-In 293 T-Rex and OCI-AML2 cells after HTRA2 knockdown ...... 49

Figure 2.6 Knockdown of HTRA2 disrupts cristae formation in Flp-In T-REx 293 and OCI- AML2 cells ...... 50

Figure 2.7 Schematic of cell-free enzymatic assay for HTRA2 ...... 51

Figure 2.8 HTRA2 degrades IMMT ...... 52

Figure 2.9 CHCHD3 is not a substrate of HTRA2 in vitro ...... 53

Figure 2.10 Model of HTRA2 maintenance of the cristae formation through IMMT of the MIB complex ...... 54

Figure 2.11 GO enrichment analysis of YME1L1 ...... 58

Figure 2.12 GO enrichment analysis of OMA1 ...... 61

Figure 2.13 GO enrichment analysis of IMMP1L ...... 65

Figure 2.14 GO enrichment analysis of IMMP2L ...... 69

Figure 2.15 GO enrichment analysis of PARL ...... 79

Figure 2.16 GO enrichment analysis of LACTB ...... 82

Figure 2.17 Two additional shControls validate the effects of HTRA2 on IMMT levels ...... 84

Chapter 3

Figure 3.1 HTRA2 knockdown reduces growth of AML cell lines ...... 92

Figure 3.2 HTRA2 knockdown down does not affect mitochondrial function ...... 93

Figure 3.3 HTRA2 knockdown in OCI-AML2 cells increases differentiation ...... 94

Figure 3.4 HTRA2 knockdown reduces engraftment of TEX cells in mice ...... 96

Figure 3.5 Summary of RNA-sequencing data on HTRA2 knockdown in OCI-AML2 cells ...... 98

Chapter 4

Figure 4.1 Interactome of neurolysin in Flp-In T-REx 293 cells ...... 102

Figure 4.2 GO enrichment analysis of NLN interactome ...... 104

Figure 4.3 Gel-excision MS experiment overview ...... 106

Figure 4.4 GO enrichment analysis of LETM1 interactome ...... 111

Figure 4.5 GO enrichment analysis of the 114 unique interactors of LETM1 ...... 112

xii

Figure 4.6 GO enrichment analysis of the overlap between proteins identified in the major and minor complex gel-excision experiment with the BioID interactors of LETM1 ...... 114

Figure 4.7 MLS-STAT3 Interactome ...... 119

Figure 4.8 Pearson correlation analysis of Chapter 4 BioID datasets ...... 120

xiii

Glossary

2C-BioID: two-component BioID ADHD: attention hyper deficit disorder ADSC: adipose derived stromal cells AFG3L2: AFG3-like protein 2 AIF: apoptosis-inducing factor AKAP: A-kinase-anchoring protein AML: acute myeloid leukemia AMP: adenosine monophosphate AMPK: AMP-activated protein kinase AOMF: Advanced Optical Microscopy Facility AP-1: activator protein-1 AP-MS: affinity purification coupled to mass spectrometry APAF-1: apoptotic protease activating factor 1 APAF-3: apoptotic protease activating factor 3 APEX: engineered ascorbate peroxidase 2 ATF4: activating transcription factor 4 ATF5: activating transcription factor 5 ATFS-1: activating transcription factor associated with stress ATP: adenosine triphosphate ATP5I: ATP synthase subunit e ATP5L: ATP synthase subunit g ATRA: all-trans retinoic acid Bcl-2: B-cell CLL/ lymphoma 2 BCS1L: mitochondrial chaperone BCS1 BFDR: Bayesian false discovery rate BioID: proximity-dependent biotinylation BirA: biotin ligase (E. coli) BirA*: biotin ligase (E. coli) R118G mutant BZW1: W2 domain-containing protein 1 BZW2: W2 domain-containing protein 2 CFU: colony-forming unit CHCHD3: coiled-coil-helix-coiled-coil-helix domain-containing protein 3 CHOP: transcription factor C/EBP homologous protein CID: collision-induced dissociation CLPB: caseinolytic peptidase B protein homolog CLPP: ClpP protease subunit Co-IP: co-immunoprecipitation COX4: cytochrome c oxidase 4 Cryo-EM: cryo-electron microscopy DMEM: Dulbecco’s Modified Eagle Medium ECAR: extracellular acidification rate ECSIT: evolutionarily conserved signaling intermediate in Toll pathways eIF2a: eukaryotic translation initiation factor 2 subunit 1 ER: endoplasmic reticulum xiv

ESI: electrospray ionization ETC: electron transport chain FADH2: flavin adenine dinucleotide FBS: fetal bovine serum FDR: false discovery rate FKBP: FK506-binding protein FRB: FKBP-rapamycin-binding domain of mammalian target of rapamycin [mTOR] GCN2: general control nonderepressible 2 GO: gene ontology GPD2: glycerol-3-phosphate dehydrogenase HAX1: HCLS1 associated protein X-1 HCD: higher energy collision induced dissociation HIF1a: hypoxia inducible factor 1-alpha HK2: Hexokinase HSC: hematopoietic stem cell HTRA2: high temperature requirement peptidase A 2 IAP: inhibitor of apoptosis protein IM: inner membrane IMDM: Iscove’s Modified Dulbecco’s Medium IMMP1L: inner mitochondrial membrane peptidase subunit 1 IMMP2L: inner mitochondrial membrane peptidase subunit 2 IMMT: mitochondrial inner membrane protein IMS: intermembrane space IP-MS: Immunoprecipitation coupled with mass spectrometry IPO11: Importin 11 IPs: immunoprecipitations IRF3: interferon regulatory factor 3 JAK: Janus kinase family LACTB: Serine beta-lactamase-like LC-MS/MS: liquid chromatography MS/MS LETM1: leucine zipper-EF-hand containing transmembrane protein 1 LONP: Lon protease M: matrix MAVS: mitochondrial antiviral signaling protein MEF: mouse embryonic fibroblast MIB: mitochondrial intermembrane space bridging MOMP: mitochondrial outer membrane permeabilization MPC1: mitochondrial pyruvate carrier 1 MPC2: mitochondrial pyruvate carrier 2 MS: mass spectrometry mtDNA: mitochondrial DNA MTS: mitochondrial targeting sequence mtUPR: mitochondrial unfolded protein response NADH: nicotinamide adenine dinucleotides NF-kB: nuclear factor kappa-light-chain-enhancer of activated B cells NLN: neurolysin NLS: nuclear localizing sequence NOD/SCID-GF: non-obese diabetic/ severe combined immunodeficiency-growth factor xv

NPC: nuclear pore complex NSE: non-specific esterase OCR: oxygen consumption rate OM: outer membrane OMA1: overlapping with the m-AAA protease 1 OPA1: optic atrophy 1 PAGE: polyacrylamide gel electrophoresis PAM16: mitochondrial import inner membrane translocase subunit Tim16 PARK2: E3 ligase Parkin PARL: presenilins-associated rhomboid-like PBP: penicillin-binding protein PDH: pyruvate dehydrogenase complex PERK: protein kinase R (PKR)-like endoplasmic reticulum kinase PGAM5: phosphoglycerate mutase family member 5 PINK1: PTEN-induced kinase 1 PITRM1: pitrilysin metallopeptidase 1 PKA: cAMP-dependent protein kinases PLA: proximity-ligation assay PML-RARA: promyelocytic leukemia-retinoic acid alpha gene fusion PNPase: polynucleotide phosphorylase POI: protein of interest PTEN: phosphatase and tensin homolog PTM: post-translational modification qPCR: quantitative polymerase chain reaction ROS: reactive oxygen species SAINT: significance analysis of interactome SAMM50: sorting and assembly machinery component 50 homolog SCF: stem cell factor SILAC: Stable Isotope Labeling by/with Amino acids in Cell culture SF: Steel factor SOD1: superoxide dismutase 1 SOD2: superoxide dismutase 2 SPG7: spastic paraplegia 7 STAT3: Signal transducer and activator of transcription 3 TCA: tricarboxylic acid tetR: tetracycline repressor TFAM: transcription factor A mitochondrial TIM: translocase of the inner membrane TIMM10: mitochondrial import inner membrane translocase subunit Tim10 TIMM13: mitochondrial import inner membrane translocase subunit Tim13 TIMM23: mitochondrial import inner membrane translocase subunit Tim23 TIMM44: mitochondrial import inner membrane translocase subunit Tim44 TIMM9: mitochondrial import inner membrane translocase subunit Tim9 TIMMDC1: translocase of inner mitochondrial membrane domain-containing protein 1 TLR: Toll-like receptor TOM: translocase of the outer membrane TPCK: Tosylamide-2-phenylethyl chloromethyl ketone TRAF6: tumour necrosis factor receptor-associated factor 6 xvi

UBA1: ubiquitin-like modifier activating enzyme 1 UBE2E3: ubiquitin conjugating enzyme E2 E3 UPR: unfolded protein response UPS: ubiquitin-proteasome system USP30: ubiquitin specific peptidase 30 VDAC: voltage-dependent anion channel VEGF: vascular endothelial growth factor WHS: Wolf–Hirschhorn syndrome WT1: Wilms’ tumour 1 XIAP: X-linked IAP Y2H: yeast-two hybrid YME1L1: YME1 like ATPase

xvii

Chapter 1 Introduction Introduction

Protein degradation is an essential cellular process that allows cells to adapt to stressful situations. Mitochondria possess a unique system of protein degradation in the form of mitochondrial proteases. Classically, mitochondrial proteases were thought to be involved in degrading damaged or misfolded proteins within the mitochondria, and the cleavage of mitochondrial localizing sequences (MLS) (1). However, more recently, these proteases have been associated with other important mitochondrial and biological functions including lipid biosynthesis, mitophagy, mitochondrial dynamics and apoptosis (2). Yet, despite evidence linking proteases to important cellular functions and disease, this class of protein remains largely ill-defined. In this thesis, the interactome of intermembrane space proteases will be described along with other mitochondrial proteins. These interactomes can be used to infer biological functions, as exemplified through the validation of the High Temperature Requirement Peptidase A 2 (HTRA2) interactome.

1.1 Mitochondria

The mitochondrion was first described in the 1840s, but it was not until 1890 that Richard Altmann described them as ubiquitous “elementary organisms” that were living within cells (3, 4). Mitochondria were first isolated by fractionation in 1946 by Albert Claude, who showed that all the components of the electron transport chain (ETC) localized to the mitochondria (5). In 1948, Albert Lehninger and Eugene Kennedy utilized this technique and discovered that mitochondria are the primary organelles responsible for energy production through oxidative phosphorylation and the generation of adenosine triphosphate (ATP) (6). Mitochondria were then coined as the “powerhouses of the cell” in 1957 by Philip Siekevitz (7). In 1963, Margit Nass and Slyvan Nass first described mitochondrial DNA, which was further confirmed by Schatz et al. in 1964 (8, 9).

The mitochondrial genome is a circular chromosome 16.5 kb in length, with 37 genes encoding 22 transfer RNAs, 2 ribosomal RNAs, and 13 proteins that are all components of the ETC (10). Approximately 1100 other mitochondrial proteins are nuclear encoded, and these proteins are

1 2 imported into the mitochondria (11, 12). Mitochondria range in size from approximately 0.75-3 µm in diameter and vary in number based on cell type, which is largely dependent on cell- specific energy demand. For example, liver cells contain approximately 1000-2000 mitochondria while erythrocytes contain none (13, 14).

1.1.1 Origin of the Mitochondrion

The endosymbiotic theory is the most widely accepted view on mitochondrial origins that was first proposed by Lynn Margulis in 1967 (15). This theory hypothesizes that the mitochondria originated from a bacterium that was engulfed by eukaryotic cells and repurposed for energy production. However, the exact details on how or why this event occurred remains controversial. It was thought that the ancestral bacterium was an alphaproteobacterium and the leading candidate was the Rickettsiales order based on their genetic similarities (16–18). In contrast, a recent paper in Nature concluded that the mitochondrion did not evolve from any of the current known alphaproteobacteria (19). Instead the authors hypothesized that the mitochondrion likely evolved from a proteobacteria that pre-dates the divergence of alphaproteobacteria. It is therefore possible that the proteobacterial ancestor of the mitochondrion may already be extinct.

1.1.2 Mitochondrial Structure

The exact structure of the mitochondria was not known until 1952, when George Palade published the first high-resolution electron micrographs of the mitochondria. These images displayed two membranes (the inner and outer membrane) and straight stacked lines termed “cristae” enclosed within a tubular mitochondria (20). Palade and Fritiof Sjöstrand were later able to identify these cristae as invaginations of the inner membrane separating the mitochondria into four major compartments: the outer membrane (OM), intermembrane space (IMS), inner membrane (IM) and matrix (M) (Figure 1.1). (21, 22). The OM and IM are close in proximity leaving approximately a 12-40 nm space between them known as the IMS (23). The area enclosed within the inner membrane is known as the mitochondrial matrix.

Figure 1.1 Mitochondrial Structure A) Representation of a mitochondrion B) Zoomed-in view of the dual-membrane organization of the mitochondrion

The OM is a more porous membrane that allows the free flow of ions and small uncharged molecules with an approximate size exclusion of 3000 Da (24). This is mainly through the voltage-dependent anion channel (VDAC) (25). Due to the free flow of ions and small molecules through this channel, the IMS remains similar in composition to the cytoplasm. Any protein or molecule larger than this is transported into the mitochondria through translocases of the outer membrane (TOMs). The OM also serves as an area for cellular signaling between the mitochondria and the cell. For example, a cell death stimulus on the OM can activate mitochondrial outer membrane permeabilization (MOMP) and induce apoptosis. The role of mitochondria in apoptosis will be discussed in detail in Section 1.1.3.3.

In contrast to the OM, the IM is protein-rich and impermeable to ions and small molecules. Specific transporters are required for each small molecule in order to cross the IM (26). Proteins

4 are shuttled both across and into this membrane through the use of translocases of the inner membrane (TIMs). TIMs can coordinate with TOMs to form various super-complexes that can effectively transport proteins into all compartments of the mitochondria (27). Within the inner membrane there are differences in protein composition that help in maintaining mitochondrial health, such as cristae formation. Cristae are long extensions of the IM into the mitochondrial matrix that increase surface area for oxidative phosphorylation (28). ETC proteins are primarily localized to the cristae with 94% of complex III and complex V proteins residing within this specific region of the IM (28).

The mitochondrial matrix contains the mitochondrial DNA, DNA replication machinery, and mitochondrial ribosomes. Transcription factor A mitochondrial (TFAM) is responsible for condensing the mitochondrial DNA into structures called nucleoids, each containing one copy of mitochondrial DNA (29, 30). Nucleoids are responsible for controlling mitochondrial gene expression, regulating metabolism, and protecting mitochondrial DNA from damage (31). The mitochondrial matrix is the site of enzymatic and metabolic reactions for the citric acid cycle, urea cycle, oxidative phosphorylation, and transamination to form amino acids. As a result, the mitochondrial matrix maintains a very high concentration of proteins and enzymes that equals approximately 50% of the total mitochondrial weight (32).

1.1.3 Function of the Mitochondrion

The mitochondria have an essential and complex role within eukaryotic cells. In 1948, it was discovered that mitochondria are responsible for production of ATP through oxidative phosphorylation (5, 6). More recently there have been numerous other functions associated with mitochondria including the citric acid cycle, fatty acid metabolism, apoptosis, cell signaling, and stress response (33).

1.1.3.1 Metabolism and ATP Production

One of the major sources of energy in the cell comes from glucose through a process called glycolysis. This process is able to breakdown a glucose molecule into two ATPs, two nicotinamide adenine dinucleotides (NADH), and two pyruvates within the cytoplasm. The two three-carbon pyruvate molecules are then non-specifically transported through the mitochondrial outer membrane transporter VDAC. Once in the IMS, mitochondrial pyruvate carriers 1 (MPC1)

5 and 2 (MPC2) transport pyruvate across the inner membrane and into the mitochondrial matrix (34, 35). Pyruvate can also be sourced from deamination of amino acids (36). Within the matrix pyruvate is converted into a two-carbon acetyl-CoA molecule by the pyruvate dehydrogenase complex (PDH) (37, 38). Acetyl-CoA can also be produced from β-oxidation of fatty acids and to a lesser extent metabolism of ketone bodies derived from fatty acids. These occur more frequently under fasting conditions when there is less glucose available to the cell.

β-oxidation is the sequential removal of two carboxyl-terminal carbons producing multiple acetyl-CoA molecules per fatty acid chain, one NADH and one flavin adenine dinucleotide

(FADH2) (39). Both NADH and FADH2 will be discussed later for their roles in oxidative phosphorylation. β-oxidation is an energy efficient way to generate ATP as one fatty acid contains approximately 39 J/Kg compared with 17 J/Kg for glucose (40).

Ketone bodies are produced in the liver from fatty acid oxidation. Within cells utilizing ketones, these molecules can be converted to acetyl-CoA. Ketone bodies are specifically important within the brain, where they can contribute up to 60% of the brain’s energy under starvation conditions (41). There are three types of ketone bodies that can be formed: acetoacetate, 3-β- hydroxybutyrate and acetone (42). These metabolites are produced in the mitochondria of the liver under conditions of low glucose and transported through the blood to energy deprived cells. Once they arrive at these cells, the ketone bodies are transported into the mitochondria and converted back to acetyl-CoA by succinyl CoA-oxoacid transferase and methylacetoacetyl CoA thiolase (42). Acetyl-CoA can then be introduced back into the tricarboxylic acid (TCA) cycle.

The TCA cycle is an eight-step process that breaks down the two-carbon metabolite acetyl-CoA into 2 CO2 molecules and forms the reducing intermediates later used in oxidative phosphorylation (NADH and FADH2)(Figure 1.2). Acetyl-CoA is combined with the 4-carbon oxaloacetate to produce the 6-carbon citrate. Sequential reactions turn citrate back into oxaloacetate that can then be reused and combined with another acetyl-CoA molecule to start the cycle over again (43). Each Acetyl-CoA molecule that is passed through the TCA cycle is able to generate three NADH, one FADH2 and one GTP molecule within the mitochondrial matrix

(44). NADH and FADH2 are then able to carry the energy generated from these reactions to the ETC.

The ETC pumps protons from the matrix across the inner membrane into the IMS using the energy generated from transferring electrons across its four subunits. The fifth subunit, complex V or ATP synthase, uses the proton gradient produced from complexes I-IV to produce ATP (Figure 1.2). Electrons are passed through complexes I-IV in a series of redox reactions that pump protons from the mitochondrial matrix to the IMS. The impermeable IM is responsible for maintaining the mitochondrial membrane potential between the IMS and the mitochondrial matrix. As a result, the matrix has a higher pH of ~8.0 in comparison to the pH of the IMS which is ~7.4 (45).

NADH delivers its two electrons to NADH dehydrogenase of complex I while FADH2 delivers its two electrons to succinate, followed by delivery of the electrons to complex II (46).

Consequently, by skipping complex I, FADH2 generates less energy than NADH in the ETC. Transferring the electrons in a series of redox reactions through complex I-IV and complex II-IV results in the pumping of ten H+ ions and six H+ ions respectively, from the matrix into the IMS (47, 48).

Figure 1.2 Summary of the TCA cycle (49)

An eight-step cascade generates three NADH, one FADH2 and one GTP molecule from oxaloacetate and an acetyl-CoA molecule. NADH and FADH2 are then used to pump hydrogen ions across the inner membrane into the IMS to generate a H+ gradient. This gradient drives the production of ATP through the ATP synthase.

In theory, each NADH and FADH2 should produce three and two molecules of ATP respectively. However, the actual amount of ATP produced per NADH and FADH2 is approximately 2.5 and 1.5 (47, 48, 50). This is based on the total number of H+ molecules generated. The ATP synthase uses three H+ ions to generate one molecule of ATP (51). However, the transfer of the ATP through the inner membrane and back out into the cytoplasm also requires the movement of one H+ ion, resulting in a total of four H+ per ATP generated. Thus, for the ten and six H+ ions moved by NADH and FADH2 respectively, 2.5 and 1.5 ATP molecules are generated (47, 48) totaling approximately 30 molecules of ATP per glucose molecule. This is likely even lower due to inefficiencies in the ETC and hydrogen atoms leaking through the inner membrane (52, 53).

Oxygen is the final electron acceptor that generates water and reactive oxygen species (ROS) through combination with two H+ (54, 55). ROS is a by-product of oxidative phosphorylation and can lead to a variety of cellular responses through macromolecular damage and apoptosis (56). In the mitochondrial matrix and IMS, superoxide dismutase 2 (SOD2) and 1 (SOD1) respectively, are responsible for converting ROS into hydrogen peroxide, followed by conversion into water through the enzyme catalase (57–60). However, uncleared ROS and hydrogen peroxide can have severe toxic effects and can affect cell fate (61). ROS has been linked to numerous disease states such as inflammation, diabetes, and atherosclerosis (62). Therefore, regulating ROS levels is a crucial determinant of cell health.

1.1.3.2 Stress Response

In addition to their essential role in metabolism and energy production, mitochondria play an equally important role under conditions of cellular stress.

The mitochondrial unfolded protein response (mtUPR) is activated in response to mitochondrial dysfunction and the buildup of unfolded proteins within the mitochondria (Figure 1.3). It is a

8 similar pathway to the unfolded protein response (UPR) that occurs in the endoplasmic reticulum (ER); however, this process occurs through different stimuli and signaling mechanisms (63). One initiator of mtUPR is through mitonuclear protein imbalance. As previously discussed, the mitochondrial genome encodes 13 proteins that are involved in the ETC. The remaining components of the ETC are transcribed in the nucleus and imported into the mitochondria. Consequently, equal amounts of both the mitochondrial and nuclear subunits are required to form complete complexes of the ETC. If there is an imbalance to this ratio due to reduction in protein import (loss of nuclear ETC components) or mitochondrial DNA (mtDNA) damage (loss of mitochondrially encoded ETC components), the ETC complexes will remain incomplete (64). As a result, unassembled ETC complex proteins trigger the mtUPR, leading to the expression of mitochondrial chaperone proteins. These proteins bind the incomplete ETC complexes for eventual degradation by proteases within the mitochondria.

The signaling mechanisms involved in the upregulation of mitochondrial chaperone proteins was first described in C. elegans where a reduction in protein import during mitochondrial stress was observed. This reduction in import lead to an accumulation of the activating transcription factor associated with stress (ATFS-1). ATFS-1 contains both a MLS and nuclear localizing sequence (NLS) at the N and C termini, respectively (65). Under normal physiological conditions the MLS localizes the ATFS-1 protein to the mitochondria resulting in degradation by the Lon protease (LONP) (65). However, under stress conditions, import is impaired and the NLS localizes ATFS- 1 to the nucleus to regulate a mtUPR transcriptional response (65).

In the mammalian system, mtUPR was first described when researchers observed that a decrease in mtDNA and increases in accumulation of unfolded proteins in the mitochondrial matrix led to an increase in expression of mitochondrial chaperones and proteases (Figure 1.3)(66, 67). The exact signaling mechanism behind this process still remains unclear; however, it is known to function through the Jnk/c-Jun pathway. This pathway activates the transcription factor C/EBP homologous protein (CHOP) through an AP-1 (activator protein-1) element (68–70). CHOP is then able to increase transcription of chaperones and proteases including HSP60, HSP10, and CLPP (67). CHOP has also been described as a transcription factor upregulated during ER stress (71).

In addition to CHOP, the mammalian ortholog of ATFS-1 from C. elegans was discovered to activate activating transcription factor 5 (ATF5) and shown to be involved in mammalian mtUPR (72). Additionally, during mtUPR, activation of the activating transcription factor 4 (ATF4) pathway has been shown to be upregulated, acting through a cytoprotective role (73). In both C. elegans and in a C57BL/6 xDBA/2 (BXD) mouse model the mtUPR is regulated through epigenetic changes involving H3K27 demethylases suggesting another level of potential regulation that has yet to be fully elucidated (74).

Figure 1.3 Signaling cascade of the mammalian mitochondrial unfolded protein response (mtUPR) (75) Upon stress signals such as increased ROS or mitochondrial/nuclear protein imbalance, eukaryotic translation initiation factor 2 subunit 1 (eIF2a) is phosphorylated by general control nonderepressible 2 (GCN2) or protein kinase R (PKR)-like endoplasmic reticulum kinase (PERK) in initiate mtUPR signaling through CHOP, ATF4, and ATF5.

Thus, mitochondria are key regulators of stress and are involved in adaptive processes during various cellular conditions. Further research is required to completely understand the signaling pathways involved in initiating and regulating mtUPR.

1.1.3.3 Intrinsic Apoptosis

In contrast to mtUPR, apoptosis has a well-characterized signaling pathway through the mitochondria (Figure 1.4). Apoptosis is a form of programmed cell death and is vital to proper functionality of eukaryotic organisms. There are two apoptotic pathways in eukaryotic cells: i) the mitochondrial intrinsic pathway and ii) the extrinsic cell death receptor pathway (76). These pathways are independent until the end point activation of caspase 3, triggering the final

10 apoptotic response. The extrinsic pathway is triggered by an external death ligand that acts on a death receptor. The intrinsic apoptotic pathway responds to stimuli inside the cell through changes in the mitochondria.

The intrinsic apoptotic pathway contains factors that can both promote or prevent apoptosis. Thus, initiation of this pathway can occur through loss of anti-apoptotic signals or through increases in pro-apoptotic signals (76). Some cellular stimuli that promote apoptosis include radiation, hypoxia, viral infection, and free radicals (76). These stimuli cause changes in the levels and activities of the B-cell CLL/ lymphoma 2 (Bcl-2) family of proteins that can initiate intrinsic apoptosis.

The Bcl-2 family contains approximately 30 related proteins that are either pro-apoptotic or anti- apoptotic (77). These proteins are grouped together based on their protein domains and their homology to the founding member of this family of proteins, Bcl-2. Bcl-2 contains four protein domains named BH1, BH2, BH3, and BH4 (78). All proteins within the Bcl-2 family have at least one of these domains. There is also a specific subset of proteins that only contain the BH3 domain and are subsequently termed BH3-only proteins (79, 80).

Two of the main pro-apoptotic members of the Bcl-2 family of proteins are Bax and Bak. These proteins are constitutively expressed in cells but under normal physiological conditions are sequestered by anti-apoptotic Bcl-2 family member proteins such as Bcl-2 and Bcl-XL. Bcl-2 and Bcl-XL are able to prevent the activation of Bax and Bak by directly binding to them and inhibiting their homo-oligomerization. However, if Bax and Bak are able to form dimers, this process initiates mitochondrial outer membrane permeabilization (MOMP) (81). MOMP is the formation of pores within the outer membrane that leads to release of pro-apoptotic contents within the IMS. Three proteins have been extensively studied for the their roles in cell death upon release from the IMS: cytochrome c, DIABLO/Smac, and HTRA2 (82). Release of cytochrome c from the IMS is often considered the point of no return for apoptosis (83). This occurs through binding of cytochrome c to apoptotic protease activating factor 1 (APAF-1) and 3 (APAF-3/caspase-9) in the cytoplasm and activation of APAF-3/caspase-9, which results in downstream activation of caspase-3 and initiates the breakdown of cellular DNA and its components (84, 85). DIABLO and HTRA2 bind inhibitor of apoptosis proteins (IAPs) that

11 inhibit caspases. By binding these proteins and sequestering them away from the caspases, the caspases are no longer inhibited and are able to initiate apoptosis (Figure 1.4)(86, 87).

Pro-apoptotic Bcl-2 family members can also become activated both directly and indirectly through the BH3-only proteins. These BH3-only proteins activate or sensitize cells to apoptosis through Bak or Bax oligomerization. They are classified as activators if they directly bind Bak and Bax and aid their insertion into the OM, or sensitizers if they only bind anti-apoptotic Bcl-2 family members to sequester them from Bak or Bax (88).

Thus, the intrinsic cell death pathway involves an interplay between the pro-apoptotic, anti- apoptotic, and BH3-only proteins (89).

Figure 1.4 Summary of the intrinsic cell death pathway (90) Upon cell death stimulus BH3-only proteins initiate the oligomerization of BAX and BAK both directly and indirectly through inhibition of BCL2 family members. This induces mitochondrial outer membrane permeabilization and release contents of the IMS into the cytoplasm. Cytochrome c begins the formation of the apoptosome with caspase 9 and APAF1. SMAC and

HTRA2 (Omi) bind to inhibitor of apoptosis proteins (IAPs) to allow the progression of cell death.

1.1.3.4 Cell Signaling

In addition to their role in stress response and intrinsic apoptosis, mitochondria are involved in multiple signaling pathways enabling communication with the cytosol and adaption to changing cellular conditions.

An important example is the role of mitochondrial ROS. Although mitochondrial ROS can have several negative effects on cellular functions, it has also been identified as an essential signaling mechanism important for its role involved in cellular senescence, differentiation, metabolism, proliferation, and survival (91, 92).

Mitochondrial ROS was initially shown to have cell signaling properties through the stabilization of hypoxia inducible factor 1 (HIF1a) that lead to adapted gene expression essential to cellular survival under hypoxic conditions (93, 94). Stabilization of HIF1a was shown to provide feedback and reduce ROS levels thereby preventing ROS-induced cell death (95). A potential mechanism of this observed HIF1a feedback occurs through the switching of cytochrome c oxidase 4 (COX4) from isoform 2 to 1. Isoform 1 of COX4 produces less ROS during oxidative phosphorylation than isoform 2 providing a safeguard against excessive ROS damage (96).

Another example of mitochondrial ROS and its role in signaling is through the hydrogen peroxide produced from ROS. Hydrogen peroxide is more stable and is able to migrate to other cellular compartments and alter cellular signaling. This process was first discovered through the ability of hydrogen peroxide to inhibit tyrosine phosphatases via the oxidation of cysteine residues and its ultimate effect on downstream signaling pathways (97). Interestingly, a change in mitochondrial localization within the cell can further affect ROS signaling. Under hypoxic conditions, clusters of mitochondria localize to the nucleus increasing nuclear ROS and leading to changes in vascular endothelial growth factor (VEGF) transcription (98). Mitochondrial ROS or adenosine monophosphate (AMP) can also regulate mitochondrial metabolism through AMP- activated protein kinase (AMPK) signaling that promotes phosphorylation of several targets, increasing oxidation of fatty acids and mitochondrial biogenesis (99, 100).

Aside from ROS signaling, the mitochondrial OM can act as a signaling hub for A-kinase- anchoring proteins (AKAPs). AKAPs are a class of protein that specifically bind cAMP- dependent protein kinases (PKA) and their potential substrates. AKAP-PKA signaling complexes on the OM have been shown to regulate oxidative phosphorylation, mitochondrial dynamics, and response to hypoxia (101, 102). In response to survival signals, AKAP-PKA complexes phosphorylate and inactivate Bad, one of the pro-apoptotic Bcl-2 family member proteins, thereby inhibiting cell death (103).

The OM of the mitochondria is further involved in regulating immune responses. The mitochondrial antiviral signaling protein (MAVS) is localized to the OM and directly regulates innate immunity through activation of the antiviral signaling pathways of nuclear factor kappa- light-chain-enhancer of activated B cells (NF-kB) and interferon regulatory factor 3 (IRF3) (104). In response to stimulation of the Toll-like receptors (TLRs) from an invading pathogen, tumour necrosis factor receptor-associated factor 6 (TRAF6) interacts with evolutionarily conserved signaling intermediate in Toll pathways (ECSIT) at the OM in order to increase mitochondrial ROS and generate an effective innate immune response (105).

1.2 Mitochondrial Proteases

Protein turnover and degradation is essential to maintaining cellular functions since damaged and misfolded proteins can cause cellular toxicity (106). Protein degradation within the cytoplasm occurs through ubiquitin tagging of proteins and subsequent degradation by the 26S proteasome (106). As well, proteins can be degraded through lysosomes which bind to autophagosomes or uptake proteins to be degraded (107). However, the 26S proteasome and lysosomes do not exist within the mitochondria and as a result, the mitochondria must be able degrade its own proteins through mitochondrial proteases.

All mitochondrial proteases are nuclear-encoded cysteine, serine, or metalloproteases. Each type uses the aforementioned molecule as a nucleophile to initiate the cleavage of a peptide bond. Serine and cysteine proteases form an active site or “catalytic triad” with a histidine and an aspartate residue. This three amino acid structure catalyzes the cleavage of a peptide bond by nucleophilic attack of the serine or cysteine (108). Metalloproteases use a metal ion, often zinc, which can use a water molecule as a nucleophile to break the peptide bond (109, 110). Typically a glutamic acid assists in the reaction and one or two histidine molecules hold the metal cation in

14 place (111). Pseudo (or inactive) proteases resemble a protease in structure, yet are unable to form the active site required for peptide cleavage (2, 112).

To date, 45 mitochondrial proteases have been identified in mammals (2). Of these, 20 are localized primarily to the mitochondria and display catalytic activity in this organelle, five lack an active catalytic site, and 20 are found predominantly in other cellular compartments but are recruited to the mitochondria under specific conditions, such as apoptosis (2, 113, 114).

1.2.1 Biological Function of Mitochondrial Proteases

Historically, mitochondrial proteases were thought to have two functions: cleavage of mitochondrial import signals from newly imported proteins, and degradation of damaged or misfolded mitochondrial polypeptides (1, 115–117). Some mitochondrial proteases were also shown to serve as protein chaperones and scaffolds, independent of their protease function (118– 121). More recently, it has become evident that mitochondrial proteases are critically important for maintaining mitochondrial activity and dynamics, mitophagy, and apoptotic functions (2, 122)(Figure 1.5).

Figure 1.5 Regulation of mitochondrial function through mitochondrial proteases (2)

1.2.2 Mitochondrial Proteases within the Intermembrane Space

Of the 20 intrinsic mitochondrial proteases, seven reside within the IMS or are embedded within the IM with their catalytic site facing the IMS. There are two unanchored proteases (HTRA2,

LACTB) within the IMS and five (IMMP1L, IMMP2L, OMA1, PARL, YME1L1) that are anchored within the IM. The IMS represents a unique conduit between the cytoplasm and the mitochondrial matrix. As such, it plays essential roles in oxidative phosphorylation, protein import, mitophagy, mitochondrial dynamics and apoptosis (2). All of these processes are regulated in part by mitochondrial proteases within this space.

1.2.2.1 High Temperature Requirement Serine Peptidase A 2 (HTRA2)

High temperature requirement peptidase A 2 (HTRA2) is a serine protease first discovered as a mammalian homologue of HtrA or DegP in E. coli (120), and is localized to the IMS through a 133 amino acid mitochondrial targeting sequence (123). HTRA2 binds to the inner membrane through its targeting sequence, which is proteolytically cleaved to form the 37 kDa active protease within the IMS (124).

In response to a cell death stimulus and outer membrane permeabilization, HTRA2 is released into the cytoplasm and binds to IAPs (87, 125). HTRA2 can degrade these proteins preventing them from inhibiting caspases, and allowing apoptosis to progress (87, 125, 126). In contrast, HTRA2 has also been reported to inhibit apoptosis in mouse lymphocytes by preventing the accumulation of pro-apoptotic factor Bax at the outer membrane (127).

Additionally, HTRA2 has been linked to Parkinson’s disease. Inactivating mutations in the HTRA2 gene (mnd-/-) in mice leads to the development of an essential tremor that resembles a Parkinson’s phenotype (128). HTRA2 knockout mice develop a similar phenotype, but the mechanism of action is unknown (129).

Despite the extensive characterization of the role of HTRA2 in apoptosis, little is known about its mitochondrial function(s). Its importance in maintaining mitochondrial health was shown in HTRA2 knockout mouse embryonic fibroblasts (MEFs), which displayed increased ROS production, altered membrane potential, and disrupted mitochondrial morphology (130). However, the underlying mechanism(s) behind the effects of HTRA2 on mitochondrial function and morphology remain largely unknown.

1.2.2.2 Inner Mitochondrial Membrane Peptidase Subunit 1 (IMMP1L) and Subunit 2 (IMMP2L)

Inner mitochondrial membrane peptidase subunit 1 (IMMP1L) and subunit 2 (IMMP2L) are both serine proteases within the inner membrane of the mitochondria. IMMP1L and IMMP2L are related IMS proteases whose yeast homologues IMP1 and IMP2 form a heterodimer (131). IMP1 and IMP2 cleave mitochondrial targeting sequences from newly imported proteins in the IMS; however, they have been reported to have non-overlapping substrate profiles (132–134). The substrates of yeast IMP1 and IMP2 have been characterized, but the functions and substrates of human IMMP1L and IMMP2L have not been fully defined. IMMP1L has one known substrate (DIBALO) that it shares with IMMP2L (133). IMMP2L has two other known substrates: glycerol-3-phosphate dehydrogenase (GPD2) and cell death regulator apoptosis-inducing factor (AIF) (135).

Furthermore, it is interesting to note that the activity of IMP1 is dependent on the presence of the C-terminal end of IMP2 (132). It has not been determined whether human IMMP1L is dependent on IMMP2L.

IMMP2L has been associated with neurodevelopmental disorders including autism, Tourette syndrome, and attention hyper deficit disorder (ADHD) (136–140). How IMMP2L causes neurodevelopmental disorders is still unknown, but there are two publications that provide some insight into potential mechanisms. An IMP2 mutant mouse model displayed increased ROS in adipose derived stromal cells (ADSC) that disrupted their ability to form colonies and proliferate (141). Additionally, loss of IMMP2L disrupted the pathways of GPD2 and AIF that collaboratively drive senescence in human lung cell lines NHBE and IMR90 (135). To date, IMMP1L has not shown any associations with neurodevelopmental disease.

1.2.2.3 Serine Beta-Lactamase-like (LACTB)

Serine beta-lactamase-like (LACTB) is a serine protease within the IMS. It is the only mammalian penicillin-binding protein (PBP) that has not been removed through evolution from bacterial ancestors (142). Although there are no known substrates of LACTB, there is evidence for its proteolytic activity in vitro through cleavage of peptide bonds adjacent to aspartic-acid residues (143).

Since there are currently no known substrates of LACTB, the function of LACTB in mammalian cells remains unclear. LACTB has been shown to form long filaments within the IMS that are thought to provide mitochondrial membrane organization and mitochondrial compartmentalization (144). Two papers have described a role for LACTB in metabolism. In 2008, LACTB was found to be a susceptibility gene for obesity (145). More recently, LACTB was implicated as a tumour suppressor through modulation of lipid metabolism and differentiation of breast cancer cells (143). Thus, there is evidence that LACTB plays a role in lipid metabolism; however, the mechanism of action behind this role remains unknown.

1.2.2.4 Overlapping with the m-AAA Protease 1 Zinc Metallopeptidase (OMA1)

Overlapping with the m-AAA protease 1 (OMA1) is a zinc metallopeptidase anchored in the inner membrane. The OMA1 homolog in yeast was first discovered in 2003 where it was found to have overlapping substrate specificity with the m-AAA protease (AFG3L2 in humans) (146). It was not until 2009 that OMA1 was discovered as a master regulator of mitochondrial fusion and fission optic atrophy 1 (OPA1) in mammals (147, 148). Stress-induced cleavage of OPA1 by OMA1 into its short isoform prevents fusion and leads to mitochondrial fragmentation and mitophagy (149, 150). Stresses include loss of membrane potential and mitochondrial ATP levels (151–154). In contrast, another IMS protease discussed below, YME1 like ATPase (YME1L1), functions to promote the long isoform of OPA1 to increase mitochondrial fusion and decrease mitophagy (155). Thus, OMA1 and YME1L1 act in concert to regulate OPA1 levels, mitochondrial fusion, and mitochondrial fission.

1.2.2.5 YME1 like ATPase (YME1L1)

YME1L1 is an ATP-dependent metalloprotease sometimes referred to as i-AAA protease (IMS ATPase associated with diverse cellular activities) and is embedded within the inner membrane. Upon import into the mitochondrial inner membrane, mitochondrial processing peptidase (MPP) cleaves the MLS and allows proper insertion into the inner membrane where it forms a hexameric structure (156, 157). YME1L1 is able to degrade proteins both within the IMS and IM (158, 159). In addition to its protease function, YME1L1 can act as a chaperone in yeast helping in the disaggregation of proteins within the IMS (118, 119, 160).

As mentioned above YME1L1 regulates mitochondrial fusion through the processing of OPA1 into its long isoform (152, 161). Under stress conditions, YME1L1 is rapidly degraded allowing the short form of OPA1 to accumulate and promote cell death under oxidative stress (162). This is in part mediated by OMA1 and another protease in the IMS which currently remains unknown (162).

1.2.2.6 Presenilins-associated Rhomboid-like (PARL)

Presenilins-associated rhomboid-like (PARL) is a serine protease containing six core transmembrane domains and one additional transmembrane domain at its N-terminus (163). PARL is linked to apoptosis, mitophagy, and mitochondrial morphology (164).

PARL regulates mitophagy through PTEN-induced kinase 1 (PINK1). PINK1 is a regulator of mitophagy at the outer mitochondrial membrane. Upon loss of membrane potential, PINK1 import into the mitochondria is lost and it accumulates on the outer membrane (165, 166). PINK1 then phosphorylates the E3 ligase Parkin (PARK2) and its ubiquitin chain to initiate autophagy of dysfunctional mitochondria (167, 168). PARL is able to cleave PINK1 in the inner membrane of the mitochondria to trigger its release back into the cytosol for rapid turnover (169, 170). Loss of function mutations or knockout of the PARL gene can lead to increased mitophagy and could explain the muscle wasting phenotype seen in PARL-/- mice (171). However, other mitochondrial matrix proteases (AFG3L2, MPP and CLPXP) are associated with PINK1 turnover (164). Thus, it remains to be seen whether there are redundancies in this pathway and whether PARL knockout is sufficient to cause accumulation of PINK1 in vivo (164, 172, 173). Interestingly, phosphoglycerate mutase family member 5 (PGAM5), a phosphatase localized within the inner membrane of the mitochondria, is also cleaved by PARL upon loss of membrane potential (174). However, unlike PINK1 which is targeted for degradation after cleavage, PGAM5 becomes activated and translocates to the outer membrane to initiate mitophagy (175). PARL therefore may have a dual function in helping prevent mitophagy under healthy conditions and promoting mitophagy under stress conditions.

PARL and OPA1 were shown to interact in a yeast-2-hybrid screen and can be co- immunoprecipitated, although OPA1 has not been shown as a substrate of PARL to date (171). PARL knockdown can induce apoptosis in mouse fibroblast, which can be rescued through OPA1 overexpression (171). Further, as mentioned above OPA1 has other mechanisms of

19 regulation including YME1L1 and OMA1, thus PARL likely plays a minor role, if any, in OPA1 function (164, 176).

PARL has been reported to interact with HCLS1 associated protein X-1 (HAX1) thereby affecting HTRA2 import into the mitochondria (177). However, this remains controversial as HAX1 was thought to be an artifact in mitochondrial fractions that were membrane heavy (178). Furthermore, decreases of both PARL and processed HTRA2 after mouse striatal neuronal injury suggest a physiological connection between these two proteins (179). The muscle wasting phenotype of PARL-/- mice is similar to that of mnd-/- (HTRA2 mutated) mice suggesting these proteases act in similar pathways to protect against cell death (171). Therefore, how PARL and HTRA2 are connected in mitochondrial function and apoptosis remains to be determined.

1.2.3 Mitochondrial Proteases in Health and Disease

Mitochondrial proteases function in apoptosis, metabolism, mitophagy, mitochondrial biogenesis, and mitochondrial protein homeostasis (2). Disruption of mitochondrial proteases and their downstream pathways can therefore lead to problems in health and disease. Mitochondrial proteases are implicated in three classes of disease that will be discussed in detail below: metabolic disorders, neurodegenerative disorders and cancer.

1.2.3.1 Metabolic Disorders

As the primary metabolic organelle in the cell it is not surprising that dysregulation or mutations of mitochondrial proteases can lead to metabolic dysfunction. Defects in PARL are associated with diabetes and aging potentially through insulin signaling (180). Obesity is linked to OMA1 knockout mice that display increased body weight, adipose mass, and expression changes in lipid and glucose metabolism genes (149). LACTB was identified as a disease-susceptibility gene for obesity and validated in a mouse knockout model that showed increased fat-mass-to-lean-mass ratio (145). However, the molecular mechanisms of how these proteases can cause metabolic disorders is unknown.

1.2.3.2 Neurodegenerative Disorders

Neurodegeneration has been extensively linked to mitochondrial proteases. HTRA2 causes neurodegenerative disease in a mouse model harboring a specific deactivating mutation S276C

(128). These mice develop neuromuscular wasting and death of striatal neurons that can be rescued with wild-type HTRA2 (128, 181). Additionally, if wild-type HTRA2 is reintroduced into the brain alone, the Parkinson’s phenotype can be completely alleviated. However, these mice age faster and develop muscle wasting later in their lifespan (181). Furthermore, a knockout mouse model of HTRA2 displays a Parkinson’s phenotype also known as an essential tremor (129). After the discovery of a potential relationship between HTRA2 and Parkinson’s disease in this mouse model, patients were screened for mutations with HTRA2. One mutation, G399S, was discovered in a small subset of German Parkinson’s disease patients. (182–184). Additionally, a correlated A141S polymorphism was discovered (182). Both mutations were shown to reduce the proteolytic function of HTRA2 (182). However, the prevalence of HTRA2 mutations in Parkinson’s disease patients is still controversial, as not all studies identified mutations (185). Thus, although there is strong evidence for a relationship between HTRA2 and Parkinson’s disease, the mechanism of this relationship remains unclear.

Other IMS proteases have been associated with neurodegeneration. PARL has been linked to Parkinson’s disease, as mentioned above, through the proteolytic regulation of PINK1 (169, 170, 186). A mutation in the MLS region of YME1L1 impairs its MPP-dependent import and results in mitochondriopathy with optic atrophy (degeneration of the optic nerve) (157).

Other mitochondrial proteases not localized to the IMS have also been implicated in neurodegeneration. Ubiquitin specific peptidase 30 (USP30), an outer membrane deubiquitinating enzyme is associated with Parkinson’s disease through its role in mitophagy (187). Pitrilysin metallopeptidase 1 (PITRM1) is linked to Alzheimer’s disease as it can degrade mitochondrial amyloid-b aggregates (188). The two components of the m-AAA protease (matrix-ATPases associated with diverse cellular activities): spastic paraplegia 7 (SPG7) and AFG3-like protein 2 (AFG3L2) are both implicated in spastic paraplegia, a disease characterized by axonal degradation (189–191).

1.2.3.3 Cancer

In addition to their role in neurodegeneration, mitochondrial proteases are associated with numerous cancers.

The Schimmer lab previously demonstrated that the mitochondrial matrix protease, ATP- dependent ClpP protease subunit (CLPP), is upregulated in a subset of acute myeloid leukemia (AML) patient samples, and can be selectively targeted without affecting normal blood cell development (117). The IMS protease LACTB was recently shown to be a tumour suppressor (143), and the IMS protease HTRA2 was demonstrated to prevent the invasion of tumour cells (192, 193) and degrade the Wilms’ tumour 1 (WT1) oncoprotein (194).

A major target for cancer therapy is the inhibition of protein degradation through the ubiquitin- proteasome system (UPS), which is localized to the cytoplasm and nucleus (195–197). Bortezomib, a 26S proteasome inhibitor, was a major breakthrough as a novel proteasome inhibitor for the treatment of multiple myeloma (198). This finding sparked interest in the field of protein degradation and lead to numerous studies aimed at identifying other potential UPS targets for cancer therapy (199–201). This led to the discovery of TAK243, a selective ubiquitin- like modifier activating enzyme 1 (UBA1) inhibitor. TAK243 reduced the proliferation of multiple human cancer cell lines and similarly showed efficacy in reducing engraftment of primary human AML cells in vivo (202, 203). However, the UPS system does not function in mitochondria. Thus, gaining insight into the function of mitochondrial proteases offers the potential to better understand mitochondrial biology and mitochondrial-associated diseases.

1.3 Identifying Protein-Protein Interactions 1.3.1 Proximity-Dependent Biotinylation (BioID)

The BioID assay is used to map the interactome of proteins of interest. It is designed to identify the protein-protein interaction profile of a protein within a live cell. This interactome can elucidate cellular functions, interactions with specific protein pathways and complexes, and identify potential substrates of proteases.

BioID was developed in 2012 by Kyle Roux et al. through the use of a biotin conjugating enzyme from Escherichia coli, BirA (204). Normally, BirA activates biotin to a highly reactive biotinyl-5’-AMP molecule and attaches it to a target protein (205)(Figure 1.3). Here, BirA has been mutated at R118G (BirA*) and can efficiently activate biotin yet exhibits a reduced affinity for the activated molecule. Therefore, when cells are treated with biotin, the activated biotinoyl- AMP generated from BirA simply diffuses away and reacts with nearby primary amine groups

22 on lysine residues within an approximate 10 nm radius (206). Stable cell lines are generated with a tetracycline inducible protein of interest (POI)-BirA* fusion protein into Flp-In T-REx 293 cells. The Flp-In system uses a Flp recombinase to insert open reading frames flanked by FRT sites of our pcDNA5-BirA-FLAG vector into the cellular genome. This occurs in the same spot in the genome and only once per cell, thus producing stable isogenic cell lines (207). Once transfected, the cell lines are selected with hygromycin B for 3-4 weeks to ensure each cell contains our gene of interest. These cells also make use of the T-REx system (208). The T-REx system is also known as the tetracycline-inducible system, as these cells are constitutively expressing the tetracycline repressor (tetR) protein. Our pcDNA5 vector contains two tet operator elements upstream of our gene of interest and BirA that are bound by tetR to repress expression. When tetracycline is added, it binds and sequesters the tetR protein, removing it from the tet operators to initiate transcription. This system allows for timely and controlled expression of our fusion proteins. However, not all cells lines have Flp-systems. Therefore, a lentiviral system has also been developed which can bring the BirA inducible construct into other cell lines and even patient samples (209).

Figure 1.6 Proximity-dependent biotinylation (BioID)

The gene of interest is fused in-frame with the biotin conjugating enzyme from E. coli BirA. BirA has been mutated at its active site (R118G, BirA*) to reduce the affinity of the activated from of biotin, biotinoyl-AMP for BirA*. Once activated, biotinoyl-AMP diffuses away from BirA* and reacts with nearby lysine residues (primary amines). This creates an approximate 10nm cloud of biotinylated proteins around your protein of interest. Cells are then lysed in a

23 harsh lysis buffer, pulled down with streptavidin beads, trypsinized and analyzed through mass spectrometry.

Our BirA* fusion proteins are expressed for 24 hrs with biotin to generate sufficient biotinylated proteins. Cells are lysed in harsh modified RIPA lysis buffer and the lysates incubated with streptavidin beads. Once on the beads, the samples undergo harsh washes to remove contaminants. Proteins are then trypsinized and analyzed through mass spectrometry (MS).

When BirA* is fused in-frame with a POI, it generates reactive biotinoyl-AMP which reacts with nearby amine groups on lysine residues. This creates biotinylated proteins that are interacting with or in proximity with our protein of interest. This is one of the major advantages BioID has over traditional immunoprecipitations (IPs). Using BioID, transient interactions are identified because of the high reactivity of the activated biotinoyl-AMP molecule created. Therefore, any protein that briefly or transiently comes within the 10 nm radius is covalently tagged with biotin and can be purified with streptavidin beads. The biotin-streptavidin interface is one of the strongest reported non-covalent interactions with a binding affinity between 1013mol−1 - 1015mol−1 (210, 211). Moreover, since biotinylation is a covalent bond, the lysis conditions can be extremely harsh and allow us to identify insoluble proteins, including membrane bound proteins and chromatin-associated proteins. In contrast, IPs require very gentle lysis so as not to disturb the interactions between the protein of interest and the proteins being pulled down, making the identification of membrane-bound proteins extremely challenging. Moreover, the interaction between the antibody and protein is weaker than streptavidin and biotin.

Numerous other iterations of BioID have been developed in order to improve the assay. One limitation of BioID is the large size of the BirA* that is approximately 30-35 kDa or 321 amino acids. This size of the tag has occasionally affected the localization the POI rendering BioID ineffective for some proteins (212). In response, “BioID2” was developed with a smaller biotin conjugating enzyme from the organism Aquifex aeolicus. This enzyme is 233 amino acids long and can provide better endogenous localization for some POIs (212). In contrast, a two- component BioID (2C-BioID) method was developed that tags both the BirA and the POI independently with FKBP (FK506-binding protein) and FRB (FKBP-rapamycin-binding domain of mammalian target of rapamycin [mTOR]) respectively. FKBP and FRB only dimerize upon induction with the rapamycin analog dimerizing-agent AP21967 (213). Therefore, these proteins

24 are kept separate and allowed to localize to their correct cellular compartments. Only upon addition of the dimerizing-agent are the BirA* and POI brought into contact with each other for proximity-dependent biotinylation.

The BioID assay is performed over 24 hrs to induce enough biotinylated proteins and get a complete cell-cycle picture of all the potential interactors for a POI. However, some interactions are more dynamic, occurring within minutes and could be missed over the course of 24 hrs. To address this, TurboID and miniTurbo were developed to run the BioID assay in as little as 10 minutes. TurboID and miniTurbo use the same biotin conjugating enzyme as in BioID but with several mutations to increase biotinylation efficiency (214). The TurboID and miniTurbo BirA have 15 and 13 mutations respectively with part of the N-terminus deleted on the miniTurbo BirA (214).

Thus, proximity-dependent biotinylation continues to serve as an extremely useful tool in in identifying protein-protein interactions.

1.3.2 Other Methods to Identify Protein-Protein Interactions

1.3.2.1 Yeast-two Hybrid

Developed in 1989 by Fields and Song, the first in vivo protein-protein interaction screen was known as the yeast-two hybrid (Y2H) (215). This system utilizes two fusion proteins, one protein is fused to the GAL4 DNA-binding domain and the other fused to the GAL4 activation domain. Upon expression, if the two proteins of interest interact with each other, the GAL4 domains are able to activate the transcription of a reporter gene such as LacZ to confer a positive interaction signal, in this case a blue colour to the yeast (215). This method was scaled for high throughput detection of potential protein-protein interactors. However, due to the nature of the assay there are many limitations that create an estimated false discovery rate around 50% (216–218) and only a 30% overlap when comparing two large-scale Y2H studies (219). This is in part due to the biological system, where expression of mammalian proteins in yeast may result in incorrect protein folding due to lack of chaperones. Additionally, proteins that require post-translational modifications (PTMs) in order to interact, such as phosphorylation, may be unable to do so in yeast. Fusion proteins may also block specific domains required for binding or correct localization of the proteins of interest. Since there is the use of a reporter gene, the interaction

25 must take place in the nucleus in order to see a positive result. Thus, membrane-bound proteins are unable to be detected. Furthermore, over-expression of the fusion proteins may create non- physiologically relevant protein concentrations that could drive false positives.

Many improvements have been made to the Y2H system to try and increase its accuracy by using different yeast strains, DNA-binding/activating domain proteins and reporter genes (220). However, many of the Y2H limitations still persist making datasets challenging to accurately interpret.

1.3.2.2 Affinity Purification Coupled to Mass Spectrometry (AP-MS)

Affinity purification coupled to mass spectrometry (AP-MS) is similar to the classic or gold standard technique for protein-protein interactions, co-immunoprecipitation (Co-IP). Co-IP experiments identify potential interacting proteins through the use of an antibody to pull-down the POI (the bait) and its interacting partners (prey). If there is no reliable antibody against the POI, a small epitope tag such as FLAG can be attached to the POI, to enable the pull-down. Following the pull-down, the samples can then be analyzed through Western blotting to look for specific interactors. Presence of a protein band at the expected size indicates a protein-protein interaction. In contrast, AP-MS is analyzed via MS instead of Western blot. This enables the identification of all potential interactors and is not limited to looking for one specific interactor.

In contrast to the Y2H, AP-MS can use any cellular system and does not require nuclear localization of the interaction. However, the interaction needs to be strong enough to not dissociate upon cellular lysis. Therefore, gentle lysis is generally used with non-denaturing buffers to disrupt interactions as little as possible. This comes with the caveat of not being able to strongly identify insoluble proteins such as membrane and chromatin bound proteins. The same applies to more transient interactors that dissociate from the POI during cell lysis. Furthermore, during cell lysis, proteins that are not normally within the same cellular compartments are mixed together, potentially generating a positive interaction even though the proteins would never interact in a live cell (221, 222). This is where covalent biotin tagging of proteins such as in BioID is more effective in identifying transient and membrane-bound interactions. Hence, these techniques are considered complementary to each other in determining protein-protein interactions as they identify different groups of interactors. AP-MS is able to pull-down entire

26 protein complexes if the conditions of the lysis do not disrupt the protein-protein interactions. On the other hand, BioID only identifies proteins within a 10 nm radius of the POI (206).

1.3.2.3 Engineered Ascorbate Peroxidase 2 (APEX)

Another biotin labeling method to identify protein-protein interactions is through the use of engineered ascorbate peroxidase 2 (APEX). APEX is an engineered ascorbate peroxidase that breaks down hydrogen peroxide. The APEX technique mimics BioID in the expression of a fusion protein with APEX on the N or C terminal of the protein. Upon addition of a biotin- phenol and hydrogen peroxide, APEX generates a biotin-phenoxyl radical that is extremely reactive. This molecule can react and tag an entire cellular compartment within one minute. One consideration when using APEX is that hydrogen peroxide is extremely toxic to cells and thus could potentially induce proteome changes prior to the lysis of the cells after the one-minute time course.

APEX is not as useful in identifying specific interactors of a protein of interest due to the quick reactivity of the biotin-phenoxyl radical which creates a large labeling radius. This quick reactivity is best suited for mapping the entire proteome of a specific cellular compartment or organelle, as shown by the generation of the mitochondrial IMS (223) and mitochondrial matrix proteomes (224).

1.3.3 Mass Spectrometry (MS)

The end product of a BioID, AP-MS, and APEX is a complex mixture of proteins. Thus, a follow-up technique is needed to sequence and identify the protein or peptides present within the sample. MS is an analytical technique used to determine the sequence of peptides through the mass-to-charge (m/z) ratio. There are three parts or stages to a MS instrument: an ion source, a mass analyzer and a detector. First the ion source converts some of the sample into ions. These ions are then passed through the mass analyzer which selectively sorts molecules based on their m/z ratio through the use of an electromagnetic field. These ions are then passed to the detector to determine the quantity of the peptides present.

In liquid chromatography MS/MS (LC-MS/MS) samples are first passed through a column. In reverse-phased chromatography the columns have covalently linked hydrophobic alkyl chains. Peptides that pass through this column will stick to these hydrophobic chains with varying

27 degrees of strength depending on the peptide hydrophobicity. Peptides are eluted off of the column through the use of an organic solvent gradient. Peptides that are less hydrophobic and have weaker bonds to the column will require a smaller concentration of organic solvent in order to be eluted from the column. At the end of the column the sample must be ionized before entering the mass analyzer. We pass our samples through a needle at high voltage, known as electrospray ionization (ESI), which couples well with the use of liquid chromatography. ESI is known as a soft ionization technique as there is no fragmentation and generates positively- charged liquid droplets by passing the sample dissolved in a volatile liquid through the high voltage needle (225). These charged droplets shrink and evaporate, leaving the charged peptides which then pass through the mass analyzer to the detector. On our machine we use an orbitrap to detect the peptide ions which traps them in an orbital motion. The frequency of the orbital motion directly relates to the m/z ratio and can identify the mass of the peptide. This is known as the MS1 spectrum. MS/MS experiments take approximately 20 of the most abundant peptides and further fragment those for peptide sequencing through collision-induced dissociation (CID). This is known as the MS2 spectrum. CID uses neutral molecules to collide with the sample and fragment the peptides (226). This tends to break the amide bond in peptides, thus producing multiple smaller versions of a larger peptide. These smaller peptide fragments are then analyzed through the orbitrap to determine their masses.

There are multiple methods to determine the sequence of the peptides within a sample. One such method termed de novo sequencing determines the sequence based on the mass lost from each resulting peptide fragment. Another common way to determine the sequence of peptides and the proteins they originated from is spectral matching. This involves using the fully sequenced genome of an organism to develop an in silico proteome. This proteome can further be used to predict all possible peptides after protease treatment and their subsequent spectrums, such as all tryptic peptides. These theoretical spectra can then be matched to the spectra generated from the MS2 to determine the peptide that is present. Further, PTMs can be detected as each modification will have a known mass shift (227, 228). For example, the mass shift of phosphorylation is 79.99 Da that can be observed on the mass spectrum (229). These PTM mass shifts can be added to spectral matching databases in order to identify them. There are numerous tools available to help in the analysis of MS data, some of which are discussed below. For our specific analysis we used spectral mapping.

1.3.4 Analysis of BioID-MS Data

The mass spectrometer provides raw data in the form of spectra that can be mapped to an in silico database of peptides. In our case, Thermo .RAW files were converted to .mzML format using ProteoWizard (v3.0.10800), for peptide and protein identification (230), then searched using X!Tandem (X!TANDEM Jackhammer TPP v2013.06.15.1) (231) and Comet (v2014.02 rev.2) (232) against the human Human RefSeq v45 database (containing 36113 entries). X!Tandem and Comet are two different peptide matching programs. The programs use different algorithms to score the generated spectra from MS/MS data on how similar they are to an in silico database. Only when both programs identify the same peptide or protein for a given spectra do we assign the spectra a given peptide sequence. The program iProphet then combines the two search algorithms to determine whether X!Tandem and Comet have assigned the same peptide sequence to a given spectra (233). This provides a level of stringency in better maintaining the false discovery rate. Furthermore, all of these programs are confined to a single user-friendly bioinformatics pipeline program known as ProHits (234). ProHits is able to further analyze the peptide matched data to generate a significance analysis of interactome (SAINT) score, which provides the probability of a protein being an interactor based on comparison to control runs (BirA*only) (235, 236). This allows the user to set a Bayesian false discovery rate (BFDR) to increase stringency and identify bona fide interactors.

1.4 Thesis Rationale and Outline

Mitochondrial proteases represent a unique group of proteins that remain largely uncharacterized despite their known association with critical cellular functions and human disease. The Schimmer lab previously demonstrated that the mitochondrial matrix protease CLPP was shown to be upregulated in 45% of AML patient samples and to be a selective target in leukemic cells compared to normal hematopoietic cells. The findings from this work displayed the potential selective therapeutic targeting of CLPP in leukemic cells and a CLPP activator has since advanced into clinical trials. Due to the limited knowledge and lack of characterization pertaining to mitochondrial proteases and their cellular functions, the potential therapeutic benefit of targeting these proteins is unknown.

Therefore, I sought to characterize the interactomes of the mitochondrial proteases within the intermembrane space, a unique cellular compartment that is enriched in proteases associated with

29 health and disease. The overarching goal of this thesis was to gain a better understanding of the biological functions of these IMS proteases. In chapter two, I will discuss the results obtained from the BioID of seven IMS proteases and the validation of the HTRA2 protease interactome. In chapter three, I will discuss our findings that HTRA2 can affect the growth and differentiation of AML cells. In chapter four, I will discuss results obtained from the BioID of other mitochondrial proteins and their interactomes.

Chapter 2 IMS Protease Interactome Identifies Novel Function of HTRA2

30 31

2.1 Chapter Overview

Mitochondrial proteases are of increasing interest because of their recent associations with critical cellular functions and disease (2). Many of these proteases remain ill-defined in the literature. To better understand the biological function of these proteases we wished to identify potential interacting proteins to elucidate their potential biological functions. Previously in the Schimmer and Raught labs, this was done with the mitochondrial matrix protease CLPP revealing a role in degrading the ETC and selectively affecting the growth of leukemic cells over normal hematopoietic cells.

In this chapter I discuss characterizing the interactomes of the seven IMS proteases using BioID in Flp-In T-REx 293 cells. Across our seven IMS protease baits we identify 802 high confidence protein-protein interactions and 342 unique protein interactors. From this dataset we validate the interactome of HTRA2 through its association with the mitochondrial intermembrane space bridging (MIB) complex.

2.2 Methods 2.2.1 Cloning cDNA of seven mitochondrial intermembrane space proteases (HTRA2 BC000096, IMMP1L BC023595, IMMP2L BC008497, LACTB BC067288, OMA1 BC012915, PARL BC014058, YME1L1 BC023507) were obtained from the Mammalian Gene Collection (237). Plasmids were purified (Geneaid #PD300, New Taipei City, Taiwan) and open reading frames were PCR amplified with Q5 DNA Polymerase (NEB, Ipswich Massachusetts). PCR products were digested with two of AscI, NotI, or BamHI (NEB) and ligated with T4 ligase (NEB) into our pcDNA5 FRT/TO BirA*FLAG expression vector (238). The two additional shRNA controls used in Fig. S4 were directed against NME2 (TRCN0000381107, 5’GTACCGGACCAATCCAGCAGATTCAAAGCTCGAGCTTTGAATCTGCTGGATTGGTT TTTTTG3’) and PHLPP1 (NM_194449.1-475s21c1, 5’CCGGCCAGACTTACTACATTTGCTTCTCGAGAAGCAAATGTAGTAAGTCTGGTTTT TG3’).

2.2.2 Generation of Stable Inducible Cell Lines and Cell Culture

Stable Flp-In T-REx 293 cells (Invitrogen, Carlsbad, California, R78007) expressing the fusion BirA*FLAG with our protein of interest were generated. Flp-In cells have been stably transfected with an FRT site that can be recognized by the Flp recombinase from Saccharomyces cerevisiae (239). A pcDNA5/FRT plasmid containing our gene of interest fused in frame with the BirA*FLAG is co-transfected with the pOG44 plasmid containing the Flp recombinase. This allows for a single homologous recombination event ensuring only a single copy of our gene of interest is inserted into the cells at the FRT site. The pcDNA5 vector also contains a hygromycin B resistance gene and are selected over three to four weeks at 200 µg /ml.

Flp-In T-REx 293 cells were expanded in Dulbecco’s Modified Eagle Medium (DMEM) with 10% fetal bovine serum (FBS) (Hyclone SH30396, lot #AC10260283, Fisher, Hampton, New Hampshire). OCI-AML2 cells were grown in Iscove’s Modified Dulbecco’s Medium (IMDM), 10% FBS. HEK293T cells for production of lentivirus were grown in DMEM with 10% FBS and 1% BSA. All cells were supplemented with 100 units/mL penicillin and 100 µg/mL streptomycin and cultured at 37°C with 5% CO2.

2.2.3 Proximity-Dependent Biotinylation

BioID and mass spectrometry were conducted as in (238). Briefly, Flp-In T-REx 293 cells were stably transfected with tetracycline-inducible pcDNA5 FRT/TO BirA-R118G - FLAG (BirA*FLAG) expression vectors, expressing one of the seven IMS proteases. Cells were incubated for 24h in complete media supplemented with 1 μg/ml tetracycline (Sigma-Aldrich, St. Louis, Missouri) and 50 μM biotin (BioShop, Burlington, Ontario, Canada). Cells were lysed, sonicated twice for 10 sec at 35% amplitude (Sonic Dismembrator 500; Fisher Scientific) and centrifuged at 16000 rpm (35,000 × g) for 30 min at 4°C. Supernatants were passed through a Micro Bio-Spin Chromatography column (Bio-Rad 732-6204, Hercules, California) and were incubated with 30ul of high performance streptavidin packed beads (GE Healthcare, Chicago, Illinois) for 3 hrs at 4°C on an end-over-end rotator. Beads were collected (2,000rpm, 2min) and washed 6 times with 50mM ammonium bicarbonate (pH 8.3). Beads were then treated with L-1- Tosylamide-2-phenylethyl chloromethyl ketone (TPCK)-trypsin (Promega, Madison, Wisconsin) for 16 hrs at 37°C on an end-over-end rotator. After 16 hrs, another 1ul of TPCK-trypsin was

33 added for 2 hrs and incubated in a water bath at 37°C. Supernatants were lyophilized and stored at 4°C for downstream mass spectrometry analysis. Two biological and two technical replicates were completed for each protease.

2.2.4 Liquid Chromatography-Electrospray Ionization-Mass Spectrometry

Liquid chromatography was conducted using a C18 pre-column (Acclaim PepMap 100, 2 cm x 75 µm ID, Thermo Scientific, Waltham, Massachusetts) and a C18 analytical column (Acclaim PepMap RSLC, 50 cm x 75 µm ID, Thermo Scientific), running a 120 min reversed-phase gradient (0-40% ACN in 0.1% formic acid) at 225 nl/min on an EASY-nLC1200 pump (Proxeon, Odense, Denmark) in-line with a Q-Exactive HF mass spectrometer (Thermo Scientific). An MS scan was performed with a resolution of 60,000 (FWHM) followed by up to twenty MS/MS scans (minimum ion count of 1,000 for activation) using higher energy collision induced dissociation (HCD) fragmentation. Dynamic exclusion was set for 5 seconds (10 ppm; exclusion list size = 500).

2.2.5 Mass Spectrometry Data Analysis

For peptide and protein identification, Thermo .RAW files were converted to the .mzML format using ProteoWizard (v3.0.10800; Kessner et al, 2008), then searched using X!Tandem (X!TANDEM Jackhammer TPP v2013.06.15.1)(231) and Comet (v2014.02 rev.2)(232) against the human Human RefSeq v45 database (containing 36113 entries). Search parameters specified a parent ion mass tolerance of 10 ppm, and an MS/MS fragment ion tolerance of 0.4 Da, with up to 2 missed cleavages allowed for trypsin (excluding K/RP). Variable modifications included deamidation on N and Q, oxidation on M, GG on K, and acetylation on protein N-termini in the search. Data were filtered through the TPP (v4.7 POLAR VORTEX rev 1) with general parameters set as –p0.05 -x20 –PPM.

Proteins identified with an iProphet cutoff of 0.9 (corresponding to ≤1% FDR) and at least two unique peptides were analyzed with SAINT Express (v.3.6).(235, 236) Control runs (21 runs from cells expressing the BirA*FLAG epitope tag only) were collapsed to the 2 highest spectral counts for each prey, and high confidence interactors were defined as those with BFDR≤0.01.

Prohits-viz was used for bait-bait Pearson Correlations and heat map generation. All raw mass spectrometry files have been deposited at the MassIVE archive (massive.ucsd.edu), ID MSV000083140.

2.2.6 Enrichment Analysis and Annotation

Toppgene was used to assign gene ontology (GO) mitochondrial annotations to the seven IMS protease interactome. Metascape.org was used to determine enrichment for the HTRA2 interactome. The HTRA2 interactome was manually annotated.

2.2.7 shRNA Knockdown of HTRA2

Flp-In T-REx 293 and OCI-AML2 cells were transduced with shRNAs targeting HTRA2 (Accession No.NM013247 with coding sequence for HTRA2 shRNA-1 5’CCGGAGTCAGTACAACTTCAT-3’ or HTRA2 shRNA-2 5’GAAGAATCACAGAAACACTTT-3’) or control sequences targeting GFP (Accession No. clonetechGfp_587s1c1 with coding sequence for GFP shRNA-587 (shGFP) 5’- TGCCCGACAACCACTACCTGA -3’) in a lentiviral vector carrying a puromycin resistance gene. The day after transduction, Flp-In T-REx 293 and OCI-AML2 cells were treated with 2 µg/mL and 1.5 µg/mL puromycin, respectively, and harvested 7 days post transduction.

2.2.8 Immunofluorescence Confocal Microscopy

For Flp-In T-REx 293 cells, 7.5 x 104 cells were plated on polylysine-L coated coverslips in a 24 well plate. For OCI-AML2 cells, 1.25 x 105 cells were seeded in a 24 well plate. The following day cells were co-stained with MitoTracker Red CMXRos (Thermo, M7512) at 100 nM for 15 min and Hoescht at 500 ng/ml for 10 min. Cells were then washed and fixed with 4% PFA for 10 min at RT before imaging using PlanApo 60X oil lens, NA 1.40 on an Olympus FV1000 confocal microscope (zoom factor between 3-5; Olympus America, Melville, NY). Images were processed using the Volocity Viewer v6 and exported as TIFF files.

2.2.9 Electron Microscopy

Flp-In T-REx 293 and OCI-AML2 HTRA2 knockdown cells were generated as above. 5 x 106 cells were washed once in PBS and pelleted at 1,000 rpm for 10 min. Cells were then fixed in 1 mL of fixative solution (4% paraformaldehyde (PFA), 1% glutaraldehyde in 0.1M PBS, pH 7.2) for 1-2 hrs at room temperature. The solution was removed, and the cells were re-incubated in fresh fixative solution and stored at 4°C. Samples were sent to the University of Toronto Microscopy Imaging Laboratory for transmission electron microscopy.

2.2.10 Immunoblotting

All primary antibodies were diluted in 5% skim milk and blotted overnight at 4°C at the following dilutions: HTRA2 antibody (Protein Tech, 15775-1-AP) 1:1,000, IMMT antibody (Abcam, ab110329) 1:1,000, Actin (Santa Cruz, sc-69879) 1:10,000, B-Tubulin antibody (Santa Cruz, SC-9104) 1:2,000, β-Tubulin antibody (BioRad VPA00345) 1:5,000, OPA1 (BD Biosciences, 612606) 1:1,000, SAMM50 (Protein Tech, ab133709) 1:1,000, CHCHD3 (Abcam, ab69328) 1:1,000. Secondary antibodies were added at room temperature for 1 hr at the following concentrations: Sheep Anti-Mouse IgG, HRP linked whole Ab (GE Healthcare, NA931) 1:1,000, Donkey Anti-Rabbit IgG, HRP linked whole Ab (GE Healthcare, NA934) 1:1,000. ECL (Thermo, 32106) was used to visualize protein bands on PerfectFilm (Genhunter B557, Nashville, Tennessee). ImageJ was used to quantify immunoblot images.

2.2.11 Cell-free Protease Assay

Recombinant proteins were incubated in assay buffer (50 mM TrisHCl, pH 8) at 37°C for 30 min. The volume or concentration used per reaction was as follows; 1 µg of HTRA2 (R&D Systems 1458-HT, Minneapolis, Minnesota), 5 µg beta casein (Sigma, C-6905), 2 µg IMMT (Creative Biomart 838H, Shirley New York), 2 µg SAMM50 (Creative Biomart, 2506H), 2 µg CHCHD3 (Creative Biomart, 295H) and 100 µM UCF-101 (Sigma-Aldrich, SML-1105). The inhibitor UCF-101 was pre-incubated in the dark with HTRA2 at room temperature for 10 min. Samples were run on a Criterion TGX precast 4-12% gradient gel (Biorad) and stained with Gel Code (Thermo, 24590). Polyacrylamide gel electrophoresis (PAGE) ruler pre-stained (Thermo,

26616) and PAGE ruler unstained (Thermo, 26614) protein mixes were used as protein size markers.

2.2.12 Statistical Analysis and Densitometry

ImageJ was used to quantify immunoblot images and scans from the cell-free protease assay. Immunoblot signals were normalized with their respective actin or β-tubulin signal. Prism Graph Pad 6.0 was used for Analysis of immunoblot densitometry and the cell-free protease assay. A two-way ANOVA followed by Tukey’s post-hoc test was used to identify significant differences (p<0.05) between conditions.

2.2.13 Immunoprecipitation Coupled with Mass Spectrometry (IP-MS)

Immunoprecipitation coupled with mass spectrometry (IP-MS) was performed as described previously (240). Briefly, the same stable Flp-In T-REx 293 cells used in the BioID experiments were used, expressing FlagBirA-HTRA2, IMMP1L and IMMP2L. Five 15cm plates were incubated for 24 hrs in complete media supplemented with 1 μg/ml tetracycline (Sigma-Aldrich, St. Louis, Missouri). Cells were lysed in four times w/v passive lysis buffer (50mM Hepes- NaOH pH 8.0, 100mM KCl, 2mM EDTA, 0.1% NP-40, 10% glycerol, 1mM PMSF, 10mM NEM, 100µL of protease inhibitor/10mL lysis buffer, 1mM DTT). Cells were incubated on ice for 10 min, subjected to one additional freeze-thaw cycle, incubated 10 more min on ice, and centrifuged at 27,000 x g for 20 min at 4 °C. The supernatant was transferred to a fresh 15 ml conical tube, and 1µl of turbonuclease (BioVision) plus 30 µl packed, pre-equilibrated Flag-M2 agarose beads (Sigma-Aldrich). The mixture was incubated for 2 hrs at 4°C with end-over-end rotation. Beads were pelleted by centrifugation at 1000 x g for 1 min and transferred with 1 ml of lysis buffer to a fresh centrifuge tube. Beads were washed once with 1 ml lysis buffer and twice with 1ml rinsing buffer (50mM ammonium bicarbonate, 75mM KCl, pH 8.0). Bound proteins were eluted with 150µl elution buffer (125mM ammonium hydroxide, ~pH 11) twice, and the two supernatants pooled. Samples were centrifuged at 15,000 x g for 1 min, the supernatant transferred to a fresh centrifuge tube, and lyophilized.

2.3 Results

2.3.1 BioID identifies unique interactomes for mitochondrial IMS proteases

BioID was used to explore the functions of the seven IMS proteases, HTRA2, IMMP1L, IMMP2L, LACTB, OMA1, PARL and YME1L1 (204). Briefly, the C-terminus of each protease was fused in-frame with an E. coli biotin conjugating enzyme, BirA R118G (BirA*). This abortive enzyme mutant can activate biotin to a reactive biotinoyl-AMP intermediate but does not retain binding to the activated molecule. In this way, BirA* generates a ~10nm “cloud” of reactive biotin (206) surrounding each “bait” protein. Amine groups (including those on lysine residues of nearby polypeptides) in the vicinity of the bait protein are thereby irreversibly biotinylated. Protease-BirA*FLAG fusions were expressed in Flp-In T-REx 293 cells. Following cell lysis, biotinylated proteins were captured on streptavidin-sepharose beads and identified using LC-MS/MS (Supplemental Table 1). FLAG-BirA* alone was expressed in the same cell model, and the resulting dataset used as a negative control. Data were subjected to SAINT analysis (235, 236) to generate a high confidence interactor list.

In total, 802 high confidence proximity interactions with 342 unique interactors were identified for the seven IMS proteases (Figure 2.1). 272 (~80%) of the 342 interactors are annotated by GO as mitochondrial proteins associated with known IMS functions such as mitochondrial organization, electron transport and aerobic respiration (Figure 2.2A). Two proteins were identified as interactors for all seven IMS proteases; OPA1 protein, a well-established marker of the IMS, and caseinolytic peptidase B protein homolog (CLPB), a recently identified IMS component (223). In contrast, a BirA*-tagged CLPP protein, which localizes to the mitochondrial matrix, did not display proximity interactions with either CLPB or OPA1 (117) (Figure 2.2 A and B).

Figure 2.1 BioID identifies proximity interactors of the seven human IMS proteases BioID was used to identify proximity interactors of the seven human IMS proteases (bait proteins indicated in yellow). High confidence interactors are indicated, using a Bayesian false discovery rate of ≤1%. 136 of 342 interactors were manually annotated according to complex or function. Highlighted in blue are proteins annotated in GO as ‘mitochondrion’. Edge width corresponds to average peptide count (n=4). Prey proteins detected by ≤2 bait proteins are depicted as diamond-shaped.

The number of high confidence interactors for each protease ranged from 30 (YME1L1) to 243 (IMMP2L) per bait protein, with an average of 114. Individual IMS protease interactomes displayed some overlap (Figure 2.2 C), but there was little to no correlation between the

39 mitochondrial matrix protease CLPP and the IMS protease interactomes (average correlation 0.04) (Figure 2.2 C).

Figure 2.2 The seven IMS proteases are correctly localized within the IMS A) Bait vs. bait Pearson correlation analysis (Prohits-viz) of the IMS protease interactomes and the CLPP mitochondrial matrix protease. B) GO enrichment analysis across all 342 interactors (Metascape.org). C) Average peptide counts (n=4) detected of the IMS marker protein CLPB in the BirA*only control, individual IMS proteases, and CLPP.

An IMS proteome of 127 proteins was recently characterized using the related APEX technique (223). 59 of these proteins were detected in our IMS protease BioID analysis. The BioID data were also notably enriched in membrane proteins; 168 interactome components are annotated as mitochondrial membrane proteins (Table 2.1). 153 of these polypeptides are reportedly localized to the inner membrane and 16 to the outer membrane (Table 2.1). 27 interactors are annotated as non-membrane proteins localized to the IMS (while this number is small, the annotation category for the IMS contains only 79 polypeptides) (Table 2.1).

Table 2.1 Top 20 GO cellular compartment annotations for all IMS protease interactors. Annotations were generated using Toppgene

Name p-value Hit Count in Query List Hit Count in Genome mitochondrion 2.04E-219 272 1769 mitochondrial part 5.65E-215 228 987 mitochondrial envelope 1.99E-158 175 736 mitochondrial inner membrane 1.24E-153 153 507 mitochondrial membrane 1.49E-152 168 694 organelle inner membrane 1.10E-148 155 564 organelle envelope 1.36E-127 180 1169 envelope 2.98E-127 180 1174 mitochondrial matrix 9.03E-92 105 425 mitochondrial protein complex 6.12E-78 67 149 mitochondrial membrane part 2.93E-66 65 189 inner mitochondrial membrane protein complex 8.54E-65 54 112 respiratory chain 3.37E-46 40 90 mitochondrial respiratory chain 3.35E-43 36 75 respiratory chain complex 3.74E-40 33 67 oxidoreductase complex 9.92E-40 37 97 NADH dehydrogenase complex 4.53E-35 26 43 mitochondrial respiratory chain complex I 4.53E-35 26 43 respiratory chain complex I 4.53E-35 26 43 mitochondrial intermembrane space 1.04E-27 27 79

Notably, 230 of the IMS protease “prey” proteins interacted with just one or two bait polypeptides (Figure 2.1), suggesting that BioID can identify unique interactomes for individual IMS proteases. For example, while IMMP1L and IMMP2L are reported to interact with each other to form a protease complex, BioID reported different interactomes for each protease (89/143 shared interactors for IMMP1L and 89/243 shared interactors for IMMP2L). Importantly, these data are consistent with previous observations for the budding yeast homologs IMP1 and IMP2, which are also found in the same complex but have unique, non-overlapping substrate profiles (132). Together, these data suggest that BioID can identify relevant proximity interactor subpopulations even in the context of the 12-40nm diameter mitochondrial IMS sub- compartment (23).

2.3.2 HTRA2 interacts with the MIB complex

HTRA2 is a serine protease homologous to the HtrA/DegP protease in E. coli (120). HTRA2 normally localizes to the IMS, but is released into the cytoplasm in response to cell death stimuli

41 and/or outer mitochondrial membrane permeabilization (87). In the cytoplasm, HTRA2 promotes apoptosis, at least in part, by binding to and degrading the inhibitor of apoptosis proteins (IAPs) (87, 125, 126). Despite an extensive characterization of the role of HTRA2 in apoptosis, little is known about its mitochondrial functions.

Of the 81 HTRA2 interacting partners identified by BioID, 61 are annotated as mitochondrial proteins, 11 are nuclear and four are cytoplasmic polypeptides; the localization of the remaining five is currently unknown (Figure 2.3 A)(Table 2.2). A number of previously reported HTRA2 interactors were identified in this analysis, including X-linked IAP (XIAP) (87), BIRC2 (241), BIRC6 (242), ARMC8 (243), and OPA1 (130)(Figure 2.3 A). Notably, we also identified interactions between HTRA2 and eight of 13 components of the MIB complex (GO enrichment log p value = -17.7)(Figure 2.3 B, Figure 2.4), including the three MIB core components, mitochondrial inner membrane protein (IMMT), sorting and assembly machinery component 50 homolog (SAMM50), and coiled-coil-helix-coiled-coil-helix domain-containing protein 3 (CHCHD3)(Figure 2.3 B and C).

Figure 2.3 BioID of HTRA2 identifies proximity interactions with the MIB complex A) HTRA2 interactome. Interactors manually grouped according to reported function. Previously reported interactors indicated in a green circle. Edge width corresponds to average peptide counts (n=4). B) GO enrichment analysis (Metascape.org) of 81 high confidence HTRA2 interactors. C) Peptide counts of the top 15 HTRA2 interactors (based on total peptide counts). MIB complex components highlighted in blue.

Table 2.2 Complete list of interactors identified by BioID for HTRA2 Interactors identified for HTRA2 are sorted by total peptide counts across two biological and two technical replicates, and significance analysis of interactome (SAINT) using a Bayesian false discovery rate (BFDR) <1%.

HTRA2 Pool A Pool B Gene Name Full Name Top 2 Controls Tech #1 Tech #2 Tech #1 Tech #2 Total SAINT BFDR BirA* biotin ligase (E. coli ) 2815 2807 1592 1516 1110 1069 5287 HTRA2 HtrA serine peptidase 2 3 2 876 841 742 779 3238 LACTB lactamase beta 0 0 36 40 23 29 128 1 0 OMA1 OMA1 zinc metallopeptidase 0 0 5 5 0 0 10 0.5 0.09 PARL presenilin associated rhomboid like 0 0 0 0 0 0 0 IMMP1L inner mitochondrial membrane peptidase subunit 1 0 0 0 0 0 0 0 IMMP2L inner mitochondrial membrane peptidase subunit 2 0 0 0 0 0 0 0 YME1L1 YME1 like 1 ATPase 0 0 14 9 9 15 47 1 0

IMMT inner membrane mitochondrial protein 6 5 263 248 190 169 870 1 0 DNAJC11 DnaJ heat shock protein family (Hsp40) member C11 16 15 197 176 173 153 699 1 0 XIAP X-linked inhibitor of apoptosis 38 37 193 185 147 147 672 1 0 CLPB ClpB homolog, mitochondrial AAA ATPase chaperonin 3 2 152 145 162 137 596 1 0 BIRC2 baculoviral IAP repeat containing 2 0 0 116 117 95 92 420 1 0 IARS2 isoleucyl-tRNA synthetase 2, mitochondrial 4 4 82 81 74 72 309 1 0 HAX1 HCLS1 associated protein X-1 5 4 78 82 67 66 293 1 0 RAVER1 ribonucleoprotein, PTB binding 1 4 4 71 82 63 64 280 1 0 SAMM50 SAMM50 sorting and assembly machinery component 2 0 85 78 64 49 276 1 0 ATAD3A ATPase family, AAA domain containing 3A 16 16 68 73 58 47 246 1 0 BIRC6 baculoviral IAP repeat containing 6 8 6 67 56 62 55 240 1 0 MAVS mitochondrial antiviral signaling protein 10 10 54 58 57 68 237 1 0 CHCHD3 coiled-coil-helix-coiled-coil-helix domain containing 3 0 0 59 68 35 45 207 1 0 AFG3L2 AFG3 like matrix AAA peptidase subunit 2 8 8 52 46 35 34 167 1 0 CKMT1B creatine kinase, mitochondrial 1B 0 0 44 49 34 35 162 1 0 MTX2 metaxin 2 0 0 43 33 37 30 143 1 0 NDUFA8 NADH:ubiquinone oxidoreductase subunit A8 0 0 37 30 42 27 136 1 0 C20orf11 GID complex subunit 8 homolog 9 6 27 33 37 35 132 1 0 LACTB lactamase beta 0 0 36 40 23 29 128 1 0 NDUFS1 NADH:ubiquinone oxidoreductase core subunit S1 6 5 29 23 28 30 110 1 0 FAM54A mitochondrial fission regulator 2 0 0 24 19 33 33 109 1 0 ATAD3B ATPase family, AAA domain containing 3B 0 0 27 29 21 20 97 1 0 CPOX coproporphyrinogen oxidase 0 0 23 20 26 26 95 1 0 SLC25A12 solute carrier family 25 member 12 4 4 30 25 22 16 93 1 0 ARMC8 armadillo repeat containing 8 0 0 21 17 20 25 83 1 0 ARMC1 armadillo repeat containing 1 0 0 22 23 19 18 82 1 0 MTFR1 mitochondrial fission regulator 1 0 0 16 15 31 20 82 1 0 TRAF2 TNF receptor associated factor 2 0 0 13 18 25 25 81 1 0 COX15 cytochrome c oxidase assembly homolog COX15 0 0 22 19 16 12 69 1 0 AK2 adenylate kinase 2 2 0 19 17 17 12 65 1 0 NDUFS2 NADH:ubiquinone oxidoreductase core subunit S2 3 3 14 15 18 17 64 1 0 CCDC58 coiled-coil domain containing 58 0 0 18 17 14 13 62 1 0 TIMM13 translocase of inner mitochondrial membrane 13 0 0 13 14 16 16 59 1 0 SELRC1 cytochrome c oxidase assembly factor 7 (putative) 0 0 14 18 11 15 58 1 0 LETM1 leucine zipper and EF-hand containing transmembrane protein 1 0 0 9 12 20 14 55 1 0 UBR5 ubiquitin protein ligase E3 component n-recognin 5 0 0 19 22 6 8 55 1 0 MFF mitochondrial fission factor 0 0 16 10 11 13 50 1 0 TTC19 tetratricopeptide repeat domain 19 0 0 8 10 16 13 47 1 0 YME1L1 YME1 like 1 ATPase 0 0 14 9 9 15 47 1 0 APOOL apolipoprotein O like 0 0 16 12 7 9 44 1 0 TOMM70A translocase of outer mitochondrial membrane 70 0 0 13 11 9 11 44 1 0 NDUFV3 NADH:ubiquinone oxidoreductase subunit V3 0 0 10 8 14 12 44 1 0 EXD2 exonuclease 3'-5' domain containing 2 0 0 9 8 12 14 43 1 0 ENDOG endonuclease G 0 0 15 16 5 4 40 1 0 BCL2L13 BCL2 like 13 0 0 6 6 15 13 40 1 0 ACAD9 acyl-CoA dehydrogenase family member 9 0 0 5 5 14 14 38 1 0 USP30 ubiquitin specific peptidase 30 0 0 6 6 12 11 35 1 0 MARC2 mitochondrial amidoxime reducing component 2 0 0 9 6 11 9 35 1 0 CHCHD6 coiled-coil-helix-coiled-coil-helix domain containing 6 0 0 7 9 10 7 33 1 0 MRPS24 mitochondrial ribosomal protein S24 0 0 9 6 10 8 33 1 0 NDUFS8 NADH:ubiquinone oxidoreductase core subunit S8 0 0 7 6 10 8 31 1 0 PYCR1 pyrroline-5-carboxylate reductase 1 0 0 5 7 8 5 25 1 0 NDUFA12 NADH:ubiquinone oxidoreductase subunit A12 0 0 6 5 8 6 25 1 0 SDHA succinate dehydrogenase complex flavoprotein subunit A 0 0 6 4 8 6 24 1 0 SLC30A9 solute carrier family 30 member 9 0 0 4 5 6 8 23 1 0 COX5B cytochrome c oxidase subunit 5B 0 0 4 7 6 6 23 1 0 PCGF1 polycomb group ring finger 1 0 0 7 5 4 6 22 1 0 EFHA1 mitochondrial calcium uptake 2 0 0 4 5 5 6 20 1 0 OPA1 OPA1, mitochondrial dynamin like GTPase 2 0 22 22 11 10 65 0.99 0 MTX1 metaxin 1 2 0 16 14 13 11 54 0.99 0 FAM54B mitochondrial fission regulator 1 like 0 0 3 7 16 11 37 0.99 0 ATPAF1 ATP synthase mitochondrial F1 complex assembly factor 1 0 0 5 3 11 7 26 0.99 0 GLS glutaminase 0 0 3 3 7 11 24 0.99 0 MRPS11 mitochondrial ribosomal protein S11 0 0 3 6 7 5 21 0.99 0 RCN1 reticulocalbin 1 0 0 5 5 3 4 17 0.99 0 COX4I1 cytochrome c oxidase subunit 4I1 4 3 18 19 14 13 64 0.98 0 RAC1 Rac family small GTPase 1 0 0 3 3 4 3 13 0.98 0 OCIAD1 OCIA domain containing 1 13 8 33 32 31 30 126 0.97 0 NDUFA13 NADH:ubiquinone oxidoreductase subunit A13 7 3 19 20 24 18 81 0.97 0 PYCR2 pyrroline-5-carboxylate reductase 2 0 0 3 2 5 5 15 0.96 0 NDUFA2 NADH:ubiquinone oxidoreductase subunit A2 0 0 4 4 2 3 13 0.96 0 SLIRP SRA stem-loop interacting RNA binding protein 0 0 3 3 2 3 11 0.95 0 ADCK2 aarF domain containing kinase 2 0 0 4 3 2 2 11 0.93 0 ACOT2 acyl-CoA thioesterase 2 12 0 44 40 62 43 189 0.93 0.01 COX6C cytochrome c oxidase subunit 6C 0 0 3 2 3 2 10 0.93 0.01 STRBP spermatid perinuclear RNA binding protein 2 0 9 8 7 9 33 0.9 0.01

CENPM centromere protein M 0 0 2 2 3 2 9 0.9 0.01 COX5A cytochrome c oxidase subunit 5A 2 0 9 6 14 8 37 0.89 0.01 AIFM1 apoptosis inducing factor mitochondria associated 1 4 4 20 22 14 12 68 0.88 0.01 TMEM209 transmembrane protein 209 0 0 2 2 2 2 8 0.88 0.01 NDUFV2 NADH:ubiquinone oxidoreductase core subunit V2 3 3 8 11 14 12 45 0.77 0.01

To further investigate the HTRA2 interactome, we performed standard IP-MS on FlagBirA- HTRA2 (Table 2.3). Notably, the MIB component IMMT was identified in this pulldown, along with five additional proteins detected in the BioID dataset (ARMC8, DNAJC11, HAX1, IARS2, and TOMM70A). An HTRA2-MIB complex interaction was thus identified using two orthogonal methods.

Table 2.3 IP-MS interactor list for HTRA2 Interactors identified for HTRA2 are sorted by total peptide counts across the top three out of four runs with a BFDR of <1%.

HTRA2 Gene Name Top 2 Controls Run #1 Run #2 Run #3 Total SAINT BFDR BirA 10691 10573 1604 1601 1520 4725 HTRA2 0 0 844 831 827 2502 IMMP1L 0 0 0 0 0 0 IMMP2L 0 0 0 0 0 0

HNRNPH1 72 58 212 202 202 616 1 0 C1QBP 42 38 165 160 149 474 1 0 PSME3 2 0 147 138 125 410 1 0 BAG2 10 9 106 93 71 270 1 0 MYH10 13 10 106 98 49 253 1 0 MRPL28 0 0 82 81 76 239 1 0 SUGT1 25 21 86 78 72 236 1 0 IARS2 12 8 79 70 54 203 1 0 HAX1 10 9 41 40 40 121 1 0 MRPL47 0 0 41 40 37 118 1 0 UBAP2L 8 6 35 34 29 98 1 0 MRPL24 0 0 34 32 30 96 1 0 KIAA0564 8 7 30 26 25 81 1 0 MRPL41 0 0 25 24 24 73 1 0 DNAJC11 0 0 15 15 14 44 1 0 MRPL23 0 0 15 11 8 34 1 0 EIF4G3 0 0 13 10 10 33 1 0 ESRRA 0 0 11 10 10 31 1 0 MYL12B 0 0 13 10 6 29 1 0 ACAA1 0 0 11 8 6 25 1 0 CPS1 0 0 11 7 7 25 1 0 CLINT1 0 0 9 9 7 25 1 0 PPOX 0 0 10 6 5 21 1 0 POLR2C 0 0 8 7 6 21 1 0 EARS2 0 0 7 7 5 19 1 0 VPS16 0 0 7 6 4 17 1 0 RPL35A 0 0 6 6 5 17 1 0 FAM192A 0 0 7 5 5 17 1 0 DOCK7 0 0 6 6 4 16 1 0 RPAP3 0 0 7 4 4 15 1 0 RNASEH2A 0 0 6 4 4 14 1 0 CAPN7 0 0 5 4 4 13 1 0 ZMYM4 0 0 5 4 4 13 1 0 POLR2L 0 0 4 4 4 12 1 0 TOMM70A 0 0 4 4 4 12 1 0 ANKLE2 0 0 7 4 3 14 0.99 0 MRPS26 0 0 6 5 3 14 0.99 0 FXR1 0 0 5 5 3 13 0.99 0 GPN3 0 0 6 4 3 13 0.99 0 TAMM41 0 0 5 5 3 13 0.99 0 NUP37 0 0 5 4 3 12 0.99 0 POLR1D 0 0 5 4 3 12 0.99 0

MRPS35 0 0 5 4 3 12 0.99 0 VPS18 0 0 4 4 3 11 0.99 0 LSG1 0 0 4 4 3 11 0.99 0 SNRNP27 0 0 4 3 3 10 0.99 0 GTF3C1 5 2 15 14 14 43 0.98 0 AUP1 0 0 3 3 3 9 0.98 0 ARMC8 0 0 3 3 3 9 0.98 0 IQGAP1 0 0 12 10 2 24 0.97 0 VARS2 0 0 9 7 2 18 0.97 0 KBTBD6 0 0 8 4 2 14 0.96 0 PDDC1 0 0 6 5 2 13 0.96 0 POLR2A 0 0 6 4 2 12 0.96 0 DYNLT1 0 0 6 4 2 12 0.96 0 SNW1 0 0 5 4 2 11 0.96 0.01 POTEI 0 0 5 4 2 11 0.96 0.01 POLDIP2 0 0 5 3 2 10 0.96 0.01 TBK1 0 0 4 4 2 10 0.96 0.01 MTMR9 0 0 5 3 2 10 0.96 0.01 CSNK2B 0 0 4 4 2 10 0.96 0.01 PPP4C 0 0 4 3 2 9 0.96 0.01 IMMT 0 0 4 3 2 9 0.96 0.01 PNMA2 0 0 3 3 2 8 0.95 0.01 MFAP1 0 0 3 3 2 8 0.95 0.01 NT5C3 0 0 3 2 2 7 0.92 0.01 RNPS1 0 0 3 2 2 7 0.92 0.01

The multiprotein MIB IMS complex (Figure 2.4) anchors the outer to the inner membrane, and is essential for the formation of mitochondrial cristae (244–250). Knockdown of any of the three core MIB complex components (IMMT, SAMM50, CHCHD3) disrupts cristae structure (246). We hence hypothesized that HTRA2 could be involved in the regulation of mitochondrial cristae via interactions with the MIB complex.

Figure 2.4 Schematic of the MIB complex Blue stars highlight the eight MIB components identified by HTRA2 BioID. Gene names of the three MIB core components are in bold.

2.3.3 HTRA2 is required to maintain mitochondrial cristae structure

Mitochondrial cristae are organized folds of the inner membrane that increase surface area for oxidative phosphorylation and release cytochrome c during apoptosis (251, 252). To assess its role in the regulation of cristae function, we knocked down HTRA2 in HEK 293 cells. Knockdown of HTRA2 did not alter mitochondrial ultrastructure (Figure 2.5), but disrupted cristae formation (Figure 2.6 A), leading to more condensed and tightly packed inner membrane structures, as assessed by transmission electron microscopy. Over-expression of murine HTRA2, which is 85% identical to human HTRA2 but resistant to the shRNA used to knockdown the human form, restored cristae structure (Figure 2.6 A).

Figure 2.5 Mitochondrial ultra-structure in Flp-In 293 T-Rex and OCI-AML2 cells after HTRA2 knockdown Seven days post-transduction with lentiviral vectors containing no shRNA, shControl, shHTRA2-1, and shHTRA2-2, A-D) Flp-In 293 T-REx cells and E-H) OCI-AML2 cells were incubated with 100nM MitoTracker Red CMXRos for 15 min and 500ng/mL Hoechst for 10min. Cells were fixed and imaged with fluorescence microscopy.

Figure 2.6 Knockdown of HTRA2 disrupts cristae formation in Flp-In T-REx 293 and OCI-AML2 cells Transmission electron microscopy images of (A) Flp-In T-REx 293 cells and (B) OCI-AML2 cells seven days post transduction with lentiviral vectors containing shControl, shHTRA2-1, or shHTRA2-2. Rescue of cristae formation was achieved using Flp-In T-Rex 293 cells stably expressing shRNA resistant mHTRA2 in the presence of 10nm/mL tetracycline. Immunoblots show levels of wild type and murine (m) HTRA2.

We and others have previously shown that AML cells have unique mitochondrial characteristics, with increased reliance on oxidative phosphorylation (117, 253–259). Knockdown of HTRA2 also disrupted cristae structure in the AML cell line OCI-AML2 (Figure 2.6 B). Thus, HTRA2 function is necessary for the maintenance of mitochondrial cristae structure in multiple cell types.

2.3.4 The MIB complex subunit IMMT is an HTRA2 substrate

Since HTRA2 interacts with multiple MIB components, and knockdown of HTRA2 disrupted cristae structure, we hypothesized that one or more MIB components could be HTRA2 substrates. To this end, cell-free enzymatic assays were conducted (Figure 2.7). Consistent with previous reports, recombinant HTRA2 cleaved the positive control ß-casein, and this degradation was inhibited by the HTRA2 inhibitor UCF101 (121, 260, 261)(Figure 2.8 A). While no

51 proteolytic activity was detected against the two core MIB complex components SAMM50 or CHCHD3, HTRA2 cleaved recombinant IMMT (Figure 2.8A and 2.9). HTRA2-mediated IMMT degradation was prevented by the addition of UCF101 (Figure 2.8A). Supporting IMMT as a bona fide HTRA2 substrate, intracellular levels of the IMMT protein increased after HTRA2 knockdown (Figure 2.8 B and C). In contrast, HTRA2 knockdown lead to little or no increase in SAMM50, CHCHD3 or OPA1 (a protein that has also been reported to be involved in mitochondrial cristae formation);(130, 155) (Figure 2.8 B and C).

Together, these data suggest that the MIB complex protein IMMT is an HTRA2 substrate. Further, we believe HTRA2 can affect cristae formation through the regulation of IMMT of the MIB complex (Figure 2.10).

Figure 2.7 Schematic of cell-free enzymatic assay for HTRA2 Each potential substrate is incubated with HTRA2, and HTRA2 + UCF101 (HTRA2 inhibitor). Beta-casein is used as a positive control of HTRA2 proteolytic activity.

Figure 2.8 HTRA2 degrades IMMT A) Cell-free enzymatic assay of HTRA2 incubated with positive control substrate ß-casein, IMMT, SAMM50, and an HTRA2 inhibitor UCF101 at 37°C for 30min. Samples were subjected to SDS-PAGE and stained with Gel Code. Arrows highlight full length IMMT protein. B) Levels of MIB core complex components and OPA1 in OCI-AML2 cells seven days post transduction with shRNA targeting HTRA2 in lentiviral vectors. C) Densitometry analysis of three independent immunoblots similar to B) using image J, two- way ANOVA was performed in GraphPad Prism 6 followed by a post-hoc Tukey’s multiple comparisons test (*p<0.05, **p<0.01, ****p<0.0001).

Figure 2.9 CHCHD3 is not a substrate of HTRA2 in vitro Cell-free enzymatic assay of HTRA2 incubated with positive control substrate ß-casein, CHCHD3, and the HTRA2 inhibitor UCF101 at 37°C for 30min. Samples were subjected to SDS-PAGE and stained with Gel Code.

Figure 2.10 Model of HTRA2 maintenance of the cristae formation through IMMT of the MIB complex Stars represent interactors of HTRA2 identified by BioID.

2.3.5 The G399S Parkinson’s associated HTRA2 mutant loses a specific subset of interactors

HTRA2 has been linked to Parkinson’s disease through the G399S mutations and shown disrupted mitochondrial structure and cristae formation (182). Thus, we evaluated whether the G399S mutation could affect the interactome of HTRA2. The HTRA2 G399S interactome identified 32 interactors compared with the 81 interactors identified with the wild-type (WT) HTRA2 interactome (Table 2.4). This appears to be a general decrease in the peptide counts of each protein across the board as there is not a drastic drop off for specific proteins. For example, CLPB which we used as a marker of the IMS, had a total of 596 peptides identified in the WT interactome compared with 151 in the G399S interactome. Similar trends in peptide count reduction can be seen for the majority of interactors. This reduced many of the putative interactors discovered with WT HTRA2 below the threshold (BFDR of 1%) to be identified as an interactor in the G399S interactome. This is further evident by the number of peptides identified for both HTRA2 and BirA of 3238 and 5287 respectively. This is compared with 1935 for HTRA2 and 1981 for BirA in the G399S interactome. Furthermore, the total number of matched peptides is unchanged (WT=31704.25/replicate, G399S=28268.75/replicate) suggesting that this loss is not due to batch variations or mass spectrometer function.

We further analyzed a proteolytically dead mutant S306A version of HTRA2 through BioID and showed little changes in the overall interactome. There were 67 putative interacting proteins identified in the S306A HTRA2 interactome with 17 unique interactors not identified in either the WT or G399S interactomes. The S306A interactome appears more closely related to the WT as opposed to the G399S mutant not just in the number of interactors identified, but also in total peptide counts. There were 32166 peptides identified on average for each run similar to the ~32000 and ~28000 identified in the WT and G399S interactomes respectively. In the S306A interactome there were 451 peptides identified for CLPB, 4355 for BirA, and 3846 for HTRA2. These numbers are more closely associated with WT interactome than the G399S interactome.

Table 2.4 Complete list of interactors identified by BioID for HTRA2 G399S Interactors identified for HTRA2 G399S are sorted by total peptide counts across two biological and two technical replicates, and significance analysis of interactome (SAINT) using a Bayesian false discovery rate (BFDR) <1%.

HTRA2 G399S Pool A Pool B Gene Name Full Name Top 2 Controls Tech #1 Tech #2 Tech #1 Tech #2 Total SAINT BFDR BirA* biotin ligae (E. coli) 2802 2753 504 489 493 495 1981 HTRA2 High temperature requirement peptidase A 2 3 2 488 473 470 504 1935

MATR3 matrin 3 40 39 116 114 122 112 464 1 0 BIRC6 baculoviral IAP repeat containing 6 8 7 81 73 78 82 314 1 0 DNAJC11 DnaJ heat shock protein family (Hsp40) member C11 16 15 64 66 63 66 259 1 0 RAVER1 ribonucleoprotein, PTB binding 1 4 4 51 66 48 55 220 1 0 IMMT inner membrane mitochondrial protein 6 5 45 54 43 53 195 1 0 CLPB ClpB homolog, mitochondrial AAA ATPase chaperonin 3 2 45 30 37 39 151 1 0 IARS2 isoleucyl-tRNA synthetase 2, mitochondrial 4 4 27 27 26 18 98 1 0 NDUFA8 NADH:ubiquinone oxidoreductase subunit A8 0 0 19 17 20 22 78 1 0 BIRC2 baculoviral IAP repeat containing 2 0 0 12 12 19 16 59 1 0 UBR5 ubiquitin protein ligase E3 component n-recognin 5 0 0 9 7 15 12 43 1 0 TRAF2 TNF receptor associated factor 2 0 0 5 9 9 9 32 1 0 CPOX coproporphyrinogen oxidase 0 0 9 5 10 6 30 1 0 CKMT1B creatine kinase, mitochondrial 1B 0 0 6 6 8 8 28 1 0 ATPAF1 ATP synthase mitochondrial F1 complex assembly factor 1 0 0 6 6 9 7 28 1 0 LETM1 leucine zipper and EF-hand containing transmembrane protein 1 0 0 5 5 8 5 23 1 0 GFM1 G elongation factor mitochondrial 1 0 0 5 8 4 6 23 1 0 TIMM13 translocase of inner mitochondrial membrane 13 0 0 4 5 4 5 18 1 0 TOMM70A translocase of outer mitochondrial membrane 70 0 0 6 4 4 4 18 1 0 RAC1 Rac family small GTPase 1 0 0 4 5 4 4 17 1 0 SAMM50 SAMM50 sorting and assembly machinery component 2 0 12 15 16 14 57 0.99 0 NDUFAF2 NADH:ubiquinone oxidoreductase complex assembly factor 2 0 0 4 3 6 6 19 0.99 0 CHCHD3 coiled-coil-helix-coiled-coil-helix domain containing 3 0 0 5 4 3 4 16 0.99 0 RBM12B RNA binding motif protein 12B 0 0 8 3 4 3 18 0.98 0 FAM54A mitochondrial fission regulator 2 0 0 2 5 5 8 20 0.96 0 ACAD9 acyl-CoA dehydrogenase family member 9 0 0 2 6 4 5 17 0.96 0 MTX2 metaxin 2 0 0 2 3 5 3 13 0.94 0.01 SLC30A9 solute carrier family 30 member 9 0 0 4 2 2 5 13 0.91 0.01 TFAM transcription factor A, mitochondrial 0 0 2 3 4 2 11 0.9 0.01 MRPS11 mitochondrial ribosomal protein S11 0 0 2 2 3 3 10 0.9 0.01 AFG3L2 AFG3 like matrix AAA peptidase subunit 2 8 8 25 30 24 23 102 0.89 0.01 CLPX caseinolytic mitochondrial matrix peptidase chaperone subunit 6 4 17 16 16 17 66 0.89 0.01 NDUFV3 NADH:ubiquinone oxidoreductase subunit V3 0 0 2 2 3 2 9 0.86 0.01

Table 2.5 Complete list of interactors identified by BioID for HTRA2 S306A Interactors identified for HTRA2 S306A are sorted by total peptide counts across two biological and two technical replicates, and significance analysis of interactome (SAINT) using a Bayesian false discovery rate (BFDR) <1%.

HTRA2 S306A Pool A Pool B Gene Name Full Name Top 2 Controls Tech #1 Tech #2 Tech #1 Tech #2 Total SAINT BFDR BirA* biotin ligae (E. coli) 2802 2753 1096 1168 1093 998 4355 HTRA2 High temperature requirement peptidase A 2 3 2 890 1036 965 955 3846

DNAJC11 DnaJ heat shock protein family (Hsp40) member C11 16 15 161 191 161 183 696 1 0 XIAP X-linked inhibitor of apoptosis 38 37 126 140 117 116 499 1 0 IMMT inner membrane mitochondrial protein 6 5 119 141 113 116 489 1 0 CLPB ClpB homolog, mitochondrial AAA ATPase chaperonin 3 2 93 107 108 96 404 1 0 IARS2 isoleucyl-tRNA synthetase 2, mitochondrial 4 4 71 79 100 91 341 1 0 RAVER1 ribonucleoprotein, PTB binding 1 4 4 69 93 85 71 318 1 0 SAMM50 SAMM50 sorting and assembly machinery component 2 0 43 46 44 46 179 1 0 HAX1 HCLS1 associated protein X-1 5 4 46 43 46 37 172 1 0 MAVS mitochondrial antiviral signaling protein 10 10 41 45 39 46 171 1 0 BIRC2 baculoviral IAP repeat containing 2 0 0 36 34 45 46 161 1 0 OCIAD1 OCIA domain containing 1 13 8 46 48 32 33 159 1 0 NDUFS3 NADH:ubiquinone oxidoreductase core subunit S3 10 7 36 38 45 39 158 1 0 BIRC6 baculoviral IAP repeat containing 6 8 7 31 34 39 39 143 1 0 NDUFA8 NADH:ubiquinone oxidoreductase subunit A8 0 0 39 33 22 32 126 1 0 CKMT1B creatine kinase, mitochondrial 1B 0 0 31 32 31 24 118 1 0 FAM54A mitochondrial fission regulator 2 0 0 18 24 28 31 101 1 0 TRAF2 TNF receptor associated factor 2 0 0 23 32 19 26 100 1 0 CLPX caseinolytic mitochondrial matrix peptidase chaperone subunit 6 4 20 27 26 23 96 1 0 COX4I1 cytochrome c oxidase subunit 4I1 4 3 19 20 21 18 78 1 0 NDUFS2 NADH:ubiquinone oxidoreductase core subunit S2 3 3 18 19 16 24 77 1 0 MTX2 metaxin 2 0 0 21 20 18 17 76 1 0 ARMC1 armadillo repeat containing 1 0 0 8 14 25 23 70 1 0 MTX1 metaxin 1 2 0 13 13 20 19 65 1 0 MTFR1 mitochondrial fission regulator 1 0 0 15 16 16 17 64 1 0 CPOX coproporphyrinogen oxidase 0 0 12 17 18 16 63 1 0 CCDC58 coiled-coil domain containing 58 0 0 12 12 15 15 54 1 0 LETM1 leucine zipper and EF-hand containing transmembrane protein 1 0 0 15 10 12 12 49 1 0 COX15 cytochrome c oxidase assembly homolog COX15 0 0 13 14 9 13 49 1 0 CHCHD3 coiled-coil-helix-coiled-coil-helix domain containing 3 0 0 8 12 11 13 44 1 0 NDUFAF2 NADH:ubiquinone oxidoreductase complex assembly factor 2 0 0 12 13 10 8 43 1 0 ATPAF1 ATP synthase mitochondrial F1 complex assembly factor 1 0 0 10 9 11 11 41 1 0 PPIF peptidylprolyl isomerase F 0 0 9 15 9 7 40 1 0 SELRC1 cytochrome c oxidase assembly factor 7 (putative) 0 0 8 11 9 10 38 1 0 SLC30A9 solute carrier family 30 member 9 0 0 10 4 14 9 37 1 0 PYCR2 pyrroline-5-carboxylate reductase 2 0 0 8 9 10 8 35 1 0 MDH2 malate dehydrogenase 2 0 0 11 11 7 6 35 1 0 UBR5 ubiquitin protein ligase E3 component n-recognin 5 0 0 7 10 10 7 34 1 0 TIMM13 translocase of inner mitochondrial membrane 13 0 0 9 8 7 8 32 1 0 MRPL28 mitochondrial ribosomal protein L28 0 0 4 7 10 6 27 1 0 TTC19 tetratricopeptide repeat domain 19 0 0 4 5 7 10 26 1 0 USP30 ubiquitin specific peptidase 30 0 0 4 8 5 7 24 1 0 EXD2 exonuclease 3'-5' domain containing 2 0 0 6 4 10 4 24 1 0 RAC1 Rac family small GTPase 1 0 0 7 6 5 5 23 1 0 CISD2 CDGSH iron sulfur domain 2 0 0 5 6 5 6 22 1 0 HSPE1 heat shock protein family E (Hsp10) member 1 0 0 4 5 6 7 22 1 0 ACAD9 acyl-CoA dehydrogenase family member 9 0 0 4 6 6 5 21 1 0 FAM54B mitochondrial fission regulator 1 like 0 0 7 4 5 4 20 1 0 NDUFV3 NADH:ubiquinone oxidoreductase subunit V3 0 0 5 4 5 5 19 1 0 PYCR1 pyrroline-5-carboxylate reductase 1 0 0 4 5 5 5 19 1 0 TIMM44 translocase of inner mitochondrial membrane 44 8 6 23 25 32 24 104 0.99 0 AK2 adenylate kinase 2 2 0 12 15 12 14 53 0.99 0 TOMM70A translocase of outer mitochondrial membrane 70 0 0 3 5 10 7 25 0.99 0 GFM1 G elongation factor mitochondrial 1 0 0 3 4 7 5 19 0.99 0 MBNL1 muscleblind like splicing regulator 1 0 0 3 4 4 8 19 0.99 0 YME1L1 YME1 like 1 ATPase 0 0 4 3 4 6 17 0.99 0 AFG3L2 AFG3 like matrix AAA peptidase subunit 2 8 8 25 25 28 31 109 0.98 0 NDUFS1 NADH:ubiquinone oxidoreductase core subunit S1 6 5 18 20 21 30 89 0.98 0 APOOL apolipoprotein O like 0 0 7 5 2 4 18 0.96 0 NDUFAF4 NADH:ubiquinone oxidoreductase complex assembly factor 4 0 0 2 5 5 6 18 0.96 0 QRSL1 glutaminyl-tRNA amidotransferase subunit QRSL1 0 0 5 3 2 5 15 0.95 0 PET112 glutamyl-tRNA amidotransferase subunit B 0 0 3 5 4 2 14 0.95 0 MRPL17 mitochondrial ribosomal protein L17 0 0 5 3 2 4 14 0.95 0 DIABLO diablo IAP-binding mitochondrial protein 10 9 34 42 32 27 135 0.94 0.01 THEM4 thioesterase superfamily member 4 0 0 2 3 5 3 13 0.94 0.01 VARS2 valyl-tRNA synthetase 2, mitochondrial 0 0 2 3 4 2 11 0.9 0.01 CISD1 CDGSH iron sulfur domain 1 0 0 3 2 3 2 10 0.9 0.01 CYCS cytochrome c, somatic 0 0 3 2 2 3 10 0.9 0.01

2.3.6 Other IMS Protease BioIDs

The remaining six IMS protease datasets and GO enrichment analysis are briefly presented below.

2.3.6.1 YME1L1

YME1L1 identified the fewest interactors with 30 total putative interactors (Table 2.6). Of the 30 total interactors 26 were annotated as mitochondrial in GO. YME1L1 is associated with mitochondrial protein import, and mitochondrial dynamics (155, 160). Pathway enrichment analysis identified interactors associated with both pathways (Figure 2.11). The IMS markers of CLPB and known interactors OPA1 were both identified. In yeast, polynucleotide phosphorylase (PNPase) was shown to require Yme1 in order to be properly translocated into the IMS. Its mammalian homolog PNPT1 was not detected within our dataset, suggesting potential differences between yeast and mammalian YME1L1.

Table 2.6 Complete list of interactors identified by BioID for YME1L1 Interactors identified for YME1L1 are sorted by total peptide counts across two biological and two technical replicates and significance analysis of interactome (SAINT) using a Bayesian false discovery rate (BFDR) <1%.

YME1L1 Pool A Pool B Gene Name Full Name Top 2 Controls Tech #1 Tech #2 Tech #1 Tech #2 Total SAINT BFDR BirA* biotin ligase (E. coli) 2815 2807 1624 1851 823 803 5101 HTRA2 HtrA serine peptidase 2 3 2 0 0 0 0 0 LACTB lactamase beta 0 0 12 12 20 17 61 1 0 OMA1 OMA1 zinc metallopeptidase 0 0 0 4 2 2 8 PARL presenilin associated rhomboid like 0 0 12 11 12 13 48 1 0 IMMP1L inner mitochondrial membrane peptidase subunit 1 0 0 0 0 0 0 0 IMMP2L inner mitochondrial membrane peptidase subunit 2 0 0 0 0 0 0 0 YME1L1 YME1 like 1 ATPase 0 0 902 936 696 703 3237 IMMT inner membrane mitochondrial protein 6 5 99 92 115 133 439 1 0 CLPB ClpB homolog, mitochondrial AAA ATPase chaperonin 3 2 122 99 105 96 422 1 0 CKMT1B creatine kinase, mitochondrial 1B 0 0 54 50 49 46 199 1 0 SAMM50 SAMM50 sorting and assembly machinery component 2 0 32 29 32 35 128 1 0 COX4I1 cytochrome c oxidase subunit 4I1 4 3 35 31 32 29 127 1 0 CPOX coproporphyrinogen oxidase 0 0 32 33 28 19 112 1 0 COX15 cytochrome c oxidase assembly homolog COX15 0 0 26 25 25 30 106 1 0 ENDOG endonuclease G 0 0 25 28 24 23 100 1 0 CBR1 carbonyl reductase 1 6 4 24 25 21 22 92 1 0 HAX1 HCLS1 associated protein X-1 5 4 22 18 18 27 85 1 0 NDUFA8 NADH:ubiquinone oxidoreductase subunit A8 0 0 17 17 22 19 75 1 0 CCDC58 coiled-coil domain containing 58 0 0 17 20 17 19 73 1 0 AK2 adenylate kinase 2 2 0 12 12 25 18 67 1 0 CHCHD3 coiled-coil-helix-coiled-coil-helix domain containing 3 0 0 11 12 19 23 65 1 0 SELRC1 cytochrome c oxidase assembly factor 7 (putative) 0 0 22 16 10 14 62 1 0 LACTB lactamase beta 0 0 12 12 20 17 61 1 0 PARL presenilin associated rhomboid like 0 0 12 11 12 13 48 1 0 TIMM13 translocase of inner mitochondrial membrane 13 0 0 9 9 13 10 41 1 0 MTX2 metaxin 2 0 0 16 10 5 6 37 1 0 ADCK2 aarF domain containing kinase 2 0 0 5 10 10 9 34 1 0 TOMM70A translocase of outer mitochondrial membrane 70 0 0 6 6 8 6 26 1 0 ELOVL1 ELOVL fatty acid elongase 1 0 0 7 5 6 8 26 1 0 USP30 ubiquitin specific peptidase 30 0 0 6 4 6 5 21 1 0 RAC1 Rac family small GTPase 1 0 0 5 5 5 3 18 0.99 0 CYCS cytochrome c, somatic 0 0 6 3 5 2 16 0.96 0 HCCS holocytochrome c synthase 0 0 4 6 2 3 15 0.96 0 PLD3 phospholipase D family member 3 0 0 2 2 4 4 12 0.94 0 SLC25A12 solute carrier family 25 member 12 4 4 20 12 24 21 77 0.89 0.01 DNAJC11 DnaJ heat shock protein family (Hsp40) member C11 16 15 49 50 41 45 185 0.87 0.01 OPA1 OPA1, mitochondrial dynamin like GTPase 2 0 9 5 15 14 43 0.87 0.01

G2:0007005: PitRchRnGriRn RrganizatiRn 5-H6A-1268020: 0itRchRnGriaO SrRtHin iPSRrt G2:0009205: SurinH ribRnucOHRsiGH triShRsShatH PHtabROic SrRcHss G2:0008053: PitRchRnGriaO fusiRn hsa00860: 3RrShyrin anG chORrRShyOO PHtabROisP G2:1990542: PitRchRnGriaO transPHPbranH transSRrt G2:0071333: cHOOuOar rHsSRnsH tR gOucRsH stiPuOus G2:0009152: SurinH ribRnucOHRtiGH biRsynthHtic SrRcHss

0 2 4 6 8 10 12 -ORg10(3)

Figure 2.11 GO enrichment analysis of YME1L1 Metascape was used to generate the values and graph.

2.3.6.2 OMA1

OMA1 identified 77 interactors of which 70 are annotated as mitochondrial in GO. Known interactor and IMS marker OPA1 was one of the top proteins identified (Table 2.7). GO enrichment analysis revealed the known mitochondrial fusion pathway (through OPA1) as well as other classical mitochondrial pathways such as the ETC (Figure 2.12). Further validation of this dataset is required to decipher whether these interactions have any biological relevance.

Table 2.7 Complete list of interactors identified by BioID for OMA1 Interactors identified for OMA1 are sorted by total peptide counts across two biological and two technical replicates and significance analysis of interactome (SAINT) using a Bayesian false discovery rate (BFDR) <1%.

OMA1 Pool A Pool B Gene Name Full Name Top 2 Controls Tech #1 Tech #2 Tech #1 Tech #2 Total SAINT BFDR BirA* biotin ligase (E. coli) 2815 2807 2339 2392 2143 2399 9273 HTRA2 HtrA serine peptidase 2 3 2 0 7 2 0 9 LACTB lactamase beta 0 0 43 47 44 44 178 1 0 OMA1 OMA1 zinc metallopeptidase 0 0 1110 1092 1437 1449 5088 PARL presenilin associated rhomboid like 0 0 4 6 0 0 10 IMMP1L inner mitochondrial membrane peptidase subunit 1 0 0 0 0 0 0 0 IMMP2L inner mitochondrial membrane peptidase subunit 2 0 0 4 0 0 0 4 YME1L1 YME1 like 1 ATPase 0 0 30 25 21 24 100 1 0 IMMT inner membrane mitochondrial protein 6 5 312 315 208 263 1098 1 0 CLPB ClpB homolog, mitochondrial AAA ATPase chaperonin 3 2 180 181 190 210 761 1 0 DNAJC11 DnaJ heat shock protein family (Hsp40) member C11 16 15 151 149 183 190 673 1 0 APOOL apolipoprotein O like 0 0 130 137 150 147 564 1 0 COX15 cytochrome c oxidase assembly homolog COX15 0 0 112 131 130 127 500 1 0 MCM3 minichromosome maintenance complex component 3 32 25 108 96 89 112 405 1 0 SAMM50 SAMM50 sorting and assembly machinery component 2 0 90 88 69 79 326 1 0 CKMT1B creatine kinase, mitochondrial 1B 0 0 87 76 78 80 321 1 0 OPA1 OPA1, mitochondrial dynamin like GTPase 2 0 83 80 57 63 283 1 0 SLC25A25 solute carrier family 25 member 25 0 0 78 79 57 61 275 1 0 SLC25A12 solute carrier family 25 member 12 4 4 74 80 48 46 248 1 0 HAX1 HCLS1 associated protein X-1 5 4 60 57 54 52 223 1 0 COX4I1 cytochrome c oxidase subunit 4I1 4 3 62 59 45 50 216 1 0 OCIAD1 OCIA domain containing 1 13 8 49 40 48 48 185 1 0 LACTB lactamase beta 0 0 43 47 44 44 178 1 0 NDUFA8 NADH:ubiquinone oxidoreductase subunit A8 0 0 46 37 45 41 169 1 0 AIFM1 apoptosis inducing factor mitochondria associated 1 4 4 44 40 38 39 161 1 0 CPOX coproporphyrinogen oxidase 0 0 32 31 44 44 151 1 0 MTX2 metaxin 2 0 0 49 43 28 28 148 1 0 GPD2 glycerol-3-phosphate dehydrogenase 2 4 3 37 32 27 28 124 1 0 AK2 adenylate kinase 2 2 0 35 29 28 31 123 1 0 CHCHD3 coiled-coil-helix-coiled-coil-helix domain containing 3 0 0 37 34 22 28 121 1 0 COX5A cytochrome c oxidase subunit 5A 2 0 33 28 30 24 115 1 0 CCDC58 coiled-coil domain containing 58 0 0 20 25 31 37 113 1 0 YME1L1 YME1 like 1 ATPase 0 0 30 25 21 24 100 1 0 SELRC1 cytochrome c oxidase assembly factor 7 (putative) 0 0 28 29 21 20 98 1 0 CBR1 carbonyl reductase 1 6 4 19 23 22 29 93 1 0 TOMM70A translocase of outer mitochondrial membrane 70 0 0 21 32 19 21 93 1 0 ADCK2 aarF domain containing kinase 2 0 0 24 26 17 19 86 1 0 MICU1 mitochondrial calcium uptake 1 0 0 21 21 18 19 79 1 0 HCCS holocytochrome c synthase 0 0 18 18 20 20 76 1 0 EFHA1 mitochondrial calcium uptake 2 0 0 21 20 20 14 75 1 0 TIMM13 translocase of inner mitochondrial membrane 13 0 0 18 18 24 14 74 1 0 ENDOG endonuclease G 0 0 20 26 12 13 71 1 0 ACAD9 acyl-CoA dehydrogenase family member 9 0 0 16 15 21 16 68 1 0 TMEM126B transmembrane protein 126B 0 0 12 12 21 22 67 1 0 TTC19 tetratricopeptide repeat domain 19 0 0 17 15 16 18 66 1 0 NDUFB10 NADH:ubiquinone oxidoreductase subunit B10 0 0 15 20 14 11 60 1 0 ATAD3B ATPase family, AAA domain containing 3B 0 0 20 21 8 9 58 1 0 CYCS cytochrome c, somatic 0 0 20 15 12 10 57 1 0 MTX1 metaxin 1 2 0 14 17 13 13 57 1 0 SLC25A24 solute carrier family 25 member 24 0 0 12 19 12 10 53 1 0 TIMM8A translocase of inner mitochondrial membrane 8A 0 0 8 11 15 16 50 1 0 OCIAD2 OCIA domain containing 2 0 0 11 8 14 12 45 1 0 SLC30A9 solute carrier family 30 member 9 0 0 14 14 10 6 44 1 0 COX5B cytochrome c oxidase subunit 5B 0 0 11 6 12 14 43 1 0 LETM1 leucine zipper and EF-hand containing transmembrane protein 1 0 0 12 13 8 10 43 1 0 ABCB8 ATP binding cassette subfamily B member 8 0 0 13 11 7 9 40 1 0 TIMMDC1 translocase of inner mitochondrial membrane domain containing 1 0 0 9 9 10 10 38 1 0 NDUFB9 NADH:ubiquinone oxidoreductase subunit B9 0 0 11 11 8 5 35 1 0 ECSIT ECSIT signalling integrator 0 0 8 8 10 8 34 1 0 APOO apolipoprotein O 0 0 12 10 5 6 33 1 0 FAM162A family with sequence similarity 162 member A 0 0 7 6 9 9 31 1 0 NDUFA12 NADH:ubiquinone oxidoreductase subunit A12 0 0 11 7 5 5 28 1 0 USP30 ubiquitin specific peptidase 30 0 0 8 5 5 5 23 1 0 TMEM186 transmembrane protein 186 0 0 5 6 6 5 22 1 0 CYC1 cytochrome c1 0 0 5 6 6 4 21 1 0 NDUFAF4 NADH:ubiquinone oxidoreductase complex assembly factor 4 0 0 5 4 6 5 20 1 0 IARS2 isoleucyl-tRNA synthetase 2, mitochondrial 4 4 20 30 20 15 85 0.99 0 NDUFS2 NADH:ubiquinone oxidoreductase core subunit S2 3 3 20 18 12 14 64 0.99 0 SCO1 SCO1, cytochrome c oxidase assembly protein 0 0 5 3 8 10 26 0.99 0 NDUFB5 NADH:ubiquinone oxidoreductase subunit B5 0 0 3 6 9 7 25 0.99 0 COX6C cytochrome c oxidase subunit 6C 0 0 7 6 3 3 19 0.99 0 ND4 mitochondrially encoded NADH:ubiquinone oxidoreductase core subunit 4 0 0 7 4 3 4 18 0.99 0 ATPAF1 ATP synthase mitochondrial F1 complex assembly factor 1 0 0 5 3 4 4 16 0.99 0 C9orf46 plasminogen receptor with a C-terminal lysine 0 0 4 4 3 3 14 0.99 0

NDUFV2 NADH:ubiquinone oxidoreductase core subunit V2 3 3 12 15 13 12 52 0.98 0 FAM136A family with sequence similarity 136 member A 0 0 3 3 5 3 14 0.98 0 UGGT1 UDP-glucose glycoprotein glucosyltransferase 1 0 0 6 8 2 5 21 0.97 0 NDUFV3 NADH:ubiquinone oxidoreductase subunit V3 0 0 4 5 2 3 14 0.96 0 ERP44 endoplasmic reticulum protein 44 0 0 2 3 4 3 12 0.96 0 SYNJ2BP-COX16 SYNJ2BP-COX16 readthrough 0 0 4 2 2 4 12 0.94 0 CHCHD6 coiled-coil-helix-coiled-coil-helix domain containing 6 0 0 2 2 3 4 11 0.93 0 RNH1 ribonuclease/angiogenin inhibitor 1 0 0 4 2 2 3 11 0.93 0 NDUFS1 NADH:ubiquinone oxidoreductase core subunit S1 6 5 18 24 16 21 79 0.92 0.01 AFG3L2 AFG3 like matrix AAA peptidase subunit 2 8 8 44 46 22 27 139 0.88 0.01 ATAD3A ATPase family, AAA domain containing 3A 16 16 72 54 42 52 220 0.85 0.01

G2:0007005: PitRchRnGUiRn RUganizatiRn 5-H6A-611105: 5HsSiUatRUy HOHctURn tUansSRUt C2580:6249: 0,B cRPSOHx G2:0006839: PitRchRnGUiaO tUansSRUt 5-H6A-1268020: 0itRchRnGUiaO SURtHin iPSRUt G2:0006123: PitRchRnGUiaO HOHctURn tUansSRUt, cytRchURPH c tR RxygHn C2580:2914: 5HsSiUatRUy chain cRPSOHx , (bHta subunit) PitRchRnGUiaO G2:0008053: PitRchRnGUiaO IusiRn G2:0017004: cytRchURPH cRPSOHx assHPbOy G2:0007585: UHsSiUatRUy gasHRus HxchangH G2:0006919: activatiRn RI cystHinH-tySH HnGRSHStiGasH activity invROvHG in aSRStRtic SURcHss G2:0009127: SuUinH nucOHRsiGH PRnRShRsShatH biRsynthHtic SURcHss

0 5 10 15 20 25 30 35 40 -ORg10(3)

Figure 2.12 GO enrichment analysis of OMA1 Metascape was used to generate the values and graph.

2.3.6.3 IMMP1L

IMMP1L identified 143 interactors of which 124 are annotated as mitochondrial (Table 2.8). GO enrichment analysis identified the classical pathways associated with the mitochondrial inner membrane such as ETC and mitochondrial transport (Figure 2.13). As mentioned above, IMMP1L is known to form a complex with IMMP2L in yeast (132). 89 of the 143 interactors overlapped with IMMP2L. IMMP1L has one known substrate in yeast, DIABLO which we identified for IMMP1L, but not IMMP2L. Further the two known substrates of IMMP2L are GPD2 and AIF which were both identified in our IMMP1L BioID. This suggests that IMMP1L and IMMP2L function similarly to their yeast counterparts by forming a complex. IMMP1L identified IMMP2L as a putative interactor, but further validation is needed to see direct interaction.

Table 2.8 Complete list of interactors identified by BioID for IMMP1L Interactors identified for IMMP1L are sorted by total peptide counts across two biological and two technical replicates and significance analysis of interactome (SAINT) using a Bayesian false discovery rate (BFDR) <1%.

IMMP1L Pool A Pool B Gene Name Full Name Top 2 Controls Tech #1 Tech #2 Tech #1 Tech #2 Total SAINT BFDR BirA* biotin ligase (E. coli) 2815 2807 1590 1668 1623 1593 6474 HTRA2 HtrA serine peptidase 2 3 2 7 9 5 6 27 LACTB lactamase beta 0 0 38 36 48 46 168 1 0 OMA1 OMA1 zinc metallopeptidase 0 0 17 21 28 23 89 1 0 PARL presenilin associated rhomboid like 0 0 6 4 7 8 25 1 0 IMMP1L inner mitochondrial membrane peptidase subunit 1 0 0 160 173 155 159 647 IMMP2L inner mitochondrial membrane peptidase subunit 2 0 0 82 78 72 69 301 1 0 YME1L1 YME1 like 1 ATPase 0 0 28 21 33 40 122 1 0 IMMT inner membrane mitochondrial protein 6 5 345 375 421 433 1574 1 0 COX15 cytochrome c oxidase assembly homolog COX15 0 0 172 165 186 192 715 1 0 CLPB ClpB homolog, mitochondrial AAA ATPase chaperonin 3 2 183 172 167 172 694 1 0 SLC25A13 solute carrier family 25 member 13 42 29 136 140 122 134 532 1 0 IARS2 isoleucyl-tRNA synthetase 2, mitochondrial 4 4 85 88 144 146 463 1 0 SLC25A12 solute carrier family 25 member 12 4 4 119 116 101 94 430 1 0 SAMM50 SAMM50 sorting and assembly machinery component 2 0 102 111 99 109 421 1 0 CKMT1B creatine kinase, mitochondrial 1B 0 0 98 94 84 84 360 1 0 LRPPRC leucine rich pentatricopeptide repeat containing 18 14 53 64 93 95 305 1 0 HAX1 HCLS1 associated protein X-1 5 4 63 66 86 87 302 1 0 IMMP2L inner mitochondrial membrane peptidase subunit 2 0 0 82 78 72 69 301 1 0 ATAD3A ATPase family, AAA domain containing 3A 16 16 53 49 77 81 260 1 0 GPD2 glycerol-3-phosphate dehydrogenase 2 4 3 57 51 71 75 254 1 0 MTX2 metaxin 2 0 0 53 52 75 62 242 1 0 ACAD9 acyl-CoA dehydrogenase family member 9 0 0 51 40 79 72 242 1 0 AK2 adenylate kinase 2 2 0 60 65 54 52 231 1 0 OPA1 OPA1, mitochondrial dynamin like GTPase 2 0 52 41 66 71 230 1 0 CPOX coproporphyrinogen oxidase 0 0 75 64 44 47 230 1 0 CHCHD3 coiled-coil-helix-coiled-coil-helix domain containing 3 0 0 43 41 73 70 227 1 0 CCDC58 coiled-coil domain containing 58 0 0 69 75 34 45 223 1 0 APOOL apolipoprotein O like 0 0 55 58 51 55 219 1 0 TTC19 tetratricopeptide repeat domain 19 0 0 55 66 37 47 205 1 0 COX4I1 cytochrome c oxidase subunit 4I1 4 3 53 63 35 44 195 1 0 LONP1 lon peptidase 1, mitochondrial 14 14 43 43 49 55 190 1 0 AIFM1 apoptosis inducing factor mitochondria associated 1 4 4 50 51 41 47 189 1 0 NDUFS3 NADH:ubiquinone oxidoreductase core subunit S3 10 7 34 41 51 55 181 1 0 COX5A cytochrome c oxidase subunit 5A 2 0 55 52 35 37 179 1 0 OCIAD1 OCIA domain containing 1 13 8 47 44 38 40 169 1 0 LACTB lactamase beta 0 0 38 36 48 46 168 1 0 ENDOG endonuclease G 0 0 50 46 34 32 162 1 0 NDUFS2 NADH:ubiquinone oxidoreductase core subunit S2 3 3 32 33 46 50 161 1 0 ECSIT ECSIT signalling integrator 0 0 29 28 52 45 154 1 0 DIABLO diablo IAP-binding mitochondrial protein 10 9 44 40 33 37 154 1 0 AFG3L2 AFG3 like matrix AAA peptidase subunit 2 8 8 38 29 45 36 148 1 0 NDUFA8 NADH:ubiquinone oxidoreductase subunit A8 0 0 30 34 44 34 142 1 0 NDUFS1 NADH:ubiquinone oxidoreductase core subunit S1 6 5 30 33 40 27 130 1 0 TOMM70A translocase of outer mitochondrial membrane 70 0 0 36 32 29 32 129 1 0 ADCK2 aarF domain containing kinase 2 0 0 19 21 39 43 122 1 0 YME1L1 YME1 like 1 ATPase 0 0 28 21 33 40 122 1 0 HCCS holocytochrome c synthase 0 0 28 29 30 33 120 1 0 C1orf212 small integral membrane protein 12 0 0 32 35 25 24 116 1 0 CYCS cytochrome c, somatic 0 0 32 35 20 22 109 1 0 TMEM126B transmembrane protein 126B 0 0 25 28 28 26 107 1 0 SELRC1 cytochrome c oxidase assembly factor 7 (putative) 0 0 34 34 18 21 107 1 0 MICU1 mitochondrial calcium uptake 1 0 0 23 23 29 31 106 1 0 LETM1 leucine zipper and EF-hand containing transmembrane protein 1 0 0 16 18 31 40 105 1 0 NDUFA13 NADH:ubiquinone oxidoreductase subunit A13 7 3 26 27 24 26 103 1 0 SLC25A24 solute carrier family 25 member 24 0 0 22 28 30 20 100 1 0 VARS2 valyl-tRNA synthetase 2, mitochondrial 0 0 16 9 36 38 99 1 0 TIMM13 translocase of inner mitochondrial membrane 13 0 0 27 33 16 19 95 1 0 SCO1 SCO1, cytochrome c oxidase assembly protein 0 0 21 21 34 19 95 1 0 TIMMDC1 translocase of inner mitochondrial membrane domain containing 1 0 0 14 18 25 33 90 1 0 OMA1 OMA1 zinc metallopeptidase 0 0 17 21 28 23 89 1 0 EFHA1 mitochondrial calcium uptake 2 0 0 16 14 26 27 83 1 0 CBR1 carbonyl reductase 1 6 4 22 19 19 21 81 1 0 BRP44 mitochondrial pyruvate carrier 2 0 0 22 22 17 19 80 1 0 USP30 ubiquitin specific peptidase 30 0 0 9 16 26 28 79 1 0 MDH2 malate dehydrogenase 2 0 0 26 27 15 9 77 1 0 SLC25A25 solute carrier family 25 member 25 0 0 12 13 24 26 75 1 0 FAM162A family with sequence similarity 162 member A 0 0 27 22 12 13 74 1 0 NDUFB10 NADH:ubiquinone oxidoreductase subunit B10 0 0 19 11 23 20 73 1 0 NDUFV3 NADH:ubiquinone oxidoreductase subunit V3 0 0 15 14 14 20 63 1 0 ATAD3B ATPase family, AAA domain containing 3B 0 0 12 16 16 19 63 1 0 APOO apolipoprotein O 0 0 21 18 11 11 61 1 0 TIMM8A translocase of inner mitochondrial membrane 8A 0 0 14 20 13 14 61 1 0 SCO2 SCO2, cytochrome c oxidase assembly protein 0 0 15 17 13 15 60 1 0

HSPE1 heat shock protein family E (Hsp10) member 1 0 0 15 16 15 13 59 1 0 NDUFV2 NADH:ubiquinone oxidoreductase core subunit V2 3 3 13 15 14 16 58 1 0 NDUFAF1 NADH:ubiquinone oxidoreductase complex assembly factor 1 0 0 9 6 24 19 58 1 0 COX5B cytochrome c oxidase subunit 5B 0 0 15 18 14 10 57 1 0 CYC1 cytochrome c1 0 0 8 19 13 15 55 1 0 C12orf73 chromosome 12 open reading frame 73 0 0 14 10 15 15 54 1 0 NDUFAF2 NADH:ubiquinone oxidoreductase complex assembly factor 2 0 0 15 11 13 14 53 1 0 NUDT19 nudix hydrolase 19 0 0 14 14 12 11 51 1 0 PYCR1 pyrroline-5-carboxylate reductase 1 0 0 11 13 12 11 47 1 0 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 0 0 8 16 10 13 47 1 0 PYCR2 pyrroline-5-carboxylate reductase 2 0 0 9 11 13 13 46 1 0 NDUFS8 NADH:ubiquinone oxidoreductase core subunit S8 0 0 8 11 14 12 45 1 0 TRIAP1 TP53 regulated inhibitor of apoptosis 1 0 0 10 13 12 10 45 1 0 GLS glutaminase 0 0 10 7 14 13 44 1 0 ATP5I ATP synthase membrane subunit e 0 0 14 12 10 8 44 1 0 BCS1L BCS1 homolog, ubiquinol-cytochrome c reductase complex chaperone 0 0 13 10 10 11 44 1 0 NDUFAF4 NADH:ubiquinone oxidoreductase complex assembly factor 4 0 0 11 6 10 16 43 1 0 EXOG exo/endonuclease G 0 0 10 9 12 10 41 1 0 NDUFB9 NADH:ubiquinone oxidoreductase subunit B9 0 0 13 7 10 10 40 1 0 GFM1 G elongation factor mitochondrial 1 0 0 7 13 8 11 39 1 0 PPA2 pyrophosphatase (inorganic) 2 0 0 5 8 13 13 39 1 0 ECHS1 enoyl-CoA hydratase, short chain 1 0 0 9 8 12 9 38 1 0 TMEM126A transmembrane protein 126A 0 0 11 8 7 11 37 1 0 TMEM242 transmembrane protein 242 0 0 11 13 7 6 37 1 0 NDUFB5 NADH:ubiquinone oxidoreductase subunit B5 0 0 11 11 9 6 37 1 0 COX6C cytochrome c oxidase subunit 6C 0 0 7 7 13 10 37 1 0 C19orf52 translocase of inner mitochondrial membrane 29 0 0 7 8 10 10 35 1 0 CHCHD6 coiled-coil-helix-coiled-coil-helix domain containing 6 0 0 8 9 9 9 35 1 0 MMAB metabolism of cobalamin associated B 0 0 10 8 6 9 33 1 0 SDHA succinate dehydrogenase complex flavoprotein subunit A 0 0 9 11 6 6 32 1 0 ACADSB acyl-CoA dehydrogenase short/branched chain 0 0 8 7 9 7 31 1 0 FAM136A family with sequence similarity 136 member A 0 0 9 8 7 6 30 1 0 TACO1 translational activator of cytochrome c oxidase I 0 0 8 7 6 8 29 1 0 ND5 mitochondrially encoded NADH:ubiquinone oxidoreductase core subunit 5 0 0 6 9 8 6 29 1 0 SLC30A9 solute carrier family 30 member 9 0 0 6 7 7 8 28 1 0 ATPAF1 ATP synthase mitochondrial F1 complex assembly factor 1 0 0 5 5 9 9 28 1 0 RCN1 reticulocalbin 1 0 0 7 8 6 7 28 1 0 TIMM17B translocase of inner mitochondrial membrane 17B 0 0 5 6 6 9 26 1 0 NDUFB8 NADH:ubiquinone oxidoreductase subunit B8 0 0 6 8 5 6 25 1 0 NDUFB3 NADH:ubiquinone oxidoreductase subunit B3 0 0 6 5 8 6 25 1 0 NDUFA2 NADH:ubiquinone oxidoreductase subunit A2 0 0 5 6 9 5 25 1 0 PARL presenilin associated rhomboid like 0 0 6 4 7 8 25 1 0 FAM82B regulator of microtubule dynamics 1 0 0 7 5 6 6 24 1 0 ND4 mitochondrially encoded NADH:ubiquinone oxidoreductase core subunit 4 0 0 5 5 8 6 24 1 0 CALU calumenin 0 0 9 5 6 4 24 1 0 CHCHD4 coiled-coil-helix-coiled-coil-helix domain containing 4 0 0 5 7 6 5 23 1 0 C9orf46 plasminogen receptor with a C-terminal lysine 0 0 6 4 6 6 22 1 0 PDIA4 protein disulfide isomerase family A member 4 2 2 11 11 15 10 47 0.99 0 NDUFA12 NADH:ubiquinone oxidoreductase subunit A12 0 0 3 4 9 10 26 0.99 0 RNH1 ribonuclease/angiogenin inhibitor 1 0 0 5 5 3 8 21 0.99 0 DCXR dicarbonyl and L-xylulose reductase 0 0 7 3 6 4 20 0.99 0 TFAM transcription factor A, mitochondrial 0 0 5 5 3 6 19 0.99 0 PCK2 phosphoenolpyruvate carboxykinase 2, mitochondrial 0 0 3 5 4 6 18 0.99 0 FECH ferrochelatase 0 0 4 6 4 3 17 0.99 0 SLIRP SRA stem-loop interacting RNA binding protein 0 0 5 5 3 3 16 0.99 0 COX1 prostaglandin-endoperoxide synthase 1 0 0 3 4 4 4 15 0.99 0 NDUFA5 NADH:ubiquinone oxidoreductase subunit A5 7 5 28 19 24 25 96 0.98 0 NDUFS5 NADH:ubiquinone oxidoreductase subunit S5 0 0 3 4 3 3 13 0.98 0 NDUFV1 NADH:ubiquinone oxidoreductase core subunit V1 4 3 12 14 19 16 61 0.97 0 NDUFS6 NADH:ubiquinone oxidoreductase subunit S6 0 0 2 4 4 4 14 0.97 0 THEM4 thioesterase superfamily member 4 0 0 5 2 3 6 16 0.96 0 C9orf64 chromosome 9 open reading frame 64 0 0 2 3 4 3 12 0.96 0 TIMM21 translocase of inner mitochondrial membrane 21 0 0 2 3 3 4 12 0.96 0 COX7A2L cytochrome c oxidase subunit 7A2 like 0 0 3 2 3 3 11 0.95 0 IDI1 isopentenyl-diphosphate delta isomerase 1 2 0 11 9 9 8 37 0.94 0 UGGT1 UDP-glucose glycoprotein glucosyltransferase 1 0 0 2 2 7 9 20 0.94 0 SDR39U1 short chain dehydrogenase/reductase family 39U member 1 0 0 2 2 8 8 20 0.94 0 TMX3 thioredoxin related transmembrane protein 3 0 0 2 2 4 6 14 0.94 0 ATP5F1 ATP synthase peripheral stalk-membrane subunit b 4 2 10 15 18 15 58 0.93 0.01 CCT7 chaperonin containing TCP1 subunit 7 89 84 233 222 253 260 968 0.91 0.01 NME4 NME/NM23 nucleoside diphosphate kinase 4 2 2 8 8 14 14 44 0.91 0.01 NDUFS7 NADH:ubiquinone oxidoreductase core subunit S7 2 2 8 8 12 9 37 0.91 0.01 SGTA small glutamine rich tetratricopeptide repeat containing alpha 0 0 2 2 2 3 9 0.9 0.01 PDIA3 protein disulfide isomerase family A member 3 9 7 26 22 32 32 112 0.88 0.01 PDCL3 phosducin like 3 6 6 17 19 21 21 78 0.86 0.01 KIAA1191 KIAA1191 4 3 18 21 10 17 66 0.84 0.01 ACOT1 acyl-CoA thioesterase 1 43 42 155 132 121 103 511 0.75 0.01

G2:0007005: PitRFhRnGUiRn RUgDnizDtiRn 5-H6A-611105: 5HsSiUDtRUy HOHFtURn tUDnsSRUt C2580:2920: 5HsSiUDtRUy FhDin FRPSOHx , (ODPEGD suEunit) PitRFhRnGUiDO G2:0006839: PitRFhRnGUiDO tUDnsSRUt G2:0007007: innHU PitRFhRnGUiDO PHPEUDnH RUgDnizDtiRn G2:0009060: DHUREiF UHsSiUDtiRn C2580:2914: 5HsSiUDtRUy FhDin FRPSOHx , (EHtD suEunit) PitRFhRnGUiDO G2:0006851: PitRFhRnGUiDO FDOFiuP iRn tUDnsPHPEUDnH tUDnsSRUt G2:0017004: FytRFhURPH FRPSOHx DssHPEOy C2580:2942: (Fsit FRPSOHx ((C6,7, 1D8)63, 1D8)A)1) G2:0008053: PitRFhRnGUiDO IusiRn G2:0034982: PitRFhRnGUiDO SURtHin SURFHssing G2:0015988: HnHUgy FRuSOHG SURtRn tUDnsPHPEUDnH tUDnsSRUt, DgDinst HOHFtURFhHPiFDO gUDGiHnt G2:0006979: UHsSRnsH tR RxiGDtivH stUHss G2:0009084: gOutDPinH IDPiOy DPinR DFiG EiRsynthHtiF SURFHss hsD00860: 3RUShyUin DnG FhORURShyOO PHtDEROisP G2:0070584: PitRFhRnGUiRn PRUShRgHnHsis G2:0042776: PitRFhRnGUiDO A73 synthHsis FRuSOHG SURtRn tUDnsSRUt 5-H6A-70263: GOuFRnHRgHnHsis G2:0006457: SURtHin IROGing

0 10 20 30 40 50 60 70 -ORg10(3)

Figure 2.13 GO enrichment analysis of IMMP1L Metascape was used to generate the values and graph.

2.3.6.4 IMMP2L

In total IMMP2L identified 243 interactors of which 202 are annotated as mitochondrial in GO (Table 2.9). As mentioned above 89 interactors overlap with IMMP1L. In contrast to IMMP1L, IMMP2L was unable to identify IMMP1L as an interactor. Known interactor AIF was identified as an interactor, but GPD2 was not. In addition to identifying the known IMS markers CLPB and OPA1, IMMP2L surprisingly identified 100 mitochondrial matrix proteins. While the IMMP1L interactome appears to suggest association with IMMP2L, the IMMP2L interactome appears to show a potential independent function from IMMP1L within the mitochondrial matrix. This is highlighted as the top pathway enriched within the IMMP2L dataset is mitochondrial gene expression. IMMP2L identified 29 components of the mitochondrial ribosome including the ribosome/inner membrane tethering protein OXA1L.

Table 2.9 Complete list of interactors identified by BioID for IMMP2L Interactors identified for IMMP2L are sorted by total peptide counts across two biological and two technical replicates and significance analysis of interactome (SAINT) using a Bayesian false discovery rate (BFDR) <1%.

IMMP2L Pool A Pool B Gene Name Full Name Top 2 Controls Tech #1 Tech #2 Tech #1 Tech #2 Total SAINT BFDR BirA* biotin ligase (E. coli) 2815 2807 2654 2977 3238 3332 12201 HTRA2 HtrA serine peptidase 2 3 2 0 0 0 0 0 LACTB lactamase beta 0 0 5 4 5 7 21 1 0 OMA1 OMA1 zinc metallopeptidase 0 0 5 3 4 4 16 0.99 0 PARL presenilin associated rhomboid like 0 0 2 2 0 0 4 IMMP1L inner mitochondrial membrane peptidase subunit 1 0 0 0 0 0 0 0 IMMP2L inner mitochondrial membrane peptidase subunit 2 0 0 120 132 131 145 528 YME1L1 YME1 like 1 ATPase 0 0 8 8 6 7 29 1 0 IARS2 isoleucyl-tRNA synthetase 2, mitochondrial 4 4 225 226 221 213 885 1 0 ACOT1 acyl-CoA thioesterase 1 43 42 163 157 172 181 673 1 0 LRPPRC leucine rich pentatricopeptide repeat containing 18 14 160 161 173 176 670 1 0 SHMT2 serine hydroxymethyltransferase 2 29 16 119 112 131 124 486 1 0 LETM1 leucine zipper and EF-hand containing transmembrane protein 1 0 0 117 120 123 123 483 1 0 NDUFS2 NADH:ubiquinone oxidoreductase core subunit S2 3 3 97 107 115 109 428 1 0 KIAA0664 clustered mitochondria homolog 14 14 98 103 108 110 419 1 0 NDUFS3 NADH:ubiquinone oxidoreductase core subunit S3 10 7 70 80 78 85 313 1 0 AFG3L2 AFG3 like matrix AAA peptidase subunit 2 8 8 77 76 79 79 311 1 0 USP30 ubiquitin specific peptidase 30 0 0 71 73 76 86 306 1 0 COX15 cytochrome c oxidase assembly homolog COX15 0 0 71 74 82 68 295 1 0 PTCD3 pentatricopeptide repeat domain 3 9 9 72 68 73 79 292 1 0 NDUFS1 NADH:ubiquinone oxidoreductase core subunit S1 6 5 60 64 76 80 280 1 0 MRPS31 mitochondrial ribosomal protein S31 10 8 63 61 67 68 259 1 0 IMMT inner membrane mitochondrial protein 6 5 59 71 59 67 256 1 0 NDUFA9 NADH:ubiquinone oxidoreductase subunit A9 19 16 56 56 66 62 240 1 0 CLPB ClpB homolog, mitochondrial AAA ATPase chaperonin 3 2 53 46 52 56 207 1 0 VPS13A vacuolar protein sorting 13 homolog A 2 0 46 57 50 43 196 1 0 TIMM44 translocase of inner mitochondrial membrane 44 8 6 43 48 50 44 185 1 0 DAP3 death associated protein 3 14 13 43 40 48 53 184 1 0 VARS2 valyl-tRNA synthetase 2, mitochondrial 0 0 34 36 40 44 154 1 0 MRPS9 mitochondrial ribosomal protein S9 9 8 35 27 39 41 142 1 0 NDUFAF4 NADH:ubiquinone oxidoreductase complex assembly factor 4 0 0 33 35 39 32 139 1 0 PYCR2 pyrroline-5-carboxylate reductase 2 0 0 32 35 34 34 135 1 0 NDUFA5 NADH:ubiquinone oxidoreductase subunit A5 7 5 30 32 37 36 135 1 0 MRPS22 mitochondrial ribosomal protein S22 5 4 28 36 35 36 135 1 0 NDUFV3 NADH:ubiquinone oxidoreductase subunit V3 0 0 36 29 34 35 134 1 0 BCS1L BCS1 homolog, ubiquinol-cytochrome c reductase complex chaperone 0 0 29 31 34 38 132 1 0 MTHFD1L methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1 like 5 5 37 35 28 31 131 1 0 SIRT2 sirtuin 2 0 0 33 29 26 38 126 1 0 PYCR1 pyrroline-5-carboxylate reductase 1 0 0 28 28 30 32 118 1 0 PREPL prolyl endopeptidase like 0 0 27 29 31 31 118 1 0 SLC30A9 solute carrier family 30 member 9 0 0 24 27 30 31 112 1 0 NDUFAF2 NADH:ubiquinone oxidoreductase complex assembly factor 2 0 0 27 28 31 23 109 1 0 GLS glutaminase 0 0 27 25 30 27 109 1 0 NDUFS8 NADH:ubiquinone oxidoreductase core subunit S8 0 0 26 26 29 26 107 1 0 CLPX caseinolytic mitochondrial matrix peptidase chaperone subunit 6 4 27 29 24 23 103 1 0 NDUFV2 NADH:ubiquinone oxidoreductase core subunit V2 3 3 25 24 28 24 101 1 0 GRSF1 G-rich RNA sequence binding factor 1 6 2 28 26 25 22 101 1 0 ATPAF1 ATP synthase mitochondrial F1 complex assembly factor 1 0 0 23 22 25 30 100 1 0 NME4 NME/NM23 nucleoside diphosphate kinase 4 2 2 25 23 30 22 100 1 0 ACAD9 acyl-CoA dehydrogenase family member 9 0 0 21 21 28 26 96 1 0 NDUFV1 NADH:ubiquinone oxidoreductase core subunit V1 4 3 26 21 25 23 95 1 0 NDUFA8 NADH:ubiquinone oxidoreductase subunit A8 0 0 19 28 22 25 94 1 0 SAMM50 SAMM50 sorting and assembly machinery component 2 0 27 21 21 24 93 1 0 MRPS35 mitochondrial ribosomal protein S35 4 3 20 22 26 24 92 1 0 GFM1 G elongation factor mitochondrial 1 0 0 27 19 27 18 91 1 0 PDIA4 protein disulfide isomerase family A member 4 2 2 22 25 21 23 91 1 0 KIAA0564 von Willebrand factor A domain containing 8 2 0 19 20 26 26 91 1 0 SLC25A12 solute carrier family 25 member 12 4 4 20 21 25 24 90 1 0 NOA1 nitric oxide associated 1 0 0 17 25 24 24 90 1 0 MDH2 malate dehydrogenase 2 0 0 22 19 22 26 89 1 0 NDUFA12 NADH:ubiquinone oxidoreductase subunit A12 0 0 19 21 23 23 86 1 0 MRPS26 mitochondrial ribosomal protein S26 0 0 20 24 20 21 85 1 0 PDPR pyruvate dehydrogenase phosphatase regulatory subunit 0 0 22 20 20 21 83 1 0 MRPS7 mitochondrial ribosomal protein S7 2 0 19 17 19 24 79 1 0 MRPS23 mitochondrial ribosomal protein S23 5 5 21 19 18 20 78 1 0 AIFM1 apoptosis inducing factor mitochondria associated 1 4 4 18 19 18 21 76 1 0 TACO1 translational activator of cytochrome c oxidase I 0 0 16 18 20 22 76 1 0 ECHS1 enoyl-CoA hydratase, short chain 1 0 0 16 17 21 21 75 1 0 POLRMT RNA polymerase mitochondrial 0 0 17 15 21 22 75 1 0 PNPT1 polyribonucleotide nucleotidyltransferase 1 0 0 18 21 17 16 72 1 0 MMAB metabolism of cobalamin associated B 0 0 15 18 18 18 69 1 0 CKMT1B creatine kinase, mitochondrial 1B 0 0 14 20 19 15 68 1 0 POLDIP2 DNA polymerase delta interacting protein 2 2 0 19 19 14 16 68 1 0 NUDT19 nudix hydrolase 19 0 0 11 16 25 15 67 1 0

MRPS24 mitochondrial ribosomal protein S24 0 0 14 18 19 15 66 1 0 GOPC golgi associated PDZ and coiled-coil motif containing 3 2 17 13 18 18 66 1 0 NDUFS7 NADH:ubiquinone oxidoreductase core subunit S7 2 2 20 16 14 13 63 1 0 QRSL1 QRSL1, glutaminyl-tRNA amidotransferase subunit A 0 0 13 16 15 17 61 1 0 MRPL45 mitochondrial ribosomal protein L45 4 0 14 16 13 17 60 1 0 TTC19 tetratricopeptide repeat domain 19 0 0 14 18 13 13 58 1 0 LARS2 leucyl-tRNA synthetase 2, mitochondrial 2 0 12 15 13 17 57 1 0 SDHA succinate dehydrogenase complex flavoprotein subunit A 0 0 13 14 14 15 56 1 0 GTPBP10 GTP binding protein 10 0 0 12 17 16 11 56 1 0 C17orf80 chromosome 17 open reading frame 80 0 0 14 15 13 12 54 1 0 PPA2 pyrophosphatase (inorganic) 2 0 0 13 12 15 13 53 1 0 PDE12 phosphodiesterase 12 0 0 12 11 17 11 51 1 0 NFS1 NFS1, cysteine desulfurase 0 0 8 11 15 17 51 1 0 ERAL1 Era like 12S mitochondrial rRNA chaperone 1 0 0 15 12 10 11 48 1 0 MTX2 metaxin 2 0 0 13 7 13 14 47 1 0 HSPE1 heat shock protein family E (Hsp10) member 1 0 0 12 12 12 11 47 1 0 IBA57 IBA57, iron-sulfur cluster assembly 0 0 12 12 11 12 47 1 0 CPOX coproporphyrinogen oxidase 0 0 11 10 14 11 46 1 0 OGDH oxoglutarate dehydrogenase 0 0 9 14 10 13 46 1 0 MRPS25 mitochondrial ribosomal protein S25 0 0 10 13 10 11 44 1 0 PTPMT1 protein tyrosine phosphatase, mitochondrial 1 0 0 7 12 12 13 44 1 0 NDUFA2 NADH:ubiquinone oxidoreductase subunit A2 0 0 8 11 11 12 42 1 0 GUF1 GUF1 homolog, GTPase 0 0 11 10 10 11 42 1 0 TFAM transcription factor A, mitochondrial 0 0 10 11 11 9 41 1 0 TEFM transcription elongation factor, mitochondrial 0 0 9 11 9 11 40 1 0 MTIF2 mitochondrial translational initiation factor 2 0 0 6 11 14 9 40 1 0 ADCK2 aarF domain containing kinase 2 0 0 9 10 10 10 39 1 0 ACADSB acyl-CoA dehydrogenase short/branched chain 0 0 10 9 9 11 39 1 0 ABHD10 abhydrolase domain containing 10 0 0 10 7 13 9 39 1 0 APOOL apolipoprotein O like 0 0 10 12 10 6 38 1 0 MRPL46 mitochondrial ribosomal protein L46 0 0 10 10 7 11 38 1 0 EXD2 exonuclease 3'-5' domain containing 2 0 0 11 7 9 10 37 1 0 RTN4IP1 reticulon 4 interacting protein 1 0 0 7 7 10 13 37 1 0 ECSIT ECSIT signalling integrator 0 0 8 11 10 7 36 1 0 NDUFS4 NADH:ubiquinone oxidoreductase subunit S4 0 0 11 6 11 7 35 1 0 NDUFAF3 NADH:ubiquinone oxidoreductase complex assembly factor 3 0 0 8 9 8 10 35 1 0 CARS2 cysteinyl-tRNA synthetase 2, mitochondrial 0 0 11 7 6 11 35 1 0 FECH ferrochelatase 0 0 10 5 9 10 34 1 0 SLIRP SRA stem-loop interacting RNA binding protein 0 0 6 7 11 10 34 1 0 ALDH2 aldehyde dehydrogenase 2 family member 0 0 10 9 8 7 34 1 0 HARS2 histidyl-tRNA synthetase 2, mitochondrial 0 0 4 12 9 9 34 1 0 MRPL21 mitochondrial ribosomal protein L21 0 0 11 13 6 4 34 1 0 MRS2 magnesium transporter MRS2 0 0 10 7 7 10 34 1 0 TMEM126B transmembrane protein 126B 0 0 12 6 8 7 33 1 0 NDUFS6 NADH:ubiquinone oxidoreductase subunit S6 0 0 6 9 12 6 33 1 0 PITRM1 pitrilysin metallopeptidase 1 0 0 7 8 10 8 33 1 0 POLG DNA polymerase gamma, catalytic subunit 0 0 7 9 9 8 33 1 0 THEM4 thioesterase superfamily member 4 0 0 7 8 8 9 32 1 0 CALU calumenin 0 0 4 9 7 11 31 1 0 SDHB succinate dehydrogenase complex iron sulfur subunit B 0 0 7 9 7 8 31 1 0 MTPAP mitochondrial poly(A) polymerase 0 0 6 9 10 5 30 1 0 YME1L1 YME1 like 1 ATPase 0 0 8 8 6 7 29 1 0 CHCHD3 coiled-coil-helix-coiled-coil-helix domain containing 3 0 0 7 9 5 7 28 1 0 NDUFA6 NADH:ubiquinone oxidoreductase subunit A6 0 0 6 6 7 9 28 1 0 PET112 glutamyl-tRNA amidotransferase subunit B 0 0 6 8 7 7 28 1 0 CCDC58 coiled-coil domain containing 58 0 0 6 8 7 6 27 1 0 TOMM70A translocase of outer mitochondrial membrane 70 0 0 4 8 10 5 27 1 0 SELRC1 cytochrome c oxidase assembly factor 7 (putative) 0 0 6 5 9 7 27 1 0 COX5B cytochrome c oxidase subunit 5B 0 0 5 8 7 7 27 1 0 MRPS6 mitochondrial ribosomal protein S6 0 0 6 6 9 5 26 1 0 EARS2 glutamyl-tRNA synthetase 2, mitochondrial 0 0 7 7 7 5 26 1 0 RAP1A RAP1A, member of RAS oncogene family 0 0 6 5 7 7 25 1 0 MRPS16 mitochondrial ribosomal protein S16 0 0 7 7 6 5 25 1 0 OXA1L OXA1L, mitochondrial inner membrane protein 0 0 7 6 6 5 24 1 0 PIGT phosphatidylinositol glycan anchor biosynthesis class T 0 0 6 6 5 7 24 1 0 MRPS11 mitochondrial ribosomal protein S11 0 0 4 4 6 10 24 1 0 AARS2 alanyl-tRNA synthetase 2, mitochondrial 0 0 4 8 4 8 24 1 0 MICU1 mitochondrial calcium uptake 1 0 0 4 5 7 7 23 1 0 ERP44 endoplasmic reticulum protein 44 0 0 5 7 6 5 23 1 0 TMEM109 transmembrane protein 109 0 0 7 4 7 5 23 1 0 COQ5 coenzyme Q5, methyltransferase 0 0 5 7 5 5 22 1 0 LACTB lactamase beta 0 0 5 4 5 7 21 1 0 C20orf7 NADH:ubiquinone oxidoreductase complex assembly factor 5 0 0 4 5 6 6 21 1 0 DHTKD1 dehydrogenase E1 and transketolase domain containing 1 0 0 4 6 4 6 20 1 0 KIAA0391 KIAA0391 0 0 5 4 5 6 20 1 0 SIRT1 sirtuin 1 0 0 5 4 6 5 20 1 0 NUCB2 nucleobindin 2 0 0 4 6 6 4 20 1 0

GTPBP3 GTP binding protein 3, mitochondrial 0 0 4 5 4 6 19 1 0 GLRX5 glutaredoxin 5 0 0 5 4 5 5 19 1 0 DCXR dicarbonyl and L-xylulose reductase 0 0 4 5 5 4 18 1 0 TMX3 thioredoxin related transmembrane protein 3 0 0 4 5 4 5 18 1 0 PRKCA protein kinase C alpha 0 0 4 5 5 4 18 1 0 MRPL15 mitochondrial ribosomal protein L15 0 0 3 5 5 5 18 1 0 GRPEL1 GrpE like 1, mitochondrial 0 0 4 4 6 4 18 1 0 MRPL40 mitochondrial ribosomal protein L40 0 0 5 4 4 5 18 1 0 CAPN2 calpain 2 0 0 5 4 5 4 18 1 0 DHX40 DEAH-box helicase 40 0 0 4 4 4 5 17 1 0 NT5DC2 5'-nucleotidase domain containing 2 7 7 33 27 36 22 118 0.99 0 MRPS5 mitochondrial ribosomal protein S5 5 3 18 15 18 19 70 0.99 0 COX4I1 cytochrome c oxidase subunit 4I1 4 3 19 17 18 13 67 0.99 0 DLST dihydrolipoamide S-succinyltransferase 3 2 14 11 13 15 53 0.99 0 TBRG4 transforming growth factor beta regulator 4 2 0 14 11 15 12 52 0.99 0 FASTKD2 FAST kinase domains 2 2 0 14 11 13 11 49 0.99 0 C2orf56 NADH:ubiquinone oxidoreductase complex assembly factor 7 0 0 3 5 8 6 22 0.99 0 ATPAF2 ATP synthase mitochondrial F1 complex assembly factor 2 0 0 3 3 8 7 21 0.99 0 GCDH glutaryl-CoA dehydrogenase 0 0 3 5 7 6 21 0.99 0 TIMM13 translocase of inner mitochondrial membrane 13 0 0 6 3 5 6 20 0.99 0 NDUFAF1 NADH:ubiquinone oxidoreductase complex assembly factor 1 0 0 5 3 6 6 20 0.99 0 HINT2 histidine triad nucleotide binding protein 2 0 0 5 3 6 6 20 0.99 0 PCK2 phosphoenolpyruvate carboxykinase 2, mitochondrial 0 0 6 3 5 5 19 0.99 0 UGGT1 UDP-glucose glycoprotein glucosyltransferase 1 0 0 6 3 5 5 19 0.99 0 SUPV3L1 Suv3 like RNA helicase 0 0 6 3 3 7 19 0.99 0 ALDH1L2 aldehyde dehydrogenase 1 family member L2 0 0 5 3 4 7 19 0.99 0 MAP2K3 mitogen-activated protein kinase kinase 3 0 0 7 3 4 4 18 0.99 0 ACSS1 acyl-CoA synthetase short chain family member 1 0 0 4 3 6 5 18 0.99 0 ATP5D ATP synthase F1 subunit delta 0 0 3 3 7 5 18 0.99 0 ADCK4 coenzyme Q8B 0 0 5 3 5 5 18 0.99 0 CALR calreticulin 0 0 6 5 3 3 17 0.99 0 SUCLG2 succinate-CoA ligase GDP-forming beta subunit 0 0 5 3 4 5 17 0.99 0 MRPS36 mitochondrial ribosomal protein S36 0 0 5 3 4 5 17 0.99 0 BCL2L13 BCL2 like 13 0 0 5 3 3 6 17 0.99 0 ACADM acyl-CoA dehydrogenase medium chain 0 0 3 5 5 4 17 0.99 0 OMA1 OMA1 zinc metallopeptidase 0 0 5 3 4 4 16 0.99 0 EFHA1 mitochondrial calcium uptake 2 0 0 3 4 4 5 16 0.99 0 RCN1 reticulocalbin 1 0 0 4 5 4 3 16 0.99 0 FOXRED1 FAD dependent oxidoreductase domain containing 1 0 0 3 4 4 5 16 0.99 0 BCKDHA branched chain keto acid dehydrogenase E1, alpha polypeptide 0 0 3 5 4 4 16 0.99 0 RNH1 ribonuclease/angiogenin inhibitor 1 0 0 3 3 5 4 15 0.99 0 SLC25A19 solute carrier family 25 member 19 0 0 4 4 4 3 15 0.99 0 RAC1 Rac family small GTPase 1 0 0 4 4 4 3 15 0.99 0 MRPL10 mitochondrial ribosomal protein L10 0 0 3 4 4 4 15 0.99 0 TMLHE trimethyllysine hydroxylase, epsilon 0 0 4 5 3 3 15 0.99 0 NRD1 nardilysin convertase 0 0 3 3 5 4 15 0.99 0 C10orf2 twinkle mtDNA helicase 0 0 4 4 4 3 15 0.99 0 MRPL50 mitochondrial ribosomal protein L50 0 0 5 3 4 3 15 0.99 0 CEPT1 choline/ethanolamine phosphotransferase 1 0 0 3 3 4 4 14 0.99 0 MRPS27 mitochondrial ribosomal protein S27 9 5 22 21 23 23 89 0.98 0 MRPS34 mitochondrial ribosomal protein S34 4 4 17 14 22 16 69 0.98 0 MRPS10 mitochondrial ribosomal protein S10 2 2 15 15 9 16 55 0.98 0 FDFT1 farnesyl-diphosphate farnesyltransferase 1 0 0 3 5 3 3 14 0.98 0 CISD2 CDGSH iron sulfur domain 2 0 0 3 3 3 3 12 0.98 0 ME2 malic enzyme 2 2 0 8 12 17 13 50 0.97 0 TIMMDC1 translocase of inner mitochondrial membrane domain containing 1 0 0 4 7 8 2 21 0.97 0 SGPL1 sphingosine-1-phosphate lyase 1 0 0 7 4 2 4 17 0.97 0 SLC27A4 solute carrier family 27 member 4 0 0 2 4 6 4 16 0.97 0 CYC1 cytochrome c1 0 0 4 3 6 2 15 0.97 0 MRPL55 mitochondrial ribosomal protein L55 0 0 2 4 4 4 14 0.97 0 MRPS18C mitochondrial ribosomal protein S18C 0 0 2 4 4 4 14 0.97 0 CPS1 carbamoyl-phosphate synthase 1 0 0 3 5 4 2 14 0.96 0 UBR5 ubiquitin protein ligase E3 component n-recognin 5 0 0 4 2 4 3 13 0.96 0 MRPL17 mitochondrial ribosomal protein L17 0 0 3 3 5 2 13 0.96 0 TBCD tubulin folding cofactor D 0 0 2 4 4 3 13 0.96 0 GCLM glutamate-cysteine ligase modifier subunit 0 0 2 3 4 3 12 0.96 0 CISD1 CDGSH iron sulfur domain 1 0 0 3 3 3 2 11 0.95 0 BIRC6 baculoviral IAP repeat containing 6 8 6 24 25 23 22 94 0.94 0 NIPSNAP1 nipsnap homolog 1 2 0 8 10 8 14 40 0.94 0 MRPL48 mitochondrial ribosomal protein L48 0 0 8 2 2 4 16 0.94 0 IDH3A isocitrate dehydrogenase 3 (NAD(+)) alpha 0 0 2 5 4 2 13 0.94 0 HLA-A major histocompatibility complex, class I, A 0 0 2 2 3 5 12 0.94 0 RNMTL1 mitochondrial rRNA methyltransferase 3 0 0 4 2 4 2 12 0.94 0 TIMM21 translocase of inner mitochondrial membrane 21 0 0 2 4 2 3 11 0.93 0 ALG6 ALG6, alpha-1,3-glucosyltransferase 0 0 2 2 4 3 11 0.93 0 AGPAT1 1-acylglycerol-3-phosphate O-acyltransferase 1 0 0 2 2 4 3 11 0.93 0 GATC glutamyl-tRNA amidotransferase subunit C 0 0 4 2 2 3 11 0.93 0 CPD carboxypeptidase D 8 5 22 25 24 19 90 0.93 0.01 ATP5F1 ATP synthase peripheral stalk-membrane subunit b 4 2 11 14 11 11 47 0.93 0.01

ND4 mitochondrially encoded NADH:ubiquinone oxidoreductase core subunit 4 0 0 2 3 2 3 10 0.93 0.01 SPTLC1 serine palmitoyltransferase long chain base subunit 1 0 0 3 2 3 2 10 0.93 0.01 COX5A cytochrome c oxidase subunit 5A 2 0 10 6 12 10 38 0.91 0.01 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 2 0 10 9 12 6 37 0.91 0.01 ACADVL acyl-CoA dehydrogenase very long chain 4 0 14 16 15 17 62 0.9 0.01 AASS aminoadipate-semialdehyde synthase 2 0 9 7 8 9 33 0.9 0.01 ETFA electron transfer flavoprotein subunit alpha 14 5 38 34 41 36 149 0.88 0.01 FASTKD5 FAST kinase domains 5 3 0 12 15 9 12 48 0.88 0.01 OPA1 OPA1, mitochondrial dynamin like GTPase 2 0 10 9 8 6 33 0.88 0.01 P4HB prolyl 4-hydroxylase subunit beta 3 3 14 15 10 10 49 0.86 0.01 ATAD3A ATPase family, AAA domain containing 3A 16 16 51 50 42 48 191 0.85 0.01 HSD17B4 hydroxysteroid 17-beta dehydrogenase 4 6 6 20 22 17 18 77 0.83 0.01 MRPS2 mitochondrial ribosomal protein S2 6 4 16 14 19 20 69 0.83 0.01 AK2 adenylate kinase 2 2 0 8 5 8 10 31 0.83 0.01 SLC25A4 solute carrier family 25 member 4 5 4 14 16 13 15 58 0.8 0.01 FAF2 Fas associated factor family member 2 2 0 5 7 6 13 31 0.79 0.01 CBR1 carbonyl reductase 1 6 4 15 17 18 14 64 0.76 0.01 CORO7-PAM16 CORO7-PAM16 readthrough 0 0 13 15 19 0 47 0.75 0.01 PPIF peptidylprolyl isomerase F 0 0 13 12 11 0 36 0.75 0.01 TOMM20 translocase of outer mitochondrial membrane 20 0 0 12 0 8 13 33 0.75 0.01

G2:0140053: PLtoFhoQGrLDO gHQH HxprHssLoQ G2:0007005: PLtoFhoQGrLoQ orgDQLzDtLoQ 5-H6A-1428517: 7hH FLtrLF DFLG (7CA) FyFOH DQG rHspLrDtory HOHFtroQ trDQsport G2:0009060: DHroELF rHspLrDtLoQ G2:0000959: PLtoFhoQGrLDO 51A PHtDEoOLF proFHss C2580:2948: 5HspLrDtory FhDLQ FoPpOHx , (LQFoPpOHtH LQtHrPHGLDtH), PLtoFhoQGrLDO G2:1990542: PLtoFhoQGrLDO trDQsPHPErDQH trDQsport G2:0006520: FHOOuODr DPLQo DFLG PHtDEoOLF proFHss C2580:2904: 5HspLrDtory FhDLQ FoPpOHx , (LQtHrPHGLDtH 9,,/650ND), PLtoFhoQGrLDO G2:0051186: FoIDFtor PHtDEoOLF proFHss G2:0007007: LQQHr PLtoFhoQGrLDO PHPErDQH orgDQLzDtLoQ G2:0043039: t51A DPLQoDFyODtLoQ G2:0016054: orgDQLF DFLG FDtDEoOLF proFHss G2:0006851: PLtoFhoQGrLDO FDOFLuP LoQ trDQsPHPErDQH trDQsport G2:0043461: protoQ-trDQsportLQg A73 syQthDsH FoPpOHx DssHPEOy G2:0033014: tHtrDpyrroOH ELosyQthHtLF proFHss C2580:2938: (FsLt FoPpOHx ((C6,7, 1D8)63, 72020) C2580:6959: GA7B-GA7C-456/1 FoPpOHx G2:0090407: orgDQophosphDtH ELosyQthHtLF proFHss G2:0008053: PLtoFhoQGrLDO IusLoQ

0 10 20 30 40 50 60 70 -Oog10(3)

Figure 2.14 GO enrichment analysis of IMMP2L Metascape was used to generate the values and graph.

We then performed IP-MS on both IMMP1L (Table 2.10) and IMMP2L (Table 2.11) and showed similar levels of overlap between their interactors with 69 of 97 for IMMP1L and 69 of 157 for IMMP2L. There were 24 interactions validated that were also detected with the BioID approach.

Table 2.10 IP-MS interactor list for IMMP1L Interactors identified for IMMP1L are sorted by total peptide counts across the top three out of four runs with a BFDR of <1%.

IMMP1L Gene Name Top 2 Controls Run #1 Run #2 Run #3 Total SAINT BFDR BirA 10691 10573 2517 2498 2474 7489 HTRA2 0 0 0 0 0 0 IMMP1L 0 0 244 242 240 726 IMMP2L 0 0 0 0 0 0

HSPD1 56 55 974 955 904 2833 1 0 IARS2 12 8 243 242 240 725 1 0 MDN1 29 23 97 86 76 259 1 0 VARS2 0 0 33 30 29 92 1 0 UBAP2L 8 6 31 29 29 89 1 0 KIF5C 2 2 29 25 23 77 1 0 CLPP 6 4 20 20 18 58 1 0 EARS2 0 0 19 18 14 51 1 0 ACAA1 0 0 15 14 13 42 1 0 UPF1 3 2 15 13 12 40 1 0 PPOX 0 0 15 13 11 39 1 0 RPAP3 0 0 15 12 11 38 1 0 NUP214 0 0 12 11 11 34 1 0 OSTF1 0 0 13 11 9 33 1 0 RNASEH2A 0 0 12 9 9 30 1 0 TMLHE 0 0 9 9 8 26 1 0 ILK 0 0 10 10 5 25 1 0 SARS2 0 0 10 9 6 25 1 0 CPS1 0 0 9 8 7 24 1 0 ARF5 0 0 9 8 7 24 1 0 POLR2C 0 0 8 8 7 23 1 0 NUP37 0 0 9 7 7 23 1 0 MRPL37 0 0 8 8 7 23 1 0 QRICH1 0 0 9 8 6 23 1 0 POLDIP2 0 0 8 8 6 22 1 0 CAMK2G 0 0 10 7 4 21 1 0 ZER1 0 0 7 7 6 20 1 0 PRDX3 0 0 7 6 6 19 1 0 VPS16 0 0 6 6 6 18 1 0 AUP1 0 0 7 6 5 18 1 0 EIF5 0 0 6 6 6 18 1 0 GCAT 0 0 8 6 4 18 1 0 DOCK7 0 0 6 6 5 17 1 0 VPS18 0 0 7 5 5 17 1 0 COMMD4 0 0 8 5 4 17 1 0 FXR1 0 0 6 5 5 16 1 0 TBK1 0 0 6 5 5 16 1 0 MTMR9 0 0 7 5 4 16 1 0 PSPC1 0 0 6 5 5 16 1 0 SELO 0 0 6 6 4 16 1 0 PEG10 0 0 6 6 4 16 1 0 POLR2L 0 0 5 5 5 15 1 0 PIH1D1 0 0 6 5 4 15 1 0 CBR3 0 0 6 5 4 15 1 0 POLA2 0 0 6 5 4 15 1 0

GPN3 0 0 5 5 4 14 1 0 PDDC1 0 0 5 5 4 14 1 0 PPP4C 0 0 5 5 4 14 1 0 TCEB2 0 0 6 4 4 14 1 0 CPSF3L 0 0 5 5 4 14 1 0 FLAD1 0 0 6 4 4 14 1 0 TTC19 0 0 5 4 4 13 1 0 POLG 0 0 5 4 4 13 1 0 MAGED1 0 0 5 4 4 13 1 0 NT5DC2 4 0 26 24 23 73 0.99 0 DNAJC7 6 5 23 20 19 62 0.99 0 NUP62 2 0 12 12 10 34 0.99 0 EIF1AY 0 0 9 7 3 19 0.99 0 DNAJC11 0 0 7 5 3 15 0.99 0 GEMIN7 0 0 6 5 3 14 0.99 0 POLR2A 0 0 6 4 3 13 0.99 0 ERAL1 0 0 5 5 3 13 0.99 0 ABCA1 0 0 6 4 3 13 0.99 0 ESRRA 0 0 5 4 3 12 0.99 0 CLINT1 0 0 5 4 3 12 0.99 0 TOMM70A 0 0 5 4 3 12 0.99 0 DLST 0 0 5 4 3 12 0.99 0 NR2F2 0 0 5 4 3 12 0.99 0 NUP88 0 0 5 4 3 12 0.99 0 DYNLT1 0 0 5 3 3 11 0.99 0 PPP1R12A 0 0 4 4 3 11 0.99 0 EIF4G3 0 0 4 3 3 10 0.99 0 CAPN7 0 0 4 3 3 10 0.99 0 SEC16A 0 0 4 3 3 10 0.99 0 WDHD1 0 0 4 3 3 10 0.99 0 ANK3 0 0 4 3 3 10 0.99 0 ANAPC7 0 0 4 3 3 10 0.99 0 DOPEY2 0 0 4 3 3 10 0.99 0 LRCH2 0 0 3 3 3 9 0.98 0 MYL12B 0 0 7 6 2 15 0.97 0 CUL4B 0 0 6 3 2 11 0.96 0.01 MSTO1 0 0 5 4 2 11 0.96 0.01 HAUS5 0 0 5 3 2 10 0.96 0.01 UTRN 0 0 4 3 2 9 0.96 0.01 FAM203B 0 0 4 3 2 9 0.96 0.01 WDR62 0 0 4 3 2 9 0.96 0.01 TRIM33 2 0 13 9 8 30 0.95 0.01 CSNK2A1 0 0 3 3 2 8 0.95 0.01 PRKAG1 0 0 3 3 2 8 0.95 0.01 RINT1 0 0 3 3 2 8 0.95 0.01 PRMT3 7 5 20 20 18 58 0.93 0.01 TONSL 0 0 5 2 2 9 0.93 0.01 POLR1D 0 0 4 2 2 8 0.93 0.01 HAUS6 0 0 3 2 2 7 0.92 0.01 ATXN2L 0 0 3 2 2 7 0.92 0.01 URI1 0 0 3 2 2 7 0.92 0.01 PDCD5 0 0 3 2 2 7 0.92 0.01

Table 2.11 IP-MS interactor list for IMMP2L Interactors identified for IMMP2L are sorted by total peptide counts across the top three out of four runs with a BFDR of <1%.

IMMP2L Gene Name Top 2 Controls Run #1 Run #2 Run #3 Total SAINT BFDR BirA 10691 10573 3443 3413 3383 10239 HTRA2 0 0 0 0 0 0 IMMP1L 0 0 0 0 0 0 IMMP2L 0 0 232 211 198 641

HSPA9 59 58 333 313 171 817 1 0 HSPD1 56 55 255 247 200 702 1 0 C1QBP 42 38 208 200 174 582 1 0 UBR4 28 25 201 195 153 549 1 0 IARS2 12 8 173 171 158 502 1 0 UBAP2L 8 6 43 43 37 123 1 0 ANP32E 9 8 46 37 34 117 1 0 SMS 9 9 38 34 32 104 1 0 PRMT3 7 5 26 26 26 78 1 0 BTAF1 5 3 26 21 19 66 1 0 MRPL4 3 0 22 21 20 63 1 0 VARS2 0 0 21 21 20 62 1 0 RPS27 0 0 20 20 18 58 1 0 RPTOR 5 4 21 18 18 57 1 0 LAS1L 5 3 22 17 17 56 1 0 NUP214 0 0 18 18 16 52 1 0 ZZEF1 0 0 25 16 9 50 1 0 RPAP3 0 0 19 18 12 49 1 0 PPOX 0 0 18 17 9 44 1 0 NUP62 2 0 17 14 13 44 1 0 YTHDC2 3 2 15 14 14 43 1 0 CDK5RAP1 0 0 15 14 12 41 1 0 EARS2 0 0 13 13 9 35 1 0 ACAA1 0 0 12 11 9 32 1 0 FXR1 0 0 11 11 10 32 1 0 ARF5 0 0 11 10 10 31 1 0 OSTF1 0 0 11 10 9 30 1 0 MRPL41 0 0 11 10 9 30 1 0 ESRRA 0 0 12 9 8 29 1 0 WRNIP1 0 0 11 10 7 28 1 0 MRPL47 0 0 10 9 9 28 1 0 KBTBD6 0 0 11 10 7 28 1 0 MRPL37 0 0 13 8 6 27 1 0 VPS18 0 0 10 9 8 27 1 0 LSG1 0 0 11 10 6 27 1 0 RNASEH2A 0 0 11 9 6 26 1 0 VPS16 0 0 9 9 8 26 1 0 NUP88 0 0 11 10 5 26 1 0 MRPS26 0 0 9 9 8 26 1 0 NEDD8 0 0 10 8 8 26 1 0 PRDX3 0 0 10 8 7 25 1 0 EIF1AY 0 0 9 8 8 25 1 0 GPN3 0 0 9 8 7 24 1 0 CPS1 0 0 8 8 7 23 1 0 DOCK7 0 0 10 9 4 23 1 0 NOA1 0 0 9 7 7 23 1 0 ZMYM4 0 0 9 8 5 22 1 0 QRICH1 0 0 9 6 6 21 1 0

MRPS35 0 0 8 8 5 21 1 0 NUP37 0 0 7 7 6 20 1 0 WDHD1 0 0 7 7 6 20 1 0 ORC2 0 0 8 8 4 20 1 0 POLR2C 0 0 7 6 6 19 1 0 ERAL1 0 0 9 5 5 19 1 0 FAM203B 0 0 8 6 5 19 1 0 MASTL 0 0 9 5 5 19 1 0 MRPL24 0 0 7 6 6 19 1 0 ANKRD52 0 0 8 6 4 18 1 0 PPP4C 0 0 6 6 5 17 1 0 GEMIN7 0 0 6 6 5 17 1 0 EXOC3 0 0 7 5 5 17 1 0 SIRT1 0 0 7 5 5 17 1 0 POLDIP2 0 0 8 4 4 16 1 0 PDDC1 0 0 6 5 5 16 1 0 PPP1R12A 0 0 6 5 5 16 1 0 CUL4B 0 0 6 5 5 16 1 0 MSTO1 0 0 6 6 4 16 1 0 CAMK2G 0 0 6 5 4 15 1 0 GCAT 0 0 5 5 5 15 1 0 ANKLE2 0 0 6 5 4 15 1 0 AUP1 0 0 6 4 4 14 1 0 SELO 0 0 6 4 4 14 1 0 RPL35A 0 0 6 4 4 14 1 0 MED16 0 0 5 5 4 14 1 0 INPP5B 0 0 5 5 4 14 1 0 PDPK1 0 0 5 4 4 13 1 0 RRM1 11 9 34 32 30 96 0.99 0 GRSF1 7 3 31 23 20 74 0.99 0 WAPAL 5 3 18 16 15 49 0.99 0 CHAMP1 4 3 16 15 14 45 0.99 0 UPF1 3 2 16 12 11 39 0.99 0 ANKHD1-EIF4EBP3 2 2 13 11 10 34 0.99 0 BEND3 0 0 12 9 3 24 0.99 0 DCLK1 0 0 8 7 3 18 0.99 0 EIF4G3 0 0 8 5 3 16 0.99 0 HEATR3 0 0 6 6 3 15 0.99 0 EIF5 0 0 6 5 3 14 0.99 0 TBK1 0 0 6 5 3 14 0.99 0 VPS26B 0 0 6 5 3 14 0.99 0 CPSF3L 0 0 6 4 3 13 0.99 0 HAUS6 0 0 6 4 3 13 0.99 0 NT5C3 0 0 6 4 3 13 0.99 0 ILK 0 0 5 4 3 12 0.99 0 CBR3 0 0 5 4 3 12 0.99 0 TOMM70A 0 0 5 4 3 12 0.99 0 SSBP1 0 0 5 4 3 12 0.99 0 DIAPH3 0 0 5 4 3 12 0.99 0 POLR2L 0 0 4 4 3 11 0.99 0 NR2F2 0 0 4 4 3 11 0.99 0 CHTF18 0 0 5 3 3 11 0.99 0 WIPI2 0 0 4 4 3 11 0.99 0 OPA3 0 0 5 3 3 11 0.99 0 PREPL 0 0 5 3 3 11 0.99 0

PSPC1 0 0 4 3 3 10 0.99 0 PEG10 0 0 4 3 3 10 0.99 0 TTC19 0 0 4 3 3 10 0.99 0 TUBGCP4 0 0 4 3 3 10 0.99 0 MTIF2 0 0 4 3 3 10 0.99 0 UFD1L 0 0 4 3 3 10 0.99 0 RRAGB 0 0 4 3 3 10 0.99 0 VPS53 2 0 14 12 9 35 0.98 0 PIH1D1 0 0 3 3 3 9 0.98 0 GUCY1B3 0 0 3 3 3 9 0.98 0 PDS5A 7 6 27 22 20 69 0.97 0 SLK 2 0 17 11 8 36 0.97 0 HECTD1 2 0 11 10 9 30 0.97 0 COMMD4 0 0 12 10 2 24 0.97 0 FLAD1 0 0 8 6 2 16 0.97 0 GTF3C2 0 0 10 4 2 16 0.96 0 DYNLT1 0 0 6 4 2 12 0.96 0 DHX57 0 0 6 4 2 12 0.96 0 DIAPH1 11 8 29 28 28 85 0.96 0.01 PTCD3 3 3 13 13 11 37 0.96 0.01 KCMF1 2 0 11 10 8 29 0.96 0.01 MTMR9 0 0 5 4 2 11 0.96 0.01 RNF14 0 0 5 4 2 11 0.96 0.01 CLINT1 0 0 5 3 2 10 0.96 0.01 GSTCD 0 0 5 3 2 10 0.96 0.01 MYL12B 0 0 4 3 2 9 0.96 0.01 IFRD2 0 0 4 3 2 9 0.96 0.01 PEX1 0 0 4 3 2 9 0.96 0.01 PARD3 0 0 4 3 2 9 0.96 0.01 MIPEP 0 0 4 3 2 9 0.96 0.01 MRPS24 0 0 4 3 2 9 0.96 0.01 NOL9 3 0 15 15 12 42 0.95 0.01 TCEB2 0 0 3 3 2 8 0.95 0.01 PRKAG1 0 0 3 3 2 8 0.95 0.01 DICER1 0 0 3 3 2 8 0.95 0.01 PIK3R1 0 0 3 3 2 8 0.95 0.01 ARMC8 0 0 3 3 2 8 0.95 0.01 ACOT2 8 2 30 28 22 80 0.94 0.01 ADCK4 2 2 12 11 8 31 0.94 0.01 POLG 0 0 5 2 2 9 0.93 0.01 RABGAP1 0 0 5 2 2 9 0.93 0.01 POLR1D 0 0 4 2 2 8 0.93 0.01 ACTR10 0 0 4 2 2 8 0.93 0.01 HDAC6 0 0 4 2 2 8 0.93 0.01 COPS7A 0 0 4 2 2 8 0.93 0.01 RICTOR 0 0 4 2 2 8 0.93 0.01 ANKRD28 3 3 12 11 11 34 0.92 0.01 POLR2A 0 0 3 2 2 7 0.92 0.01 CSNK2A1 0 0 3 2 2 7 0.92 0.01 GPT2 0 0 3 2 2 7 0.92 0.01 DNAJC19 0 0 3 2 2 7 0.92 0.01 METAP1 0 0 3 2 2 7 0.92 0.01 MRPS23 0 0 3 2 2 7 0.92 0.01 DDA1 0 0 3 2 2 7 0.92 0.01

2.3.6.5 PARL

PARL identified 170 interactors of which 156 are annotated as mitochondrial in GO (Table 2.12, Figure 2.15). PARL identified known interactors OPA1 and HAX1 both known to reside within the IMS. Two other known interactors are PGAM5 and PINK1 that are cleaved by PARL in response to membrane potential changes but are not identified in our BioID. Therefore, it would be interesting to see how the PARL interactome would change if an agent was used to disrupt membrane potential. Within the GO enrichment analysis, PARL identified many pathways associated with IMS function such as ETC and mitochondrial organization. Interestingly, PARL identified some unique mitochondrial import chaperone proteins that are part of the TIMM22 complex.

Table 2.12 Complete list of interactors identified by BioID for PARL Interactors identified for PARL are sorted by total peptide counts across two biological and two technical replicates and significance analysis of interactome (SAINT) using a Bayesian false discovery rate (BFDR) <1%.

PARL Pool A Pool B Gene Name Full Name Top 2 Controls Tech #1 Tech #2 Tech #1 Tech #2 Total SAINT BFDR BirA* biotin ligase (E. coli) 2815 2807 1057 1031 1155 1149 4392 HTRA2 HtrA serine peptidase 2 3 2 8 5 9 7 29 LACTB lactamase beta 0 0 45 47 51 47 190 1 0 OMA1 OMA1 zinc metallopeptidase 0 0 21 20 24 19 84 1 0 PARL presenilin associated rhomboid like 0 0 170 150 175 171 666 IMMP1L inner mitochondrial membrane peptidase subunit 1 0 0 53 52 52 48 205 1 0 IMMP2L inner mitochondrial membrane peptidase subunit 2 0 0 10 10 10 10 40 1 0 YME1L1 YME1 like 1 ATPase 0 0 85 78 82 77 322 1 0 COX15 cytochrome c oxidase assembly homolog COX15 0 0 337 276 338 270 1221 1 0 IMMT inner membrane mitochondrial protein 6 5 231 242 254 239 966 1 0 CLPB ClpB homolog, mitochondrial AAA ATPase chaperonin 3 2 260 228 216 213 917 1 0 ADCK2 aarF domain containing kinase 2 0 0 189 174 199 181 743 1 0 ACOT1 acyl-CoA thioesterase 1 43 42 178 168 152 136 634 1 0 IARS2 isoleucyl-tRNA synthetase 2, mitochondrial 4 4 136 135 135 137 543 1 0 TIMM50 translocase of inner mitochondrial membrane 50 29 28 103 108 109 102 422 1 0 GPD2 glycerol-3-phosphate dehydrogenase 2 4 3 99 81 103 96 379 1 0 SHMT2 serine hydroxymethyltransferase 2 29 16 99 93 85 102 379 1 0 SLC25A12 solute carrier family 25 member 12 4 4 107 97 86 82 372 1 0 SAMM50 SAMM50 sorting and assembly machinery component 2 0 95 81 87 92 355 1 0 COX4I1 cytochrome c oxidase subunit 4I1 4 3 87 83 84 78 332 1 0 ATAD3A ATPase family, AAA domain containing 3A 16 16 81 68 91 90 330 1 0 YME1L1 YME1 like 1 ATPase 0 0 85 78 82 77 322 1 0 AFG3L2 AFG3 like matrix AAA peptidase subunit 2 8 8 80 73 87 77 317 1 0 LETM1 leucine zipper and EF-hand containing transmembrane protein 1 0 0 79 83 78 73 313 1 0 LRPPRC leucine rich pentatricopeptide repeat containing 18 14 76 72 79 78 305 1 0 OPA1 OPA1, mitochondrial dynamin like GTPase 2 0 81 73 72 78 304 1 0 TIMM13 translocase of inner mitochondrial membrane 13 0 0 81 74 72 75 302 1 0 CKMT1B creatine kinase, mitochondrial 1B 0 0 74 75 65 65 279 1 0 CCDC58 coiled-coil domain containing 58 0 0 75 77 65 53 270 1 0 APOOL apolipoprotein O like 0 0 76 68 61 59 264 1 0 NDUFS3 NADH:ubiquinone oxidoreductase core subunit S3 10 7 70 62 66 64 262 1 0 ENDOG endonuclease G 0 0 64 62 62 65 253 1 0 NDUFS2 NADH:ubiquinone oxidoreductase core subunit S2 3 3 71 55 69 56 251 1 0 HAX1 HCLS1 associated protein X-1 5 4 55 50 69 51 225 1 0 CPOX coproporphyrinogen oxidase 0 0 64 54 53 53 224 1 0 AIFM1 apoptosis inducing factor mitochondria associated 1 4 4 57 56 54 55 222 1 0 CYC1 cytochrome c1 0 0 61 55 52 51 219 1 0 NDUFA8 NADH:ubiquinone oxidoreductase subunit A8 0 0 57 55 54 45 211 1 0 OCIAD1 OCIA domain containing 1 13 8 54 51 51 54 210 1 0 NDUFS1 NADH:ubiquinone oxidoreductase core subunit S1 6 5 51 45 56 54 206 1 0 IMMP1L inner mitochondrial membrane peptidase subunit 1 0 0 53 52 52 48 205 1 0 LACTB lactamase beta 0 0 45 47 51 47 190 1 0 COX5A cytochrome c oxidase subunit 5A 2 0 48 42 44 43 177 1 0 HCCS holocytochrome c synthase 0 0 46 39 44 45 174 1 0 AK2 adenylate kinase 2 2 0 49 44 40 38 171 1 0 C1orf212 small integral membrane protein 12 0 0 47 43 41 39 170 1 0 NDUFA13 NADH:ubiquinone oxidoreductase subunit A13 7 3 44 42 43 41 170 1 0 MTX2 metaxin 2 0 0 40 35 48 44 167 1 0 ACAD9 acyl-CoA dehydrogenase family member 9 0 0 41 37 40 47 165 1 0 TTC19 tetratricopeptide repeat domain 19 0 0 46 48 38 32 164 1 0 PTCD3 pentatricopeptide repeat domain 3 9 9 43 36 43 33 155 1 0 MRPS31 mitochondrial ribosomal protein S31 10 8 35 35 38 40 148 1 0 NDUFAF2 NADH:ubiquinone oxidoreductase complex assembly factor 2 0 0 34 37 34 29 134 1 0 TIMMDC1 translocase of inner mitochondrial membrane domain containing 1 0 0 29 36 36 31 132 1 0 TIMM44 translocase of inner mitochondrial membrane 44 8 6 36 34 32 30 132 1 0 NDUFA5 NADH:ubiquinone oxidoreductase subunit A5 7 5 33 32 32 33 130 1 0 TOMM70A translocase of outer mitochondrial membrane 70 0 0 31 36 31 31 129 1 0 CYCS cytochrome c, somatic 0 0 39 30 34 25 128 1 0 COX6B1 cytochrome c oxidase subunit 6B1 0 0 36 32 26 33 127 1 0 NDUFB10 NADH:ubiquinone oxidoreductase subunit B10 0 0 34 31 34 26 125 1 0 EFHA1 mitochondrial calcium uptake 2 0 0 30 25 33 29 117 1 0 SLC25A24 solute carrier family 25 member 24 0 0 30 27 32 26 115 1 0 CHCHD3 coiled-coil-helix-coiled-coil-helix domain containing 3 0 0 27 25 25 36 113 1 0 TMEM126B transmembrane protein 126B 0 0 25 27 28 31 111 1 0 ECSIT ECSIT signalling integrator 0 0 29 24 30 28 111 1 0 PREPL prolyl endopeptidase like 0 0 35 27 28 21 111 1 0 PYCR2 pyrroline-5-carboxylate reductase 2 0 0 27 30 29 24 110 1 0 MICU1 mitochondrial calcium uptake 1 0 0 28 27 25 24 104 1 0 SLC30A9 solute carrier family 30 member 9 0 0 28 22 28 25 103 1 0 SELRC1 cytochrome c oxidase assembly factor 7 (putative) 0 0 25 27 17 27 96 1 0 SCO1 SCO1, cytochrome c oxidase assembly protein 0 0 23 27 23 19 92 1 0 CBR1 carbonyl reductase 1 6 4 23 27 23 18 91 1 0 NDUFAF4 NADH:ubiquinone oxidoreductase complex assembly factor 4 0 0 22 24 23 19 88 1 0 COX5B cytochrome c oxidase subunit 5B 0 0 22 22 21 22 87 1 0

APOO apolipoprotein O 0 0 23 23 22 19 87 1 0 TMEM126A transmembrane protein 126A 0 0 17 26 20 24 87 1 0 NDUFV1 NADH:ubiquinone oxidoreductase core subunit V1 4 3 25 16 24 19 84 1 0 OMA1 OMA1 zinc metallopeptidase 0 0 21 20 24 19 84 1 0 SLC25A25 solute carrier family 25 member 25 0 0 21 23 20 19 83 1 0 MDH2 malate dehydrogenase 2 0 0 28 18 17 18 81 1 0 NDUFS8 NADH:ubiquinone oxidoreductase core subunit S8 0 0 23 19 16 22 80 1 0 NDUFV2 NADH:ubiquinone oxidoreductase core subunit V2 3 3 19 14 18 24 75 1 0 C12orf73 chromosome 12 open reading frame 73 0 0 23 23 17 12 75 1 0 ATPAF1 ATP synthase mitochondrial F1 complex assembly factor 1 0 0 22 15 16 19 72 1 0 TIMM8A translocase of inner mitochondrial membrane 8A 0 0 18 18 17 18 71 1 0 TMEM242 transmembrane protein 242 0 0 20 17 14 19 70 1 0 NDUFB5 NADH:ubiquinone oxidoreductase subunit B5 0 0 19 15 17 18 69 1 0 FAM162A family with sequence similarity 162 member A 0 0 17 18 15 15 65 1 0 NDUFV3 NADH:ubiquinone oxidoreductase subunit V3 0 0 19 16 16 13 64 1 0 BRP44 mitochondrial pyruvate carrier 2 0 0 21 19 15 8 63 1 0 NDUFS7 NADH:ubiquinone oxidoreductase core subunit S7 2 2 15 15 15 16 61 1 0 EXOG exo/endonuclease G 0 0 17 13 17 13 60 1 0 ATP5F1 ATP synthase peripheral stalk-membrane subunit b 4 2 17 15 14 14 60 1 0 C19orf52 translocase of inner mitochondrial membrane 29 0 0 12 15 17 13 57 1 0 ATAD3B ATPase family, AAA domain containing 3B 0 0 15 8 15 18 56 1 0 TFAM transcription factor A, mitochondrial 0 0 16 12 13 15 56 1 0 PYCR1 pyrroline-5-carboxylate reductase 1 0 0 16 14 12 13 55 1 0 COX6C cytochrome c oxidase subunit 6C 0 0 14 12 14 14 54 1 0 NDUFB8 NADH:ubiquinone oxidoreductase subunit B8 0 0 16 10 13 15 54 1 0 TACO1 translational activator of cytochrome c oxidase I 0 0 10 12 17 15 54 1 0 TMEM65 transmembrane protein 65 0 0 13 12 13 13 51 1 0 HSPE1 heat shock protein family E (Hsp10) member 1 0 0 14 15 11 10 50 1 0 SDHA succinate dehydrogenase complex flavoprotein subunit A 0 0 15 15 10 10 50 1 0 UBR2 ubiquitin protein ligase E3 component n-recognin 2 0 0 11 4 17 17 49 1 0 GLS glutaminase 0 0 12 13 13 10 48 1 0 MMAB metabolism of cobalamin associated B 0 0 14 10 15 9 48 1 0 NDUFB11 NADH:ubiquinone oxidoreductase subunit B11 0 0 15 10 10 12 47 1 0 OCIAD2 OCIA domain containing 2 0 0 11 12 12 11 46 1 0 NDUFB9 NADH:ubiquinone oxidoreductase subunit B9 0 0 12 10 12 12 46 1 0 NDUFAF1 NADH:ubiquinone oxidoreductase complex assembly factor 1 0 0 14 8 13 11 46 1 0 NDUFA12 NADH:ubiquinone oxidoreductase subunit A12 0 0 14 6 13 10 43 1 0 GUF1 GUF1 homolog, GTPase 0 0 12 11 9 11 43 1 0 PTPMT1 protein tyrosine phosphatase, mitochondrial 1 0 0 9 11 12 10 42 1 0 PAM16 presequence translocase associated motor 16 0 0 13 11 7 10 41 1 0 IMMP2L inner mitochondrial membrane peptidase subunit 2 0 0 10 10 10 10 40 1 0 PPIF peptidylprolyl isomerase F 0 0 14 9 9 6 38 1 0 TRIAP1 TP53 regulated inhibitor of apoptosis 1 0 0 9 12 9 7 37 1 0 TIMM10 translocase of inner mitochondrial membrane 10 0 0 11 8 9 9 37 1 0 C17orf80 chromosome 17 open reading frame 80 0 0 9 7 11 9 36 1 0 HARS2 histidyl-tRNA synthetase 2, mitochondrial 0 0 10 5 11 9 35 1 0 NDUFB3 NADH:ubiquinone oxidoreductase subunit B3 0 0 8 9 8 8 33 1 0 ECHS1 enoyl-CoA hydratase, short chain 1 0 0 9 10 7 7 33 1 0 FAM136A family with sequence similarity 136 member A 0 0 8 9 7 8 32 1 0 TIMM17B translocase of inner mitochondrial membrane 17B 0 0 10 6 8 8 32 1 0 C9orf46 plasminogen receptor with a C-terminal lysine 0 0 9 6 9 7 31 1 0 NFS1 NFS1, cysteine desulfurase 0 0 9 11 7 4 31 1 0 FAM82B regulator of microtubule dynamics 1 0 0 8 8 7 7 30 1 0 THEM4 thioesterase superfamily member 4 0 0 7 9 5 9 30 1 0 MRPS26 mitochondrial ribosomal protein S26 0 0 6 9 10 4 29 1 0 NDUFAF3 NADH:ubiquinone oxidoreductase complex assembly factor 3 0 0 7 9 7 6 29 1 0 ND5 mitochondrially encoded NADH:ubiquinone oxidoreductase core subunit 5 0 0 5 7 8 8 28 1 0 GFM1 G elongation factor mitochondrial 1 0 0 8 7 7 5 27 1 0 ATP5I ATP synthase membrane subunit e 0 0 5 8 7 6 26 1 0 PDPR pyruvate dehydrogenase phosphatase regulatory subunit 0 0 7 6 7 5 25 1 0 HINT2 histidine triad nucleotide binding protein 2 0 0 7 6 6 6 25 1 0 MRPS24 mitochondrial ribosomal protein S24 0 0 5 4 8 7 24 1 0 NDUFS4 NADH:ubiquinone oxidoreductase subunit S4 0 0 5 4 5 8 22 1 0 ARMC10 armadillo repeat containing 10 0 0 8 5 4 5 22 1 0 OXA1L OXA1L, mitochondrial inner membrane protein 0 0 7 6 4 5 22 1 0 SLIRP SRA stem-loop interacting RNA binding protein 0 0 4 6 6 5 21 1 0 COX19 cytochrome c oxidase assembly factor COX19 0 0 5 5 6 4 20 1 0 SFXN3 sideroflexin 3 0 0 6 5 5 4 20 1 0 RNMTL1 mitochondrial rRNA methyltransferase 3 0 0 6 5 5 4 20 1 0 RNH1 ribonuclease/angiogenin inhibitor 1 0 0 4 5 5 5 19 1 0 MRPL21 mitochondrial ribosomal protein L21 0 0 4 5 6 4 19 1 0 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 0 0 5 5 4 4 18 1 0 PNPT1 polyribonucleotide nucleotidyltransferase 1 0 0 4 4 5 5 18 1 0 MRPS11 mitochondrial ribosomal protein S11 0 0 4 5 4 5 18 1 0 ND4 mitochondrially encoded NADH:ubiquinone oxidoreductase core subunit 4 0 0 7 3 8 7 25 0.99 0 CHCHD6 coiled-coil-helix-coiled-coil-helix domain containing 6 0 0 5 3 7 4 19 0.99 0 MRPL46 mitochondrial ribosomal protein L46 0 0 6 3 4 6 19 0.99 0 SUPV3L1 Suv3 like RNA helicase 0 0 5 5 6 3 19 0.99 0 UBR1 ubiquitin protein ligase E3 component n-recognin 1 0 0 3 3 8 5 19 0.99 0

TIMM8B translocase of inner mitochondrial membrane 8 homolog B 0 0 7 4 4 3 18 0.99 0 RAC1 Rac family small GTPase 1 0 0 6 4 4 3 17 0.99 0 TIMM9 translocase of inner mitochondrial membrane 9 0 0 4 3 4 5 16 0.99 0 ERAL1 Era like 12S mitochondrial rRNA chaperone 1 0 0 4 3 4 4 15 0.99 0 GRPEL1 GrpE like 1, mitochondrial 0 0 4 4 4 3 15 0.99 0 SCO2 SCO2, cytochrome c oxidase assembly protein 0 0 3 4 3 4 14 0.99 0 UQCRB ubiquinol-cytochrome c reductase binding protein 0 0 4 3 4 3 14 0.99 0 MRPS7 mitochondrial ribosomal protein S7 2 0 11 11 11 11 44 0.98 0 MTPAP mitochondrial poly(A) polymerase 0 0 3 3 3 4 13 0.98 0 ACADSB acyl-CoA dehydrogenase short/branched chain 0 0 8 7 5 2 22 0.97 0 NDUFA2 NADH:ubiquinone oxidoreductase subunit A2 0 0 2 3 4 6 15 0.97 0 NDUFS6 NADH:ubiquinone oxidoreductase subunit S6 0 0 5 2 4 4 15 0.97 0 SLC25A13 solute carrier family 25 member 13 42 29 136 125 119 110 490 0.96 0 FASTKD2 FAST kinase domains 2 2 0 12 8 10 11 41 0.96 0 VARS2 valyl-tRNA synthetase 2, mitochondrial 0 0 3 4 2 9 18 0.96 0 IBA57 IBA57, iron-sulfur cluster assembly 0 0 4 6 3 2 15 0.96 0 NDUFS5 NADH:ubiquinone oxidoreductase subunit S5 0 0 4 3 3 2 12 0.96 0 PDIA3 protein disulfide isomerase family A member 3 9 7 26 26 23 26 101 0.94 0 CMC1 C-X9-C motif containing 1 0 0 2 3 2 4 11 0.93 0 POLDIP2 DNA polymerase delta interacting protein 2 2 0 9 10 8 7 34 0.91 0.01 CLTA clathrin light chain A 0 0 2 4 2 2 10 0.91 0.01 NME4 NME/NM23 nucleoside diphosphate kinase 4 2 2 7 8 9 10 34 0.83 0.01 RG9MTD1 tRNA methyltransferase 10C, mitochondrial RNase P subunit 12 8 29 32 30 26 117 0.78 0.01 MRPS35 mitochondrial ribosomal protein S35 4 3 11 12 11 13 47 0.78 0.01 RAP1A RAP1A, member of RAS oncogene family 0 0 10 0 8 7 25 0.75 0.01

G2:0007005: PitRFhRnGUiRn RUgDnizDtiRn 5-H6A-611105: 5HsSiUDtRUy HOHFtURn tUDnsSRUt G2:0006839: PitRFhRnGUiDO tUDnsSRUt C2580:2920: 5HsSiUDtRUy FhDin FRPSOHx , (ODPEGD suEunit) PitRFhRnGUiDO G2:0007007: innHU PitRFhRnGUiDO PHPEUDnH RUgDnizDtiRn G2:0140053: PitRFhRnGUiDO gHnH HxSUHssiRn G2:0009060: DHUREiF UHsSiUDtiRn C2580:2914: 5HsSiUDtRUy FhDin FRPSOHx , (EHtD suEunit) PitRFhRnGUiDO G2:0017004: FytRFhURPH FRPSOHx DssHPEOy G2:0070584: PitRFhRnGUiRn PRUShRgHnHsis G2:0006851: PitRFhRnGUiDO FDOFiuP iRn tUDnsPHPEUDnH tUDnsSRUt G2:0034982: PitRFhRnGUiDO SURtHin SURFHssing C2580:2942: (Fsit FRPSOHx ((C6,7, 1D8)63, 1D8)A)1) G2:0008637: DSRStRtiF PitRFhRnGUiDO FhDngHs G2:0009084: gOutDPinH IDPiOy DPinR DFiG EiRsynthHtiF SURFHss G2:0042776: PitRFhRnGUiDO A73 synthHsis FRuSOHG SURtRn tUDnsSRUt G2:0070129: UHguODtiRn RI PitRFhRnGUiDO tUDnsODtiRn G2:0006309: DSRStRtiF D1A IUDgPHntDtiRn G2:0033014: tHtUDSyUUROH EiRsynthHtiF SURFHss G2:0051186: FRIDFtRU PHtDEROiF SURFHss

0 10 20 30 40 50 60 70 80 -ORg10(3)

Figure 2.15 GO enrichment analysis of PARL Metascape was used to generate the values and graph.

2.3.6.6 LACTB

LACTB identified 56 high-confidence interactors of which 52 are annotated as mitochondrial according to GO (Table 2.13). LACTB has no known substrates or interactors but identifies the IMS markers OPA1 and CLPB. LACTB was also shown to be a tumour suppressor that can affect lipid metabolism in breast cancer (143). However, we see few interactors relating to lipid metabolism or other metabolic processes in our GO enrichment analysis (Figure 2.16). Thus,

80 looking at LACTB in a more relevant breast cancer cell line may identify more lipid related interactors.

Table 2.13 Complete list of interactors identified by BioID for LACTB Interactors identified for LACTB are sorted by total peptide counts across two biological and two technical replicates and significance analysis of interactome (SAINT) using a Bayesian false discovery rate (BFDR) <1%.

LACTB Pool A Pool B Gene Name Full Name Top 2 Controls Tech #1 Tech #2 Tech #1 Tech #2 Total SAINT BFDR BirA* biotin ligase (E. coli) 2815 2807 2167 2067 2517 2318 9069 HTRA2 HtrA serine peptidase 2 3 2 11 8 5 5 29 LACTB lactamase beta 0 0 1340 1382 1428 1457 5607 OMA1 OMA1 zinc metallopeptidase 0 0 4 4 4 2 14 0.97 0 PARL presenilin associated rhomboid like 0 0 4 2 3 4 13 0.96 0 IMMP1L inner mitochondrial membrane peptidase subunit 1 0 0 0 0 0 0 0 IMMP2L inner mitochondrial membrane peptidase subunit 2 0 0 6 9 5 4 24 1 0 YME1L1 YME1 like 1 ATPase 0 0 17 16 17 14 64 1 0 CLPB ClpB homolog, mitochondrial AAA ATPase chaperonin 3 2 187 168 197 161 713 1 0 IMMT inner membrane mitochondrial protein 6 5 96 99 93 94 382 1 0 CKMT1B creatine kinase, mitochondrial 1B 0 0 73 63 74 73 283 1 0 COX15 cytochrome c oxidase assembly homolog COX15 0 0 62 56 59 52 229 1 0 ATAD3A ATPase family, AAA domain containing 3A 16 16 54 50 49 46 199 1 0 USP30 ubiquitin specific peptidase 30 0 0 48 42 58 49 197 1 0 HAX1 HCLS1 associated protein X-1 5 4 40 51 51 52 194 1 0 SAMM50 SAMM50 sorting and assembly machinery component 2 0 29 29 31 31 120 1 0 ENDOG endonuclease G 0 0 28 26 29 29 112 1 0 NDUFA8 NADH:ubiquinone oxidoreductase subunit A8 0 0 27 26 30 28 111 1 0 CPOX coproporphyrinogen oxidase 0 0 23 28 31 28 110 1 0 COX4I1 cytochrome c oxidase subunit 4I1 4 3 27 29 26 21 103 1 0 AK2 adenylate kinase 2 2 0 24 21 28 25 98 1 0 IARS2 isoleucyl-tRNA synthetase 2, mitochondrial 4 4 21 24 27 25 97 1 0 SLC25A12 solute carrier family 25 member 12 4 4 25 22 22 24 93 1 0 TTC19 tetratricopeptide repeat domain 19 0 0 23 16 23 26 88 1 0 APOOL apolipoprotein O like 0 0 17 22 18 22 79 1 0 CCDC58 coiled-coil domain containing 58 0 0 17 20 17 19 73 1 0 SELRC1 cytochrome c oxidase assembly factor 7 (putative) 0 0 18 17 19 19 73 1 0 ATPAF1 ATP synthase mitochondrial F1 complex assembly factor 1 0 0 20 15 19 15 69 1 0 OPA1 OPA1, mitochondrial dynamin like GTPase 2 0 15 11 22 20 68 1 0 YME1L1 YME1 like 1 ATPase 0 0 17 16 17 14 64 1 0 MTX2 metaxin 2 0 0 13 11 16 12 52 1 0 TIMM13 translocase of inner mitochondrial membrane 13 0 0 14 11 13 13 51 1 0 HCCS holocytochrome c synthase 0 0 11 7 15 13 46 1 0 CHCHD3 coiled-coil-helix-coiled-coil-helix domain containing 3 0 0 9 11 10 11 41 1 0 ATAD3B ATPase family, AAA domain containing 3B 0 0 9 11 9 11 40 1 0 TIMM8A translocase of inner mitochondrial membrane 8A 0 0 12 8 9 11 40 1 0 MICU1 mitochondrial calcium uptake 1 0 0 8 6 10 8 32 1 0 CYCS cytochrome c, somatic 0 0 8 7 8 9 32 1 0 MARC2 mitochondrial amidoxime reducing component 2 0 0 9 6 7 5 27 1 0 NDUFB10 NADH:ubiquinone oxidoreductase subunit B10 0 0 8 7 6 6 27 1 0 EXD2 exonuclease 3'-5' domain containing 2 0 0 7 6 6 7 26 1 0 IMMP2L inner mitochondrial membrane peptidase subunit 2 0 0 6 9 5 4 24 1 0 BCL2L13 BCL2 like 13 0 0 4 5 6 6 21 1 0 EFHA1 mitochondrial calcium uptake 2 0 0 4 6 5 6 21 1 0 NDUFS8 NADH:ubiquinone oxidoreductase core subunit S8 0 0 6 4 5 4 19 1 0 SLC30A9 solute carrier family 30 member 9 0 0 4 5 4 4 17 1 0 CBR1 carbonyl reductase 1 6 4 18 18 19 21 76 0.99 0 CAPN2 calpain 2 0 0 10 8 5 3 26 0.99 0 NUDT19 nudix hydrolase 19 0 0 6 3 5 6 20 0.99 0 ACAD9 acyl-CoA dehydrogenase family member 9 0 0 6 4 6 3 19 0.99 0 MDH2 malate dehydrogenase 2 0 0 4 3 4 5 16 0.99 0 DCXR dicarbonyl and L-xylulose reductase 0 0 3 4 4 3 14 0.99 0 DNAJC11 DnaJ heat shock protein family (Hsp40) member C11 16 15 46 43 51 48 188 0.98 0 COX5B cytochrome c oxidase subunit 5B 0 0 3 3 3 5 14 0.98 0 CHCHD4 coiled-coil-helix-coiled-coil-helix domain containing 4 0 0 3 3 3 3 12 0.98 0 TOMM70A translocase of outer mitochondrial membrane 70 0 0 9 9 6 2 26 0.97 0 MARC1 mitochondrial amidoxime reducing component 1 0 0 5 4 2 6 17 0.97 0 OMA1 OMA1 zinc metallopeptidase 0 0 4 4 4 2 14 0.97 0 AIFM1 apoptosis inducing factor mitochondria associated 1 4 4 19 19 18 13 69 0.96 0 PARL presenilin associated rhomboid like 0 0 4 2 3 4 13 0.96 0 TIMMDC1 translocase of inner mitochondrial membrane domain containing 1 0 0 3 2 3 3 11 0.95 0 LETM1 leucine zipper and EF-hand containing transmembrane protein 1 0 0 2 2 3 3 10 0.93 0.01 PYCR1 pyrroline-5-carboxylate reductase 1 0 0 2 2 3 3 10 0.93 0.01 COX5A cytochrome c oxidase subunit 5A 2 0 7 4 14 9 34 0.79 0.01

G2:0007005: PitRchRnGriRn RrganizatiRn G2:0006839: PitRchRnGriaO transSRrt G2:0007007: innHr PitRchRnGriaO PHPbranH RrganizatiRn G2:0022904: rHsSiratRry HOHctrRn transSRrt chain 5-H6A-1268020: 0itRchRnGriaO SrRtHin iPSRrt G2:0033108: PitRchRnGriaO rHsSiratRry chain cRPSOHx assHPbOy G2:0008053: PitRchRnGriaO fusiRn G2:0034982: PitRchRnGriaO SrRtHin SrRcHssing G2:0017004: cytRchrRPH cRPSOHx assHPbOy G2:0009636: rHsSRnsH tR tRxic substancH G2:0006919: activatiRn Rf cystHinH-tySH HnGRSHStiGasH activity invROvHG in aSRStRtic SrRcHss G2:0006006: gOucRsH PHtabROic SrRcHss G2:0090407: RrganRShRsShatH biRsynthHtic SrRcHss

0 5 10 15 20 25 -ORg10(3)

Figure 2.16 GO enrichment analysis of LACTB Metascape was used to generate the values and graph.

2.4 Discussion

The IMS proteases are required to maintain proper mitochondrial structure and function, but their individual biological roles have remained poorly characterized. Here, we generated BioID-based protein proximity maps for the seven human IMS proteases, identifying new putative functions and substrates for this important group of enzymes. Notably, despite the spatial constraints of the 12-40nm diameter IMS compartment, BioID detected highly specific protease interactomes, with ~67% of the identified binding partners interacting with only one or two proteases.

Consistent with a number of previous publications (238, 240, 262), we found that BioID outperformed IP-MS in the identification of membrane protein proximity interactions: e.g. 48 of 81 (59%) HTRA2 interactors found by BioID were annotated as mitochondrial membrane proteins, compared with 14 of 67 (21%) for the standard IP-MS approach (Table 2.2 and 2.3). BioID also identified a number of previously reported HTRA2 interactors (BIRC2, BIRC6, and XIAP) not detected in our IP-MS analysis. These data indicate that BioID can be a highly complementary approach for the identification of protein interactions in mitochondria.

As in all of our previous BioID studies, we used the BirA*FLAG tag expressed in the same cell type as a negative control, in order to identify background (i.e. CRAPome) proteins that interact non-specifically with the streptavidin-sepharose beads or the BirA*FLAG tag moiety. This control polypeptide localizes throughout the cytoplasm and nucleus but does not localize to the IMS. After subtraction of the cytoplasmic/nuclear background proteins, we thus compared

83 individual protease interactomes with one another to reveal uniquely enriched polypeptide interactors and protein complexes, with the assumption that any IMS-specific background proteins would be detected in most or all of the protease BioID analyses.

To demonstrate how the IMS protease dataset could be used to uncover novel biology, we focused on the interaction between HTRA2 and the MIB complex. Despite the importance of MIB in maintaining cristae structure, little is known about how this complex is regulated. Our in vivo and in vitro data provide strong evidence that the core MIB complex subunit IMMT is an HTRA2 substrate. Although SAMM50 protein levels were also slightly increased upon HTRA2 knockdown, no degradation of this protein was observed in our in vitro HTRA2 protease assay (Figure 2.8). It must be noted, however, that our assay may not be optimized for the analysis of membrane proteins such as SAMM50.

It is also interesting to note that our shControl (directed towards the GFP protein) appears to have an effect on all MIB complex component levels. All three of IMMT, SAMM50, and CHCHD3 are decreased upon transduction of this specific shControl when compared with normal non-transduced or “no virus” cells and HTRA2 knockdown cells (Figure 2.8). Thus, when analyzing the HTRA2 knockdown data we compared the levels MIB complex components to both the no virus cells and the shControl. Only IMMT was increased when compared to both controls. To confirm there was not a transduction specific effect within our protocol effecting IMMT levels, we transduced cells with two other control shRNAs directed towards PHLPP1 and NME2 (two nuclear proteins). There were no changes in IMMT levels, suggesting that the effects seen with the shControl are some off target effects of the shRNA and not effects of the transduction itself (Figure 2.17). Additionally, this effect appears to be Western blot specific as our shControl EM images mirror our non-transduced cell images (Figure 2.6). Thus, exactly how the shControl is affecting MIB complex protein levels remains unclear at this time.

Figure 2.17 Two additional shControls validate the effects of HTRA2 on IMMT levels Levels of IMMT in OCI-AML2 cells seven days post transduction with shControl, shHTRA2-1, shHTRA2-2, and two additional shControls.

Notably, prior studies have also linked HTRA2 to mitochondrial cristae function. Knockout of HTRA2 in mouse embryonic fibroblasts disrupted mitochondrial morphology and cristae structure (130). In this case, the changes in cristae and mitochondrial morphology were attributed to increased OPA1 levels (130). We did not observe any changes in OPA1 levels or a reduction in inner membrane quantity in response to HTRA2 knockdown (Figure 2.8). These disparities could be due to differences in residual levels of HTRA2 in our knockdown experiments, and/or reflect a cell context-dependent observation.

Mutations of both HTRA2 and MIB complex subunits have been linked to neurodegenerative diseases in patients and model organisms (121, 129, 183, 184, 247, 263, 264). An inactivating mutation (G399S) in HTRA2 is associated with Parkinson’s disease and essential tremor in patients (182–184). Similarly, the mnd-/- mouse possesses an HTRA2 inactivating mutation and displays essential tremor that can be rescued with wild-type HTRA2 (181). We speculate that the human G399S mutation affects the stability and thus activity of the protease. This is shown in our interactome by an overall general decrease in peptide counts of both the bait and the preys with no obvious pattern of loss (Table 2.4). This is in contrast to the S306A mutation which abolishes the protease activity of HTRA2, however maintains the majority of interactions identified in the WT (Table 2.5). Further evaluation could determine whether the 17 gained interactors over the wild-type are potential substrates that increased upon the loss of protease

85 activity. We did not see an increase in the IMMT peptide counts suggesting that this may not be the case. In regard to the G399S mutation we speculate that it affects the stability of the protein, thus reducing the number and peptide counts of the interactors in the BioID data. This is further supported as there is no identifiable preference or pattern in the interactor loss. There is a general reduction in all peptide counts, suggesting the mutation is not gaining or losing specific interactors that could affect its function. Further evaluation of the stability of the HTRA2 G399S protein could confirm this theory.

HTRA2 has also been associated with several human malignancies. In U2OS osteosarcoma cells, the WT1 protein was found to be degraded in an HTRA2-dependent manner (194). In ovarian serous carcinoma, lower levels of HTRA2 are associated with a worse prognosis and increased invasive activity of ovarian cancer cell lines in culture (193). To more fully understand the biological roles of HTRA2 and the other IMS proteases in oncogenesis, it will be important to conduct BioID in additional cell types, transformed cells and xenograft models.

Overall, the work in this chapter has provided the interactomes of seven IMS proteases. This includes the validation of the HTRA2 interactome through its interaction with the MIB complex and degradation of IMMT. It shows the validity and usefulness of using BioID to better understand the biological and cellular functions of mitochondrial proteases within the IMS.

Chapter 3 Effects of HTRA2 on Acute Myeloid Leukemia

3.1 Introduction

Hematopoiesis is the hierarchical differentiation of blood cells into a variety of different sub- types from a stem or progenitor cell. When blood cells are unable to differentiate, due to either mutations or cellular damage, the proliferation of these undifferentiated cells leads to the development of leukemia. Acute myeloid leukemia (AML) is a cancer of the myeloid lineage of blood cells, characterized by the proliferation of undifferentiated myeloid cells. Currently, chemotherapies and stem cell transplants provide an approximate 35-40% cure rate in patients less than 60 years old and an approximate 5-15% for patients above 60 years old (265). From the 1970s until about three years ago, there was minimal improvement in the treatment options for AML patients. However, over the past few years there have been numerous new therapies approved for the treatment of AML (266). The overall improvements with these new therapies range from increases in overall survival to decreases in relapse rates for specific patients (267– 271).

Many of the newer therapies approved for the treatment of AML patients were developed as more-targeted treatments towards leukemic cells. Thus, identifying unique features of AML cells is of great interest in order to selectively target leukemic cells while providing minimal toxicities to normal hematopoietic cells. It has been shown that AML cells have unique mitochondrial characteristics, including increased reliance on oxidative phosphorylation, sparking tremendous interest over the past decade as a potential therapeutic target (117, 253–259). Therefore, based on our characterization of HTRA2, we were subsequently interested in the potential role of HTRA2 in AML.

3.2 Methods 3.2.1 Cell Culture (Growth Curves)

OCI-AML2 cells were grown in IMDM, 10% FBS (Hyclone SH30396, lot #AC10260283, Fisher, Hampton, New Hampshire). HEK293T cells for production of lentivirus were grown in DMEM with 10% FBS and 1% BSA. NB4 cells were grow in RPMI media supplemented with 10% fetal bovine serum, 100 units/mL penicillin, and 100 µg/mL streptomycin. TEX leukemia cells obtained from Dr. John Dick’s lab (272) were maintained in IMDM with 20% FBS, 2 mM L-glutamine, 20 ng/mL stem cell factor (SCF), and 2 ng/mL interleukin-3 (IL-3). All cells

(except TEX cells) were supplemented with 100 units/mL penicillin and 100 µg/mL streptomycin and cultured at 37°C with 5% CO2.

5 x 106 OCI-AML2/NB4/TEX cells were transduced in a T25 flask with shRNAs targeting HTRA2 (Accession No.NM013247 with coding sequence for HTRA2 shRNA-1 5’CCGGAGTCAGTACAACTTCAT-3’ or HTRA2 shRNA-2 5’GAAGAATCACAGAAACACTTT-3’) or control sequences targeting GFP (Accession No. clonetechGfp_587s1c1 with coding sequence for GFP shRNA-587 (shGFP) 5’- TGCCCGACAACCACTACCTGA -3’) in a lentiviral vector carrying a puromycin resistance gene. 2 mL of virus was used for OCI-AML2/NB4 cells and 6 mL of virus for TEX cells. The day after transduction, cells were transferred to a T75 and treated with 1.5 µg/mL and 2.0 µg/mL puromycin for OCI-AML2/NB4 cells and TEX cells respectively. After 3 days of puromycin selection cells were spun at 1,700 rpm for 5 min and resuspended in 30 mL of media. Cells were counted daily with trypan blue exclusion staining starting from day 3 to day 7 using a hemocytometer before being harvested at day 7 post-transduction. 5 x 106 cells were set aside from immunoblot analysis to confirm HTRA2 knockdown.

3.2.2 Seahorse Analyzer

Oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) were measured in OCI-AML2 and Flp-In T-REx 293 cells after shHTRA2 knockdown using the Seahorse XF Cell Energy Phenotype Test Kit (Agilent, 103325-100) following manufacturer’s protocol. Data were collected using the Seahorse XF-96 analyzer (Seahorse Bioscience, MA, USA). Seven days after transduction OCI-AML2 cells were resuspended in unbuffered XF assay medium (Agilent, 102365-100) (pH 7.4) supplemented with 25 mM glucose and 1 mM pyruvate and seeded at 1.2 × 105 cells/well in Cell-Tak coated (0.15 μg/well) XF96 plates. Flp-In T-REx 293 cells were plated at 4 x 104 cells/well and resuspended in XF assay medium (pH 7.2) supplemented with 11mM glucose and 2mM L-glutamine. Cells were equilibrated in the unbuffered for 1 hour at 37°C in a CO2-free incubator before being transferred to the XF96 analyzer.

3.2.3 Mitochondrial ROS Analysis

Mitochondrial ROS was measured by flow cytometry using Mitosox Red (Molecular Probes, Eugene, OR, cat # M36008). 2 x 105 cells were plated in 0.2 mL in a 96-well plate. Cells were centrifuged at 3000 rpm for 1 min and resuspended in 0.2 mL of 5µM Mitosox Red for each applicable well for 30 min at 37ºC. Antimycin and staurosporine were used as positive controls for Mitosox Red and annexin V respectively. Cells were centrifuged at 3000 rpm for 1 min and resuspended in 0.2 mL annexin V. Cells were then run through flow cytometry on the Canto 96.

3.2.4 Colony-Forming Unit Assay

The colony-forming unit (CFU) assay was performed in gridded 35mm dishes. A mixture of Methocult (40 mL) (Stemcell Technologies, Vancouver, BC 04100), FCS (30 mL), and IMDM (30 mL) was used to generate the semi-solid media. NB4 cells were diluted to an approximate concentration of 1500-2250 cells per 0.3 mL. 0.3 mL of cells was then added to 2.7 mL of our media mixture and vortexed for 10 seconds at max speed. The tube was left upright for approximately 30 min to let the bubbles settle. A 3 mL luer lock syringe with an 18.5-gauge blunt needle was used to plate 1mL of cells into 2 x 35 mm dishes. Dishes were carefully rotated to ensure equal distribution of cells across the plate. A third dish filled with PBS was placed with the other 2 dishes into a 10cm plate and incubated at 37°C, 5% CO2. Colonies were counted on day 6.

3.2.5 ATRA-Treated NB4 Cells and CD11b Staining

NB4 cells were transduced with lentiviral vectors targeted GFP and HTRA2 (shControl, shHTRA2-1, shHTRA2-2). Four days after transfection cells were incubated with 100nM all- trans retinoic acid (ATRA) and prepared for flow cytometry two days later (day 6).

1 x 105 NB4 cells were plated per well in 100 µL of PBS with 1% FBS. Unstained cells and anti- mouse beads (BD Biosciences, San Jose, CA 552843) were used for compensation. Plates were centrifuged at 1000 rpm for 2 min and flipped sharply to remove liquid. Wells were then incubated with 100 µL of 2.5 µg/100 µL Fc bloc (BD Biosciences 564220) for 10 min. Antibody cocktails were prepared with 1.5 µL/100 µL of APC-CD11b (BD Biosciences 340937) and protected from light. Plates were then centrifuged at 1000 rpm for 2 min and flipped sharply to

90 remove all liquid. Cells were then stained with appropriate antibodies. 10 µL of DMSO was added to the 7AAD (Bd Biosciences 559925) compensation well. Plates were then centrifuged at 1000 rpm for 2 min and flipped sharply to remove all liquid. 7AAD is added to all applicable wells and run through the flow cytometer.

3.2.6 Non-Specific Esterase Staining

OCI-AML2 cells were transduced as above (Section 3.2.1) with shControl, shHTRA2-1, and shHTRA2-2. OCI-AML2 cells were counted and prepared at a concentration of 1 x 106 cells/mL. 50-100 µL of cells were then spun onto a glass slide (VWR, Mississauga, ON 48311-703) using the cytospin centrifuge (Thermo A78300003) at 1000 rpm for 5 min. Cells were checked and adjusted for optimal seeding on the slide (~70-80% confluent). The fixation solutions were then prepared. Citrate solution (10X) within the NSE kit (Sigma-Aldrich 90A1) was diluted to 1X solution with milliQH20. In the 18mL of 1X citrate solution, 5 mL methanol (BioShop MET 302.4) and 27 mL of acetone (Sigma-Aldrich 270725) were added. In total this 50mL fixation solution was spread into two coplin jars (~25 mL each jar). Slides were placed in the fixative for 1 min and washed twice with distilled water in two separate coplin jars. Slides were air dried overnight. The next day the non-specific esterase (NSE) staining reaction solution is prepared as follows. 1 capsule of Fast blue RR salt (Diazonium compound, that couples with napthol to form black deposits) and 1 capsule of α-Napthyl acetate (is enzymatically hydrolyzed by esterases to form napthol) in 2 ml of Ethylene Glycol Monomethyl Ether is added into separate 50 mL tubes of Tris pH 7.6 buffer solution. Tubes are incubated at 37°C to dissolve all crystals. The two solutions are then mixed together, incubated at 37°C for 5 min and wrapped in aluminum foil to protect from light. Slides are then incubated in the reaction solution for 30 min. Slides are washed twice for 1 min with distilled water. After the washes the slides are stained for 10 min in Mayer’s Hematoxylin solution. Slides are then washed twice in distilled water for 1 min and dried. 2-3 drops of clear mount mounting media (Electron Microscopy Sciences, Hatfield, PA Cat# 1785-12) is added onto the slides with the coverslip and left overnight to mount. Slides are then ready for imaging via microscope at the Advanced Optical Microscopy Facility (AOMF).

Images obtained from the AOMF were analyzed using ImageJ. Images were converted to 16-bit images. The total intensity of representative images of the slide was divided by the total number

91 of cells on the image, giving an intensity per cell. T-tests were used to determine if there were significant differences between control and HTRA2 knockdown cells.

3.2.7 Engraftment of HTRA2 Knockdown TEX cells

2 x 105 TEX cells transduced with two separate shRNA sequences in lentiviral vectors targeting HTRA2 (shHTRA2-1 and shHTRA2-2 from chapter 2) or shControl (targeting GFP) were injected into the right femur of sublethally irradiated non-obese diabetic (NOD)/severe combined immunodeficiency-growth factor (SCID-GF) mice with human IL-3, GM-CSF, and Steel factor (SF) (273). Five weeks after injection, mice were sacrificed, and the percentage of human CD45+ cells was counted by flow cytometry.

3.2.8 RNA-sequencing

OCI-AML 2 cells were transduced as above (Section 3.2.1). mRNA was isolated from 2 x 106 cells using the RNeasy Plus Mini Kit (Qiagen, Hilden, Germany 74134). RNA samples were then submitted to Sick Kids TCAG facility for sequencing on the Illumina HiSeq 2500, to generate 250-270 million paired end reads of 125-bases.

3.3 Results 3.3.1 HTRA2 Knockdown Reduces the Growth of AML Cell Lines and Increases Their Differentiation

Due to the unique mitochondrial properties of AML cells and the effects of HTRA2 on mitochondrial structure, we sought to evaluate whether HTRA2 could affect leukemic cell growth and proliferation. To assess this, we knocked down HTRA2 in OCI-AML2, TEX, and HL60 cells. HTRA2 knockdown reduced the growth of OCI-AML2, TEX and HL60 cells with multiple shRNAs against HTRA2. We hypothesized that if HTRA2 was acting as a pro-apoptotic protein, which has previously been reported in other cell types, then upon HTRA2 knockdown the leukemic cells would have stagnant or increased survival. However, we observed a decrease in growth and cell viability, suggesting a different mechanism of action for HTRA2 in leukemic cells (Figure 3.1).

Figure 3.1 HTRA2 knockdown reduces growth of AML cell lines AML cell lines were transduced with lentivirus containing shRNA directed against GFP or HTRA2. Cells were selected with 2µg/mL puromycin for 3 days and counted from day 3-7 post infection using a hemocytometer. A) AML2, B) TEX, C) NB4 and D) HL60 cells have representative growth curves shown. shControl is shGFP, shHTRA2-1 is shHTRA2-1031 and shHTRA2-2 is shHTRA2-2121.

To further elucidate these findings, we used the Seahorse analyzer to assess mitochondrial function of HTRA2 knockdown leukemic cells. Surprisingly, HTRA2 knockdown had no effect on the oxygen consumption rate (OCR), extracellular acidification rate (ECAR: a measure of glycolysis) and reserve capacity (Figure 3.2 A-C). There was a slight reduction in ROS that has been shown in previous publications (Figure 3.2 D).

Figure 3.2 HTRA2 knockdown down does not affect mitochondrial function OCI-AML2 cells were transduced with lentiviral shRNA targeting GFP and HTRA2. These cells were then used to measure mitochondrial function using the Seahorse XF 96 analyzer looking at A) oxygen consumption rate (OCR), B) extracellular acidification rate (ECAR, measure of glycolysis), and C) reserve capacity. D) Mitochondrial ROS was measured using flow cytometry.

Leukemic cells have been shown to reduce growth and cell viability in culture when they are forced to differentiate. Differentiation therapy is used in acute promyelocytic leukemia (APL) which is a sub-type of AML and comprises approximately 15% of AML patients (274). The use of all-trans retinoic acid (ATRA) forces these specific leukemic cells to differentiate, but is unable to target the leukemic stem cell or initiating cell (275, 276). Thus, in APL, ATRA treatment is combined with chemotherapy to achieve a favourable prognosis (274). We performed a non-specific esterase (NSE) assay to evaluate the level of differentiation of OCI- AML2 cells upon HTRA2 knockdown. This assay measures differentiation based on the presence of a-naphthyl acetate esterase, which is found in differentiated cells such as monocytes,

94 macrophages, and histocytes. a-naphthyl acetate esterase hydrolyzes a-naphthyl acetate generating a free naphthol compound. The naphthyl compound couples with diazonium salt forming coloured deposits at the site of enzyme activity. These deposits can be measured with imaging software to determine the intensity and thereby the level of differentiation of the cells. HTRA2 knockdown OCI-AML2 cells were harvested seven days post-transduction and spun onto slides using Cytospin. The NSE assay was performed and subsequently the slides were imaged at the AOMF. Total intensity of a representative image with optimal cell density (~50% confluency) was used to calculate total intensity of the image for shControl, shHTRA2-1, and shHTRA2-2 (Figure 3.3 A-C) The total number of cells was counted using ImageJ. HTRA2 knockdown cells were significantly increased in NSE staining intensity per cell when compared with shControl cells (Figure 3.3 D).

Figure 3.3 HTRA2 knockdown in OCI-AML2 cells increases differentiation

A-C) Non-specific esterase staining was performed on HTRA2 knockdown OCI-AML2 cells and evaluated 7 days post transduction. Representative images from three separate experiments are shown. D) Image J was used to count the number of cells and perform densitometry analysis.

3.3.2 HTRA2 Knockdown Reduces Engraftment of TEX Cells in Mice

Since HTRA2 knockdown increases the differentiation of OCI-AML2 cells, we next hypothesized whether HTRA2 could reduce leukemic cell growth in vivo. To evaluate this hypothesis, we tested the effects of HTRA2 knockdown on the engraftment potential of the leukemic cell line TEX. TEX cells are an engineered human leukemic cell line derived from normal hematopoietic stem cells (272). TEX cells transduced with lentiviral shRNAs were injected into the right femur of NOD-SCID-GF mice. Measurements of leukemic cells in the left femur were used to determine the engraftment potential, a measure of leukemic stemness. HTRA2 knockdown showed reduced engraftment in the left femur using two separate shRNAs compared with the shControl (Figure 3.4 A and B).

Figure 3.4 HTRA2 knockdown reduces engraftment of TEX cells in mice TEX cells were transduced with shRNA directed towards GFP (Control) and HTRA2 (treated). Cells were injected into NOD/SCID-GF mice with IL-3, GM-CSF, and SF. Mice were sacrificed 5 weeks after injection and sorted by percentage of human cells (CD45+) within the bone marrow. The experiment was repeated twice, and a representative graph is shown for both A) shHTRA2-1 and B) shHTRA2-2.

3.3.3 Altered Gene Expression in HTRA2 Knockdown OCI-AML2 Cells

With the observed decrease in leukemic cell growth and no changes in mitochondrial function following HTRA2 knockdown, we hypothesized that HTRA2 affects leukemic cells through a potential nuclear function. There have been reports of a small nuclear pool of endogenous

HTRA2 localized within the nucleus (277, 278). Of note we also identified 11 nuclear proteins within our HTRA2 BioID dataset supporting a potential pool of nuclear HTRA2 (Figure 2.3 A).

RNA sequencing was performed on HTRA2 knockdown OCI-AML2 cells to determine whether there were changes in gene expression and if these changes correlated with hematopoietic cell differentiation. Each shRNA clone (shHTRA2-1, shHTRA2-2, shControl) was transduced separately three times totaling three biological replicates. Data was normalized to reads per kilobase million (RPKM) and averaged across the three runs. Each shRNA clone was then compared to the shControl to determine genes that were either upregulated or downregulated. Genes considered significantly up or down regulated had to achieve a log 2-fold change of +/- 1.0 and a false discovery rate (FDR) of 1%. This yielded 213 downregulated genes and 45 upregulated genes for shHTRA2-1 and 253 downregulated genes and 182 upregulated genes for shHTRA2-2 (Figure 3.5 A and B). The overlap between the two shHTRA2 clones was 86 downregulated genes and 17 of the upregulated genes (Figure 3.5 A and B). If the stringency of the log 2-fold cutoff was reduced to +/- 0.5 an increase in the number of differentially expressed genes was observed; however, a similar percentage of overlap between the two runs was seen.

We next looked at the GO enrichment terms for the up- and down-regulated genes separately. With so few genes overlapping in the upregulated genes there were few pathways identified in GO (Figure 3.5 C and D). However, the top pathway was leukocyte activation based on these eight genes: ARSB, CD68, CYBB, CXCR2, LYZ, SERPINA1, PTAFR, LRRK2, and MEFV. The top pathways for the downregulated genes included the ATF2 pathway, the HIF-1a pathway, the downstream P53 pathway and leukocyte activation. Interestingly, leukocyte activation was identified as both an up- and down-regulated pathway in HTRA2 knockdown cells. The downregulated genes in the leukocyte activation pathway were: ALDOC, ARG1, RHOH, BPI, C3AR1, DEFA4, JUN, PTPRN2, SLC2A3, NDRG1, CD300A, METTL7A, SLC44A2, HGF, CD109, and IL23A. Further validation of these genes is needed to characterize if their association with HTRA2 has any biological relevance.

Figure 3.5 Summary of RNA-sequencing data on HTRA2 knockdown in OCI-AML2 cells Overlap in gene expression changes between shHTRA2-1 and shHTRA2-2 for A) down regulated genes and B) upregulated genes. GO enrichment analysis of genes C) down or D) up

99 regulated upon HTRA2 knockdown. Metascape was used to generate GO enrichment values and graph.

Within the 11 nuclear interactors for HTRA2 was PCGF1 of the polycomb repressive complex (PRC) 1.1. This complex is heavily implicated in hematopoiesis and blood cell differentiation. Therefore, it’s possible that HTRA2 regulates leukemic cell stemness through its interaction with PCGF1. Further validation is needed to test this hypothesis.

3.4 Conclusions and Future Directions

We have found that HTRA2 knockdown can reduce the growth of leukemic cells and increase their differentiation. Furthermore, we have shown that HTRA2 knockdown leukemic cells have reduced engraftment potential in vivo. The mechanism behind the effect of HTRA2 knockdown on leukemic cell growth and differentiation remains to be determined.

RNA-seq data revealed numerous genes and pathways that may be involved in leukemic cell differentiation through HTRA2 knockdown. To further assess this, quantitative polymerase chain reaction (qPCR) should be performed for each of the differentially expressed genes within the leukocyte activation pathway. Once confirmed as differentially expressed, these genes should be investigated as potential substrates or downstream signaling events of HTRA2 through Western blot analysis and the in-vitro protease assay. Their role in leukemic cell growth should also be evaluated to assess their effect on differentiation and whether reintroduction of HTRA2 or the candidate protein itself can rescue the observed phenotype.

100

Chapter 4 BioID of other Mitochondrial Proteins

BioID of other Mitochondrial Proteins

In addition to the characterization of the IMS proteases, I assisted in performing BioID on mitochondrial proteins for five other projects. These projects included two collaborations (helping characterize STAT3 for the Trudel lab and ATP5I with the Rubenstein lab) and four projects within the Schimmer lab characterizing mitochondrial proteins: NLN, LETM1, HK2 and one non-mitochondrial protein: IPO11.

In this chapter the BioID datasets of the aforementioned mitochondrial proteins were analyzed to infer novel interactors and potential functions of these proteins. All BioID experiments were performed as described in Chapter 2. Some full data sets are not presented here in anticipation of future publication.

4.1 Neurolysin (NLN)

Neurolysin (NLN) is a mitochondrial metallopeptidase that is secreted into circulation and functions by cleaving neuropeptides and regulating physiological functions including blood pressure (279–281).

NLN was initially characterized as an IMS protease in 1995 and was part of our list when completing the full BioID dataset of IMS proteases (282). However, upon analysis of the NLN dataset there were considerable differences in comparison with the other IMS proteases. NLN was unable to identify CLPB and OPA1, markers of the IMS used in our other datasets. OPA1 is a well characterized IMS protein involved in mitochondrial dynamics (152, 283). CLPB is believed to be an IMS chaperone protein and was consistently one of the top interactors for the other seven IMS protease (223, 284). Furthermore, CLPX, a mitochondrial matrix chaperone protein that unfolds proteins for degradation by CLPP, was identified as an interactor by NLN but none of the other seven IMS proteases. This suggested a potential mitochondrial matrix localization for NLN in contrast to the reported IMS localization.

101

Additionally, the entire mitochondrial proteome was elucidated by Dr. Ting’s lab at MIT through the use of the APEX technique described in Chapter 1. APEX was used to identify the specific proteome of the mitochondrial matrix and IMS in two separate publications (223, 224). NLN was identified in the mitochondrial matrix proteome; however, not the IMS proteome.

Within our dataset we manually annotated 72 of the 86 proteins identified to the mitochondrial inner membrane or the mitochondrial matrix (Figure 4.1, Table 4.1). This included a large proportion of complex I of the ETC. Complex I contains an inner membrane arm and a mitochondrial matrix arm. All of the interactors identified by NLN were part of the mitochondrial matrix arm, suggesting the interaction with this complex occurs on the mitochondrial matrix side of the inner membrane. GO enrichment analysis further identified pathways from the mitochondrial matrix such as gene expression (Figure 4.2). Further confirmation of NLN’s localization to the mitochondrial matrix was observed in 2017, when NLN was reported to reside within the mitochondrial matrix via mitochondrial sub-fractionation and Western blot analysis (285).

The BioID of NLN resulted in the PhD project lead by Sara Mirali. She discovered the role of NLN on ETC super complex formation and its role in AML (286).

102

Figure 4.1 Interactome of neurolysin in Flp-In T-REx 293 cells

Mitochondrial proteins are manually annotated in light blue and non-mitochondrial interactors in dark blue. Pathway groupings were manually annotated.

Table 4.1 Complete list of interactors identified by BioID for NLN Interactors identified are sorted by total peptide counts across two biological and two technical replicates, and significance analysis of interactome (SAINT) using a Bayesian false discovery rate (BFDR) <1%.

103

Complete list of NLN's interactors identified by BioID-MS NLN Pool A Pool B Gene Name Full Name Top 2 Controls Tech #1 Tech #2 Tech #1 Tech #2 Total SAINT BFDR birA Biotin ligase ( E. coli ) 2815 2807 607 582 584 541 2314 0.79 NLN Neuroysin 0 0 290 265 285 263 1103 0 IARS2 isoleucyl-tRNA synthetase 2, mitochondrial 4 4 168 158 169 158 653 1 0 ACOT1 acyl-CoA thioesterase 1 43 42 127 126 122 127 502 1 0 LRPPRC leucine rich pentatricopeptide repeat containing 18 14 96 95 102 88 381 1 0 LETM1 leucine zipper and EF-hand containing transmembrane protein 1 0 0 92 84 76 74 326 1 0 GLUD1 glutamate dehydrogenase 1 21 18 74 72 59 57 262 1 0 NDUFS2 NADH:ubiquinone oxidoreductase core subunit S2 3 3 61 62 50 44 217 1 0 ETFA electron transfer flavoprotein subunit alpha 14 7 59 57 52 46 214 1 0 NDUFS3 NADH:ubiquinone oxidoreductase core subunit S3 10 7 58 50 50 52 210 1 0 NDUFS1 NADH:ubiquinone oxidoreductase core subunit S1 6 5 45 52 46 44 187 1 0 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 15 14 45 47 50 43 185 1 0 AFG3L2 AFG3 like matrix AAA peptidase subunit 2 8 8 41 40 41 39 161 1 0 CLPX caseinolytic mitochondrial matrix peptidase chaperone subunit 6 4 29 36 28 29 122 1 0 NDUFA5 NADH:ubiquinone oxidoreductase subunit A5 7 5 29 28 29 20 106 1 0 TIMM44 translocase of inner mitochondrial membrane 44 8 6 25 26 27 27 105 1 0 ETFB electron transfer flavoprotein subunit beta 5 4 26 24 26 24 100 1 0 ATP5F1 ATP synthase peripheral stalk-membrane subunit b 4 2 25 21 23 21 90 1 0 CBR1 carbonyl reductase 1 6 4 21 18 23 20 82 1 0 HSPE1 heat shock protein family E (Hsp10) member 1 0 0 20 19 15 20 74 1 0 VARS2 valyl-tRNA synthetase 2, mitochondrial 0 0 18 17 20 16 71 1 0 MDH2 malate dehydrogenase 2 0 0 20 19 13 17 69 1 0 ACAD9 acyl-CoA dehydrogenase family member 9 0 0 18 20 15 16 69 1 0 GLS glutaminase 0 0 19 16 16 14 65 1 0 PPIF peptidylprolyl isomerase F 0 0 17 15 17 14 63 1 0 SLC30A9 solute carrier family 30 member 9 0 0 15 16 13 18 62 1 0 TEFM transcription elongation factor, mitochondrial 0 0 22 10 15 14 61 1 0 POLDIP2 DNA polymerase delta interacting protein 2 2 0 18 13 13 16 60 1 0 NDUFS8 NADH:ubiquinone oxidoreductase core subunit S8 0 0 16 13 13 18 60 1 0 NDUFAF4 NADH:ubiquinone oxidoreductase complex assembly factor 4 0 0 13 15 15 14 57 1 0 TACO1 translational activator of cytochrome c oxidase I 0 0 14 14 16 12 56 1 0 PYCR1 pyrroline-5-carboxylate reductase 1 0 0 11 14 15 13 53 1 0 ATPAF1 ATP synthase mitochondrial F1 complex assembly factor 1 0 0 14 18 8 12 52 1 0 PNPT1 polyribonucleotide nucleotidyltransferase 1 0 0 14 14 13 10 51 1 0 PYCR2 pyrroline-5-carboxylate reductase 2 0 0 12 14 9 12 47 1 0 BCS1L BCS1 homolog, ubiquinol-cytochrome c reductase complex chaperone 0 0 13 16 12 6 47 1 0 ECHS1 enoyl-CoA hydratase, short chain 1 0 0 14 12 10 8 44 1 0 NDUFV3 NADH:ubiquinone oxidoreductase subunit V3 0 0 13 11 10 10 44 1 0 GFM1 G elongation factor mitochondrial 1 0 0 9 13 8 8 38 1 0 NDUFA12 NADH:ubiquinone oxidoreductase subunit A12 0 0 9 8 10 10 37 1 0 MTIF2 mitochondrial translational initiation factor 2 0 0 10 9 9 9 37 1 0 KIAA0391 KIAA0391 0 0 11 7 9 8 35 1 0 PPA2 pyrophosphatase (inorganic) 2 0 0 14 6 9 4 33 1 0 PDPR pyruvate dehydrogenase phosphatase regulatory subunit 0 0 8 12 7 6 33 1 0 MRPS26 mitochondrial ribosomal protein S26 0 0 9 8 6 9 32 1 0 SDHA succinate dehydrogenase complex flavoprotein subunit A 0 0 5 8 10 8 31 1 0 NDUFAF2 NADH:ubiquinone oxidoreductase complex assembly factor 2 0 0 11 6 6 7 30 1 0 NUDT19 nudix hydrolase 19 0 0 8 5 8 8 29 1 0 MIF macrophage migration inhibitory factor 0 0 9 7 5 7 28 1 0 ACADSB acyl-CoA dehydrogenase short/branched chain 0 0 8 7 6 5 26 1 0 COQ5 coenzyme Q5, methyltransferase 0 0 5 6 7 7 25 1 0 THEM4 thioesterase superfamily member 4 0 0 6 5 6 6 23 1 0 C20orf7 NADH:ubiquinone oxidoreductase complex assembly factor 5 0 0 6 5 7 4 22 1 0 NDUFA2 NADH:ubiquinone oxidoreductase subunit A2 0 0 6 5 5 6 22 1 0 NDUFAF3 NADH:ubiquinone oxidoreductase complex assembly factor 3 0 0 5 7 5 5 22 1 0 MMAB metabolism of cobalamin associated B 0 0 5 4 7 5 21 1 0 POLRMT RNA polymerase mitochondrial 0 0 8 3 6 4 21 1 0 ECSIT ECSIT signalling integrator 0 0 4 7 4 5 20 1 0 DCXR dicarbonyl and L-xylulose reductase 0 0 5 6 5 4 20 1 0 ERAL1 Era like 12S mitochondrial rRNA chaperone 1 0 0 6 4 5 4 19 1 0 MRPS24 mitochondrial ribosomal protein S24 0 0 5 4 5 5 19 1 0 NDUFV2 NADH:ubiquinone oxidoreductase core subunit V2 3 3 11 13 14 14 52 0.99 0 KIAA0564 von Willebrand factor A domain containing 8 2 0 12 12 10 12 46 0.99 0 NDUFS7 NADH:ubiquinone oxidoreductase core subunit S7 2 2 9 8 12 12 41 0.99 0 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate0 cyclohydrolase0 6 4 3 3 16 0.99 0 PREPL prolyl endopeptidase like 0 0 4 4 3 4 15 0.99 0 SLIRP SRA stem-loop interacting RNA binding protein 0 0 4 4 4 2 14 0.99 0 PTCD3 pentatricopeptide repeat domain 3 9 9 27 27 29 28 111 0.98 0 PEX19 peroxisomal biogenesis factor 19 5 3 22 16 16 14 68 0.98 0 C17orf80 chromosome 17 open reading frame 80 0 0 8 6 4 2 20 0.98 0 IBA57 IBA57, iron-sulfur cluster assembly 0 0 4 4 6 2 16 0.98 0 NFS1 NFS1, cysteine desulfurase 0 0 4 3 4 2 13 0.97 0 RAC1 Rac family small GTPase 1 0 0 3 2 4 4 13 0.97 0 MRPL21 mitochondrial ribosomal protein L21 0 0 4 3 2 3 12 0.97 0 MUT methylmalonyl-CoA mutase 0 0 4 3 3 2 12 0.97 0 SHMT2 serine hydroxymethyltransferase 2 29 16 83 87 79 81 330 0.96 0 ME2 malic enzyme 2 2 0 9 9 8 12 38 0.96 0 AK2 adenylate kinase 2 2 0 7 10 10 12 39 0.95 0 SUCLG2 succinate-CoA ligase GDP-forming beta subunit 0 0 3 3 2 2 10 0.95 0 LARS2 leucyl-tRNA synthetase 2, mitochondrial 2 0 7 9 10 8 34 0.93 0 NDUFV1 NADH:ubiquinone oxidoreductase core subunit V1 4 3 12 10 14 13 49 0.91 0.01 PLD3 phospholipase D family member 3 0 0 2 2 2 2 8 0.91 0.01 UBQLN1 ubiquilin 1 2 0 8 7 6 9 30 0.89 0.01 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 2 0 9 8 6 5 28 0.84 0.01 NUDCD3 NudC domain containing 3 13 11 32 38 32 38 140 0.77 0.01 MTHFD1L methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1 like 5 5 15 16 14 16 61 0.76 0.01 CORO7-PAM16 CORO7-PAM16 readthrough 0 0 0 9 9 12 30 0.75 0.01 RTN4IP1 reticulon 4 interacting protein 1 0 0 9 8 5 0 22 0.75 0.01

104

5-H6A-1428517: 7hH citric aciG (7CA) cycOH anG rHsSiratRry HOHctrRn transSRrt G2:0140053: PitRchRnGriaO gHnH HxSrHssiRn G2:0043648: GicarbRxyOic aciG PHtabROic SrRcHss G2:0006520: cHOOuOar aPinR aciG PHtabROic SrRcHss G2:0000959: PitRchRnGriaO 51A PHtabROic SrRcHss G2:0032787: PRnRcarbRxyOic aciG PHtabROic SrRcHss 5-H6A-379726: 0itRchRnGriaO t51A aPinRacyOatiRn 000141: C1-unit intHrcRnvHrsiRn, HuNaryRtHs G2:1990542: PitRchRnGriaO transPHPbranH transSRrt G2:0033013: tHtraSyrrROH PHtabROic SrRcHss G2:0006457: SrRtHin fROGing G2:0006979: rHsSRnsH tR RxiGativH strHss G2:0021762: substantia nigra GHvHORSPHnt G2:0006140: rHguOatiRn Rf nucOHRtiGH PHtabROic SrRcHss G2:0051881: rHguOatiRn Rf PitRchRnGriaO PHPbranH SRtHntiaO 5-H6A-9609507: 3rRtHin ORcaOizatiRn 5-H6A-5628897: 7353 5HguOatHs 0HtabROic GHnHs G2:0006733: RxiGRrHGuctiRn cRHnzyPH PHtabROic SrRcHss G2:0001676: ORng-chain fatty aciG PHtabROic SrRcHss

0 5 10 15 20 25 30 35 40 -ORg10(3)

Figure 4.2 GO enrichment analysis of NLN interactome Metascape was used to generate GO enrichment values and graph.

4.2 Leucine zipper-EF-hand containing transmembrane protein 1 (LETM1)

A hypothesized mechanism for NLN’s effect on supercomplex formation is through its interaction with leucine zipper-EF-hand containing transmembrane protein 1 (LETM1). LETM1 was identified as one of the top interactors in the NLN BioID dataset (Table 4.1) and has been previously shown to affect supercomplex formation (287). Supercomplex formation was further evaluated in our lab in AML cells and affected growth and stemness of these cells (286).

LETM1 is known to be involved in Ca+2/H+ transport, glucose metabolism and Wolf–Hirschhorn syndrome (WHS), a disease characterized by a distinct facial phenotype and intellectual disability (288–290). LETM1 contains a 114 amino acid mitochondrial targeting sequence and a single transmembrane domain (291, 292). LETM1 is believed to form a homo-hexameric structure to transport Ca+2 that can have an open and closed conformational state dependent on the pH (288). LETM1 is known to form a major and a minor complex when run on a blue native- PAGE (287). The lone known interactor, mitochondrial chaperone BCS1 (BCS1L), is essential in the formation of LETM1 major and minor complexes; however, the components of the LETM1 complexes are unknown (287).

105

Therefore, determining the components of the major and minor complex of LETM1 could help elucidate the mechanism(s) regulating supercomplex formation. To determine these components, we performed BioID alongside a gel-excision MS experiment. BioID was performed as described in Chapter 2. The gel excision experiment was performed in LETM1 knockdown and LETM1 overexpressing Flp-In T-REx 293 cells. The cells were lysed, run on a blue-native PAGE gel and probed for LETM1. The bands corresponding to the LETM1 major and minor complexes were cut out and sent for analysis via mass spectrometry (Figure 4.3 A). In the LETM1 knockdowns there were no major and minor complexes, revealing an effective knockdown. Thus, when the proteins were compared between the overexpressed and knockdown lanes, the proteins that differed revealed potential components of the LETM1 complexes. This identified 94 proteins for the minor complex and 140 proteins for the major complex (Figure 4.3 B).

106

Figure 4.3 Gel-excision MS experiment overview A) LETM1 overexpressing and LETM1 knockdown Flp-In T-REx 293 cells were run on a blue- native PAGE. The minor and major complexes were cut into strips labeled 2-3 and 4-5 respectively. The gel strips were then digested and analyzed through MS. B) Proteins identified as above a 2-fold increase in the LETM1 overexpression cells compared with the LETM1 knockout cells are listed according to the strip they originated from.

107

We next performed BioID on LETM1 to narrow down the potential list of proteins for the major and minor complex. BioID identified 283 putative interactors for LETM1 of which 262 were mitochondrial (Table 4.2). Additionally, 146 interactors were annotated as mitochondria inner membrane and 137 were annotated as mitochondrial matrix, suggesting correct localization of our LETM1-BirA*FLAG fusion protein at the inner membrane was observed (when added together those numbers are above the total number of mitochondrial interactors due to dual annotations for some proteins). We identified the BCS1L, the only bona fide interactor known for LETM1. GO enrichment analysis of the full 283 protein interactome identified the major mitochondrial pathways such as mitochondrial gene expression, mitochondrial organization and the TCA cycle (Figure 4.4). However, since the controls were not mitochondrial localized, we further compared the interactome against another mitochondrial matrix protein CLPP. This identified a 169 protein overlap with 114 unique interactors to LETM1 in comparison with CLPP (Figure 4.5 A). When analyzed separately for GO enrichment, the 114 interactors identified pathways closely associated with LETM1 function including cristae formation, respiratory complex assembly and mitochondrial calcium ion transport (Figure 4.5 B). This was used to reduce some potential background interactors because the LETM1 interactome was so large. However, the removal of true potential interactors of LETM1 based on their identification in the CLPP interactome was possible.

Table 4.2 Complete list of interactors identified by BioID for LETM1 Interactors identified are sorted by total peptide counts across two biological and two technical replicates, and significance analysis of interactome (SAINT) using a Bayesian false discovery rate (BFDR) <1%.

108

LETM1 Pool A Pool B Gene Name Full Name Top 2 Controls Tech #1 Tech #2 Tech #1 Tech #2 Total SAINT BFDR BirA Biotin Ligase 2815 2802 4452 4483 4048 4212 17195 0 0.6 LETM1 leucine zipper and EF-hand containing transmembrane protein 1 0 0 4446 4490 4732 4634 18302

ATP5B ATP synthase F1 subunit beta 134 115 411 401 459 431 1702 1 0 ACOT1 acyl-CoA thioesterase 1 43 42 372 378 434 427 1611 1 0 LRPPRC leucine rich pentatricopeptide repeat containing 18 14 379 399 414 405 1597 1 0 ATP5A1 ATP synthase F1 subunit alpha 145 135 403 414 370 399 1586 1 0 TOMM40 translocase of outer mitochondrial membrane 40 40 35 370 378 381 385 1514 1 0 NDUFS2 NADH:ubiquinone oxidoreductase core subunit S2 3 3 306 328 366 338 1338 1 0 SHMT2 serine hydroxymethyltransferase 2 29 16 263 277 292 275 1107 1 0 AFG3L2 AFG3 like matrix AAA peptidase subunit 2 8 8 257 266 268 256 1047 1 0 NDUFS1 NADH:ubiquinone oxidoreductase core subunit S1 6 5 137 167 188 171 663 1 0 PHB prohibitin 33 31 148 144 179 141 612 1 0 IARS2 isoleucyl-tRNA synthetase 2, mitochondrial 4 4 130 123 131 136 520 1 0 NDUFS3 NADH:ubiquinone oxidoreductase core subunit S3 10 7 121 120 136 130 507 1 0 ABCB7 ATP binding cassette subfamily B member 7 8 5 101 130 135 132 498 1 0 HSD17B10 hydroxysteroid 17-beta dehydrogenase 10 35 26 109 124 126 130 489 1 0 NDUFA9 NADH:ubiquinone oxidoreductase subunit A9 19 16 100 116 120 119 455 1 0 TIMM44 translocase of inner mitochondrial membrane 44 8 6 113 111 117 110 451 1 0 RPS12 ribosomal protein S12 17 13 100 122 106 104 432 1 0 SLC30A9 solute carrier family 30 member 9 0 0 103 105 104 94 406 1 0 NDUFAF2 NADH:ubiquinone oxidoreductase complex assembly factor 2 0 0 102 104 99 100 405 1 0 NNT nicotinamide nucleotide transhydrogenase 11 8 94 97 79 95 365 1 0 ECH1 enoyl-CoA hydratase 1 22 22 82 90 89 86 347 1 0 CKMT1B creatine kinase, mitochondrial 1B 0 0 90 93 86 75 344 1 0 PTCD3 pentatricopeptide repeat domain 3 9 9 76 80 84 91 331 1 0 MRPS31 mitochondrial ribosomal protein S31 10 8 83 80 82 85 330 1 0 DNAJC11 DnaJ heat shock protein family (Hsp40) member C11 16 15 70 71 84 84 309 1 0 ATPAF1 ATP synthase mitochondrial F1 complex assembly factor 1 0 0 64 68 78 75 285 1 0 ACADVL acyl-CoA dehydrogenase very long chain 4 0 68 72 71 71 282 1 0 CLPB caseinolytic mitochondrial matrix peptidase chaperone subunit B3 2 66 68 68 77 279 1 0 MDH2 malate dehydrogenase 2 0 0 63 59 73 73 268 1 0 NDUFAF4 NADH:ubiquinone oxidoreductase complex assembly factor 4 0 0 62 65 66 66 259 1 0 GLUD1 glutamate dehydrogenase 1 21 18 58 64 66 63 251 1 0 PYCR1 pyrroline-5-carboxylate reductase 1 0 0 63 59 67 59 248 1 0 ECHS1 enoyl-CoA hydratase, short chain 1 0 0 65 60 58 60 243 1 0 IMMT inner membrane mitochondrial protein 6 5 68 59 55 61 243 1 0 DIABLO diablo IAP-binding mitochondrial protein 10 9 67 66 51 56 240 1 0 STOML2 stomatin like 2 17 13 60 67 57 56 240 1 0 BCS1L BCS1 homolog, ubiquinol-cytochrome c reductase complex chaperone0 0 53 59 57 64 233 1 0 RTN4IP1 reticulon 4 interacting protein 1 0 0 61 52 58 54 225 1 0 ACAD9 acyl-CoA dehydrogenase family member 9 0 0 54 58 53 53 218 1 0 PRDX3 peroxiredoxin 3 17 16 46 57 58 57 218 1 0 GLS glutaminase 0 0 44 59 52 59 214 1 0 PTPMT1 protein tyrosine phosphatase mitochondrial 1 0 0 51 49 59 55 214 1 0 NDUFA5 NADH:ubiquinone oxidoreductase subunit A5 7 5 49 52 57 54 212 1 0 SDHA succinate dehydrogenase complex flavoprotein subunit A 0 0 45 52 57 51 205 1 0 IBA57 iron-sulfur cluster assembly factor IBA57 0 0 54 54 45 48 201 1 0 NDUFV2 NADH:ubiquinone oxidoreductase core subunit V2 3 3 51 51 48 49 199 1 0 OAT ornithine aminotransferase 13 13 45 51 48 51 195 1 0 SSBP1 single stranded DNA binding protein 1 6 4 40 44 58 53 195 1 0 TACO1 translational activator of cytochrome c oxidase I 0 0 42 49 50 54 195 1 0 RG9MTD1 tRNA methyltransferase 10C, mitochondrial RNase P subunit 12 8 50 47 48 47 192 1 0 NDUFS8 NADH:ubiquinone oxidoreductase core subunit S8 0 0 48 44 44 44 180 1 0 KIAA0564 von Willebrand factor A domain containing 8 2 0 43 47 36 46 172 1 0 NDUFV1 NADH:ubiquinone oxidoreductase core subunit V1 4 3 43 38 46 42 169 1 0 PNPT1 polyribonucleotide nucleotidyltransferase 1 0 0 43 44 41 41 169 1 0 NDUFA12 NADH:ubiquinone oxidoreductase subunit A12 0 0 47 41 37 40 165 1 0 NDUFV3 NADH:ubiquinone oxidoreductase subunit V3 0 0 39 41 40 41 161 1 0 COX15 cytochrome c oxidase assembly homolog COX15 0 0 37 36 46 39 158 1 0 CPT2 carnitine palmitoyltransferase 2 0 0 39 48 38 33 158 1 0 MRS2 magnesium transporter MRS2 0 0 43 34 40 41 158 1 0 NME4 NME/NM23 nucleoside diphosphate kinase 4 2 2 43 41 36 38 158 1 0 PNPLA8 patatin like phospholipase domain containing 8 0 0 38 46 34 38 156 1 0 MAVS mitochondrial antiviral signaling protein 10 10 41 38 35 33 147 1 0 PET112 glutamyl-tRNA amidotransferase subunit B 0 0 29 40 41 37 147 1 0 NDUFAF3 NADH:ubiquinone oxidoreductase complex assembly factor 3 0 0 36 36 35 34 141 1 0 PNMA2 PNMA family member 2 0 0 24 41 40 36 141 1 0 QRSL1 glutaminyl-tRNA amidotransferase subunit QRSL1 0 0 34 36 35 34 139 1 0 MMAB metabolism of cobalamin associated B 0 0 36 33 31 38 138 1 0 ABHD10 abhydrolase domain containing 10 0 0 29 30 39 37 135 1 0 PAM16 presequence translocase associated motor 16 0 0 35 38 30 32 135 1 0 PYCR2 pyrroline-5-carboxylate reductase 2 0 0 33 33 38 31 135 1 0 NFS1 NFS1 cysteine desulfurase 0 0 28 29 37 38 132 1 0 PPA2 inorganic pyrophosphatase 2 0 0 32 30 37 31 130 1 0 ALDH4A1 aldehyde dehydrogenase 4 family member A1 0 0 41 32 27 27 127 1 0

109

MTHFD1L methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 15 like 5 30 31 32 34 127 1 0 FECH ferrochelatase 0 0 27 35 30 34 126 1 0 THEM4 thioesterase superfamily member 4 0 0 30 31 27 37 125 1 0 C17orf80 chromosome 17 open reading frame 80 0 0 33 35 32 22 122 1 0 CPOX coproporphyrinogen oxidase 0 0 30 28 27 36 121 1 0 MRPS26 mitochondrial ribosomal protein S26 0 0 36 29 26 28 119 1 0 ABCB10 ATP binding cassette subfamily B member 10 4 2 26 29 26 34 115 1 0 SLC25A40 solute carrier family 25 member 40 0 0 32 28 26 29 115 1 0 MRPL45 mitochondrial ribosomal protein L45 4 2 30 26 28 30 114 1 0 TMEM43 transmembrane protein 43 2 0 26 27 26 34 113 1 0 MRPL44 mitochondrial ribosomal protein L44 6 2 29 28 29 26 112 1 0 NDUFS7 NADH:ubiquinone oxidoreductase core subunit S7 2 2 26 30 28 27 111 1 0 FLAD1 flavin adenine dinucleotide synthetase 1 8 5 29 33 22 25 109 1 0 HAX1 HCLS1 associated protein X-1 5 4 24 31 27 27 109 1 0 MRPS22 mitochondrial ribosomal protein S22 5 4 25 25 22 33 105 1 0 SLC25A12 solute carrier family 25 member 12 4 4 29 25 24 27 105 1 0 ECSIT ECSIT signaling integrator 0 0 26 27 24 27 104 1 0 OXA1L OXA1L mitochondrial inner membrane protein 0 0 26 26 28 24 104 1 0 NT5DC2 5'-nucleotidase domain containing 2 7 7 27 25 27 24 103 1 0 HSDL2 hydroxysteroid dehydrogenase like 2 5 4 24 29 25 22 100 1 0 AK2 adenylate kinase 2 2 0 22 24 30 22 98 1 0 LOC100507855 #N/A 0 0 23 27 21 23 94 1 0 HINT2 histidine triad nucleotide binding protein 2 0 0 21 27 19 25 92 1 0 ACAA2 acetyl-CoA acyltransferase 2 0 0 24 26 20 21 91 1 0 MRPL12 mitochondrial ribosomal protein L12 6 5 21 28 21 21 91 1 0 COX5A cytochrome c oxidase subunit 5A 2 0 18 23 27 22 90 1 0 DNAJC19 DnaJ heat shock protein family (Hsp40) member C19 0 0 24 21 21 23 89 1 0 GFM1 G elongation factor mitochondrial 1 0 0 25 21 23 19 88 1 0 AIFM1 apoptosis inducing factor mitochondria associated 1 4 4 18 20 22 25 85 1 0 SLC25A4 solute carrier family 25 member 4 5 4 23 19 21 22 85 1 0 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 2 0 20 19 22 24 85 1 0 CCDC58 coiled-coil domain containing 58 0 0 23 20 20 21 84 1 0 PPIF peptidylprolyl isomerase F 0 0 18 22 24 20 84 1 0 RMND1 required for meiotic nuclear division 1 homolog 0 0 19 19 24 22 84 1 0 DLST dihydrolipoamide S-succinyltransferase 3 2 22 22 20 18 82 1 0 ETFB electron transfer flavoprotein subunit beta 5 4 25 20 17 19 81 1 0 NDUFA8 NADH:ubiquinone oxidoreductase subunit A8 0 0 20 21 24 16 81 1 0 PDK3 pyruvate dehydrogenase kinase 3 4 2 18 21 19 23 81 1 0 ERAL1 Era like 12S mitochondrial rRNA chaperone 1 0 0 16 18 29 17 80 1 0 ACADM acyl-CoA dehydrogenase medium chain 0 0 19 19 20 21 79 1 0 SAMM50 SAMM50 sorting and assembly machinery component 2 0 22 18 20 19 79 1 0 NDUFA2 NADH:ubiquinone oxidoreductase subunit A2 0 0 18 18 21 21 78 1 0 NIPSNAP1 nipsnap homolog 1 2 0 22 17 17 21 77 1 0 HSPE1 heat shock protein family E (Hsp10) member 1 0 0 19 22 18 17 76 1 0 ME2 malic enzyme 2 2 0 22 19 18 17 76 1 0 CARS2 cysteinyl-tRNA synthetase 2, mitochondrial 0 0 18 17 19 21 75 1 0 NDUFS6 NADH:ubiquinone oxidoreductase subunit S6 0 0 19 18 17 20 74 1 0 SELRC1 cytochrome c oxidase assembly factor 7 (putative) 0 0 20 19 17 18 74 1 0 ACO2 aconitase 2 0 0 19 17 18 19 73 1 0 NARS2 asparaginyl-tRNA synthetase 2, mitochondrial 0 0 20 18 15 18 71 1 0 PDE12 phosphodiesterase 12 0 0 17 18 16 20 71 1 0 LACTB lactamase beta 0 0 20 16 17 16 69 1 0 ALDH2 aldehyde dehydrogenase 2 family member 0 0 17 13 17 21 68 1 0 GTPBP3 GTP binding protein 3, mitochondrial 0 0 17 16 15 19 67 1 0 MRPS36 mitochondrial ribosomal protein S36 0 0 15 16 17 19 67 1 0 NDUFS4 NADH:ubiquinone oxidoreductase subunit S4 0 0 19 19 14 15 67 1 0 SDHB succinate dehydrogenase complex iron sulfur subunit B 0 0 16 15 17 18 66 1 0 SLIRP SRA stem-loop interacting RNA binding protein 0 0 14 19 15 18 66 1 0 OGDH oxoglutarate dehydrogenase 0 0 16 14 16 19 65 1 0 OXCT1 3-oxoacid CoA-transferase 1 0 0 16 17 21 11 65 1 0 RNMTL1 mitochondrial rRNA methyltransferase 3 0 0 14 18 16 17 65 1 0 ATP5F1 ATP synthase peripheral stalk-membrane subunit b 4 2 15 14 17 17 63 1 0 COX11 cytochrome c oxidase copper chaperone COX11 0 0 11 17 19 16 63 1 0 C20orf7 NADH:ubiquinone oxidoreductase complex assembly factor 5 0 0 15 17 15 15 62 1 0 PGS1 phosphatidylglycerophosphate synthase 1 0 0 16 16 16 14 62 1 0 ACADSB acyl-CoA dehydrogenase short/branched chain 0 0 13 16 19 13 61 1 0 OXSM 3-oxoacyl-ACP synthase, mitochondrial 0 0 16 20 12 13 61 1 0 GCDH glutaryl-CoA dehydrogenase 0 0 18 15 15 12 60 1 0 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2,0 methenyltetrahydrofolate0 14 cyclohydrolase13 14 15 56 1 0 AK3 adenylate kinase 3 0 0 14 12 18 11 55 1 0 TIMM8A translocase of inner mitochondrial membrane 8A 0 0 13 12 15 14 54 1 0 BCL2L13 BCL2 like 13 0 0 14 14 13 12 53 1 0 NDUFAF1 NADH:ubiquinone oxidoreductase complex assembly factor 1 0 0 13 12 13 15 53 1 0 FASTKD2 FAST kinase domains 2 2 0 14 12 12 14 52 1 0 SPRYD4 SPRY domain containing 4 0 0 8 13 17 14 52 1 0 C8orf82 chromosome 8 open reading frame 82 0 0 11 12 16 12 51 1 0 CYC1 cytochrome c1 0 0 13 14 13 11 51 1 0 NDUFA6 NADH:ubiquinone oxidoreductase subunit A6 0 0 14 10 13 14 51 1 0 AARS2 alanyl-tRNA synthetase 2, mitochondrial 0 0 11 15 15 9 50 1 0

110

WARS2 tryptophanyl tRNA synthetase 2, mitochondrial 0 0 8 13 17 12 50 1 0 GATC glutamyl-tRNA amidotransferase subunit C 0 0 13 12 11 13 49 1 0 YME1L1 YME1 like 1 ATPase 0 0 13 13 13 10 49 1 0 C2orf56 NADH:ubiquinone oxidoreductase complex assembly factor 7 0 0 16 12 9 11 48 1 0 MRPL21 mitochondrial ribosomal protein L21 0 0 9 12 13 14 48 1 0 SUPV3L1 Suv3 like RNA helicase 0 0 12 13 9 14 48 1 0 ATPAF2 ATP synthase mitochondrial F1 complex assembly factor 2 0 0 14 13 9 10 46 1 0 GRPEL1 GrpE like 1, mitochondrial 0 0 11 11 13 11 46 1 0 ALAS1 5'-aminolevulinate synthase 1 0 0 11 14 8 12 45 1 0 GTPBP10 GTP binding protein 10 0 0 13 11 10 11 45 1 0 COX5B cytochrome c oxidase subunit 5B 0 0 11 11 10 11 43 1 0 VARS2 valyl-tRNA synthetase 2, mitochondrial 0 0 9 10 10 13 42 1 0 HARS2 histidyl-tRNA synthetase 2, mitochondrial 0 0 13 13 8 7 41 1 0 THNSL1 threonine synthase like 1 0 0 10 8 12 11 41 1 0 TTC19 tetratricopeptide repeat domain 19 0 0 10 8 14 9 41 1 0 USP30 ubiquitin specific peptidase 30 0 0 9 13 9 10 41 1 0 EXD2 exonuclease 3'-5' domain containing 2 0 0 13 9 11 5 38 1 0 NDUFA7 NADH:ubiquinone oxidoreductase subunit A7 0 0 10 7 10 10 37 1 0 FAM162A family with sequence similarity 162 member A 0 0 10 7 10 9 36 1 0 MRPL46 mitochondrial ribosomal protein L46 0 0 9 10 9 8 36 1 0 POLRMT RNA polymerase mitochondrial 0 0 7 10 10 9 36 1 0 TIMM13 translocase of inner mitochondrial membrane 13 0 0 8 11 8 9 36 1 0 NXN nucleoredoxin 0 0 10 9 8 8 35 1 0 CLYBL citrate lyase beta like 0 0 6 9 11 8 34 1 0 HADH hydroxyacyl-CoA dehydrogenase 0 0 7 9 10 8 34 1 0 KIAA0391 protein only RNase P catalytic subunit 0 0 8 11 5 10 34 1 0 MRPL20 mitochondrial ribosomal protein L20 0 0 11 9 5 9 34 1 0 ADCK4 coenzyme Q8B 0 0 8 9 6 10 33 1 0 LYRM4 LYR motif containing 4 0 0 9 8 9 7 33 1 0 MRPS24 mitochondrial ribosomal protein S24 0 0 7 9 10 7 33 1 0 UQCC ubiquinol-cytochrome c reductase complex assembly factor 1 0 0 10 8 6 8 32 1 0 MFF mitochondrial fission factor 0 0 6 9 7 9 31 1 0 MTX2 metaxin 2 0 0 9 5 10 7 31 1 0 MARC2 #N/A 0 0 7 8 7 8 30 1 0 XPNPEP3 X-prolyl aminopeptidase 3 0 0 5 9 8 8 30 1 0 PMPCA peptidase, mitochondrial processing alpha subunit 0 0 7 6 8 8 29 1 0 MRRF mitochondrial ribosome recycling factor 0 0 5 7 8 8 28 1 0 DCXR dicarbonyl and L-xylulose reductase 0 0 8 5 7 7 27 1 0 FAM54A mitochondrial fission regulator 2 0 0 8 7 6 6 27 1 0 FOXRED1 FAD dependent oxidoreductase domain containing 1 0 0 8 7 4 8 27 1 0 TMEM126B transmembrane protein 126B 0 0 7 6 7 7 27 1 0 UQCRB ubiquinol-cytochrome c reductase binding protein 0 0 7 9 4 7 27 1 0 C20orf72 mitochondrial genome maintenance exonuclease 1 0 0 9 7 4 6 26 1 0 DHTKD1 dehydrogenase E1 and transketolase domain containing 1 0 0 7 4 6 9 26 1 0 HIBCH 3-hydroxyisobutyryl-CoA hydrolase 0 0 6 7 6 7 26 1 0 ATP5J ATP synthase peripheral stalk subunit F6 0 0 7 6 8 4 25 1 0 FAM210A family with sequence similarity 210 member A 0 0 4 8 8 5 25 1 0 IDE insulin degrading enzyme 0 0 6 6 7 6 25 1 0 SUCLG2 succinate-CoA ligase GDP-forming beta subunit 0 0 6 6 8 5 25 1 0 TMEM65 transmembrane protein 65 0 0 6 7 6 6 25 1 0 EARS2 glutamyl-tRNA synthetase 2, mitochondrial 0 0 4 7 4 9 24 1 0 MRPL13 mitochondrial ribosomal protein L13 0 0 5 6 7 6 24 1 0 SCO1 synthesis of cytochrome C oxidase 1 0 0 6 6 5 7 24 1 0 TOMM70A translocase of outer mitochondrial membrane 70 0 0 9 5 4 6 24 1 0 BCKDHB branched chain keto acid dehydrogenase E1 subunit beta 0 0 7 4 6 6 23 1 0 GUF1 GUF1 homolog, GTPase 0 0 6 6 7 4 23 1 0 MRPS25 mitochondrial ribosomal protein S25 0 0 5 7 7 4 23 1 0 MUT methylmalonyl-CoA mutase 0 0 6 6 5 6 23 1 0 GLRX5 glutaredoxin 5 0 0 6 6 4 6 22 1 0 MICU1 mitochondrial calcium uptake 1 0 0 4 6 4 8 22 1 0 PITRM1 pitrilysin metallopeptidase 1 0 0 5 5 5 6 21 1 0 PREPL prolyl endopeptidase like 0 0 3 5 5 8 21 1 0 TIMM21 translocase of inner mitochondrial membrane 21 0 0 6 7 3 5 21 1 0 COX6C cytochrome c oxidase subunit 6C 0 0 4 3 6 7 20 1 0 LANCL1 LanC like 1 0 0 3 5 4 7 19 1 0 LYRM5 electron transfer flavoprotein regulatory factor 1 0 0 5 4 5 5 19 1 0 MNF1 ubiquinol-cytochrome c reductase complex assembly factor 2 0 0 4 6 4 5 19 1 0 MRPL48 mitochondrial ribosomal protein L48 0 0 5 5 3 5 18 1 0 MRPS6 mitochondrial ribosomal protein S6 0 0 4 5 5 4 18 1 0 NDUFB10 NADH:ubiquinone oxidoreductase subunit B10 0 0 6 6 3 3 18 1 0 SLC25A24 solute carrier family 25 member 24 0 0 6 5 4 3 18 1 0 COX10 cytochrome c oxidase assembly factor heme A:farnesyltransferase0 COX10 0 4 5 3 5 17 1 0 TFAM transcription factor A, mitochondrial 0 0 4 4 4 5 17 1 0 DOLPP1 dolichyldiphosphatase 1 0 0 5 3 4 4 16 1 0 MRPL15 mitochondrial ribosomal protein L15 0 0 5 4 3 4 16 1 0 MRPL17 mitochondrial ribosomal protein L17 0 0 3 5 5 3 16 1 0 MRPL55 mitochondrial ribosomal protein L55 0 0 4 4 3 5 16 1 0 ACSS1 acyl-CoA synthetase short chain family member 1 0 0 3 4 3 5 15 1 0 ARG2 arginase 2 0 0 3 3 5 4 15 1 0 GADD45GIP1 GADD45G interacting protein 1 0 0 5 3 3 4 15 1 0

111

PIN1 peptidylprolyl cis/trans isomerase, NIMA-interacting 1 0 0 3 5 3 4 15 1 0 SLC25A19 solute carrier family 25 member 19 0 0 3 3 4 5 15 1 0 CHCHD3 coiled-coil-helix-coiled-coil-helix domain containing 3 0 0 4 4 3 3 14 1 0 MRPS16 mitochondrial ribosomal protein S16 0 0 3 4 3 4 14 1 0 PCK2 phosphoenolpyruvate carboxykinase 2, mitochondrial 0 0 4 3 3 4 14 1 0 LYPLAL1 lysophospholipase like 1 6 4 17 18 18 22 75 0.99 0 MRPS34 mitochondrial ribosomal protein S34 4 4 14 14 19 18 65 0.99 0 MRPS35 mitochondrial ribosomal protein S35 4 3 17 16 12 18 63 0.99 0 LARS2 leucyl-tRNA synthetase 2, mitochondrial 2 0 12 12 11 10 45 0.99 0 ALDH1L2 aldehyde dehydrogenase 1 family member L2 0 0 2 7 6 8 23 0.99 0 MTFR1 mitochondrial fission regulator 1 0 0 7 8 2 4 21 0.99 0 FAM82A2 regulator of microtubule dynamics 3 0 0 2 5 5 6 18 0.99 0 MRPL50 mitochondrial ribosomal protein L50 0 0 4 4 2 4 14 0.99 0 ETFA electron transfer flavoprotein subunit alpha 14 7 43 35 57 43 178 0.98 0 COX4I1 cytochrome c oxidase subunit 4I1 4 3 12 17 13 15 57 0.98 0 AASS aminoadipate-semialdehyde synthase 2 0 8 12 11 11 42 0.98 0 MRPL1 mitochondrial ribosomal protein L1 2 0 12 11 8 9 40 0.98 0 MTIF2 mitochondrial translational initiation factor 2 0 0 5 2 3 3 13 0.98 0 PDPR pyruvate dehydrogenase phosphatase regulatory subunit 0 0 4 3 2 4 13 0.98 0 TMEM70 transmembrane protein 70 0 0 3 3 3 2 11 0.98 0 FASTKD5 FAST kinase domains 5 3 0 15 11 13 16 55 0.97 0 MRPS10 mitochondrial ribosomal protein S10 2 2 17 13 8 9 47 0.97 0 POLDIP2 DNA polymerase delta interacting protein 2 2 0 7 9 11 10 37 0.97 0 TST thiosulfate sulfurtransferase 0 0 4 4 2 2 12 0.97 0 PTCD2 pentatricopeptide repeat domain 2 0 0 2 2 4 3 11 0.97 0 GHITM growth hormone inducible transmembrane protein 0 0 3 3 2 2 10 0.97 0 NDUFAB1 NADH:ubiquinone oxidoreductase subunit AB1 0 0 2 3 3 2 10 0.97 0 MRPS28 mitochondrial ribosomal protein S28 4 3 14 14 11 13 52 0.96 0 CAPNS1 calpain small subunit 1 2 0 13 6 13 11 43 0.96 0 HADHA hydroxyacyl-CoA dehydrogenase trifunctional multienzyme complex15 subunit alpha4 44 38 39 43 164 0.93 0 PRAF2 PRA1 domain family member 2 5 3 16 15 14 12 57 0.93 0 MRPL19 mitochondrial ribosomal protein L19 4 0 11 15 9 15 50 0.92 0 MRPL43 mitochondrial ribosomal protein L43 2 0 7 6 8 7 28 0.92 0 CLPX caseinolytic mitochondrial matrix peptidase chaperone subunit X6 4 21 25 21 14 81 0.91 0 MRPL38 mitochondrial ribosomal protein L38 2 0 5 7 6 7 25 0.9 0 MTX1 metaxin 1 2 0 9 7 5 6 27 0.88 0 OPA1 OPA1 mitochondrial dynamin like GTPase 2 0 18 11 12 3 44 0.85 0 OCIAD1 OCIA domain containing 1 13 8 27 31 30 33 121 0.84 0.01 RARS2 arginyl-tRNA synthetase 2, mitochondrial 3 2 10 7 14 10 41 0.84 0.01 ACAT1 acetyl-CoA acetyltransferase 1 14 13 43 40 36 35 154 0.83 0.01 MRPS7 mitochondrial ribosomal protein S7 2 0 4 6 7 6 23 0.83 0.01 MRPS27 mitochondrial ribosomal protein S27 9 5 25 21 18 20 84 0.82 0.01 BID BH3 interacting domain death agonist 2 0 6 5 5 5 21 0.78 0.01 MRPL40 mitochondrial ribosomal protein L40 0 0 9 10 0 10 29 0.75 0.01 APOOL apolipoprotein O like 0 0 7 7 9 0 23 0.75 0.01 MRPL28 mitochondrial ribosomal protein L28 0 0 0 10 6 7 23 0.75 0.01 LETM2 leucine zipper and EF-hand containing transmembrane protein 2 0 0 4 6 0 6 16 0.75 0.01 C7orf55-LUC7L2FMC1-LUC7L2 readthrough 0 0 5 0 4 5 14 0.75 0.01 MTO1 mitochondrial tRNA translation optimization 1 0 0 4 4 6 0 14 0.75 0.01 ATAD3B ATPase family AAA domain containing 3B 0 0 5 4 0 4 13 0.75 0.01 ERP44 endoplasmic reticulum protein 44 0 0 4 5 0 4 13 0.75 0.01

Figure 4.4 GO enrichment analysis of LETM1 interactome

112

Metascape was used to generate the values and graph.

Figure 4.5 GO enrichment analysis of the 114 unique interactors of LETM1 A) Proteins were identified as unique if they did not appear as interactors in the CLPP BioID. B) Highlighted pathways relating to known or suspected functions of LETM1. Metascape was used to generate the values and graph.

To narrow down the interactor list to potential components of the major and minor LETM1 complexes we compared the entire 283 protein interactome with the gel-excision proteins that were differentially expressed between the LETM1 overexpressing cells and LETM1 knockdown cells (log-fold change of +2.0) (Figure 4.6 A). This identified 21 proteins for the minor complex and 27 proteins for the major complex. GO enrichment analysis of these smaller groups of interactors identified different biological pathways for both the minor and the major complex. The major complex contained the classical associations to mitochondrial proteins and calcium ion transport (Figure 4.6 B). In contrast, the minor complex identified the pathway associated with NADH dehydrogenase complex assembly (Figure 4.6 C). These observations point to

113 potential role for the minor complex of LETM1 to regulate supercomplex formation and the major complex of LETM1 to regulate calcium ion transport.

114

Figure 4.6 GO enrichment analysis of the overlap between proteins identified in the major and minor complex gel-excision experiment with the BioID interactors of LETM1 A) All 283 interactors for LETM1 were cross-referenced with the 94 and 140 potential components of the LETM1 minor or LETM1 major complexes respectively. GO enrichment

115 analysis of the B) major and C) minor complexes. Metascape was used to generate the values and graph.

Mdm39 is the yeast homolog of LETM1 and has be shown to bind mitochondrial ribosomes (293). We identified 5 components of the mitochondrial ribosome and an inner membrane tethering protein for the mitochondrial ribosome (OXA1L) within the LETM1 minor complex list of 21 proteins (Figure 4.6 A). Additional experiments are needed to evaluate the effects of LETM1 and NLN on mitochondrial translation. For example, investigating the mitochondrially encoded protein levels in LETM1 and NLN knockdown cells could offer insight into the role of these mitochondrial proteins in translation.

Validation of the protein lists identifying potential complex components for LETM1 minor and major complex is required. While Co-IP is the gold standard for confirming protein-protein interactions, it is not applicable in all situations and challenging when dealing with membrane proteins. Thus, other functional rescue experiments or similar phenotypes upon candidate protein knockdown could provide more insight into potential LETM1 major and minor complex components.

4.3 Signal transducer and activator of transcription 3 (STAT3)

Signal transducer and activator of transcription 3 (STAT3) is a transcription factor that is localized to the nucleus to alter gene expression upon activation by cytokine stimulation. The classical signaling pathway is the Janus kinase family (JAK)-STAT pathway. Within this pathway JAKs translocate to a cytokine receptor upon stimulation, this in turn creates phosphorylated tyrosine residues on the receptor and JAKs that serve as a docking site for the SH2 domain of STAT3 (294). Once docked, STAT3 is phosphorylated, homodimerizes and translocates into the nucleus to effect gene expression.

More recently, STAT3 has been shown to have additional functions not related to its role in JAK-STAT signaling pathways, specifically within the mitochondria. STAT3 has been identified in the mitochondria of both tissues and cell lines, where the mitochondrial STAT3 has been shown to affect oncogenic transformation and cellular respiration (295, 296). This has drawn interest as a potential therapeutic target with the goal to specifically target the effects of mitochondrial STAT3. However, the mechanism explaining the effect of STAT3 on

116 mitochondrial function remains unclear. To date, STAT3 is known to reside primarily within the inner membrane and mitochondrial matrix shown through sub-fractionation experiments (297). Additionally, STAT3 can reduce the activity of the ETC, bind to mitochondrial DNA to suppress transcription, and alter mitochondrial ROS (295, 298, 299).

We performed BioID on STAT3 with an MLS to determine the potential mitochondrial interacting proteins. In total, we identified 110 interactors of which 106 were annotated as mitochondrial based on GO (Table 4.3, Figure 4.7). Consistent with the mitochondrial matrix localization of STAT3, when compared with other mitochondrial protein BioIDs, the MLS- STAT3 correlated with mitochondrial matrix proteins as opposed to IMS proteins (Figure 4.8). Thus, although we were using an MLS not normally present on STAT3, we observed correct localization within the mitochondrial matrix. Additionally, there was a strong enrichment for ETC components as we expected, and other clusters of protein involved in mitochondrial transcription and translation (Figure 4.7). There were also some unique interactors not observed in previous mitochondrial BioIDs involved in iron-sulfur cluster formation. Iron-sulfur clusters are utilized in the ETC to transport electrons. Further validation of the dataset is needed to gain a greater understanding of STAT3 mitochondrial biology.

Table 4.3 Complete list of interactors identified by BioID for MLS-STAT3 Interactors identified are sorted by total peptide counts across two biological and two technical replicates, and significance analysis of interactome (SAINT) using a Bayesian false discovery rate (BFDR) <1%.

117

MLS-STAT3-WT Pool A Pool B Gene Name Full Name Top 2 Controls Tech #1 Tech #2 Tech #1 Tech #2 Total SAINT BFDR BirA* biotin ligase (E. coli) 2815 2807 5276 5522 1429 1350 13577 STAT3 signal transducer and activator of transcription 3 94 52 3828 3885 1188 1227 10128

ACOT1 acyl-CoA thioesterase 1 43 42 690 739 366 340 2135 1 0 SHMT2 serine hydroxymethyltransferase 2 29 16 291 303 202 199 995 1 0 IARS2 isoleucyl-tRNA synthetase 2, mitochondrial 4 4 216 209 93 82 600 1 0 LRPPRC leucine rich pentatricopeptide repeat containing 18 14 175 151 57 52 435 1 0 NDUFS2 NADH:ubiquinone oxidoreductase core subunit S2 3 3 154 153 59 49 415 1 0 NDUFS1 NADH:ubiquinone oxidoreductase core subunit S1 6 5 109 114 51 59 333 1 0 NDUFS3 NADH:ubiquinone oxidoreductase core subunit S3 10 7 99 88 67 78 332 1 0 AFG3L2 AFG3 like matrix AAA peptidase subunit 2 8 8 100 96 55 53 304 1 0 NDUFA9 NADH:ubiquinone oxidoreductase subunit A9 19 16 97 78 61 54 290 1 0 LETM1 leucine zipper and EF-hand containing transmembrane protein 1 0 0 129 110 30 18 287 1 0 PTCD3 pentatricopeptide repeat domain 3 9 9 84 80 43 35 242 1 0 SIRT2 sirtuin 2 0 0 87 88 33 25 233 1 0 GLS glutaminase 0 0 78 84 32 27 221 1 0 BCS1L BCS1 homolog, ubiquinol-cytochrome c reductase complex chaperone 0 0 73 64 35 40 212 1 0 PYCR2 pyrroline-5-carboxylate reductase 2 0 0 67 61 42 30 200 1 0 MDH2 malate dehydrogenase 2 0 0 64 60 37 34 195 1 0 NME4 NME/NM23 nucleoside diphosphate kinase 4 2 2 60 65 30 37 192 1 0 ATPAF1 ATP synthase mitochondrial F1 complex assembly factor 1 0 0 51 58 42 32 183 1 0 TIMM44 translocase of inner mitochondrial membrane 44 8 6 47 42 30 36 155 1 0 NDUFAF2 NADH:ubiquinone oxidoreductase complex assembly factor 2 0 0 43 41 38 30 152 1 0 NDUFV3 NADH:ubiquinone oxidoreductase subunit V3 0 0 47 51 17 26 141 1 0 PYCR1 pyrroline-5-carboxylate reductase 1 0 0 55 52 15 18 140 1 0 KIAA0564 von Willebrand factor A domain containing 8 2 0 46 36 23 19 124 1 0 POLDIP2 DNA polymerase delta interacting protein 2 2 0 38 41 26 16 121 1 0 THEM4 thioesterase superfamily member 4 0 0 34 33 24 25 116 1 0 TACO1 translational activator of cytochrome c oxidase I 0 0 36 35 18 24 113 1 0 NDUFV1 NADH:ubiquinone oxidoreductase core subunit V1 4 2 37 33 22 18 110 1 0 PPA2 pyrophosphatase (inorganic) 2 0 0 30 32 25 21 108 1 0 ECHS1 enoyl-CoA hydratase, short chain 1 0 0 38 21 20 28 107 1 0 PPIF peptidylprolyl isomerase F 0 0 33 25 25 22 105 1 0 MMAB metabolism of cobalamin associated B 0 0 28 28 23 24 103 1 0 NDUFAF4 NADH:ubiquinone oxidoreductase complex assembly factor 4 0 0 29 33 19 22 103 1 0 NDUFA12 NADH:ubiquinone oxidoreductase subunit A12 0 0 33 33 22 13 101 1 0 NDUFV2 NADH:ubiquinone oxidoreductase core subunit V2 3 2 25 27 24 24 100 1 0 ABHD10 abhydrolase domain containing 10 0 0 29 28 18 24 99 1 0 NIPSNAP1 nipsnap homolog 1 2 0 30 24 15 18 87 1 0 MTHFD1L methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1 like 5 5 23 24 19 18 84 1 0 C17orf80 chromosome 17 open reading frame 80 0 0 29 23 14 17 83 1 0 HSPE1 heat shock protein family E (Hsp10) member 1 0 0 25 24 17 17 83 1 0 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 2 0 21 30 18 11 80 1 0 RTN4IP1 reticulon 4 interacting protein 1 0 0 24 24 15 16 79 1 0 PNPT1 polyribonucleotide nucleotidyltransferase 1 0 0 30 32 8 6 76 1 0 NFS1 NFS1 cysteine desulfurase 0 0 36 30 4 6 76 1 0 HINT2 histidine triad nucleotide binding protein 2 0 0 19 17 22 18 76 1 0 IBA57 iron-sulfur cluster assembly factor IBA57 0 0 27 27 14 7 75 1 0 C2orf56 NADH:ubiquinone oxidoreductase complex assembly factor 7 0 0 21 24 12 16 73 1 0 CARS2 cysteinyl-tRNA synthetase 2, mitochondrial 0 0 27 26 10 10 73 1 0 NDUFS8 NADH:ubiquinone oxidoreductase core subunit S8 0 0 22 22 14 14 72 1 0 QRSL1 glutaminyl-tRNA amidotransferase subunit QRSL1 0 0 29 29 5 6 69 1 0 VARS2 valyl-tRNA synthetase 2, mitochondrial 0 0 23 24 10 7 64 1 0 PAM16 presequence translocase associated motor 16 0 0 16 17 13 18 64 1 0 PET112 glutamyl-tRNA amidotransferase subunit B 0 0 23 25 7 8 63 1 0 SDHA succinate dehydrogenase complex flavoprotein subunit A 0 0 22 27 7 6 62 1 0 GFM1 G elongation factor mitochondrial 1 0 0 13 15 17 11 56 1 0 C20orf7 NADH:ubiquinone oxidoreductase complex assembly factor 5 0 0 15 17 15 9 56 1 0 NUBPL nucleotide binding protein like 0 0 13 19 11 9 52 1 0 ALDH4A1 aldehyde dehydrogenase 4 family member A1 0 0 15 22 10 5 52 1 0 NDUFS7 NADH:ubiquinone oxidoreductase core subunit S7 2 2 12 14 11 13 50 1 0 NDUFS6 NADH:ubiquinone oxidoreductase subunit S6 0 0 11 14 13 12 50 1 0 GCDH glutaryl-CoA dehydrogenase 0 0 21 20 4 4 49 1 0 ACADM acyl-CoA dehydrogenase medium chain 0 0 18 14 9 7 48 1 0 NDUFS4 NADH:ubiquinone oxidoreductase subunit S4 0 0 15 14 9 9 47 1 0 ACADSB acyl-CoA dehydrogenase short/branched chain 0 0 14 18 8 7 47 1 0 ACAD9 acyl-CoA dehydrogenase family member 9 0 0 12 10 13 10 45 1 0 NDUFAF3 NADH:ubiquinone oxidoreductase complex assembly factor 3 0 0 23 15 4 3 45 1 0 SPRYD4 SPRY domain containing 4 0 0 5 8 18 14 45 1 0 AK3 adenylate kinase 3 0 0 11 10 12 12 45 1 0 CLYBL citrate lyase beta like 0 0 16 13 8 7 44 1 0 POLRMT RNA polymerase mitochondrial 0 0 15 13 8 7 43 1 0 ERAL1 Era like 12S mitochondrial rRNA chaperone 1 0 0 11 15 11 5 42 1 0 MRPS24 mitochondrial ribosomal protein S24 0 0 15 11 8 8 42 1 0 ATPAF2 ATP synthase mitochondrial F1 complex assembly factor 2 0 0 13 14 8 6 41 1 0 GTPBP10 GTP binding protein 10 0 0 13 11 7 7 38 1 0 NDUFA6 NADH:ubiquinone oxidoreductase subunit A6 0 0 12 12 7 6 37 1 0 SUCLG2 succinate-CoA ligase GDP-forming beta subunit 0 0 15 15 3 4 37 1 0 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate0 cyclohydrolase0 13 14 6 4 37 1 0 SUCLG1 succinate-CoA ligase alpha subunit 0 0 10 14 4 8 36 1 0 TFAM transcription factor A, mitochondrial 0 0 8 14 7 6 35 1 0 C8orf82 chromosome 8 open reading frame 82 0 0 10 12 8 4 34 1 0 NDUFA2 NADH:ubiquinone oxidoreductase subunit A2 0 0 10 11 5 7 33 1 0 PDE12 phosphodiesterase 12 0 0 11 9 6 5 31 1 0 SLC30A9 solute carrier family 30 member 9 0 0 13 10 4 3 30 1 0 NUDT19 nudix hydrolase 19 0 0 10 8 7 4 29 1 0 MRPL46 mitochondrial ribosomal protein L46 0 0 8 7 7 5 27 1 0

118

UQCC ubiquinol-cytochrome c reductase complex assembly factor 1 0 0 10 8 4 4 26 1 0 SIRT3 sirtuin 3 0 0 8 7 4 5 24 1 0 LYRM5 electron transfer flavoprotein regulatory factor 1 0 0 5 7 4 5 21 1 0 PDPR pyruvate dehydrogenase phosphatase regulatory subunit 0 0 6 6 4 4 20 1 0 C20orf72 mitochondrial genome maintenance exonuclease 1 0 0 4 5 5 6 20 1 0 TEFM transcription elongation factor, mitochondrial 0 0 5 6 4 4 19 1 0 AARS2 alanyl-tRNA synthetase 2, mitochondrial 0 0 6 3 5 4 18 1 0 NDUFA5 NADH:ubiquinone oxidoreductase subunit A5 7 5 42 43 31 19 135 0.99 0 CLPX caseinolytic mitochondrial matrix peptidase chaperone subunit 6 4 25 26 24 17 92 0.99 0 C7orf55 formation of mitochondrial complex V assembly factor 1 homolog 0 0 4 5 3 4 16 0.99 0 MRPS26 mitochondrial ribosomal protein S26 0 0 13 16 2 6 37 0.98 0 OGDH oxoglutarate dehydrogenase 0 0 16 13 2 4 35 0.98 0 FECH ferrochelatase 0 0 8 13 4 2 27 0.98 0 NRD1 nardilysin convertase 0 0 4 4 9 2 19 0.98 0 MRPS25 mitochondrial ribosomal protein S25 0 0 2 4 7 5 18 0.98 0 COX5B cytochrome c oxidase subunit 5B 0 0 5 2 5 4 16 0.98 0 GRPEL1 GrpE like 1, mitochondrial 0 0 7 7 3 2 19 0.97 0 BCKDHA branched chain keto acid dehydrogenase E1 subunit alpha 0 0 6 5 3 2 16 0.97 0 IDH3A isocitrate dehydrogenase (NAD(+)) 3 alpha 0 0 5 4 2 3 14 0.97 0 RNMTL1 mitochondrial rRNA methyltransferase 3 0 0 8 7 2 2 19 0.96 0 MRPL45 mitochondrial ribosomal protein L45 4 2 38 28 12 10 88 0.94 0 COX5A cytochrome c oxidase subunit 5A 2 0 8 10 13 6 37 0.92 0 ACADVL acyl-CoA dehydrogenase very long chain 4 0 30 30 7 13 80 0.82 0.01 CLPB ClpB homolog, mitochondrial AAA ATPase chaperonin 3 2 19 16 7 9 51 0.78 0.01 LARS2 leucyl-tRNA synthetase 2, mitochondrial 2 0 12 14 7 3 36 0.78 0.01 EARS2 glutamyl-tRNA synthetase 2, mitochondrial 0 0 12 10 11 0 33 0.75 0.01

119

Figure 4.7 MLS-STAT3 Interactome Mitochondrial annotations and biological groups were sorted manually.

Identifying the mitochondrial import pathway responsible for STAT3 would be beneficial to target in specific malignancies where mitochondrial STAT3 is known to increase oncogenic potential (296). Our BioID dataset identified four proteins involved in mitochondrial protein import, including two proteins that are part of the mitochondrial import inner membrane translocase subunit Tim23 (TIMM23) import pathway. These two proteins are mitochondrial

120 import inner membrane translocase subunit Tim44 (TIMM44) and mitochondrial import inner membrane translocase subunit Tim16 (PAM16). Future experiments targeting the TIMM23/TIMM44/PAM16 proteins and evaluating the levels of mitochondrial STAT3 via Western blotting would help validate the Tim23 import pathway as the pathway of STAT3 mitochondrial import.

Figure 4.8 Pearson correlation analysis of Chapter 4 BioID datasets Graph was generated using ProHitz Viz.

121

4.4 ATP synthase subunit e (ATP5I)

Dr. John Rubenstein’s lab focuses its research on understanding the structure and mechanics of the ATP synthase (complex V of the ETC) using cryo-electron microscopy (cryo-EM) (300, 301). One component, ATP synthase subunit e (ATP5I/ATP5ME), extends a long alpha helix into the IMS (302). ATP5I has shown to be essential for ATP synthase dimerization and cristae formation, but its mechanism of action remains unknown (302, 303). It was hypothesized in yeast that subunit e and subunit k interact to initiate the dimerization of ATP synthase (302). Loss of dimerization of ATP synthase in yeast was shown to have little effect on mitochondrial function. This was not the case in mammalian cells where loss of dimerization reduced oxidative phosphorylation activity and was shown to have effects on mitochondria ultrastructure (303).

We performed BioID on ATP5I to help elucidate its protein interactors and better understand its functions. We identified 100 interactors of which 91 are annotated as mitochondrial according to GO (Table 4.4). Furthermore, we identified the hypothesized dimerization partner for ATP5I, ATP synthase subunit g (ATP5L/ATP5MG). Validation of this direct interaction in mammalian cells would help confirm this hypothesis through in vitro binding assays or x-ray crystallography.

Similarly, to STAT3, the mitochondrial import mechanism for ATP5I is unknown. Within our BioID we identified the mitochondrial import inner membrane translocase subunit Tim13 (TIMM13), a protein known to import mitochondrial inner membrane proteins. We also identified the translocase of inner mitochondrial membrane domain-containing protein 1 (TIMMDC1) which is known to serve as a chaperone to assist in the maturation of the membrane arm of complex I into the inner membrane (304). In this publication they note that the knockdown of TIMMDC1 impairs mitochondrial ultrastructure and ETC function. Thus, it is possible that TIMMDC1 coordinates with TIMM13 in the import of ATP5I. Testing whether TIMMDC1 or TIMM13 knockdown reduces ATP5I import and ATP synthase dimerization would confirm these potential mechanisms of ATP5I mitochondrial import.

Table 4.4 Complete list of interactors identified by BioID for ATP5I Interactors identified are sorted by total peptide counts across two biological and two technical replicates, and significance analysis of interactome (SAINT) using a Bayesian false discovery rate (BFDR) <1%.

122

ATP5I Pool A Pool B Gene NameFull Name Top 2 Controls Tech #1 Tech #2 Tech #1 Tech #2 Total SAINT BFDR birA Biotin Ligase 2802 2753 2322 2240 1939 1780 8281 0 0.89 ATP5I ATP synthase subunit e 0 0 105 103 84 65 357 0 IMMT inner membrane mitochondrial protein 6 4 184 174 272 292 922 1 0 COX15 COX15, cytochrome c oxidase assembly homolog 0 0 132 138 125 126 521 1 0 CLPB ClpB homolog, mitochondrial AAA ATPase chaperonin 3 2 131 128 136 115 510 1 0 SHMT2 serine hydroxymethyltransferase 2 29 16 164 114 124 92 494 1 0 LRPPRC leucine rich pentatricopeptide repeat containing 18 13 117 120 82 81 400 1 0 KIAA0664 clustered mitochondria homolog 14 14 90 106 75 64 335 1 0 NDUFS3 NADH:ubiquinone oxidoreductase core subunit S3 10 5 87 67 83 62 299 1 0 CKMT1B creatine kinase, mitochondrial 1B 0 0 57 73 95 71 296 1 0 APOOL apolipoprotein O like 0 0 77 73 67 67 284 1 0 IARS2 isoleucyl-tRNA synthetase 2, mitochondrial 4 3 76 78 60 60 274 1 0 SAMM50 SAMM50 sorting and assembly machinery component 0 0 52 56 86 72 266 1 0 ATAD3A ATPase family, AAA domain containing 3A 16 12 66 70 65 57 258 1 0 LETM1 leucine zipper and EF-hand containing transmembrane protein 1 0 0 83 87 46 38 254 1 0 NDUFS1 NADH:ubiquinone oxidoreductase core subunit S1 6 3 56 58 70 64 248 1 0 UHRF1BP1LUHRF1 binding protein 1 like 2 0 62 48 69 66 245 1 0 OCIAD1 OCIA domain containing 1 8 6 49 61 68 64 242 1 0 NDUFA9 NADH:ubiquinone oxidoreductase subunit A9 14 13 56 51 68 65 240 1 0 AFG3L2 AFG3 like matrix AAA peptidase subunit 2 8 8 58 56 45 37 196 1 0 PTCD3 pentatricopeptide repeat domain 3 9 8 50 50 53 41 194 1 0 SLC25A12 solute carrier family 25 member 12 4 4 59 62 33 37 191 1 0 NDUFS2 NADH:ubiquinone oxidoreductase core subunit S2 2 0 44 60 31 40 175 1 0 COX4I1 cytochrome c oxidase subunit 4I1 4 0 45 37 39 53 174 1 0 NDUFA8 NADH:ubiquinone oxidoreductase subunit A8 0 0 48 39 39 36 162 1 0 ATP5F1 ATP synthase peripheral stalk-membrane subunit b 4 2 42 50 32 36 160 1 0 LACTB lactamase beta 0 0 52 37 39 29 157 1 0 CPOX coproporphyrinogen oxidase 0 0 32 44 37 41 154 1 0 HAX1 HCLS1 associated protein X-1 5 4 34 46 34 36 150 1 0 TUBA1A tubulin alpha 1a 0 0 55 64 9 15 143 1 0 COX5A cytochrome c oxidase subunit 5A 2 0 45 52 26 19 142 1 0 MTX2 metaxin 2 0 0 25 30 47 34 136 1 0 TIMM44 translocase of inner mitochondrial membrane 44 8 6 36 32 28 33 129 1 0 NDUFA5 NADH:ubiquinone oxidoreductase subunit A5 7 5 30 32 39 28 129 1 0 PYCR2 pyrroline-5-carboxylate reductase 2 0 0 26 34 26 20 106 1 0 TIMM13 translocase of inner mitochondrial membrane 13 0 0 29 25 19 30 103 1 0 NDUFV2 NADH:ubiquinone oxidoreductase core subunit V2 0 0 26 25 21 24 96 1 0 SELRC1 cytochrome c oxidase assembly factor 7 (putative) 0 0 21 27 17 27 92 1 0 ACAD9 acyl-CoA dehydrogenase family member 9 0 0 26 31 17 17 91 1 0 MRPS22 mitochondrial ribosomal protein S22 5 4 19 22 22 18 81 1 0 CHCHD3 coiled-coil-helix-coiled-coil-helix domain containing 3 0 0 16 21 19 23 79 1 0 TMEM126Btransmembrane protein 126B 0 0 15 21 23 20 79 1 0 NDUFAF2 NADH:ubiquinone oxidoreductase complex assembly factor 2 0 0 22 28 13 15 78 1 0 NDUFV1 NADH:ubiquinone oxidoreductase core subunit V1 4 2 20 18 20 20 78 1 0 MRPS35 mitochondrial ribosomal protein S35 3 3 18 17 25 18 78 1 0 TIMMDC1 translocase of inner mitochondrial membrane domain containing 1 0 0 25 22 16 14 77 1 0 GLS glutaminase 0 0 25 32 8 8 73 1 0 CCDC58 coiled-coil domain containing 58 0 0 23 16 18 15 72 1 0 GRSF1 G-rich RNA sequence binding factor 1 0 0 14 25 19 11 69 1 0 AK2 adenylate kinase 2 2 0 17 19 15 15 66 1 0 YME1L1 YME1 like 1 ATPase 0 0 24 20 10 11 65 1 0 NDUFV3 NADH:ubiquinone oxidoreductase subunit V3 0 0 18 20 11 15 64 1 0 NDUFA12 NADH:ubiquinone oxidoreductase subunit A12 0 0 17 20 14 12 63 1 0 NDUFS8 NADH:ubiquinone oxidoreductase core subunit S8 0 0 11 8 24 18 61 1 0 TOMM70A translocase of outer mitochondrial membrane 70 0 0 20 21 8 9 58 1 0 BCS1L BCS1 homolog, ubiquinol-cytochrome c reductase complex chaperone 0 0 25 18 6 8 57 1 0 MICU1 mitochondrial calcium uptake 1 0 0 17 18 11 8 54 1 0 MRPL44 mitochondrial ribosomal protein L44 0 0 14 6 21 12 53 1 0 PYCR1 pyrroline-5-carboxylate reductase 1 0 0 15 12 10 14 51 1 0 ATPAF1 ATP synthase mitochondrial F1 complex assembly factor 1 0 0 16 16 8 9 49 1 0 SLC30A9 solute carrier family 30 member 9 0 0 14 12 8 12 46 1 0 CYCS cytochrome c, somatic 0 0 14 11 10 11 46 1 0 ATAD3B ATPase family, AAA domain containing 3B 0 0 15 9 10 10 44 1 0 FAM162A family with sequence similarity 162 member A 0 0 8 15 9 12 44 1 0 NDUFAF4 NADH:ubiquinone oxidoreductase complex assembly factor 4 0 0 15 12 8 8 43 1 0 MDH2 malate dehydrogenase 2 0 0 13 18 5 6 42 1 0 HCCS holocytochrome c synthase 0 0 15 15 5 6 41 1 0 NDUFB9 NADH:ubiquinone oxidoreductase subunit B9 0 0 12 10 8 11 41 1 0 TACO1 translational activator of cytochrome c oxidase I 0 0 19 5 6 9 39 1 0 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 0 0 13 8 7 11 39 1 0 EFHA1 mitochondrial calcium uptake 2 0 0 12 13 7 7 39 1 0 C17orf80 chromosome 17 open reading frame 80 0 0 10 11 6 8 35 1 0 ENDOG endonuclease G 0 0 9 8 12 5 34 1 0 C12orf73 chromosome 12 open reading frame 73 0 0 9 14 5 5 33 1 0 NDUFB10 NADH:ubiquinone oxidoreductase subunit B10 0 0 5 10 6 11 32 1 0 MMAB methylmalonic aciduria (cobalamin deficiency) cblB type 0 0 8 10 7 6 31 1 0 THEM4 thioesterase superfamily member 4 0 0 12 9 5 4 30 1 0 NDUFA2 NADH:ubiquinone oxidoreductase subunit A2 0 0 4 5 7 13 29 1 0 APOO apolipoprotein O 0 0 9 8 4 4 25 1 0

123

PNPT1 polyribonucleotide nucleotidyltransferase 1 0 0 5 8 6 4 23 1 0 MRPL12 mitochondrial ribosomal protein L12 0 0 6 4 5 4 19 1 0 HINT2 histidine triad nucleotide binding protein 2 0 0 4 4 4 5 17 1 0 OPA1 OPA1, mitochondrial dynamin like GTPase 2 0 22 27 10 14 73 0.99 0 OMA1 OMA1 zinc metallopeptidase 0 0 21 13 3 5 42 0.99 0 TTC19 tetratricopeptide repeat domain 19 0 0 17 10 3 5 35 0.99 0 POLRMT RNA polymerase mitochondrial 0 0 6 11 5 3 25 0.99 0 EXOG exo/endonuclease G 0 0 7 6 4 3 20 0.99 0 HSPE1 heat shock protein family E (Hsp10) member 1 0 0 6 7 4 3 20 0.99 0 MRPS10 mitochondrial ribosomal protein S10 2 0 13 11 10 11 45 0.98 0 MRPS24 mitochondrial ribosomal protein S24 0 0 8 6 3 3 20 0.98 0 ND4 mitochondrially encoded NADH:ubiquinone oxidoreductase core subunit 4 0 0 7 4 3 3 17 0.98 0 SLC25A24 solute carrier family 25 member 24 0 0 12 13 11 2 38 0.96 0 GEMIN7 gem nuclear organelle associated protein 7 0 0 4 3 4 2 13 0.95 0 AIFM1 apoptosis inducing factor mitochondria associated 1 3 0 19 21 13 12 65 0.94 0.01 ND5 mitochondrially encoded NADH:ubiquinone oxidoreductase core subunit 5 0 0 7 3 2 3 15 0.94 0.01 ATP5L ATP synthase membrane subunit g 6 5 33 23 23 16 95 0.88 0.01 DLST dihydrolipoamide S-succinyltransferase 3 0 13 14 15 8 50 0.85 0.01 ACOT1 acyl-CoA thioesterase 1 43 42 193 230 138 105 666 0.75 0.02 C1orf212 small integral membrane protein 12 0 0 23 23 33 0 79 0.75 0.02 ECHS1 enoyl-CoA hydratase, short chain 1 0 0 13 6 0 7 26 0.75 0.02 TRIAP1 TP53 regulated inhibitor of apoptosis 1 0 0 9 11 0 6 26 0.75 0.02 4.5MRPS26 mitochondrialHexokinase ribosomal protein S26 (HK2) 0 0 7 0 8 11 26 0.75 0.02

Hexokinase (HK2) is a mitochondrial protein involved in the phosphorylation of glucose to glucose-6-phosphate (G-6P). G-6P is the precursor molecule for glycolysis, pentose phosphate pathway, glycogenesis, and hexosamine biosynthetic pathway (305). HK2 is also reported to localize to the nucleus as a potential glucose sensing mechanism (306, 307). Within the Schimmer lab we have seen an increase in HK2 within the nucleus of AML stem cells (data unpublished). Understanding the role of HK2 within the nucleus could provide therapeutic insights into targeting the leukemic stem cell population.

We performed BioID on hexokinase 2 with an NLS and without one. Our construct did not appear to localize correctly to the nucleus as there was only a gain of 15 total interactors from both nuclear localization signals used, one from SV-40 large t-antigen (PKKKRKV, denoted as PKK)(Table 4.5 and 4.6) and one from c-MYC (PAAKRVKLD, denoted as PAA)(Table 4.7). These 15 interactors only slightly increased counts from the wild-type and some were even mitochondrial, suggesting that our NLS constructs were not localizing to the nucleus. We next tried an N terminal tag with an NLS before and after the FLAGBirA*. This yielded even poorer results with seven high confidence interactors (Table 4.8). Furthermore, we did see high peptide counts for HK2 suggesting that protein stability and/or protein degradation was not the reason for few interactors, but rather the proteins localization. The two above NLS signals used on HK2 alone have also shown nuclear localization of HK2 via fluorescent microscopy (data not shown), supporting the notion that the BirA*FLAG tag is causing the incorrect localization. Future experiments should include changing the NLS again and repeating the BioID. Furthermore, if this is an issue with the BirA tag affecting the localization using the miniTurbo BioID construct or 2C-BioID could potentially result in correct nuclear localization of HK2.

124

Table 4.5 Complete list of interactors identified by BioID for HK2 Interactors identified are sorted by total peptide counts across two biological and two technical replicates, and significance analysis of interactome (SAINT) using a Bayesian false discovery rate (BFDR) <2%.

HK2 Pool A Pool B Gene Name Full Name Top 2 Controls Tech #1 Tech #2 Tech #1 Tech #2 Total SAINT BFDR birA Biotin Ligase (E. coli ) 2802 2753 3631 3766 2786 1549 11732 0 0.92 HK2 Hexokinase 2 0 0 1298 1250 1081 857 4486

AKAP1 A-kinase anchoring protein 1 23 20 108 104 107 76 395 1 0 MAVS mitochondrial antiviral signaling protein 8 6 73 69 83 101 326 1 0 HK1 hexokinase 1 13 11 43 43 44 158 288 1 0 VPS13D vacuolar protein sorting 13 homolog D 0 0 37 48 53 40 178 1 0 BCL2L13 BCL2 like 13 0 0 41 40 46 46 173 1 0 TDRKH tudor and KH domain containing 5 4 39 32 49 41 161 1 0 OCIAD1 OCIA domain containing 1 8 6 37 43 40 37 157 1 0 FBXO17 F-box protein 17 0 0 38 39 43 7 127 1 0 RHOT2 ras homolog family member T2 2 2 31 43 32 18 124 1 0 ATPAF1 ATP synthase mitochondrial F1 complex assembly factor 1 0 0 33 29 26 26 114 1 0 EXD2 exonuclease 3'-5' domain containing 2 0 0 31 31 36 14 112 1 0 USP30 ubiquitin specific peptidase 30 0 0 25 26 28 11 90 1 0 VPS13A vacuolar protein sorting 13 homolog A 2 0 25 31 19 15 90 1 0 MFF mitochondrial fission factor 0 0 19 25 21 24 89 1 0 MARC2 mitochondrial amidoxime reducing component 2 0 0 19 20 24 22 85 1 0 FAM54B mitochondrial fission regulator 1 like 0 0 15 16 25 10 66 1 0 FAM82A2 regulator of microtubule dynamics 3 0 0 16 14 19 17 66 1 0 FAM54A mitochondrial fission regulator 2 0 0 14 13 15 9 51 1 0 MTFR1 mitochondrial fission regulator 1 0 0 8 8 16 15 47 1 0 FAM73A mitoguardin 1 0 0 11 14 13 5 43 1 0 SNAP47 synaptosome associated protein 47 0 0 12 9 13 8 42 1 0 NME3 NME/NM23 nucleoside diphosphate kinase 3 0 0 9 10 13 9 41 1 0 ARMC10 armadillo repeat containing 10 0 0 5 10 8 11 34 1 0 CISD1 CDGSH iron sulfur domain 1 0 0 7 7 9 8 31 1 0 MIF macrophage migration inhibitory factor 0 0 8 6 6 8 28 1 0 SLC30A9 solute carrier family 30 member 9 0 0 6 6 6 4 22 1 0 C12orf23 transmembrane protein 263 0 0 4 5 6 6 21 1 0 CUL1 cullin 1 7 5 28 28 26 20 102 0.99 0 FKBP8 FK506 binding protein 8 7 7 25 27 23 24 99 0.99 0 UBXN4 UBX domain protein 4 4 2 13 14 17 17 61 0.99 0 CYB5R1 cytochrome b5 reductase 1 0 0 3 4 5 4 16 0.99 0 GK glycerol kinase 2 0 15 18 15 10 58 0.98 0 THEM4 thioesterase superfamily member 4 0 0 4 3 2 3 12 0.92 0 UGGT1 UDP-glucose glycoprotein glucosyltransferase 1 0 0 3 3 2 3 11 0.91 0.01 VPS26A VPS26, retromer complex component A 0 0 3 3 3 2 11 0.91 0.01 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 21 20 72 66 72 24 234 0.75 0.02 RPS12 ribosomal protein S12 12 10 42 46 55 5 148 0.75 0.02 KDELR2 KDEL endoplasmic reticulum protein retention receptor 2 0 0 10 10 13 0 33 0.75 0.02

Table 4.6 Complete list of interactors identified by BioID for PKK-HK2 Interactors identified are sorted by total peptide counts across two biological and two technical replicates, and significance analysis of interactome (SAINT) using a Bayesian false discovery rate (BFDR) <2%.

125

PKK-HK2 Pool A Pool B Gene Name Full Name Top 2 Controls Tech #1 Tech #2 Tech #1 Tech #2 Total SAINT BFDR birA Biotin Ligase (E. coli ) 2802 2753 1538 1575 2516 2440 8069 0 0.92 HK2 Hexokinase 2 0 0 654 533 874 810 2871

MAVS mitochondrial antiviral signaling protein 8 6 61 60 61 44 226 1 0 FBXO17 F-box protein 17 0 0 23 17 31 36 107 1 0 BCL2L13 BCL2 like 13 0 0 26 23 25 25 99 1 0 RHOT2 ras homolog family member T2 2 2 14 14 21 20 69 1 0 VPS13D vacuolar protein sorting 13 homolog D 0 0 12 13 16 17 58 1 0 MARC2 mitochondrial amidoxime reducing component 2 0 0 13 13 14 17 57 1 0 EXD2 exonuclease 3'-5' domain containing 2 0 0 11 12 14 18 55 1 0 ATPAF1 ATP synthase mitochondrial F1 complex assembly factor 1 0 0 10 11 17 13 51 1 0 FAM54B mitochondrial fission regulator 1 like 0 0 6 7 9 12 34 1 0 DOLPP1 dolichyldiphosphatase 1 0 0 5 9 11 8 33 1 0 MFF mitochondrial fission factor 0 0 8 10 6 8 32 1 0 FAM82A2 regulator of microtubule dynamics 3 0 0 10 5 9 5 29 1 0 MIF macrophage migration inhibitory factor 0 0 5 7 6 6 24 1 0 PDCD2L programmed cell death 2 like 0 0 5 4 9 6 24 1 0 FAM54A mitochondrial fission regulator 2 0 0 4 4 8 6 22 1 0 NXN nucleoredoxin 0 0 7 4 4 5 20 1 0 MRI1 methylthioribose-1-phosphate isomerase 1 0 0 6 4 5 5 20 1 0 OCIAD1 OCIA domain containing 1 8 6 29 25 29 23 106 0.99 0 TDRKH tudor and KH domain containing 5 4 17 21 18 18 74 0.99 0 KDELR2 KDEL endoplasmic reticulum protein retention receptor 2 0 0 6 3 5 11 25 0.99 0 MARC1 mitochondrial amidoxime reducing component 1 0 0 4 2 4 7 17 0.94 0 EIF2B3 eukaryotic translation initiation factor 2B subunit gamma 0 0 3 7 4 2 16 0.93 0 GK glycerol kinase 2 0 12 12 7 9 40 0.89 0.01 CUL1 cullin 1 7 5 19 18 28 24 89 0.88 0.01 C12orf23 transmembrane protein 263 0 0 2 3 3 2 10 0.87 0.01 NUDT16L1 nudix hydrolase 16 like 1 0 0 2 2 3 3 10 0.87 0.01 RRP1 ribosomal RNA processing 1 0 0 3 2 2 3 10 0.87 0.01 SGPL1 sphingosine-1-phosphate lyase 1 0 0 3 2 2 2 9 0.83 0.02

Table 4.7 Complete list of interactors identified by BioID for PAA-HK2 Interactors identified are sorted by total peptide counts across two biological and two technical replicates, and significance analysis of interactome (SAINT) using a Bayesian false discovery rate (BFDR) <2%.

126

PAA-HK2 Pool A Pool B Gene Name Full Name Top 2 Controls Tech #1 Tech #2 Tech #1 Tech #2 Total SAINT BFDR birA Biotin Ligase (E. coli ) 2802 2753 1927 1967 2107 2211 8212 0 0.92 HK2 Hexokinase 2 0 0 774 727 920 797 3218

AKAP1 A-kinase anchoring protein 1 23 20 83 71 101 112 367 1 0 MAVS mitochondrial antiviral signaling protein 8 6 75 78 89 92 334 1 0 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 21 20 63 59 72 69 263 1 0 VPS13D vacuolar protein sorting 13 homolog D 0 0 45 42 47 53 187 1 0 FBXO17 F-box protein 17 0 0 39 44 50 53 186 1 0 BCL2L13 BCL2 like 13 0 0 40 34 51 47 172 1 0 HK1 hexokinase 1 13 11 40 38 44 45 167 1 0 OCIAD1 OCIA domain containing 1 8 6 38 37 41 45 161 1 0 TDRKH tudor and KH domain containing 5 4 42 37 32 32 143 1 0 EXD2 exonuclease 3'-5' domain containing 2 0 0 28 31 32 31 122 1 0 RHOT2 ras homolog family member T2 2 2 22 32 24 32 110 1 0 MARC2 mitochondrial amidoxime reducing component 2 0 0 25 25 22 21 93 1 0 ATPAF1 ATP synthase mitochondrial F1 complex assembly factor 1 0 0 24 21 23 22 90 1 0 MFF mitochondrial fission factor 0 0 21 23 20 16 80 1 0 USP30 ubiquitin specific peptidase 30 0 0 20 19 23 16 78 1 0 FAM82A2 regulator of microtubule dynamics 3 0 0 16 17 17 18 68 1 0 FAM54B mitochondrial fission regulator 1 like 0 0 15 15 11 13 54 1 0 FAM54A mitochondrial fission regulator 2 0 0 13 10 11 14 48 1 0 NME3 NME/NM23 nucleoside diphosphate kinase 3 0 0 13 15 8 8 44 1 0 MARC1 mitochondrial amidoxime reducing component 1 0 0 13 11 8 9 41 1 0 RPS27L ribosomal protein S27 like 0 0 8 9 12 10 39 1 0 FAM73A mitoguardin 1 0 0 11 10 7 10 38 1 0 SLC30A9 solute carrier family 30 member 9 0 0 5 7 12 14 38 1 0 MIF macrophage migration inhibitory factor 0 0 9 10 8 10 37 1 0 SNAP47 synaptosome associated protein 47 0 0 9 6 12 8 35 1 0 MTFR1 mitochondrial fission regulator 1 0 0 10 10 7 7 34 1 0 DOLPP1 dolichyldiphosphatase 1 0 0 8 8 6 9 31 1 0 ARMC10 armadillo repeat containing 10 0 0 6 9 5 7 27 1 0 CISD1 CDGSH iron sulfur domain 1 0 0 5 8 6 4 23 1 0 CUL1 cullin 1 7 5 25 20 40 42 127 0.99 0 FKBP8 FK506 binding protein 8 7 7 24 24 25 25 98 0.99 0 RPS12 ribosomal protein S12 12 10 46 47 36 32 161 0.98 0 FBXL4 F-box and leucine rich repeat protein 4 0 0 3 3 4 4 14 0.98 0 VPS13A vacuolar protein sorting 13 homolog A 2 0 13 9 14 15 51 0.97 0 RHOT1 ras homolog family member T1 0 0 4 4 2 3 13 0.93 0 CYB5R1 cytochrome b5 reductase 1 0 0 3 5 2 3 13 0.92 0 UBXN4 UBX domain protein 4 4 2 12 12 14 11 49 0.91 0.01 CBR1 carbonyl reductase 1 6 4 19 17 16 16 68 0.87 0.01 GFM1 G elongation factor mitochondrial 1 0 0 2 5 2 2 11 0.84 0.01 GK glycerol kinase 2 0 6 8 13 13 40 0.83 0.02 NME1-NME2 NME1-NME2 readthrough 16 13 42 61 38 55 196 0.8 0.02

Table 4.8 Complete list of interactors identified by BioID for PAA-BirA-PAA-HK2 Interactors identified are sorted by total peptide counts across two biological and two technical replicates, and significance analysis of interactome (SAINT) using a Bayesian false discovery rate (BFDR) <3%.

NLS-BF-NLS-HK2 Pool A Pool B Gene Name Full Name Top 2 Controls Tech #1 Tech #2 Tech #1 Tech #2 Total SAINT BFDR BirA* Biotin Ligase 2815 2807 852 711 700 572 2835 HK2 Hexokinase 2 0 0 711 516 687 488 2402

SIRT1 sirtuin 1 0 0 8 7 7 13 35 1 0 TDP2 tyrosyl-DNA phosphodiesterase 2 0 0 5 5 9 13 32 1 0 BIVM-ERCC5 BIVM-ERCC5 readthrough 0 0 6 7 5 5 23 1 0 IWS1 interacts with SUPT6H, CTD assembly factor 1 0 0 5 9 4 6 24 0.99 0 PHF10 PHD finger protein 10 0 0 9 6 4 5 24 0.99 0 TIMM13 translocase of inner mitochondrial membrane 13 0 0 7 8 5 2 22 0.9 0 AASDH aminoadipate-semialdehyde dehydrogenase 0 0 2 4 6 3 15 0.88 0.02 CTR9 CTR9 homolog, Paf1/RNA polymerase II complex component 4 3 15 13 11 14 53 0.75 0.03

127

4.6 Importin 11 (IPO11)

Importin 11 (IPO11) is a nuclear transport receptor that recognizes nuclear import signals on proteins and delivers the them to the nuclear pore complex (NPC). It has two known substrates in helping the transport of ubiquitin conjugating enzyme E2 E3 (UBE2E3) and phosphatase and tensin homolog (PTEN) to the nucleus (308, 309).

IPO11 was identified as a top hit in a screen looking for genes upregulated in relapsed AML patient samples (data unpublished). To identify how IPO11 affects recurrent AML, we performed BioID on IPO11. The interactome identified 14 interactors including the known interactor UBE2E3. Four proteins within the nuclear core complex were identified. Additionally, two factors implicated in translation, basic leucine zipper and W2 domain-containing protein 1 (BZW1) and 2 (BZW2) were identified. These two proteins are of current interest in ongoing unpublished work to identify the mechanism by which IPO11 affects AML relapse.

Table 4.9 Complete list of interactors identified by BioID for IPO11 Interactors identified are sorted by total peptide counts across two biological and two technical replicates, and significance analysis of interactome (SAINT) using a Bayesian false discovery rate (BFDR) <2%.

IPO11 Pool A Pool B Gene Name Full Name Top 2 Controls Tech #1 Tech #2 Tech #1 Tech #2 Total SAINT BFDR BirA Biotin ligase ( E. coli ) 2815 2807 903 757 844 784 3288 0 0.96 IPO11 Importin-11 14 7 436 365 441 403 1645

NUP153 nucleoporin 153 49 48 197 201 200 165 763 1 0 NUP50 nucleoporin 50 26 24 106 106 107 103 422 1 0 PDXDC1 pyridoxal dependent decarboxylase domain containing 1 12 11 78 84 78 79 319 1 0 TFCP2 transcription factor CP2 12 11 41 43 50 40 174 1 0 MCM3AP minichromosome maintenance complex component 3 associated 0protein 0 38 40 31 33 142 1 0 BYSL bystin like 6 4 36 35 34 28 133 1 0 BZW2 basic leucine zipper and W2 domains 2 5 4 26 28 23 27 104 1 0 BZW1 basic leucine zipper and W2 domains 1 4 2 19 19 19 18 75 1 0 POM121C POM121 transmembrane nucleoporin C 0 0 9 7 12 9 37 1 0 POM121 POM121 transmembrane nucleoporin 0 0 9 7 12 8 36 1 0 TIMM13 translocase of inner mitochondrial membrane 13 0 0 7 8 11 7 33 1 0 GPSM1 G protein signaling modulator 1 0 0 5 6 5 5 21 1 0 UBB ubiquitin B 0 0 23 26 38 0 87 0.75 0 UBE2E3 ubiquitin conjugating enzyme E2 E3 0 0 17 16 21 0 54 0.75 0.02

128

4.7 Mitochondrial Proteomes

In performing four other mitochondrial protein BioIDs I was able to further show the differences in interactomes identified within the mitochondria. When looking at correlation analysis between bait proteins, mitochondrial proteins cluster based on their sub-mitochondrial localization (Figure 4.8). Both IMS proteases (HTRA2 and OMA1) clustered with ATP5I which is part of the inner membrane facing the IMS. Further ATP5I more closely clustered with OMA1 which is embedded within the inner membrane and less with HTRA2, a free-floating IMS protein. LETM1 which is an inner membrane protein within the mitochondrial matrix correlates closely with matrix proteins CLPP and MLS-targeted STAT3. When you read the list from top to bottom in Figure 4.8. it maps proteins from the IMS moving towards the mitochondrial matrix (HTRA2àOMA1àATP5IàLETM1àCLPPàMLS-STAT). IPO11 a nuclear protein does not correlate well within any of the mitochondrial proteins as expected. Thus, we are able to identify the mitochondrial localization of a protein based on its BioID interactome and how it correlates with other mitochondrial proteins. This can be a useful tool in understanding a proteins sub- mitochondrial localization.

129

Chapter 5 Discussion

Discussion

In this thesis, I used proteomic analysis to characterize mitochondrial intermembrane space proteases by identifying their putative interactors. In Chapter two, the interactome of all seven IMS proteases was identified in 293 Flp-In T-REx cells using BioID and the interaction of HTRA2 with IMMT was validated. In Chapter three, I identified the importance of HTRA2 in growth and differentiation of AML cells. In Chapter four, I discussed the BioID datasets of other projects I was a collaborator on.

5.1 Interactome of Seven IMS Proteases

In Chapter 2, I used BioID to identify the interactomes of seven IMS proteases in 293 Flp-In T- REx cells. In total, 802 high confidence proximity interactions with 342 unique interactors were identified. 272 (~80%) of the 342 interactors are annotated by GO (Supplemental Table 3) as mitochondrial proteins associated with known IMS functions such as, mitochondrial organization, electron transport and aerobic respiration. These findings suggest that we were achieving correct mitochondrial localization for our bait proteins. Additionally, we used two known IMS marker proteins, OPA1 and CLPB, to further confirm correct IMS localization of our baits within the mitochondria. Clustering our baits based on their interactomes, grouped all of our IMS proteases together and separated them from a mitochondrial matrix protein and a nuclear protein (Figure 2.2 C). This illustrates our IMS proteases have specific interactor protein profiles that can identify them as IMS proteins.

In comparison with the APEX IMS interactome that was published, our seven IMS proteases interacted with 59 of the 127 IMS proteins. Within the GO database we identified 27 of the 79 annotated mitochondrial IMS proteins. This further illustrates that our fusion bait proteins are localizing to the IMS. These numbers do not take into account the embedded mitochondrial outer and inner membrane proteins that contain protein domains within the IMS. 153 of the proteins

130 identified were annotated as mitochondrial inner membrane (Table 2.1). This included many components of the ETC which many would consider to localize more often on the mitochondrial matrix side. However, it is important to note that some embedded inner membrane proteins will have protein domains accessible on both sides of the membrane. Thus, for proteins directly embedded in the inner membrane they could be identified in the BioID assay by both IMS and matrix baits provided they contain accessible lysine residues on both sides that can be biotinylated.

We were concerned about potential background as the BirA*FLAG-only controls do not enter the mitochondria. This was further compounded by all of our baits localizing to the tight area between the two mitochondrial membranes. Kim et al. described the radius of the biotin bubble produced by BirA* as being approximately 10 nm (206). This radius provides a very small area of biotinylation within the cell. However, when considering the IMS, this area is very small and dynamic as mitochondria are constantly dividing and fusing. While the exact width of the intermembrane space has not been formally determined, it is estimated to range anywhere from 6-40 nm in width (23, 310, 311). Thus, with a 10 nm biotinylation cloud, we were unsure whether our interactomes would be too similar to infer specific interactors for the IMS proteases. However, despite this small space, 230 of the IMS protease prey proteins interacted with just one or two bait polypeptides, suggesting that BioID can identify unique interactomes for individual IMS proteases. This is further highlighted by the variance in the number of high confidence interactors identified for each protease that ranged from 30 (YME1L1) to 243 (IMMP2L), with an average of 114. This could imply that a protease such as YME1L1 has a highly specific group of substrates and localized area within the IMS that it resides, whereas IMMP2L may have a more diverse group of substrates and is more ubiquitously spread throughout the IMS.

Therefore, although the IMS is a very small cellular space, BioID was able to identify unique interactomes for each protease.

Within these unique interactomes it would be useful to separate out interactors from potential substrates of these proteases. Identifying the interactors that are substrates would give us a better understanding of a protease’s role in mitochondrial biology.

A few experiments could be performed to narrow down the list of interactors to list of putative substrates. If there was any known consensus degradation sequence that a protease specifically

131 targeted an in silico approach would be to filter out proteins strictly based on their sequence. However, as these are poorly characterized proteases no such consensus sequence exists.

A second experiment could be to use stable isotope labeling with amino acids in cell culture (SILAC) in protease knockdown cells, wild-type cells, and protease over-expressing cells. As well, if there were available inhibitors or activators of these proteases they could be used as well. Comparing this list of differentially expressed proteins upon an increase or decrease in protease function with our BioID dataset would produce a list of putative substrates. However, conclusively identifying the potential substrates of these proteases can be a tedious task, as illustrated with HTRA2 and IMMT. Thus, once narrowed down this list would still need to be validated both in vitro (proteases assay) and in cells via Western blot. Interaction of HTRA2 and the MIB Complex was further supported by functional evidence that HTRA2 affected cristae formation. Therefore, functional evidence can also be used in order to narrow down the list of interactors to a list of potential substrates.

I identified an enrichment in MIB complex components within the BioID dataset of HTRA2 and identified IMMT as a substrate involved in the maintenance of cristae formation. There had been one previous publication linking HTRA2 to cristae formation that was believed to occur through the processing of OPA1 (130). However, in our HTRA2 knockdowns we observed no changes in the total levels of OPA1 or in the levels of the long and short isoforms. We proposed that the mechanism of action in the HTRA2-mediated maintenance of proper cristae formation revolved around the processing of IMMT by HTRA2. We tested three potential substrates within the MIB complex as these three components are known as the core components that are essential for cristae formation. Removal of other components from the complex maintain cristae formation but with minor defects (246).

It is important to note that HTRA2 was not the only protease to identify MIB complex components. All proteases identified at least one protein within the complex and all identified IMMT. HTRA2 was the most enriched for the entire MIB complex identifying eight of 13 components. Only one protease identified a large number of MIB complex components, and this protease was OMA1, a known processor of OPA1 that regulates mitochondrial fusion and fission. It is therefore possible that OMA1 resides near the MIB complex with OPA1 to help

132 coordinate correct cristae folding since OPA1 has been shown to be required for proper cristae formation independent of its role in fusion and fission (312).

IMMT was identified as a potential interactor for seven IMS proteases. It is unlikely that IMMT interacts with all seven proteases; however, it may have been identified because it is a larger protein. As a large protein, it has more potential peptides that can be identified by MS. Furthermore, it’s more likely that IMMT interacts with proteins in the smaller confines of the IMS because of its size. This is similar to OPA1 which was identified by all proteases but is only known to be processed by OMA1 and YME1L1. These findings could reflect a high abundance of IMMT protein within the cells as well.

It would be interesting to evaluate if a mitochondrial control would also identify OPA1 and IMMT at high levels. We did not use any mitochondrial controls in our analysis as controls targeted against organelles tend to tag a large portion of the proteome. This leads to a substantial number of false negatives. Thus, we used endogenous controls that are targeted to both the cytoplasm and nucleus which helps reduce all background proteins that naturally stick to the beads.

Known functions of HTRA2 now include a pro-apoptotic function within the cytoplasm and involvement in mitochondrial cristae formation within the mitochondria. There remains a small nuclear pool of HTRA2 that’s function, if any, is still unknown. We validated HTRA2’s nuclear locations within our dataset as we were able to identify 11 nuclear interactors. These interactors will need to be validated further for physical interaction through either Co-IP, proximity-ligation assay (PLA), or if it is a suspected substrate, in the in vitro protease assay. Additionally, the functional effect of these interactions in cells needs to be validated. For example, the protein PCGF1 is part of the polycomb repressive complex 1.1, a known epigenetic regulator of leukemic differentiation. Thus, it would be interesting to evaluate potential changes in gene expression, methylation marks, and other DNA or histone modifications that could affect leukemic differentiation similarly to PRC 1.1. Another interesting hypothesis that can be investigated is whether HTRA2 can bind DNA directly. Performing a ChIP-seq experiment at low read depth to identify any potential DNA fragments pulled down by HTRA would address this question.

133

5.2 HTRA2 G399S Mutant Interactome

The HTRA2 G399S mutant has been linked to Parkinson’s disease (183, 184, 313). Based on these findings, we were interested in evaluating changes in the interactome of this mutant HTRA2 through BioID, that could help explain the observed phenotype. Our results indicated a reduction in overall interactors and peptide counts for the interactors identified for the mutant HTRA2 when compared with the WT. This suggested that the reduction in interactors was a result of decreased protein stability and its functional activity, and not due to a gain or loss of specific interactors. In support of this hypothesis, though we observed a loss of 49 interactors, the actual peptide counts were not completely lost. Instead, the loss of interactors was due to a reduction in peptide counts below the statistical threshold to be called an interactor when compared with the controls.

Furthermore, our results support the findings from a study of HTRA2 in a mouse model of Parkinson’s. This study observed a reduction in HTRA2 protease activity with the presence of the S276C HTRA2 mutant. These mice could be rescued upon introduction of a functional HTRA2. In theory, any inactivating mutation or destabilizing mutation should have a similar phenotype to the mnd-/- mouse. An interesting experiment would be to perform a similar functional rescue of these mice through the introduction of the G399S mutant, where we would not expect to see any rescue.

5.3 Identification of Matrix Interactors with IMMP2L

Within our dataset, we showed that there were many unique interactomes identified using BioID. This was best exemplified through the IMMP1L and IMMP2L interactomes. Despite operating within the same complex in yeast, the IMMP2L interactome was highly enriched for mitochondrial matrix proteins and mitochondrial ribosome subunits compared with IMMP1L and the other IMS proteases. Additionally, IMMP2L contained 243 interactors compared to the 143 interactors of IMMP1L. This suggests IMMP2L may have a separate role aside from IMS protein import in conjunction with IMMP1L and could therefore potentially be involved in mitochondrial matrix protein import or provide mitochondrial ribosome maintenance.

Furthermore, it is interesting to note that the activity of IMP1 (yeast homolog of IMMP1L), is dependent on the presence of the C-terminal end of the IMP2 (yeast homolog of IMMP2L)(132).

134

It has not been determined whether human IMMP1L is dependent on IMMP2L as observed in the yeast homologs. However, our IMMP2L BioID did not detect IMMP1L, but our IMMP1L BioID identified IMMP2L. Considering the BirA* tag was located on the C terminal end of IMMP2L it could have prevented an interaction with IMMP1L based on how IMP1 and IMP2 interact in yeast. Thus, it is tempting to speculate that the C-terminal end of IMMP2L stabilizes IMMP1L in mammalian cells. This could also suggest that if there are any interactors of IMMP2L that require IMMP1L in order to have an interaction, they would be missed as a result of the BirA*FLAG tag. This will be discussed as a potential limitation of BioID later in the chapter.

Recently, IMMP2L was shown to play a central role in cellular senescence through processing of signaling proteins GPD2 and AIF (135). In our IMMP1L interactome we identified both GPD2 and AIF, whereas IMMP2L was only able to identify AIF. Based on our BioID, it would be interesting to see if the recent findings of the role of IMMP2L in senescence could be attributed to IMMP1L proteolytic activity and not just the proteolytic activity of IMMP2L. Introducing an inactivating mutation in IMMP2L and/or IMMP1L and checking for processing of AIF and GPD2 could address whether IMMP1L is involved in the cleavage of their import sequences. Future validation experiments on IMMP2L should take this into account.

5.4 Identification of TIMM22 Chaperone Proteins with PARL

Within our PARL dataset we identified 170 interactors. Since PARL is an inner membrane protein we were able to identify many proteins within the ETC and many TIMM proteins responsible for the import of mitochondrial proteins. Interestingly, this included a few smaller chaperone proteins that were not identified by any of our other proteases or controls. The two small chaperones identified were mitochondrial import inner membrane translocase subunit Tim9 (TIMM9) and Tim 10 (TIMM10). Both proteins are known to help in the import of inner membrane proteins through the larger TIMM22 complex embedded within the inner membrane. TIMM9 and TIMM10 are both approximately 10 kDa (89 and 90 amino acids respectively) which makes them harder to identify through LC-MS/MS due to their smaller size and less possible tryptic peptides. As unique interactors of PARL they may be involved in either PARL import into the inner membrane or coordinate with PARL to enable protein import into the inner membrane. Knocking down TIMM9 and TIMM10 and evaluating PARL insertion into the inner

135 membrane or PARL phenotypes could potentially determine the method of mitochondrial import for PARL. However, these methods could present challenges as knockdown of TIMM9 and TIMM10 could also affect the import of multiple mitochondrial proteins. Similarly, to address whether PARL helps import mitochondrial proteins, PARL knockdowns could be tested for general levels of inner membrane proteins through sub-fractionation or by specifically looking at inner membrane proteins identified through BioID via Western blot.

5.5 Limitations of BioID

While BioID is an incredibly powerful protein-protein interaction technique that, unlike other assays, is able to identify 1) membrane bound proteins and 2) transient less stable protein interactions discussed in Chapter 1, it does have limitations. It is important to note that the BirA*FLAG tag is a large 35 kDa tag that can potentially affect protein localization or block interactions with interacting proteins. As a result, false negatives are possible with this assay. As mentioned in Chapter 1, there are numerous studies trying to improve the speed of biotinylation to capture more dynamic protein situations in a shorter time frame and to reduce the size of the BirA* itself.

Within our dataset we also exclusively used 293 Flp-In T-REx cells. Therefore, it’s possible we may have missed key interactors that explain the dependence of leukemic cells on HTRA2 that were not highly expressed in HEK293 cells but are potentially expressed in leukemic cells. This limitation has been addressed in separate experiments within the lab through the use of a lentiviral system which can infect any cell line, creating a more targeted BioID approach when necessary. The caveat of this method is that is it not able to control the copy number of your gene of interest as strictly compared to the Flp-In system; however, can provide more biologically meaningful interactions.

5.6 Effect of HTRA2 Knockdown in AML

We showed in Chapter 3 that HTRA2 can affect the growth, differentiation and engraftment of leukemic cells. No prior studies have linked HTRA2 to leukemia. It was interesting that all leukemic cell lines tested except for NB4 had clear reductions in growth. As NB4 cells are an APL cell line with the t(15;17) (q22;q11-12) translocation or promyelocytic leukemia-retinoic

136 acid alpha gene fusion (PML-RARA), it would be interesting to increase the leukemic cell line panel to see which leukemic cell lines are sensitive to HTRA2 knockdown.

The mechanism explaining the effect of HTRA2 on the growth and differentiation of leukemic cells remains unknown. Surprisingly, we saw no changes in mitochondrial function upon HTRA2 knockdown suggesting that its role in cristae formation may be independent of its role in AML. The other known function of HTRA2 is in promoting apoptosis, through its interaction with XIAP. However, if this were the function driving HTRA2’s role on growth in leukemic cells then reducing HTRA2 would increase the growth of AML cells. Thus, the small nuclear pool of HTRA2 remains as the potential mechanism of how HTRA2 promotes leukemic cell stemness. It would be interesting to perform BioID of HTRA2 in a leukemic cell line and evaluate whether new interactors could be identified, specifically within the nucleus. Additionally, cross-referencing our nuclear interactors with our RNA-sequencing data could provide the mechanism by which HTRA2 affects leukemic cell stemness.

One pathway that was identified within our RNA-sequencing was the HIF1a pathway. The HIF- 1a has been implicated in maintenance of leukemic stem cells. Initially, as leukemia is not a solid tumour, hypoxia was not thought to play an important role. However, bone marrow is hypoxic and the primary site of hematopoietic stem cells (HSCs). HSCs require hypoxic conditions to maintain their stem-like properties and highly express the mRNA transcript of HIF- 1a (314, 315). Furthermore, leukemic stem cells were shown to have increased hypoxia in comparison with normal HSCs (316, 317). Therefore, hypoxia may provide a potential therapeutic window for targeting leukemic stem cells. Investigating whether HTRA2 can affect AML cell growth or response to treatment under hypoxic conditions could provide insight into whether HTRA2 is acting through the HIF-1a pathway.

Of note, there is no current suitable in vivo inhibitor or activator of HTRA2. The HTRA2 inhibitor used in the in vitro protease assay, UCF101, was shown to have off-target side effects and be extremely toxic to cells grown in culture. Thus, in order to further pursue inhibition of HTRA2 as a potential therapeutic strategy, new inhibitors would need to be developed. The phenylalanine 149 on human HTRA2 is essential for the formation of its unique homotrimeric structure that is required for HTRA2 proteolytic activity (318). This may provide a potential binding site and starting point for small molecule inhibitor development. For potential activators,

137 targeting the PDZ domain could be therapeutically relevant, as this domain is believed to bind and inhibit the active site of the HTRA2 homotrimer (319, 320). Thus, molecules that bind and sequester the PDZ should activate the proteolytic activity of HTRA2.

References

1. Koppen, M., and Langer, T. (2007) Protein degradation within mitochondria: Versatile activities of AAA proteases and other peptidases. Crit. Rev. Biochem. Mol. Biol. 42, 221– 242 2. Quirós, P. M., Langer, T., and López-Otín, C. (2015) New roles for mitochondrial proteases in health, ageing and disease. Nat. Rev. Mol. Cell Biol. 16, 345–359 3. Altmann, R. (1894) Die Elementarorganismen und ihre Beziehungen zu den Zellen 4. Ernster, L., and Schatz, G. (1981) Mitochondria: A historical review. J. Cell Biol., 227– 255 5. Claude, A. (1946) Fractionation of mammalian liver cells by differential centrifugation : II. experimental procedures and results. J. Exp. Med. 84, 61–89 6. Lehninger, A. L., and Kennedy, E. P. (1948) The requirements of the fatty acid oxidase complex of rat liver. J. Biol. Chem. 173, 753–771 7. Siekevitz, P. (1957) Powerhouse of the Cell. Sci. Am. 197, 131–144 8. Nass, M., and Nass, S. (1963) Intramitochondrial fibers with DNA characteristics I. Fixation and electron staining reactions. J. Cell Biol., 9. Schatz, G., Haslbrunner, E., and Tuppy, H. (1964) Deoxyribonucleic acid associated with yeast mitochondria. Biochem. Biophys. Res. Commun. 15, 127–132 10. Taanman, J. W. (1999) The mitochondrial genome: Structure, transcription, translation and replication. Biochim. Biophys. Acta - Bioenerg. 1410, 103–123 11. Calvo, S. E., Clauser, K. R., and Mootha, V. K. (2016) MitoCarta2.0: An updated inventory of mammalian mitochondrial proteins. Nucleic Acids Res. 44, D1251–D1257 12. Harbauer, A. B., Zahedi, R. P., Sickmann, A., Pfanner, N., and Meisinger, C. (2014) The protein import machinery of mitochondria - A regulatory hub in metabolism, stress, and disease. Cell Metab. 19, 357–372 13. Wiemerslage, L., and Lee, D. (2016) Quantification of mitochondrial morphology in neurites of dopaminergic neurons using multiple parameters. J. Neurosci. Methods 262, 56–65 14. Alberts, B., Johnson, A., Lewis, J., Raff, M., Roberts, K., and Walter, P. (2002) in Molecular Biology of the Cell 15. Margulis, L. (1967) On the origin of mitosing cells. J. Theor. Biol. 14, 225–274 16. Andersson, S. G. E., Zomorodipour, A., Andersson, J. O., Sicheritz-Pontén, T., Alsmark, U. C. M., Podowski, R. M., Näslund, A. K., Eriksson, A. S., Winkler, H. H., and Kurland, C. G. (1998) The genome sequence of Rickettsia prowazekii and the origin of mitochondria. Nature, 17. Fitzpatrick, D. A., Creevey, C. J., and McInerney, J. O. (2006) Genome phylogenies indicate a meaningful α-proteobacterial phylogeny and support a grouping of the mitochondria with the Rickettsiales. Mol. Biol. Evol., 18. Thrash, J. C., Boyd, A., Huggett, M. J., Grote, J., Carini, P., Yoder, R. J., Robbertse, B., Spatafora, J. W., Rappé, M. S., and Giovannoni, S. J. (2011) Phylogenomic evidence for a common ancestor of mitochondria and the SAR11 clade. Sci. Rep. 1, 13 19. Martijn, J., Vosseberg, J., Guy, L., Offre, P., and Ettema, T. J. G. (2018) Deep mitochondrial origin outside the sampled alphaproteobacteria. Nature 557, 101–105 20. PALADE, G. E. (1952) The fine structure of mitochondria. Anat. Rec. 114, 427–51 21. PALADE, G. E. (1953) An electron microscope study of the mitochondrial structure. J. Histochem. Cytochem. 1, 188–211

138 139

22. Sjöstrand, F. S. (1953) Electron microscopy of mitochondria and cytoplasmic double membranes: Ultra-structure of rod-shaped mitochondria. Nature 171, 30–32 23. Herrmann, J. M., and Riemer, J. (2010) The Intermembrane Space of Mitochondria. Antioxid. Redox Signal. 13, 1341–1358 24. Colombini, M. (1980) Pore size and properties of channels from mitochondria isolated from Neurospora crassa. J. Membr. Biol. 53, 79–84 25. Colombini, M., Blachly-Dyson, E., and Forte, M. (1996) VDAC, a Channel in the Outer Mitochondrial Membrane. Ion Channels 4, 169–202 26. Kühlbrandt, W. (2015) Structure and function of mitochondrial membrane protein complexes. BMC Biol., 89 27. Chacinska, A., van der Laan, M., Mehnert, C. S., Guiard, B., Mick, D. U., Hutu, D. P., Truscott, K. N., Wiedemann, N., Meisinger, C., Pfanner, N., and Rehling, P. (2010) Distinct Forms of Mitochondrial TOM-TIM Supercomplexes Define Signal-Dependent States of Preprotein Sorting. Mol. Cell. Biol. 30, 307–318 28. Gilkerson, R. W., Selker, J. M. L., and Capaldi, R. A. (2003) The cristal membrane of mitochondria is the principal site of oxidative phosphorylation. FEBS Lett. 546, 355–358 29. Kukat, C., Wurm, C. A., Spahr, H., Falkenberg, M., Larsson, N.-G., and Jakobs, S. (2011) Super-resolution microscopy reveals that mammalian mitochondrial nucleoids have a uniform size and frequently contain a single copy of mtDNA. Proc. Natl. Acad. Sci. 108, 13534–13539 30. Kukat, C., Davies, K. M., Wurm, C. A., Spåhr, H., Bonekamp, N. A., Kühl, I., Joos, F., Polosa, P. L., Park, C. B., Posse, V., Falkenberg, M., Jakobs, S., Kühlbrandt, W., and Larsson, N.-G. (2015) Cross-strand binding of TFAM to a single mtDNA molecule forms the mitochondrial nucleoid. Proc. Natl. Acad. Sci. 112, 11288–11293 31. Lee, S. R., and Han, J. (2017) Mitochondrial Nucleoid: Shield and Switch of the Mitochondrial Genome. Oxid. Med. Cell. Longev., Article ID 8060949 32. Srere, P. A. (1980) The infrastructure of the mitochondrial matrix. Trends Biochem. Sci. 5, 120–121 33. Osellame, L. D., Blacker, T. S., and Duchen, M. R. (2012) Cellular and molecular mechanisms of mitochondrial function. Best Pract. Res. Clin. Endocrinol. Metab. 26, 711–723 34. Bricker, D. K., Taylor, E. B., Schell, J. C., Orsak, T., Boutron, A., Chen, Y. C., Cox, J. E., Cardon, C. M., Van Vranken, J. G., Dephoure, N., Redin, C., Boudina, S., Gygi, S. P., Brivet, M., Thummel, C. S., and Rutter, J. (2012) A mitochondrial pyruvate carrier required for pyruvate uptake in yeast, Drosophila, and humans. Science (80-. ). 337, 96– 100 35. Herzig, S., Raemy, E., Montessuit, S., Veuthey, J. L., Zamboni, N., Westermann, B., Kunji, E. R. S., and Martinou, J. C. (2012) Identification and functional expression of the mitochondrial pyruvate carrier. Science (80-. ). 337, 93–96 36. Chang, T. W., and Goldberg, A. L. (1978) The metabolic fates of amino acids and the formation of glutamine in skeletal muscle. J. Biol. Chem. 253, 3685–3695 37. Linn, T. C., Pettit, F. H., and Reed, L. J. (1969) aKeto acid dehydrogenase complexes, X. Regulation of the activity of the pyruvate dehydrogenase complex from beef kidney mitochondria by phosphorylation and dephosphorylation. Proc. Natl. Acad. Sci. 62, 234– 241 38. Wieland, O. H. (1983), pp 124–158. 39. Houten, S. M., and Wanders, R. J. A. (2010) A general introduction to the biochemistry of

140

mitochondrial fatty acid β-oxidation. J. Inherit. Metab. Dis. 33, 469–477 40. Schönfeld, P., and Reiser, G. (2013) Why does brain metabolism not favor burning of fatty acids to provide energy-Reflections on disadvantages of the use of free fatty acids as fuel for brain. J. Cereb. Blood Flow Metab. 33, 1493–1499 41. Cahill, G. F. (2006) Fuel Metabolism in Starvation. Annu. Rev. Nutr. 26, 1–22 42. Laffel, L. (1999) Ketone bodies: A review of physiology, pathophysiology and application of monitoring to diabetes. Diabetes. Metab. Res. Rev. 15, 412–426 43. Akram, M. (2014) Citric Acid Cycle and Role of its Intermediates in Metabolism. Cell Biochem. Biophys. 68, 475–478 44. Nazaret, C., Heiske, M., Thurley, K., and Mazat, J. P. (2009) Mitochondrial energetic metabolism: A simplified model of TCA cycle with ATP production. J. Theor. Biol. 258, 455–464 45. Biology, C., Llopis, J., McCaffery, J. M., Miyawaki, A., Farquhar, M. G., and Tsien, R. Y. (1998) Measurement of cytosolic, mitochondrial, and Golgi pH in single living cells with green fluorescent proteins. Proc. Natl. Acad. Sci. U. S. A. 95, 6803–6808 46. Cooper, G. M. (2000) The Cell: A Molecular Approach. 2nd edition 47. Hinkle, P. C., and Yu, M. L. (1979) The phosphorus/oxygen ratio of mitochondrial oxidative phosphorylation. J. Biol. Chem. 254, 2450–2455 48. Hinkie, P. C., Arun Kumar, M., Resetar, A., and Harris, D. L. (1991) Mechanistic Stoichiometry of Mitochondrial Oxidative Phosphorylation. Biochemistry 30, 3576–3582 49. Martínez-Reyes, I., and Chandel, N. S. (2020) Mitochondrial TCA cycle metabolites control physiology and disease. Nat. Commun. 11, 102 50. Klingenberg, M., and Rottenberg, H. (1977) Relation between the Gradient of the ATP/ADP Ratio and the Membrane Potential across the Mitochondrial Membrane. Eur. J. Biochem. 73, 125–130 51. Brand, M. D., and Lehninger, A. L. (1977) H+/ATP ratio during ATP hydrolysis by mitochondria: modification of the chemiosmotic theory. Proc. Natl. Acad. Sci. 74, 1955– 1959 52. Porter, R. K., and Brand, M. D. (1995) Mitochondrial proton conductance and H + /0 ratio are independent of electron transport rate in isolated hepatocytes. Biochem. J. 310, 379– 382 53. Hinkle, P. C. (2005) P/O ratios of mitochondrial oxidative phosphorylation. Biochim. Biophys. Acta - Bioenerg. 1706, 1–11 54. Henry, M. F., and Vignais, P. M. (1980) Production of superoxide anions in Paracoccus denitrificans. Arch. Biochem. Biophys. 203, 365–371 55. Lodish, A. (2001) Molecular Cell Biology (5th edition) 56. Ray, P. D., Huang, B.-W., and Tsuji, Y. (2012) Reactive oxygen species (ROS) homeostasis and redox regulation in cellular signaling. Cell. Signal. 24, 981–990 57. Weisiger, R. A., and Fridovich, I. (1973) Superoxide dismutase. Organelle specificity. J. Biol. Chem. 248, 3582–3592 58. Loschen, G., Flohé, L., and Chance, B. (1971) Respiratory chain linked H2O2 production in pigeon heart mitochondria. FEBS Lett. 18, 261–264 59. Loschen, G., Azzi, A., Richter, C., and Flohé, L. (1974) Superoxide radicals as precursors of mitochondrial hydrogen peroxide. FEBS Lett. 15, 68–72 60. Glorieux, C., and Calderon, P. B. (2017) Catalase, a remarkable enzyme: targeting the oldest antioxidant enzyme to find a new cancer treatment approach. Biol. Chem. 398, DOI: https://doi.org/10.1515/hsz-2017-0131

141

61. Bigarella, C. L., Liang, R., and Ghaffari, S. (2014) Stem cells and the impact of ROS signaling. Development 141, 4206–4218 62. Forrester, S. J., Kikuchi, D. S., Hernandes, M. S., Xu, Q., and Griendling, K. K. (2018) Reactive oxygen species in metabolic and inflammatory signaling. Circ. Res. 122, 877– 902 63. Hetz, C. (2012) The unfolded protein response: Controlling cell fate decisions under ER stress and beyond. Nat. Rev. Mol. Cell Biol., 64. Houtkooper, R. H., Mouchiroud, L., Ryu, D., Moullan, N., Katsyuba, E., Knott, G., Williams, R. W., and Auwerx, J. (2013) Mitonuclear protein imbalance as a conserved longevity mechanism. Nature 497, 451–457 65. Nargund, A. M., Pellegrino, M. W., Fiorese, C. J., Baker, B. M., and Haynes, C. M. (2012) Mitochondrial import efficiency of ATFS-1 regulates mitochondrial UPR activation. Science (80-. ). 337, 587–590 66. Martinus, R. D., Garth, G. P., Webster, T. L., Cartwright, P., Naylor, D. J., Høj, P. B., and Hoogenraad, N. J. (1996) Selective induction of mitochondrial chaperones in response to loss of the mitochondrial genome. Eur. J. Biochem. 240, 98–103 67. Zhao, Q., Wang, J., Levichkin, I. V., Stasinopoulos, S., Ryan, M. T., and Hoogenraad, N. J. (2002) A mitochondrial specific stress response in mammalian cells. EMBO J. 21, 4411–4419 68. Rath, E., Berger, E., Messlik, A., Nunes, T., Liu, B., Kim, S. C., Hoogenraad, N., Sans, M., Sartor, R. B., and Haller, D. (2012) Induction of dsRNA-activated protein kinase links mitochondrial unfolded protein response to the pathogenesis of intestinal inflammation. Gut 61, 1269–1278 69. Horibe, T., and Hoogenraad, N. J. (2007) The Chop gene contains an element for the positive regulation of the mitochondrial unfolded protein response. PLoS One 2, e835 70. Weiss, C., Schneider, S., Wagner, E. F., Zhangs, X., Seto, E., and Bohmann, D. (2003) JNK phosphorylation relieves HDAC3-dependent suppression of the transcriptional activity of c-Jun. EMBO J. 22, 3686–3695 71. Wang, X. Z., Lawson, B., Brewer, J. W., Zinszner, H., Sanjay, A., Mi, L. J., Boorstein, R., Kreibich, G., Hendershot, L. M., and Ron, D. (1996) Signals from the stressed endoplasmic reticulum induce C/EBP-homologous protein (CHOP/GADD153). Mol. Cell. Biol. 16, 4273–4280 72. Fiorese, C. J., Schulz, A. M., Lin, Y. F., Rosin, N., Pellegrino, M. W., and Haynes, C. M. (2016) The Transcription Factor ATF5 Mediates a Mammalian Mitochondrial UPR. Curr. Biol. 26, 2037–2043 73. Quirós, P. M., Prado, M. A., Zamboni, N., D’Amico, D., Williams, R. W., Finley, D., Gygi, S. P., and Auwerx, J. (2017) Multi-omics analysis identifies ATF4 as a key regulator of the mitochondrial stress response in mammals. J. Cell Biol., 74. Merkwirth, C., Jovaisaite, V., Durieux, J., Matilainen, O., Jordan, S. D., Quiros, P. M., Steffen, K. K., Williams, E. G., Mouchiroud, L., Tronnes, S. U., Murillo, V., Wolff, S. C., Shaw, R. J., Auwerx, J., and Dillin, A. (2016) Two Conserved Histone Demethylases Regulate Mitochondrial Stress-Induced Longevity. Cell 165, 1209–1223 75. Shpilka, T., and Haynes, C. M. (2018) The mitochondrial UPR: Mechanisms, physiological functions and implications in ageing. Nat. Rev. Mol. Cell Biol. 19, 109–120 76. Elmore, S. (2007) Apoptosis: a review of programmed cell death. Toxicol. Pathol. 35, 495–516 77. Tzifi, F., Economopoulou, C., Gourgiotis, D., Ardavanis, A., Papageorgiou, S., and

142

Scorilas, A. (2012) The role of BCL2 family of apoptosis regulator proteins in acute and chronic leukemias. Adv. Hematol., doi: 10.1155/2012/524308 78. Hanada, M., Aime-Sempe, C., Sato, T., and Reed, J. C. (1995) Structure-function analysis of Bcl-2 protein. Identification of conserved domains important for homodimerization with Bcl-2 and heterodimerization with bax. J. Biol. Chem. 270, 11962–11969 79. Boyd, J. M., Gallo, G. J., Elangovan, B., Houghton, A. B., Malstrom, S., Avery, B. J., Ebb, R. G., Subramanian, T., Chittenden, T., and Lutz, R. J. (1995) Bik, a novel death- inducing protein shares a distinct sequence motif with Bcl-2 family proteins and interacts with viral and cellular survival-promoting proteins. Oncogene 11, 1921–1928 80. L.Omonosova, E., and C.Hinnadurai, G. (2008) BH3-only proteins in apoptosis and beyond: An overview. Oncogene 27, S2–S19 81. Wei, M. C., Zong, W. X., Cheng, E. H. Y., Lindsten, T., Panoutsakopoulou, V., Ross, A. J., Roth, K. A., Macgregor, G. R., Thompson, C. B., and Korsmeyer, S. J. (2001) Proapoptotic BAX and BAK: A requisite gateway to mitochondrial dysfunction and death. Science (80-. ). 292, 727–730 82. Saelens, X., Festjens, N., Vande Walle, L., Van Gurp, M., Van Loo, G., and Vandenabeele, P. (2004) Toxic proteins released from mitochondria in cell death. Oncogene 23, 2861–2874 83. Liu, X., Kim, C. N., Yang, J., Jemmerson, R., and Wang, X. (1996) Induction of apoptotic program in cell-free extracts: Requirement for dATP and cytochrome c. Cell 86, 147–157 84. Zou, H., Henzel, W. J., Liu, X., Lutschg, A., and Wang, X. (1997) Apaf-1, a human protein homologous to C. elegans CED-4, participates in cytochrome c-dependent activation of caspase-3. Cell 90, 405–413 85. Li, P., Nijhawan, D., Budihardjo, I., Srinivasula, S. M., Ahmad, M., Alnemri, E. S., and Wang, X. (1997) Cytochrome c and dATP-dependent formation of Apaf-1/caspase-9 complex initiates an apoptotic protease cascade. Cell 91, 479–489 86. Adrain, C., Creagh, E. M., and Martin, S. J. (2001) Apoptosis-associated release of Smac/DIABLO from mitochondria requires active caspases and is blocked by Bcl-2. EMBO J. 20, 6627–6636 87. Suzuki, Y., Imai, Y., Nakayama, H., Takahashi, K., Takio, K., and Takahashi, R. (2001) A Serine Protease, HtrA2, Is Released from the Mitochondria and Interacts with XIAP, Inducing Cell Death. Mol. Cell 8, 613–621 88. Cosentino, K., and García-Sáez, A. J. (2017) Bax and Bak Pores: Are We Closing the Circle? Trends Cell Biol. 27, 266–275 89. Shamas-Din, A., Kale, J., Leber, B., and Andrews, D. W. (2013) Mechanisms of action of Bcl-2 family proteins. Cold Spring Harb. Perspect. Biol. 5, doi: 10.1101/cshperspect.a008714 90. Pfeffer, C. M., and Singh, A. T. K. (2018) Apoptosis: A target for anticancer therapy. Int. J. Mol. Sci. 19, 448 91. Sena, L. A., and Chandel, N. S. (2012) Physiological roles of mitochondrial reactive oxygen species. Mol. Cell 48, 158–167 92. Collins, Y., Chouchani, E. T., James, A. M., Menger, K. E., Cochemé, H. M., and Murphy, M. P. (2012) Mitochondrial redox signalling at a glance. J. Cell Sci. 125, 801– 806 93. Chandel, N. S., Maltepe, E., Goldwasser, E., Mathieu, C. E., Simon, M. C., and Schumacker, P. T. (1998) Mitochondrial reactive oxygen species trigger hypoxia-induced transcription. Proc. Natl. Acad. Sci. U. S. A. 95, 11715–11720

143

94. Chandel, N. S., McClintock, D. S., Feliciano, C. E., Wood, T. M., Melendez, J. A., Rodriguez, A. M., and Schumacker, P. T. (2000) Reactive oxygen species generated at mitochondrial Complex III stabilize hypoxia-inducible factor-1α during hypoxia: A mechanism of O2 sensing. J. Biol. Chem. 275, 25130–25138 95. Kim, J. W., Tchernyshyov, I., Semenza, G. L., and Dang, C. V. (2006) HIF-1-mediated expression of pyruvate dehydrogenase kinase: A metabolic switch required for cellular adaptation to hypoxia. Cell Metab. 3, 177–185 96. Fukuda, R., Zhang, H., Kim, J. whan, Shimoda, L., Dang, C. V., and Semenza, G. L. L. (2007) HIF-1 Regulates Cytochrome Oxidase Subunits to Optimize Efficiency of Respiration in Hypoxic Cells. Cell 129, 111–122 97. Rhee, S. G., Bae, Y. S., Lee, S. R., and Kwon, J. (2000) Hydrogen peroxide: a key messenger that modulates protein phosphorylation through cysteine oxidation. Sci. STKE, 98. Al-Mehdi, A. B., Pastukh, V. M., Swiger, B. M., Reed, D. J., Patel, M. R., Bardwell, G. C., Pastukh, V. V., Alexeyev, M. F., and Gillespie, M. N. (2012) Perinuclear mitochondrial clustering creates an oxidant-rich nuclear domain required for hypoxia- induced transcription. Sci. Signal. 5, 99. Vavvas, D., Apazidis, A., Saha, A. K., Gamble, J., Patel, A., Kemp, B. E., Witters, L. A., and Ruderman, N. B. (1997) Contraction-induced changes in acetyl-CoA carboxylase and 5’-AMP- activated kinase in skeletal muscle. J. Biol. Chem. 272, 13255–13261 100. Jäer, S., Handschin, C., St-Pierre, J., and Spiegelman, B. M. (2007) AMP-activated protein kinase (AMPK) action in skeletal muscle via direct phosphorylation of PGC-1α. Proc. Natl. Acad. Sci. U. S. A. 104, 12017–12022 101. Carlucci, A., Lignitto, L., and Feliciello, A. (2008) Control of mitochondria dynamics and oxidative metabolism by cAMP, AKAPs and the proteasome. Trends Cell Biol. 18, 604– 613 102. Kim, H., Scimia, M. C., Wilkinson, D., Trelles, R. D., Wood, M. R., Bowtell, D., Dillin, A., Mercola, M., and Ronai, Z. A. (2011) Fine-Tuning of Drp1/Fis1 Availability by AKAP121/Siah2 Regulates Mitochondrial Adaptation to Hypoxia. Mol. Cell 44, 532–544 103. Harada, H., Becknell, B., Wilm, M., Mann, M., Huang, L. J. shen, Taylor, S. S., Scott, J. D., and Korsmeyer, S. J. (1999) Phosphorylation and inactivation of BAD by mitochondria-anchored protein kinase A. Mol. Cell 3, 413–422 104. Seth, R. B., Sun, L., Ea, C. K., and Chen, Z. J. (2005) Identification and characterization of MAVS, a mitochondrial antiviral signaling protein that activates NF-κB and IRF3. Cell 122, 669–682 105. West, A. P., Brodsky, I. E., Rahner, C., Woo, D. K., Erdjument-Bromage, H., Tempst, P., Walsh, M. C., Choi, Y., Shadel, G. S., and Ghosh, S. (2011) TLR signalling augments macrophage bactericidal activity through mitochondrial ROS. Nature 472, 476–480 106. Goldberg, A. L. (2003) Protein degradation and protection against misfolded or damaged proteins. Nature 426, 895–899 107. Cooper, G. M., and Hausman, R. E. (2007) The Cell: A Molecular Approach 2nd Edition 108. Buller, A. R., and Townsend, C. A. (2013) Intrinsic evolutionary constraints on protease structure, enzyme acylation, and the identity of the catalytic triad. Proc. Natl. Acad. Sci. 110, E653–E661 109. Pelmenschikov, V., Blomberg, M. R. A., and Siegbahn, P. E. M. (2002) A theoretical study of the mechanism for peptide hydrolysis by thermolysin. J. Biol. Inorg. Chem. 7, 284–298 110. Wu, S., Zhang, C., Xu, D., and Guo, H. (2010) Catalysis of carboxypeptidase A:

144

Promoted-water versus nucleophilic pathways. J. Phys. Chem. B 114, 9259–9267 111. Vallee, B. L., and Auld, D. S. (1990) Zinc Coordination, Function, and Structure of Zinc Enzymes and Other Proteins. Biochemistry 29, 5647–5659 112. Kremmidiotis, G., Gardner, A. E., Settasatian, C., Savoia, A., Sutherland, G. R., and Callen, D. F. (2001) Molecular and functional analyses of the human and mouse genes encoding AFG3L1, a mitochondrial metalloprotease homologous to the human spastic paraplegia protein. Genomics 76, 58–65 113. Moshal, K. S., Singh, M., Sen, U., Rosenberger, D., Henderson, B., Tyagi, N., Zhang, H., and Tyagi, S. C. (2006) Homocysteine-mediated activation and mitochondrial translocation of calpain regulates MMP-9 in MVEC. Am. J. Physiol. Circ. Physiol. 291, H2825–H2835 114. Han, J., Goldstein, L. A., Hou, W., Froelich, C. J., Watkins, S. C., and Rabinowich, H. (2010) Deregulation of mitochondrial membrane potential by mitochondrial insertion of granzyme B and direct Hax-1 cleavage. J. Biol. Chem. 285, 22461–22472 115. Dudek, J., Rehling, P., and van der Laan, M. (2013) Mitochondrial protein import: Common principles and physiological networks. Biochim. Biophys. Acta - Mol. Cell Res. 1833, 274–285 116. Gur, E., and Sauer, R. T. (2008) Recognition of misfolded proteins by Lon, a AAA+ protease. Genes Dev. 22, 2267–2277 117. Cole, A., Wang, Z., Coyaud, E., Voisin, V., Gronda, M., Jitkova, Y., Mattson, R., Hurren, R., Babovic, S., Maclean, N., Restall, I., Wang, X., Jeyaraju, D. V., Sukhai, M. A., Prabha, S., Bashir, S., Ramakrishnan, A., Leung, E., Qia, Y. H., Zhang, N., Combes, K. R., Ketela, T., Lin, F., Houry, W. A., Aman, A., Al-awar, R., Zheng, W., Wienholds, E., Xu, C. J., Dick, J., Wang, J. C. Y., Moffat, J., Minden, M. D., Eaves, C. J., Bader, G. D., Hao, Z., Kornblau, S. M., Raught, B., and Schimmer, A. D. (2015) Inhibition of the Mitochondrial Protease ClpP as a Therapeutic Strategy for Human Acute Myeloid Leukemia. Cancer Cell 27, 864–876 118. Leonhard, K., Stiegler, A., Neupert, W., and Langer, T. (1999) Chaperone-like activity of the AAA domain of the yeast Yme1 AAA protease. Nature 398, 348–351 119. Schreiner, B., Westerburg, H., Forne, I., Imhof, A., Neupert, W., and Mokranjac, D. (2012) Role of the AAA protease Yme1 in folding of proteins in the intermembrane space of mitochondria. Mol. Biol. Cell 23, 4335–4346 120. Spiess, C., Beil, A., and Ehrmann, M. (1999) A temperature-dependent switch from chaperone to protease in a widely conserved heat shock protein. Cell 97, 339–347 121. Kooistra, J., Milojevic, J., Melacini, G., and Ortega, J. (2009) A new function of human htra2 as an amyloid-β oligomerization inhibitor. J. Alzheimer’s Dis. 17, 281–294 122. Bárcena, C., Mayoral, P., Quirós, P. M., and López-Otín, C. (2017) in Proteases in Physiology and Pathology, eds Chakraborti S, Dhalla NS (Springer Singapore, Singapore), pp 3–25. 123. Seong, Y. M., Choi, J. Y., Park, H. J., Kim, K. J., Ahn, S. G., Seong, G. H., Kim, I. K., Kang, S., and Rhim, H. (2004) Autocatalytic processing of HtrA2/Omi is essential for induction of caspase-dependent cell death through antagonizing XIAP. J. Biol. Chem. 279, 37588–37596 124. Savopoulos, J. W., Carter, P. S., Turconi, S., Pettman, G. R., Karran, E. H., Gray, C. W., Ward, R. V., Jenkins, O., and Creasy, C. L. (2000) Expression, purification, and functional analysis of the human serine protease HtrA2. Protein Expr. Purif. 19, 227–234 125. Hegde, R., Srinivasula, S. M., Zhang, Z., Wassell, R., Mukattash, R., Cilenti, L., Dubois,

145

G., Lazebnik, Y., Zervos, A. S., Fernandes-Alnemri, T., and Alnemri, E. S. (2002) Identification of Omi/HtrA2 as a mitochondrial apoptotic serine protease that disrupts inhibitor of apoptosis protein-caspase interaction. J. Biol. Chem. 277, 432–438 126. Yang, Q. H., Church-Hajduk, R., Ren, J., Newton, M. L., and Du, C. (2003) Omi/HtrA2 catalytic cleavage of inhibitor of apoptosis (IAP) irreversibly inactivates IAPs and facilitates caspase activity in apoptosis. Genes Dev. 17, 1487–1496 127. Chao, J. R., Parganas, E., Boyd, K., Hong, C. Y., Opferman, J. T., and Ihle, J. N. (2008) Hax1-mediated processing of HtrA2 by Parl allows survival of lymphocytes and neurons. Nature 452, 98–102 128. Jones, J. M., Datta, P., Srinivasula, S. M., Ji, W., Gupta, S., Zhang, Z. J., Davies, E., Hajnóczky, G., Saunders, T. L., Van Keuren, M. L., Fernandes-Alnemri, T., Meisler, M. H., and Alnemri, E. S. (2003) Loss of Omi mitochondrial protease activity causes the neuromuscular disorder of mnd2 mutant mice. Nature 425, 721–727 129. Martins, L. M., Morrison, A., Klupsch, K., Fedele, V., Moisoi, N., Teismann, P., Abuin, A., Grau, E., Geppert, M., Livi, G. P., Creasy, C. L., Martin, A., Hargreaves, I., Heales, S. J., Okada, H., Brandner, S., Schulz, J. B., Mak, T., and Downward, J. (2004) Neuroprotective Role of the Reaper-Related Serine Protease HtrA2/Omi Revealed by Targeted Deletion in Mice. Mol. Cell. Biol. 24, 9848–9862 130. Kieper, N., Holmström, K. M., Ciceri, D., Fiesel, F. C., Wolburg, H., Ziviani, E., Whitworth, A. J., Martins, L. M., Kahle, P. J., and Krüger, R. (2010) Modulation of mitochondrial function and morphology by interaction of Omi/HtrA2 with the mitochondrial fusion factor OPA1. Exp. Cell Res. 316, 1213–1224 131. Schneider, A., Oppliger, W., and Jenö, P. (1994) Purified inner membrane protease I of yeast mitochondria is a heterodimer. J. Biol. Chem. 269, 8635–8638 132. Nunnari, J., Fox, T. D., and Walter, P. (1993) A mitochondrial protease with two catalytic subunits of nonoverlapping specificities. Science (80-. ). 262, 1997–2004 133. Burri, L., Strahm, Y., Hawkins, C. J., Gentle, I. E., Puryer, M. A., Verhagen, A., Callus, B., Vaux, D., and Lithgow, T. (2005) Mature DIABLO/Smac Is Produced by the IMP Protease Complex on the Mitochondrial Inner Membrane. Mol. Biol. Cell 16, 2926–2933 134. Ieva, R., Heißwolf, A. K., Gebert, M., Vögtle, F.-N., Wollweber, F., Mehnert, C. S., Oeljeklaus, S., Warscheid, B., Meisinger, C., van der Laan, M., and Pfanner, N. (2013) Mitochondrial inner membrane protease promotes assembly of presequence translocase by removing a carboxy-terminal targeting sequence. Nat. Commun. 4, 10.1038/ncomms3853 135. Yuan, L., Zhai, L., Qian, L., Huang, D., Ding, Y., Xiang, H., Liu, X., Thompson, J. W., Liu, J., He, Y.-H., Chen, X.-Q., Hu, J., Kong, Q.-P., Tan, M., and Wang, X.-F. (2018) Switching off IMMP2L signaling drives senescence via simultaneous metabolic alteration and blockage of cell death. Cell Res. 28, 625–643 136. Maestrini, E., Pagnamenta, A. T., Lamb, J. A., Bacchelli, E., Sykes, N. H., Sousa, I., Toma, C., Barnby, G., Butler, H., Winchester, L., Scerri, T. S., Minopoli, F., Reichert, J., Cai, G., Buxbaum, J. D., Korvatska, O., Schellenberg, G. D., Dawson, G., Bildt, A. D., Minderaa, R. B., Mulder, E. J., Morris, A. P., Bailey, A. J., and Monaco, A. P. (2010) High-density SNP association study and copy number variation analysis of the AUTS1 and AUTS5 loci implicate the IMMP2L-DOCK4 gene region in autism susceptibility. Mol. Psychiatry 15, 954–968 137. Zhang, Y., Liu, Y., Zarrei, M., Tong, W., Dong, R., Wang, Y., Zhang, H., Yang, X., MacDonald, J. R., Uddin, M., Scherer, S. W., and Gai, Z. (2018) Association of IMMP2L deletions with autism spectrum disorder: A trio family study and meta-analysis. Am. J.

146

Med. Genet. Part B Neuropsychiatr. Genet. 177, 93–100 138. Silahtaroglu, A., Paschou, P., Melchior, L., Jensen, L. R., Debes, N. M., Brøndum- Nielsen, K., Skov, L., Tümer, Z., Rizzo, R., Glenthøj, B., Bertelsen, B., and Groth, C. (2014) Intragenic deletions affecting two alternative transcripts of the IMMP2L gene in patients with Tourette syndrome. Eur. J. Hum. Genet. 22, 1283–1289 139. Elia, J., Gai, X., Xie, H. M., Perin, J. C., Geiger, E., Glessner, J. T., D’Arcy, M., Deberardinis, R., Frackelton, E., Kim, C., Lantieri, F., Muganga, B. M., Wang, L., Takeda, T., Rappaport, E. F., Grant, S. F. A., Berrettini, W., Devoto, M., Shaikh, T. H., Hakonarson, H., and White, P. S. (2010) Rare structural variants found in attention-deficit hyperactivity disorder are preferentially associated with neurodevelopmental genes. Mol. Psychiatry 15, 637–646 140. Schiaffino, M. C., Fiorio, P., Di Rocco, M., Gimelli, G., Gimelli, S., Tassano, E., Capra, V., Cuoco, C., Mirabelli-Badenier, M., and Leoni, M. (2014) Interstitial 7q31.1 copy number variations disrupting IMMP2L gene are associated with a wide spectrum of neurodevelopmental disorders. Mol. Cytogenet. 7, 141. George, S. K., Jiao, Y., Bishop, C. E., and Lu, B. (2011) Mitochondrial peptidase IMMP2L mutation causes early onset of age-associated disorders and impairs adult stem cell self-renewal. Aging Cell 10, 584–594 142. Peitsaro, N., Polianskyte, Z., Tuimala, J., Pörn-Ares, I., Liobikas, J., Speer, O., Lindholm, D., Thompson, J., and Eriksson, O. (2008) Evolution of a family of metazoan active-site- serine enzymes from penicillin-binding proteins: a novel facet of the bacterial legacy. BMC Evol. Biol. 8, 26 143. Keckesova, Z., Donaher, J. L., De Cock, J., Freinkman, E., Lingrell, S., Bachovchin, D. A., Bierie, B., Tischler, V., Noske, A., Okondo, M. C., Reinhardt, F., Thiru, P., Golub, T. R., Vance, J. E., and Weinberg, R. A. (2017) LACTB is a tumour suppressor that modulates lipid metabolism and cell state. Nature 543, 681–686 144. Polianskyte, Z., Peitsaro, N., Dapkunas, A., Liobikas, J., Soliymani, R., Lalowski, M., Speer, O., Seitsonen, J., Butcher, S., Cereghetti, G. M., Linder, M. D., Merckel, M., Thompson, J., and Eriksson, O. (2009) LACTB is a filament-forming protein localized in mitochondria. Proc. Natl. Acad. Sci. U. S. A. 106, 18960–18965 145. Chen, Y., Zhu, J., Lum, P. Y., Yang, X., Pinto, S., MacNeil, D. J., Zhang, C., Lamb, J., Edwards, S., Sieberts, S. K., Leonardson, A., Castellini, L. W., Wang, S., Champy, M.-F., Zhang, B., Emilsson, V., Doss, S., Ghazalpour, A., Horvath, S., Drake, T. a, Lusis, A. J., and Schadt, E. E. (2008) Variations in DNA elucidate molecular networks that cause disease. Nature 452, 429–35 146. Käser, M., Kambacheld, M., Kisters-Woike, B., and Langer, T. (2003) Oma1, a Novel Membrane-bound Metallopeptidase in Mitochondria with Activities Overlapping with the m-AAA Protease. J. Biol. Chem. 278, 46414–46423 147. Ehses, S., Raschke, I., Mancuso, G., Bernacchia, A., Geimer, S., Tondera, D., Martinou, J. C., Westermann, B., Rugarli, E. I., and Langer, T. (2009) Regulation of OPA1 processing and mitochondrial fusion by m-AAA protease isoenzymes and OMA1. J. Cell Biol. 187, 1023 148. Head, B., Griparic, L., Amiri, M., Gandre-Babbe, S., and Van Der Bliek, A. M. (2009) Inducible proteolytic inactivation of OPA1 mediated by the OMA1 protease in mammalian cells. J. Cell Biol. 187, 959 149. Quirós, P. M., Ramsay, A. J., Sala, D., Fernández-Vizarra, E., Rodríguez, F., Peinado, J. R., Fernández-García, M. S., Vega, J. a, Enríquez, J. a, Zorzano, A., and López-Otín, C.

147

(2012) Loss of mitochondrial protease OMA1 alters processing of the GTPase OPA1 and causes obesity and defective thermogenesis in mice. EMBO J. 31, 2117–33 150. MacVicar, T. D. B., and Lane, J. D. (2014) Impaired OMA1 dependent OPA1 cleavage and reduced DRP1 fission activity combine to prevent mitophagy in OXPHOS dependent cells. J. Cell Sci. 127, 2313–2325 151. Baricault, L., Ségui, B., Guégand, L., Olichon, A., Valette, A., Larminat, F., and Lenaers, G. (2007) OPA1 cleavage depends on decreased mitochondrial ATP level and bivalent metals. Exp. Cell Res. 313, 3800–3808 152. Song, Z., Chen, H., Fiket, M., Alexander, C., and Chan, D. C. (2007) OPA1 processing controls mitochondrial fusion and is regulated by mRNA splicing, membrane potential, and Yme1L. J. Cell Biol. 178, 749–755 153. Guillery, O., Malka, F., Landes, T., Guillou, E., Blackstone, C., Lombès, A., Belenguer, P., Arnoult, D., and Rojo, M. (2008) Metalloprotease-mediated OPA1 processing is modulated by the mitochondrial membrane potential. Biol. Cell 100, 315–325 154. Kelly Rainbolt, T., Lebeau, J., Puchades, C., and Luke Wiseman, R. (2016) Reciprocal Degradation of YME1L and OMA1 Adapts Mitochondrial Proteolytic Activity during Stress. Cell Rep. 14, 2041–2049 155. Anand, R., Wai, T., Baker, M. J., Kladt, N., Schauss, A. C., Rugarli, E., and Langer, T. (2014) The i-AAA protease YME1L and OMA1 cleave OPA1 to balance mitochondrial fusion and fission. J. Cell Biol. 204, 919–929 156. Leonhard, K., Herrmann, J. M., Stuart, R. A., Mannhaupt, G., Neupert, W., and Langer, T. (1996) AAA proteases with catalytic sites on opposite membrane surfaces comprise a proteolytic system for the ATP-dependent degradation of inner membrane proteins in mitochondria. EMBO J. 15, 4218–4229 157. Hartmann, B., Wai, T., Hu, H., MacVicar, T., Musante, L., Fischer-Zirnsak, B., Stenzel, W., Gr??f, R., Van Den Heuvel, L., Ropers, H. H., Wienker, T. F., H??bner, C., Langer, T., and Kaindl, A. M. (2016) Homozygous YME1L1 mutation causes mitochondriopathy with optic atrophy and mitochondrial network fragmentation. Elife 5, 158. Baker, M. J., Mooga, V. P., Guiard, B., Langer, T., Ryan, M. T., and Stojanovski, D. (2012) Impaired folding of the mitochondrial small TIM chaperones induces clearance by the i-AAA protease. J. Mol. Biol. 424, 227–239 159. Potting, C., Tatsuta, T., König, T., Haag, M., Wai, T., Aaltonen, M. J., and Langer, T. (2013) TRIAP1/PRELI complexes prevent apoptosis by mediating intramitochondrial transport of phosphatidic acid. Cell Metab. 18, 287–295 160. Rainey, R. N., Glavin, J. D., Chen, H.-W., French, S. W., Teitell, M. A., and Koehler, C. M. (2006) A New Function in Translocation for the Mitochondrial i-AAA Protease Yme1: Import of Polynucleotide Phosphorylase into the Intermembrane Space. Mol. Cell. Biol. 26, 8488–8497 161. Griparic, L., Kanazawa, T., and Van Der Bliek, A. M. (2007) Regulation of the mitochondrial dynamin-like protein Opa1 by proteolytic cleavage. J. Cell Biol. 27, 757– 764 162. Rainbolt, T. K., Saunders, J. M., and Wiseman, R. L. (2015) YME1L degradation reduces mitochondrial proteolytic capacity during oxidative stress. EMBO Rep. 16, 97–106 163. Sík, A., Passer, B. J., Koonin, E. V., and Pellegrini, L. (2004) Self-regulated Cleavage of the Mitochondrial Intramembrane-cleaving Protease PARL Yields Pbeta, a Nuclear- targeted Peptide. J. Biol. Chem. 279, 15323–15329 164. Spinazzi, M., and De Strooper, B. (2016) PARL: The mitochondrial rhomboid protease.

148

Semin. Cell Dev. Biol. 60, 19–28 165. Kondapalli, C., Kazlauskaite, A., Zhang, N., Woodroof, H. I., Campbell, D. G., Gourlay, R., Burchell, L., Walden, H., MacArtney, T. J., Deak, M., Knebel, A., Alessi, D. R., and Muqit, M. M. K. (2012) PINK1 is activated by mitochondrial membrane potential depolarization and stimulates Parkin E3 ligase activity by phosphorylating Serine 65. Open Biol. 2, https://doi.org/10.1098/rsob.120080 166. Shiba-Fukushima, K., Imai, Y., Yoshida, S., Ishihama, Y., Kanao, T., Sato, S., and Hattori, N. (2012) PINK1-mediated phosphorylation of the Parkin ubiquitin-like domain primes mitochondrial translocation of Parkin and regulates mitophagy. Sci. Rep. 2, 1002 167. Koyano, F., Okatsu, K., Kosako, H., Tamura, Y., Go, E., Kimura, M., Kimura, Y., Tsuchiya, H., Yoshihara, H., Hirokawa, T., Endo, T., Fon, E. A., Trempe, J. F., Saeki, Y., Tanaka, K., and Matsuda, N. (2014) Ubiquitin is phosphorylated by PINK1 to activate parkin. Nature 510, 162–166 168. Okatsu, K., Koyano, F., Kimura, M., Kosako, H., Saeki, Y., Tanaka, K., and Matsuda, N. (2015) Phosphorylated ubiquitin chain is the genuine Parkin receptor. J. Cell Biol. 209, 111–128 169. Deas, E., Plun-Favreau, H., Gandhi, S., Desmond, H., Kjaer, S., Loh, S. H. Y., Renton, A. E. M., Harvey, R. J., Whitworth, A. J., Martins, L. M., Abramov, A. Y., and Wood, N. W. (2011) PINK1 cleavage at position A103 by the mitochondrial protease PARL. Hum. Mol. Genet. 20, 867–879 170. Meissner, C., Lorenz, H., Weihofen, A., Selkoe, D. J., and Lemberg, M. K. (2011) The mitochondrial intramembrane protease PARL cleaves human Pink1 to regulate Pink1 trafficking. J. Neurochem. 117, 856–867 171. Cipolat, S., Rudka, T., Hartmann, D., Costa, V., Serneels, L., Craessaerts, K., Metzger, K., Frezza, C., Annaert, W., D’Adamio, L., Derks, C., Dejaegere, T., Pellegrini, L., D’Hooge, R., Scorrano, L., and De Strooper, B. (2006) Mitochondrial Rhomboid PARL Regulates Cytochrome c Release during Apoptosis via OPA1-Dependent Cristae Remodeling. Cell 126, 163–175 172. Greene, A. W., Grenier, K., Aguileta, M. A., Muise, S., Farazifard, R., Haque, M. E., McBride, H. M., Park, D. S., and Fon, E. A. (2012) Mitochondrial processing peptidase regulates PINK1 processing, import and Parkin recruitment. EMBO Rep. 13, 378–385 173. Narendra, D. P., Jin, S. M., Tanaka, A., Suen, D. F., Gautier, C. A., Shen, J., Cookson, M. R., and Youle, R. J. (2010) PINK1 is selectively stabilized on impaired mitochondria to activate Parkin. PLoS Biol. 8, https://doi.org/10.1371/journal.pbio.1000298 174. Sekine, S., Kanamaru, Y., Koike, M., Nishihara, A., Okada, M., Kinoshita, H., Kamiyama, M., Maruyama, J., Uchiyama, Y., Ishihara, N., Takeda, K., and Ichijo, H. (2012) Rhomboid protease PARL mediates the mitochondrial membrane potential loss- induced cleavage of PGAM5. J. Biol. Chem. 287, 34635–34645 175. Wang, Z., Jiang, H., Chen, S., Du, F., and Wang, X. (2012) The mitochondrial phosphatase PGAM5 functions at the convergence point of multiple necrotic death pathways. Cell 148, 228–243 176. Ishihara, N., Fujita, Y., Oka, T., and Mihara, K. (2006) Regulation of mitochondrial morphology through proteolytic cleavage of OPA1. EMBO J. 25, 2966–2977 177. Chao, J.-R., Parganas, E., Boyd, K., Hong, C. Y., Opferman, J. T., and Ihle, J. N. (2008) Hax1-mediated processing of HtrA2 by Parl allows survival of lymphocytes and neurons. Nature 452, 98–102 178. Jeyaraju, D. V., Cisbani, G., De Brito, O. M., Koonin, E. V., and Pellegrini, L. (2009)

149

Hax1 lacks BH modules and is peripherally associated to heavy membranes: Implications for Omi/HtrA2 and PARL activity in the regulation of mitochondrial stress and apoptosis. Cell Death Differ. 16, 1622–1629 179. Yoshioka, H., Katsu, M., Sakata, H., Okami, N., Wakai, T., Kinouchi, H., and Chan, P. H. (2013) The role of PARL and HtrA2 in striatal neuronal injury after transient global cerebral ischemia. J. Cereb. Blood Flow Metab. 33, 1658–1665 180. Civitarese, A. E., MacLean, P. S., Carling, S., Kerr-Bayles, L., McMillan, R. P., Pierce, A., Becker, T. C., Moro, C., Finlayson, J., Lefort, N., Newgard, C. B., Mandarino, L., Cefalu, W., Walder, K., Collier, G. R., Hulver, M. W., Smith, S. R., and Ravussin, E. (2010) Regulation of skeletal muscle oxidative capacity and insulin signaling by the mitochondrial rhomboid protease PARL. Cell Metab. 11, 412–426 181. Kang, S., Louboutin, J. P., Datta, P., Landel, C. P., Martinez, D., Zervos, A. S., Strayer, D. S., Fernandes-Alnemri, T., and Alnemri, E. S. (2013) Loss of HtrA2/Omi activity in non- neuronal tissues of adult mice causes premature aging. Cell Death Differ. 20, 259–269 182. Strauss, K. M., Martins, L. M., Plun-Favreau, H., Marx, F. P., Kautzmann, S., Berg, D., Gasser, T., Wszolek, Z., Müller, T., Bornemann, A., Wolburg, H., Downward, J., Riess, O., Schulz, J. B., and Krüger, R. (2005) Loss of function mutations in the gene encoding Omi/HtrA2 in Parkinson’s disease. Hum. Mol. Genet. 14, 2099–2111 183. Unal Gulsuner, H., Gulsuner, S., Mercan, F. N., Onat, O. E., Walsh, T., Shahin, H., Lee, M. K., Dogu, O., Kansu, T., Topaloglu, H., Elibol, B., Akbostanci, C., King, M.-C., Ozcelik, T., and Tekinay, A. B. (2014) Mitochondrial serine protease HTRA2 p.G399S in a kindred with essential tremor and Parkinson disease. Proc. Natl. Acad. Sci. 111, 18285– 18290 184. Gambardella, S., Ferese, R., Scala, S., Carboni, S., Biagioni, F., Emiliano, G., Zampatti, S., Modugno, N., Fabbiano, F., Fornai, F., Centonze, D., and Ruggieri, S. (2018) Mitochondrial Serine Protease HTRA2 p.G399S in a Female with Di George Syndrome and Parkinson’s Disease. Parkinsons. Dis. 2018, doi.org/10.1155/2018/5651435 185. Ross, O. A., Soto, A. I., Vilariño-Güell, C., Heckman, M. G., Diehl, N. N., Hulihan, M. M., Aasly, J. O., Sando, S., Gibson, J. M., Lynch, T., Krygowska-Wajs, A., Opala, G., Barcikowska, M., Czyzewski, K., Uitti, R. J., Wszolek, Z. K., and Farrer, M. J. (2008) Genetic variation of Omi/HtrA2 and Parkinson’s disease. Park. Relat. Disord. 14, 539– 543 186. Shi, G., Lee, J. R., Grimes, D. A., Racacho, L., Ye, D., Yang, H., Ross, O. A., Farrer, M., McQuibban, G. A., and Bulman, D. E. (2011) Functional alteration of PARL contributes to mitochondrial dysregulation in Parkinson’s disease. Hum. Mol. Genet. 20, 1966–1974 187. Bingol, B., Tea, J. S., Phu, L., Reichelt, M., Bakalarski, C. E., Song, Q., Foreman, O., Kirkpatrick, D. S., and Sheng, M. (2014) The mitochondrial deubiquitinase USP30 opposes parkin-mediated mitophagy. Nature 510, 370–375 188. Falkevall, A., Alikhani, N., Bhushan, S., Pavlov, P. F., Busch, K., Johnson, K. A., Eneqvist, T., Tjernberg, L., Ankarcrona, M., and Glaser, E. (2006) Degradation of the amyloid β-protein by the novel mitochondrial peptidasome, PreP. J. Biol. Chem. 281, 29096–29104 189. Casari, G., De Fusco, M., Ciarmatori, S., Zeviani, M., Mora, M., Fernandez, P., De Michele, G., Filla, A., Cocozza, S., Marconi, R., Dürr, A., Fontaine, B., and Ballabio, A. (1998) Spastic paraplegia and OXPHOS impairment caused by mutations in paraplegin, a nuclear-encoded mitochondrial metalloprotease. Cell 93, 973–983 190. Di Bella, D., Lazzaro, F., Brusco, A., Plumari, M., Battaglia, G., Pastore, A., Finardi, A.,

150

Cagnoli, C., Tempia, F., Frontali, M., Veneziano, L., Sacco, T., Boda, E., Brussino, A., Bonn, F., Castellotti, B., Baratta, S., Mariotti, C., Gellera, C., Fracasso, V., Magri, S., Langer, T., Plevani, P., Di Donato, S., Muzi-Falconi, M., and Taroni, F. (2010) Mutations in the mitochondrial protease gene AFG3L2 cause dominant hereditary ataxia SCA28. Nat. Genet. 42, 313–321 191. Pierson, T. M., Adams, D., Bonn, F., Martinelli, P., Cherukuri, P. F., Teer, J. K., Hansen, N. F., Cruz, P., Mullikin, J. C., Blakesley, R. W., Golas, G., Kwan, J., Sandler, A., Fajardo, K., Markello, T., Tifft, C., Blackstone, C., Rugarli, E. I., Langer, T., Gahl, W. A., and Toro, C. (2011) Whole-exome sequencing identifies homozygous AFG3L2 mutations in a spastic ataxia-neuropathy syndrome linked to mitochondrial m-AAA proteases. PLoS Genet. 7, e1002325 192. Yamauchi, S., Hou, Y. Y., Guo, A. K., Hirata, H., Nakajima, W., Yip, A. K., Yu, C. han, Harada, I., Chiam, K. H., Sawada, Y., Tanaka, N., and Kawauchi, K. (2014) p53-mediated activation of the mitochondrial protease HtrA2/Omi prevents cell invasion. J. Cell Biol. 204, 1191–1207 193. Soyama, H., Miyamoto, M., Takano, M., Aoyama, T., Matsuura, H., Sakamoto, T., Takasaki, K., Kuwahara, M., Kato, K., Yoshikawa, T., Iwahashi, H., Tsuda, H., and Furuya, K. (2017) Ovarian serous carcinomas acquire cisplatin resistance and increased invasion through downregulation of the high-temperature-required protein A2 (HtrA2), following repeated treatment with cisplatin. Med. Oncol. 34, doi: 10.1007/s12032-017- 1058-3 194. Hartkamp, J., Carpenter, B., and Roberts, S. G. E. (2010) The Wilms’ Tumor Suppressor Protein WT1 Is Processed by the Serine Protease HtrA2/Omi. Mol. Cell 37, 159–171 195. Peters, J. M., Franke, W. W., and Kleinschmidt, J. A. (1994) Distinct 19 S and 20 S subcomplexes of the 26 S proteasome and their distribution in the nucleus and the cytoplasm. J. Biol. Chem., 196. Wójcik, C., and DeMartino, G. N. (2003) Intracellular localization of proteasomes. Int. J. Biochem. Cell Biol., 197. Rockel, T. D. (2005) Proteasomes degrade proteins in focal subdomains of the human cell nucleus. J. Cell Sci., 198. Field-Smith, A., Morgan, G. J., and Davies, F. E. (2006) Bortezomib (VelcadeTM) in the treatment of multiple myeloma. Ther. Clin. Risk Manag., 199. Sun, Y. (2003) Targeting E3 ubiquitin ligases for cancer therapy. Cancer Biol. Ther., 200. Hoeller, D., and Dikic, I. (2009) Targeting the ubiquitin system in cancer therapy. Nature, 201. Yang, Y., Kitagaki, J., Wang, H., Hou, D. X., and Perantoni, A. O. (2009) Targeting the ubiquitin-proteasome system for cancer therapy. Cancer Sci., 202. Hyer, M. L., Milhollen, M. A., Ciavarri, J., Fleming, P., Traore, T., Sappal, D., Huck, J., Shi, J., Gavin, J., Brownell, J., Yang, Y., Stringer, B., Griffin, R., Bruzzese, F., Soucy, T., Duffy, J., Rabino, C., Riceberg, J., Hoar, K., Lublinsky, A., Menon, S., Sintchak, M., Bump, N., Pulukuri, S. M., Langston, S., Tirrell, S., Kuranda, M., Veiby, P., Newcomb, J., Li, P., Wu, J. T., Powe, J., DIck, L. R., Greenspan, P., Galvin, K., Manfredi, M., Claiborne, C., Amidon, B. S., and Bence, N. F. (2018) A small-molecule inhibitor of the ubiquitin activating enzyme for cancer treatment. Nat. Med., 203. Barghout, S. H., Patel, P. S., Wang, X., Xu, G. W., Kavanagh, S., Halgas, O., Zarabi, S. F., Gronda, M., Hurren, R., Jeyaraju, D. V., MacLean, N., Brennan, S., Hyer, M. L., Berger, A., Traore, T., Milhollen, M., Smith, A. C., Minden, M. D., Pai, E. F., Hakem, R., and Schimmer, A. D. (2018) Preclinical evaluation of the selective small-molecule UBA1

151

inhibitor, TAK-243, in acute myeloid leukemia. Leukemia, 204. Roux, K. J., Kim, D. I., Raida, M., and Burke, B. (2012) A promiscuous biotin ligase fusion protein identifies proximal and interacting proteins in mammalian cells. J. Cell Biol. 196, 801–810 205. Chapman-Smith, A., and Cronan, J. E. (1999) The enzymatic biotinylation of proteins: A post-translational modification of exceptional specificity. Trends Biochem. Sci. 24, 359– 363 206. Kim, D. I., Birenda, K. C., Zhu, W., Motamedchaboki, K., Doye, V., and Roux, K. J. (2014) Probing nuclear pore complex architecture with proximity-dependent biotinylation. Proc. Natl. Acad. Sci. 111, E2453–E2461 207. Ward, R. J., Alvarez-Curto, E., and Milligan, G. (2011) Using the Flp-InTM T-RexTM system to regulate GPCR expression. Methods Mol. Biol. 746, 21–37 208. Yao, F., Svensjö, T., Winkler, T., Lu, M., Eriksson, C., and Eriksson, E. (1998) Tetracycline repressor, tetR, rather than the tetR-mammalian cell transcription factor fusion derivatives, regulates inducible gene expression in mammalian cells. Hum. Gene Ther. 9, 1939–1950 209. Samavarchi-Tehrani, P., Abdouni, H., Samson, R., and Gingras, A. C. (2018) A versatile lentiviral delivery toolkit for proximitydependent biotinylation in diverse cell types authors. Mol. Cell. Proteomics, 210. Green, N. M. (1963) Avidin. 1. The use of (14-C)biotin for kinetic studies and for assay. Biochem. J. 89, 585–591 211. Michael Green, N. (1990) Avidin and Streptavidin. Methods Enzymol., 212. Kim, D. I., Jensen, S. C., Noble, K. A., Kc, B., Roux, K. H., Motamedchaboki, K., and Roux, K. J. (2016) An improved smaller biotin ligase for BioID proximity labeling. Mol. Biol. Cell 27, 1188–1196 213. Putyrski, M., and Schultz, C. (2012) Protein translocation as a tool: The current rapamycin story. FEBS Lett. 586, 2097–2105 214. Branon, T. C., Bosch, J. A., Sanchez, A. D., Udeshi, N. D., Svinkina, T., Carr, S. A., Feldman, J. L., Perrimon, N., and Ting, A. Y. (2018) Efficient proximity labeling in living cells and organisms with TurboID. Nat. Biotechnol. 36, 880–887 215. Fields, S., and Song, O. K. (1989) A novel genetic system to detect protein-protein interactions. Nature 340, 245–246 216. Deane, C. M., Salwiński, Ł., Xenarios, I., and Eisenberg, D. (2002) Protein interactions: two methods for assessment of the reliability of high throughput observations. Mol. Cell. Proteomics 1, 349–356 217. Sprinzak, E., Sattath, S., and Margalit, H. (2003) How reliable are experimental protein- protein interaction data? J. Mol. Biol. 327, 919–923 218. Huang, H., Jedynak, B. M., and Bader, J. S. (2007) Where have all the interactions gone? Estimating the coverage of two-hybrid protein interaction maps. PLoS Comput. Biol. 3, e214 219. Ito, T., Chiba, T., Ozawa, R., Yoshida, M., Hattori, M., and Sakaki, Y. (2001) A comprehensive two-hybrid analysis to explore the yeast protein interactome. Proc. Natl. Acad. Sci. U. S. A. 98, 4569–4574 220. Brückner, A., Polge, C., Lentze, N., Auerbach, D., and Schlattner, U. (2009) Yeast two- hybrid, a powerful tool for systems biology. Int. J. Mol. Sci. 10, 2763–2788 221. Morris, J. H., Knudsen, G. M., Verschueren, E., Johnson, J. R., Cimermancic, P., Greninger, A. L., and Pico, A. R. (2014) Affinity purification-mass spectrometry and

152

network analysis to understand protein-protein interactions. Nat. Protoc. 9, 2539–2554 222. Gingras, A. C., Abe, K. T., and Raught, B. (2019) Getting to know the neighborhood: using proximity-dependent biotinylation to characterize protein complexes and map organelles. Curr. Opin. Chem. Biol. 48, 44–54 223. Hung, V., Zou, P., Rhee, H. W., Udeshi, N. D., Cracan, V., Svinkina, T., Carr, S. A., Mootha, V. K., and Ting, A. Y. (2014) Proteomic Mapping of the Human Mitochondrial Intermembrane Space in Live Cells via Ratiometric APEX Tagging. Mol. Cell 55, 332– 341 224. Rhee, H., Zou, P., Udeshi, N. D., Martell, J. D., Mootha, V. K., Carr, S. A., and Ting, A. Y. (2013) Proteomic mapping of mitochondria in living cells via spatially restricted enzymatic tagging. Science 339, 1328–31 225. Banerjee, S., and Mazumdar, S. (2012) Electrospray Ionization Mass Spectrometry: A Technique to Access the Information beyond the Molecular Weight of the Analyte. Int. J. Anal. Chem. 2012, ID 282574 226. Mitchell Wells, J., and McLuckey, S. A. (2005) Collision-induced dissociation (CID) of peptides and proteins. Methods Enzymol. 402, 148–185 227. Mann, M., and Jensen, O. N. (2003) Proteomic analysis of post-translational modifications. Nat. Biotechnol. 21, 255–261 228. Parker, C. E., Mocanu, V., Mocanu, M., Dicheva, N., and Warren, M. R. (2009) in Neuroproteomics, p Chapter 6. 229. Dephoure, N., Gould, K. L., Gygi, S. P., and Kellogg, D. R. (2013) Mapping and analysis of phosphorylation sites: A quick guide for cell biologists. Mol. Biol. Cell 24, 535–542 230. Kessner, D., Chambers, M., Burke, R., Agus, D., and Mallick, P. (2008) ProteoWizard: Open source software for rapid proteomics tools development. Bioinformatics 24, 2534– 2536 231. Craig, R., and Beavis, R. C. (2004) TANDEM: Matching proteins with tandem mass spectra. Bioinformatics 20, 1466–1467 232. Eng, J. K., Jahan, T. A., and Hoopmann, M. R. (2013) Comet: An open-source MS/MS sequence database search tool. Proteomics 13, 22–24 233. Shteynberg, D., Deutsch, E. W., Lam, H., Eng, J. K., Sun, Z., Tasman, N., Mendoza, L., Moritz, R. L., Aebersold, R., and Nesvizhskii, A. I. (2011) iProphet: Multi-level integrative analysis of shotgun proteomic data improves peptide and protein identification rates and error estimates. Mol. Cell. Proteomics 10, M111 234. Liu, G., Zhang, J., Larsen, B., Stark, C., Breitkreutz, A., Lin, Z. Y., Breitkreutz, B. J., Ding, Y., Colwill, K., Pasculescu, A., Pawson, T., Wrana, J. L., Nesvizhskii, A. I., Raught, B., Tyers, M., and Gingras, A. C. (2010) ProHits: Integrated software for mass spectrometry-based interaction proteomics. Nat. Biotechnol. 28, 1015–1017 235. Choi, H., Larsen, B., Lin, Z.-Y., Breitkreutz, A., Mellacheruvu, D., Fermin, D., Qin, Z. S., Tyers, M., Gingras, A.-C., and Nesvizhskii, A. I. (2011) SAINT: probabilistic scoring of affinity purification–mass spectrometry data. Nat. Methods 8, 70–73 236. Teo, G., Liu, G., Zhang, J., Nesvizhskii, A. I., Gingras, A.-C., and Choi, H. (2014) SAINTexpress: Improvements and additional features in Significance Analysis of INTeractome software. J. Proteomics 100, 37–43 237. Temple, G., Gerhard, D. S., Rasooly, R., Feingold, E. A., Good, P. J., Robinson, C., Mandich, A., Derge, J. G., Lewis, J., Shoaf, D., Collins, F. S., Jang, W., Wagner, L., Shenmen, C. M., Misquitta, L., Schaefer, C. F., Buetow, K. H., Bonner, T. I., Yankie, L., Ward, M., Phan, L., Astashyn, A., Brown, G., Farrell, C., Hart, J., Landrum, M., Maidak,

153

B. L., Murphy, M., Murphy, T., Rajput, B., Riddick, L., Webb, D., Weber, J., Wu, W., Pruitt, K. D., Maglott, D., Siepel, A., Brejova, B., Diekhans, M., Harte, R., Baertsch, R., Kent, J., Haussler, D., Brent, M., Langton, L., Comstock, C. L. G., Stevens, M., Wei, C., Van Baren, M. J., Salehi-Ashtiani, K., Murray, R. R., Ghamsari, L., Mello, E., Lin, C., Pennacchio, C., Schreiber, K., Shapiro, N., Marsh, A., Pardes, E., Moore, T., Lebeau, A., Muratet, M., Simmons, B., Kloske, D., Sieja, S., Hudson, J., Sethupathy, P., Brownstein, M., Bhat, N., Lazar, J., Jacob, H., Gruber, C. E., Smith, M. R., McPherson, J., Garcia, A. M., Gunaratne, P. H., Wu, J., Muzny, D., Gibbs, R. A., Young, A. C., Bouffard, G. G., Blakesley, R. W., Mullikin, J., Green, E. D., Dickson, M. C., Rodriguez, A. C., Grimwood, J., Schmutz, J., Myers, R. M., Hirst, M., Zeng, T., Tse, K., Moksa, M., Deng, M., Ma, K., Mah, D., Pang, J., Taylor, G., Chuah, E., Deng, A., Fichter, K., Go, A., Lee, S., Wang, J., Griffith, M., Morin, R., Moore, R. A., Mayo, M., Munro, S., Wagner, S., Jones, S. J. M., Holt, R. A., Marra, M. A., Lu, S., Yang, S., Hartigan, J., Graf, M., Wagner, R., Letovksy, S., Pulido, J. C., Robison, K., Esposito, D., Hartley, J., Wall, V. E., Hopkins, R. F., Ohara, O., and Wiemann, S. (2009) The completion of the Mammalian Gene Collection. Genome Res. 19, 2324–2333 238. Raught, B., Mis, M., Couzens, A. L., Gingras, A.-C., Dunham, W. H., Robitaille, M., Angers, S., Laurent, E. M. N., and Coyaud, E. (2015) BioID-based Identification of Skp Cullin F-box (SCF) β-TrCP1/2 E3 Ligase Substrates . Mol. Cell. Proteomics, 239. Gronostajski, R. M., and Sadowski, P. D. (1985) The FLP recombinase of the Saccharomyces cerevisiae 2 microns plasmid attaches covalently to DNA via a phosphotyrosyl linkage. Mol. Cell. Biol. 5, 3274–3279 240. Coyaud, E., Ranadheera, C., Cheng, D., Gonçalves, J., Dyakov, B. J. A., Laurent, E. M. N., St-Germain, J., Pelletier, L., Gingras, A.-C., Brumell, J. H., Kim, P. K., Safronetz, D., and Raught, B. (2018) Global Interactomics Uncovers Extensive Organellar Targeting by Zika Virus. Mol. Cell. Proteomics 17, 2242–2255 241. Verhagen, A. M., Silke, J., Ekert, P. G., Pakusch, M., Kaufmann, H., Connolly, L. M., Day, C. L., Tikoo, A., Burke, R., Wrobel, C., Moritz, R. L., Simpson, R. J., and Vaux, D. L. (2002) HtrA2 promotes cell death through its serine protease activity and its ability to antagonize inhibitor of apoptosis proteins. J. Biol. Chem. 277, 445–454 242. Sekine, K., Hao, Y., Suzuki, Y., Takahashi, R., Tsuruo, T., and Naito, M. (2005) HtrA2 cleaves Apollon and induces cell death by IAP-binding motif in Apollon-deficient cells. Biochem. Biophys. Res. Commun. 330, 279–285 243. Lampert, F., Stafa, D., Goga, A., Soste, M. V., Gilberto, S., Olieric, N., Picotti, P., Stoffel, M., and Peter, M. (2018) The multi-subunit GID/CTLH e3 ubiquitin ligase promotes c\ell proliferation and targets the transcription factor Hbp1 for degradation. Elife 7, https://doi.org/10.7554/eLife.35528.001 244. John, G. B., Shang, Y., Li, L., Renken, C., Mannella, C. A., Selker, J. M. L., Rangell, L., Bennett, M. J., and Zha, J. (2005) The Mitochondrial Inner Membrane Protein Mitofilin Controls Cristae Morphology. Mol. Biol. Cell 16, 1543–1554 245. Darshi, M., Mendiola, V. L., Mackey, M. R., Murphy, A. N., Koller, A., Perkins, G. A., Ellisman, M. H., and Taylor, S. S. (2011) ChChd3, an Inner Mitochondrial Membrane Protein, Is Essential for Maintaining Crista Integrity and Mitochondrial Function. J. Biol. Chem. 286, 2918–2932 246. Ott, C., Dorsch, E., Fraunholz, M., Straub, S., and Kozjak-Pavlovic, V. (2015) Detailed analysis of the human mitochondrial contact site complex indicate a hierarchy of subunits. PLoS One 10, 10.1371/journal.pone.0120213

154

247. Guarani, V., McNeill, E. M., Paulo, J. A., Huttlin, E. L., Fröhlich, F., Gygi, S. P., Vactor, D. Van, and Wade Harper, J. (2015) QIL1 is a novel mitochondrial protein required for MICOS complex stability and cristae morphology. Elife 4, 1–23 248. Anand, R., Strecker, V., Urbach, J., Wittig, I., and Reichert, A. S. (2016) Mic13 is essential for formation of crista junctions in mammalian cells. PLoS One 11, 10.1371/journal.pone.0160258 249. Huynen, M. A., Mühlmeister, M., Gotthardt, K., Guerrero-Castillo, S., and Brandt, U. (2016) Evolution and structural organization of the mitochondrial contact site (MICOS) complex and the mitochondrial intermembrane space bridging (MIB) complex. Biochim. Biophys. Acta - Mol. Cell Res. 1863, 91–101 250. Kozjak-Pavlovic, V. (2017) The MICOS complex of human mitochondria. Cell Tissue Res. 367, 83–93 251. Cogliati, S., Frezza, C., Soriano, M. E., Varanita, T., Quintana-Cabrera, R., Corrado, M., Cipolat, S., Costa, V., Casarin, A., Gomes, L. C., Perales-Clemente, E., Salviati, L., Fernandez-Silva, P., Enriquez, J. A., and Scorrano, L. (2013) Mitochondrial cristae shape determines respiratory chain supercomplexes assembly and respiratory efficiency. Cell 155, 160–171 252. Scorrano, L., Ashiya, M., Buttle, K., Weiler, S., Oakes, S. A., Mannella, C. A., and Korsmeyer, S. J. (2002) A distinct pathway remodels mitochondrial cristae and mobilizes cytochrome c during apoptosis. Dev. Cell 2, 55–67 253. Škrtić, M., Sriskanthadevan, S., Jhas, B., Gebbia, M., Wang, X., Wang, Z., Hurren, R., Jitkova, Y., Gronda, M., Maclean, N., Lai, C. K., Eberhard, Y., Bartoszko, J., Spagnuolo, P., Rutledge, A. C., Datti, A., Ketela, T., Moffat, J., Robinson, B. H., Cameron, J. H., Wrana, J., Eaves, C. J., Minden, M. D., Wang, J. C. Y., Dick, J. E., Humphries, K., Nislow, C., Giaever, G., and Schimmer, A. D. (2011) Inhibition of Mitochondrial Translation as a Therapeutic Strategy for Human Acute Myeloid Leukemia. Cancer Cell 20, 674–688 254. Lagadinou, E. D., Sach, A., Callahan, K., Rossi, R. M., Neering, S. J., Minhajuddin, M., Ashton, J. M., Pei, S., Grose, V., O’Dwyer, K. M., Liesveld, J. L., Brookes, P. S., Becker, M. W., and Jordan, C. T. (2013) BCL-2 Inhibition Targets Oxidative Phosphorylation and Selectively Eradicates Quiescent Human Leukemia Stem Cells. Cell Stem Cell 12, 329– 341 255. Liyanage, S. U., Hurren, R., Voisin, V., Bridon, G., Wang, X., Xu, C., MacLean, N., Siriwardena, T. P., Gronda, M., Yehudai, D., Sriskanthadevan, S., Avizonis, D., Shamas- Din, A., Minden, M. D., Bader, G. D., Laposa, R., and Schimmer, A. D. (2017) Leveraging increased cytoplasmic nucleoside kinase activity to target mtDNA and oxidative phosphorylation in AML. Blood 129, 2657–2666 256. Sriskanthadevan, S., Jeyaraju, D. V., Chung, T. E., Prabha, S., Xu, W., Skrtic, M., Jhas, B., Hurren, R., Gronda, M., Wang, X., Jitkova, Y., Sukhai, M. A., Lin, F.-H., Maclean, N., Laister, R., Goard, C. A., Mullen, P. J., Xie, S., Penn, L. Z., Rogers, I. M., Dick, J. E., Minden, M. D., and Schimmer, A. D. (2015) AML cells have low spare reserve capacity in their respiratory chain that renders them susceptible to oxidative metabolic stress. Blood 125, 2120–2130 257. Farge, T., Saland, E., de Toni, F., Aroua, N., Hosseini, M., Perry, R., Bosc, C., Sugita, M., Stuani, L., Fraisse, M., Scotland, S., Larrue, C., Boutzen, H., Féliu, V., Nicolau-Travers, M. L., Cassant-Sourdy, S., Broin, N., David, M., Serhan, N., Sarry, A., Tavitian, S., Kaoma, T., Vallar, L., Iacovoni, J., Linares, L. K., Montersino, C., Castellano, R.,

155

Griessinger, E., Collette, Y., Duchamp, O., Barreira, Y., Hirsch, P., Palama, T., Gales, L., Delhommeau, F., Garmy-Susini, B. H., Portais, J. C., Vergez, F., Selak, M., Danet- Desnoyers, G., Carroll, M., Récher, C., and Sarry, J. E. (2017) Chemotherapy-resistant human acute myeloid leukemia cells are not enriched for leukemic stem cells but require oxidative metabolism. Cancer Discov. 7, 716–735 258. Molina, J. R., Sun, Y., Protopopova, M., Gera, S., Bandi, M., Bristow, C., McAfoos, T., Morlacchi, P., Ackroyd, J., Agip, A. N. A., Al-Atrash, G., Asara, J., Bardenhagen, J., Carrillo, C. C., Carroll, C., Chang, E., Ciurea, S., Cross, J. B., Czako, B., Deem, A., Daver, N., De Groot, J. F., Dong, J. W., Feng, N., Gao, G., Gay, J., Do, M. G., Greer, J., Giuliani, V., Han, J., Han, L., Henry, V. K., Hirst, J., Huang, S., Jiang, Y., Kang, Z., Khor, T., Konoplev, S., Lin, Y. H., Liu, G., Lodi, A., Lofton, T., Ma, H., Mahendra, M., Matre, P., Mullinax, R., Peoples, M., Petrocchi, A., Rodriguez-Canale, J., Serreli, R., Shi, T., Smith, M., Tabe, Y., Theroff, J., Tiziani, S., Xu, Q., Zhang, Q., Muller, F., Depinho, R. A., Toniatti, C., Draetta, G. F., Heffernan, T. P., Konopleva, M., Jones, P., Di Francesco, M. E., and Marszalek, J. R. (2018) An inhibitor of oxidative phosphorylation exploits cancer vulnerability. Nat. Med. 24, 1036–1046 259. Yehudai, D., Liyanage, S. U., Hurren, R., Rizoska, B., Albertella, M., Gronda, M., Jeyaraju, D. V, Wang, X., Barghout, S. H., MacLean, N., Siriwardena, T. P., Jitkova, Y., Targett-Adams, P., and Schimmer, A. D. (2018) The thymidine dideoxynucleoside analogue, alovudine, inhibits the mitochondrial DNA polymerase gamma, impairs oxidative phosphorylation and promotes monocytic differentiation in acute myeloid leukemia. Haematologica, 10.3324/haematol.2018.195172 260. Cilenti, L., Lee, Y., Hess, S., Srinivasula, S., Park, K. M., Junqueira, D., Davis, H., Bonventre, J. V., Alnemri, E. S., and Zervos, A. S. (2003) Characterization of a Novel and Specific Inhibitor for the Pro-apoptotic Protease Omi/HtrA2. J. Biol. Chem. 278, 11489– 11494 261. Kim, K. I., Park, S. C., Kang, S. H., Cheong, G. W., and Chung, C. H. (1999) Selective degradation of unfolded proteins by the self-compartmentalizing HtrA protease, a periplasmic heat shock protein in Escherichia coli. J. Mol. Biol. 294, 1363–1374 262. Gupta, G. D., Coyaud, É., Gonçalves, J., Mojarad, B. A., Liu, Y., Wu, Q., Gheiratmand, L., Comartin, D., Tkach, J. M., Cheung, S. W. T., Bashkurov, M., Hasegan, M., Knight, J. D., Lin, Z. Y., Schueler, M., Hildebrandt, F., Moffat, J., Gingras, A. C., Raught, B., and Pelletier, L. (2015) A Dynamic Protein Interaction Landscape of the Human Centrosome- Cilium Interface. Cell 163, 1484–1499 263. Jones, J. M., Albin, R. L., Feldman, E. L., Simin, K., Schuster, T. G., Dunnick, W. A., Collins, J. T., Chrisp, C. E., Taylor, B. A., and Meisler, M. H. (1993) Mnd2: A new mouse model of inherited motor neuron disease. Genomics 16, 669–677 264. Van Laar, V. S., Berman, S. B., and Hastings, T. G. (2016) Mic60/mitofilin overexpression alters mitochondrial dynamics and attenuates vulnerability of dopaminergic cells to dopamine and rotenone. Neurobiol. Dis. 91, 247–261 265. Döhner, H., Estey, E. H., Amadori, S., Appelbaum, F. R., Büchner, T., Burnett, A. K., Dombret, H., Fenaux, P., Grimwade, D., Larson, R. A., Lo-Coco, F., Naoe, T., Niederwieser, D., Ossenkoppele, G. J., Sanz, M. A., Sierra, J., Tallman, M. S., Löwenberg, B., and Bloomfield, C. D. (2010) Diagnosis and management of acute myeloid leukemia in adults: Recommendations from an international expert panel, on behalf of the European LeukemiaNet. Blood 115, 453–474 266. Talati, C., and Sweet, K. (2018) Recently approved therapies in acute myeloid leukemia:

156

A complex treatment landscape. Leuk. Res. 73, 58–66 267. Stone, R. M., Mandrekar, S. J., Sanford, B. L., Laumann, K., Geyer, S., Bloomfield, C. D., Thiede, C., Prior, T. W., Dohner, K., Marcucci, G., Lo-Coco, F., Klisovic, R. B., Wei, A., Sierra, J., Sanz, M. A., Brandwein, J. M., De Witte, T., Niederwieser, D., Appelbaum, F. R., Medeiros, B. C., Tallman, M. S., Krauter, J., Schlenk, R. F., Ganser, A., Serve, H., Ehninger, G., Amadori, S., Larson, R. A., and Dohner, H. (2017) Midostaurin plus chemotherapy for acute myeloid leukemia with a FLT3 Mutation. N. Engl. J. Med. 377, 454–464 268. Lancet, J. E., Uy, G. L., Cortes, J. E., Newell, L. F., Lin, T. L., Ritchie, E. K., Stuart, R. K., Strickland, S. A., Hogge, D., Solomon, S. R., Stone, R. M., Bixby, D. L., Kolitz, J. E., Schiller, G. J., Wieduwilt, M. J., Ryan, D. H., Hoering, A., Banerjee, K., Chiarella, M., Louie, A. C., and Medeiros, B. C. (2018) Cpx-351 (cytarabine and daunorubicin) liposome for injection versus conventional cytarabine plus daunorubicin in older patients with newly diagnosed secondary acute myeloid leukemia. J. Clin. Oncol. 36, 2684–2692 269. Hills, R. K., Castaigne, S., Appelbaum, F. R., Delaunay, J., Petersdorf, S., Othus, M., Estey, E. H., Dombret, H., Chevret, S., Ifrah, N., Cahn, J. Y., Récher, C., Chilton, L., Moorman, A. V., and Burnett, A. K. (2014) Addition of gemtuzumab ozogamicin to induction chemotherapy in adult patients with acute myeloid leukaemia: A meta-analysis of individual patient data from randomised controlled trials. Lancet Oncol. 15, 986–996 270. Stein, E. M., DiNardo, C. D., Pollyea, D. A., Fathi, A. T., Roboz, G. J., Altman, J. K., Stone, R. M., Deangelo, D. J., Levine, R. L., Flinn, I. W., Kantarjian, H. M., Collins, R., Patel, M. R., Frankel, A. E., Stein, A., Sekeres, M. A., Swords, R. T., Medeiros, B. C., Willekens, C., Vyas, P., Tosolini, A., Xu, Q., Knight, R. D., Yen, K. E., Agresta, S., De Botton, S., and Tallman, M. S. (2017) Enasidenib in mutant IDH2 relapsed or refractory acute myeloid leukemia. Blood 130, 722–731 271. DiNardo, C. D., Stein, E. M., De Botton, S., Roboz, G. J., Altman, J. K., Mims, A. S., Swords, R., Collins, R. H., Mannis, G. N., Pollyea, D. A., Donnellan, W., Fathi, A. T., Pigneux, A., Erba, H. P., Prince, G. T., Stein, A. S., Uy, G. L., Foran, J. M., Traer, E., Stuart, R. K., Arellano, M. L., Slack, J. L., Sekeres, M. A., Willekens, C., Choe, S., Wang, H., Zhang, V., Yen, K. E., Kapsalis, S. M., Yang, H., Dai, D., Fan, B., Goldwasser, M., Liu, H., Agresta, S., Wu, B., Attar, E. C., Tallman, M. S., Stone, R. M., and Kantarjian, H. M. (2018) Durable remissions with ivosidenib in IDH1-mutated relapsed or refractory AML. N. Engl. J. Med. 378, 2386–2398 272. Warner, J. K., Wang, J. C. Y., Takenaka, K., Doulatov, S., McKenzie, J. L., Harrington, L., and Dick, J. E. (2005) Direct evidence for cooperating genetic events in the leukemic transformation of normal human hematopoietic cells. Leukemia 19, 1794–1805 273. Nicolini, F. E., Cashman, J. D., Hogge, D. E., Humphries, R. K., and Eaves, C. J. (2004) NOD/SCID mice engineered to express human IL-3, GM-CSF and steel factor constitutively mobilize engrafted human progenitors and compromise human stem cell regeneration. Leukemia 18, 341–347 274. Degos, L., and Wang, Z. Y. (2001) All trans retinoic acid in acute promyelocytic leukemia. Oncogene 20, 7140–7145 275. Breitman, T. R., Selonick, S. E., and Collins, S. J. (1980) Induction of differentiation of the human promyelocytic leukemia cell line (HL-60) by retinoic acid. Proc. Natl. Acad. Sci. U. S. A. 77, 2936–2940 276. Smith, M. A., Parkinson, D. R., Cheson, B. D., and Friedman, M. A. (1992) Retinoids in cancer therapy. J. Clin. Oncol. 10, 839–864

157

277. Hara, T., Morisaki, T., Arima, Y., Naoe, H., Saya, H., Iida, S.-I., Mimori, T., Nomura, M., Kuninaka, S., Yonehara, S., and Nitta, M. (2006) Serine protease Omi/HtrA2 targets WARTS kinase to control cell proliferation. Oncogene 26, 2395–2406 278. Marabese, M., Mazzoletti, M., Vikhanskaya, F., and Broggini, M. (2008) HtrA2 enhances the apoptotic functions of p73 on bax. Cell Death Differ. 15, 849–858 279. Checler, F., Vincent, J. P., and Kitabgi, P. (1986) Purification and characterization of a novel neurotensin-degrading peptidase from rat brain synaptic membranes. J. Biol. Chem. 261, 11274–11281 280. Chabry, J., Checler, F., Vincent, J. P., and Mazella, J. (1990) Colocalization of neurotensin receptors and of the neurotensin-degrading enzyme endopeptidase 24-16 in primary cultures of neurons. J. Neurosci. 10, 3916–3921 281. Rioli, V., Gozzo, F. C., Heimann, A. S., Linardi, A., Krieger, J. E., Shida, C. S., Almeida, P. C., Hyslop, S., Eberlin, M. N., and Ferro, E. S. (2003) Novel natural peptide substrates for endopeptidase 24.15, neurolysin, and angiotensin-converting enzyme. J. Biol. Chem. 278, 8547–8555 282. Serizawa, A., Dando, P. M., and Barrett, A. J. (1995) Characterization of a mitochondrial metallopeptidase reveals neurolysin as a homologue of thimet oligopeptidase. J. Biol. Chem. 270, 2092–2098 283. Olichon, A., Baricault, L., Gas, N., Guillou, E., Valette, A., Belenguer, P., and Lenaers, G. (2003) Loss of OPA1 perturbates the mitochondrial inner membrane structure and integrity, leading to cytochrome c release and apoptosis. J. Biol. Chem. 278, 7743–7746 284. Nakazaki, Y., and Watanabe, Y. H. (2014) ClpB chaperone passively threads soluble denatured proteins through its central pore. Genes to Cells 19, 891–900 285. Teixeira, P. F., Masuyer, G., Pinho, C. M., Branca, R. M. M., Kmiec, B., Wallin, C., Wärmländer, S. K. T. S., Berntsson, R. P. A., Ankarcrona, M., Gräslund, A., Lehtiö, J., Stenmark, P., and Glaser, E. (2018) Mechanism of Peptide Binding and Cleavage by the Human Mitochondrial Peptidase Neurolysin. J. Mol. Biol. 430, 348–362 286. Mirali, S., Botham, A., Voisin, V., Xu, C., St-Germain, J., Sharon, D., Hoff, F. W., Qiu, Y., Hurren, R., Gronda, M., Jitkova, Y., Nachmias, B., MacLean, N., Wang, X., Arruda, A., Minden, M. D., Horton, T. M., Kornblau, S. M., Chan, S. M., Bader, G. D., Raught, B., and Schimmer, A. D. (2020) The mitochondrial peptidase, neurolysin, regulates respiratory chain supercomplex formation and is necessary for AML viability. Sci. Transl. Med., 287. Tamai, S., Iida, H., Yokota, S., Sayano, T., Kiguchiya, S., Ishihara, N., Hayashi, J. I., Mihara, K., and Oka, T. (2008) Characterization of the mitochondrial protein LETM1, which maintains the mitochondrial tubular shapes and interacts with the AAA-ATPase BCS1L. J. Cell Sci. 121, 2588–2600 288. Shao, J., Fu, Z., Ji, Y., Guan, X., Guo, S., Ding, Z., Yang, X., Cong, Y., and Shen, Y. (2016) Leucine zipper-EF-hand containing transmembrane protein 1 (LETM1) forms a Ca2+/H+ antiporter. Sci. Rep. 6, 34174 289. Jiang, D., Zhao, L., Clish, C. B., and Clapham, D. E. (2013) Letm1, the mitochondrial Ca 2+ /H + antiporter, is essential for normal glucose metabolism and alters brain function in Wolf-Hirschhorn syndrome. Proc. Natl. Acad. Sci. U. S. A. 110, E2249–E2254 290. Bergemann, A. D., Cole, F., and Hirschhorn, K. (2005) The etiology of Wolf-Hirschhorn syndrome. Trends Genet. 21, 188–195 291. Dimmer, K. S., Navoni, F., Casarin, A., Trevisson, E., Endele, S., Winterpacht, A., Salviati, L., and Scorrano, L. (2008) LETM1, deleted in Wolf-Hirschhorn syndrome is

158

required for normal mitochondrial morphology and cellular viability. Hum. Mol. Genet. 83, 254–261 292. Endele, S., Fuhry, M., Pak, S. J., Zabel, B. U., and Winterpacht, A. (1999) LETM1, a novel gene encoding a putative EF-hand Ca2+-binding protein, flanks the Wolf- Hirschhorn syndrome (WHS) critical region and is deleted in most WHS patients. Genomics 60, 218–225 293. Frazier, A. E., Taylor, R. D., Mick, D. U., Warscheid, B., Stoepel, N., Meyer, H. E., Ryan, M. T., Guiard, B., and Rehling, P. (2006) Mdm38 interacts with ribosomes and is a component of the mitochondrial protein export machinery. J. Cell Biol. 172, 553–564 294. Darnell, J. E., Kerr, I. M., and Stark, G. R. (1994) Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins. Science (80-. ). 264, 1415–1421 295. Wegrzyn, J., Potla, R., Chwae, Y. J., Sepuri, N. B. V., Zhang, Q., Koeck, T., Derecka, M., Szczepanek, K., Szelag, M., Gornicka, A., Moh, A., Moghaddas, S., Chen, Q., Bobbili, S., Cichy, J., Dulak, J., Baker, D. P., Wolfman, A., Stuehr, D., Hassan, M. O., Fu, X. Y., Avadhani, N., Drake, J. I., Fawcett, P., Lesnefsky, E. J., and Larner, A. C. (2009) Function of mitochondrial Stat3 in cellular respiration. Science (80-. ). 323, 793–797 296. Gough, D. J., Corlett, A., Schlessinger, K., Wegrzyn, J., Larner, A. C., and Levy, D. E. (2009) Mitochondrial STAT3 supports RasDependent oncogenic transformation. Science (80-. ). 324, 1713–1716 297. Tammineni, P., Anugula, C., Mohammed, F., Anjaneyulu, M., Larner, A. C., and Sepuri, N. B. V. (2013) The import of the transcription factor STAT3 into mitochondria depends on GRIM-19, a component of the electron transport chain. J. Biol. Chem. 288, 4723–4732 298. Macias, E., Rao, D., Carbajal, S., Kiguchi, K., and Digiovanni, J. (2014) Stat3 binds to mtDNA and regulates mitochondrial gene expression in keratinocytes. J. Invest. Dermatol. 134, 1971–1980 299. Garama, D. J., Harris, T. J., White, C. L., Rossello, F. J., Abdul-Hay, M., Gough, D. J., and Levy, D. E. (2015) A Synthetic Lethal Interaction between Glutathione Synthesis and Mitochondrial Reactive Oxygen Species Provides a Tumor-Specific Vulnerability Dependent on STAT3. Mol. Cell. Biol. 35, 3646–3656 300. Lau, W. C. Y., Baker, L. A., and Rubinstein, J. L. (2008) Cryo-EM Structure of the Yeast ATP Synthase. J. Mol. Biol. 382, 1256–1264 301. Guo, H., and Rubinstein, J. L. (2018) Cryo-EM of ATP synthases. Curr. Opin. Struct. Biol. 52, 71–79 302. Everard-Gigot, V., Dunn, C. D., Dolan, B. M., Brunner, S., Jensen, R. E., and Stuart, R. A. (2005) Functional analysis of subunit e of the F1Fo-ATP synthase of the yeast Saccharomyces cerevisiae: Importance of the N-terminal membrane anchor region. Eukaryot. Cell 4, 346–355 303. Habersetzer, J., Larrieu, I., Priault, M., Salin, B., Rossignol, R., Brèthes, D., and Paumard, P. (2013) Human F 1 F 0 ATP Synthase, Mitochondrial Ultrastructure and OXPHOS Impairment: A (Super-)Complex Matter? PLoS One 8, e75429 304. Guarani, V., Paulo, J., Zhai, B., Huttlin, E. L., Gygi, S. P., and Harper, J. W. (2014) TIMMDC1/C3orf1 Functions as a Membrane-Embedded Mitochondrial Complex I Assembly Factor through Association with the MCIA Complex. Mol. Cell. Biol. 34, 847– 861 305. Roberts, D. J., and Miyamoto, S. (2015) Hexokinase II integrates energy metabolism and cellular protection: Akting on mitochondria and TORCing to autophagy. Cell Death

159

Differ. 22, 248–257 306. Niederacher, D., and Entian, K. (1991) Characterization of Hex2 protein, a negative regulatory element necessary for glucose repression in yeast. Eur. J. Biochem. 200, 311– 319 307. Neary, C. L., and Pastorino, J. G. (2010) Nucleocytoplasmic shuttling of hexokinase II in a cancer cell. Biochem. Biophys. Res. Commun. 394, 1075–1081 308. Plafker, S. M. (2000) Importin-11, a nuclear import receptor for the ubiquitin-conjugating enzyme, UbcM2. EMBO J. 19, 5502–5513 309. Chen, M., Nowak, D. G., Narula, N., Robinson, B., Watrud, K., Ambrico, A., Herzka, T. M., Zeeman, M. E., Minderer, M., Zheng, W., Ebbesen, S. H., Plafker, K. S., Stahlhut, C., Wang, V. M. Y., Wills, L., Nasar, A., Castillo-Martin, M., Cordon-Cardo, C., Wilkinson, J. E., Powers, S., Sordella, R., Altorki, N. K., Mittal, V., Stiles, B. M., Plafker, S. M., and Trotman, L. C. (2017) The nuclear transport receptor Importin-11 is a tumor suppressor that maintains PTEN protein. J. Cell Biol. 216, 641–656 310. Demirel, Y. (2014) Nonequilibrium Thermodynamics 311. Meyer, H. S. (2007) Color Textbook of Histology. JAMA J. Am. Med. Assoc. 286, 95–95 312. Patten, D. A., Wong, J., Khacho, M., Soubannier, V., Mailloux, R. J., Pilon‐Larose, K., MacLaurin, J. G., Park, D. S., McBride, H. M., Trinkle‐Mulcahy, L., Harper, M., Germain, M., and Slack, R. S. (2014) OPA1‐dependent cristae modulation is essential for cellular adaptation to metabolic demand. EMBO J. 33, 2676–2691 313. Kapahi, P., Yun, J., Guo, M., Cao, J. H., Chowdhury, R. B., Clark, I. E., and Dodson, M. W. (2008) Loss-of-Function Analysis Suggests That Omi/HtrA2 Is Not an Essential Component of the pink1/parkin Pathway In Vivo. J. Neurosci. 28, 14500–14510 314. Eliasson, P., Rehn, M., Hammar, P., Larsson, P., Sirenko, O., Flippin, L. A., Cammenga, J., and Jönsson, J. I. (2010) Hypoxia mediates low cell-cycle activity and increases the proportion of long-term-reconstituting hematopoietic stem cells during in vitro culture. Exp. Hematol. 38, 301–310 315. Simsek, T., Kocabas, F., Zheng, J., Deberardinis, R. J., Mahmoud, A. I., Olson, E. N., Schneider, J. W., Zhang, C. C., and Sadek, H. A. (2010) The distinct metabolic profile of hematopoietic stem cells reflects their location in a hypoxic niche. Cell Stem Cell 7, 380– 390 316. Jensen, P. O., Mortensen, B. T., Hodgkiss, R. J., Iversen A, P. O., Christensen, I. J., Helledie, N., and Larsen, J. K. (2000) Increased cellular hypoxia and reduced proliferation of both normal and leukaemic cells during progression of acute myeloid leukaemia in rats. Cell Prolif. 33, 381–395 317. Asosingh, K., De Raeve, H., De Ridder, M., Storme, G. A., Willems, A., Van Riet, I., Van Camp, B., and Vanderkerken, K. (2005) Role of the hypoxic bone marrow microenvironment in 5T2MM murine myeloma tumor progression. Haematologica 90, 810–817 318. Nam, M. K., Seong, Y. M., Park, H. J., Choi, J. Y., Kang, S., and Rhim, H. (2006) The homotrimeric structure of HtrA2 is indispensable for executing its serine protease activity. Exp. Mol. Med. 38, 36–43 319. Martins, L. M., Turk, B. E., Cowling, V., Borg, A., Jarrell, E. T., Cantley, L. C., and Downward, J. (2003) Binding specificity and regulation of the serine protease and PDZ domains of HtrA2/Omi. J. Biol. Chem. 278, 49417–49427 320. Zhang, Y., Appleton, B. A., Wu, P., Wiesmann, C., and Sidhu, S. S. (2007) Structural and functional analysis of the ligand specificity of the HtrA2/Omi PDZ domain. Protein Sci.

160

16, 1738–1750

Figures 2.1—2.6, 2.8, 2.9, 2.17 and Tables 2.2, 2.3, 2.6—2.13 were used with permission from John Wiley and Sons from the publication “Global Interactome Mapping of Mitochondrial Intermembrane Space Proteases Identifies a Novel Function for HTRA2” published in Proteomics (License number 4842520731179).

Figure 1.2 was used with permission the creative commons license: Attribution 4.0 International (CC BY 4.0) from the publication “Mitochondrial TCA cycle metabolites control physiology and disease” published in Nature Communications (49).

Figure 1.3 was used with permission from Springer Nature from the publication “The mitochondrial UPR: mechanisms, physiological functions and implications in ageing” published in Nature Reviews Molecular Cell Biology (4842570258026).

Figure 1.4 was used with permission the creative commons license: Attribution 4.0 International (CC BY 4.0) from the publication “Apoptosis: A Target for Anticancer Therapy” published in International Journal of Molecular Sciences (90).

Figure 1.5 was used with permission from Springer Nature from the publication “New roles for mitochondrial proteases in health, ageing and disease” published in Nature Reviews Molecular Cell Biology (License number 4766631017197).

161