Ligand-Dependent Platelet-Derived Growth Factor Receptor (PDGFR)-A Activation Sensitizes Rare Lung Cancer and Sarcoma Cells to PDGFR Kinase Inhibitors

Published OnlineFirst April 14, 2009; DOI: 10.1158/0008-5472.CAN-08-4327

Research Article

Ultan McDermott,1 Rachel Y. Ames,1 A. John Iafrate,2 Shyamala Maheswaran,1 Hannah Stubbs,2 Patricia Greninger,1 Kaitlin McCutcheon,1 Randy Milano,1 Angela Tam,1 Diana Y. Lee,1 Laury Lucien,1 Brian W. Brannigan,1 Lindsey E. Ulkus,1 Xiao-Jun Ma,3 Mark G. Erlander,3 Daniel A. Haber,1 Sreenath V. Sharma,1 and Jeffrey Settleman1

1Center for Molecular Therapeutics, Massachusetts General Hospital Cancer Center and Harvard Medical School, Charlestown, Massachusetts; 2Molecular Diagnostics Laboratory, Department of Pathology, Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts; and 3AviaraDx, Inc., Carlsbad, California

Abstract Introduction Platelet-derived growth factor (PDGF) receptors (PDGFR) and Sunitinib is a multitargeted tyrosine kinase inhibitor that their ligands play critical roles in several human malignan- potentlyinhibits vascular endothelial growth factor (VEGF), cies. Sunitinib is a clinically approved multitargeted tyrosine platelet-derived growth factor (PDGF), and c-KIT receptor kinases kinase inhibitor that inhibits vascular endothelial growth (1). In renal cell carcinoma, sunitinib showed superiorityover factor receptor, c-KIT, and PDGFR, and has shown clinical standard IFN-a therapy(2); sunitinib is now recommended for activity in various solid tumors. Activation of PDGFR previouslyuntreated patients with advanced renal cell carcinoma. signaling has been described in gastrointestinal stromal Sunitinib is also approved for treatment of imatinib-refractory tumors (PDGFRA mutations) as well as in chronic myeloid gastrointestinal stromal tumors (GIST), manyof which harbor leukemia (BCR-PDGFRA translocation), and sunitinib can activating c-KIT or PDGF receptor (PDGFR) kinase domain yield clinical benefit in both settings. However, the discovery mutations (3). A recent phase II clinical studyhas revealed efficacy of PDGFR activating mutations or gene rearrangements in of single-agent sunitinib in advanced non–small-cell lung cancer other tumor types could reveal additional patient populations (NSCLC) patients (4). Accumulating evidence indicates that who might benefit from treatment with anti-PDGFR therapies, inhibition of VEGF signaling using various antiangiogenic agents such as sunitinib. Using a high-throughput cancer cell line can suppress tumor growth and improve patient survival (2, 5, 6); screening platform, we found that only 2 of 637 tested human however, it is unclear from studies involving multikinase inhibitors, tumor-derived cell lines show significant sensitivity to single- such as sunitinib, as to the relative contribution of VEGF receptor agent sunitinib exposure. These two cell lines [a non–small- inhibition in suppressing tumor growth. cell lung cancer (NSCLC) and a rhabdomyosarcoma] showed The PDGFR/PDGF system includes two receptors (PDGFRA and expression of highly phosphorylated PDGFRA. In the suniti- PDGFRB) and four ligands (PDGFA, PDGFB, PDGFC, and PDGFD; nib-sensitive adenosquamous NSCLC cell line, PDGFRA ref. 7). Ligand binding induces receptor dimerization, enabling expression was associated with focal PFGRA gene amplifica- autophosphorylation of specific tyrosine residues and subsequent tion, which was similarly detected in a small fraction of recruitment of a varietyof signal transduction molecules (8). squamous cell NSCLC primary tumor specimens. Moreover, in PDGFR regulates normal cellular growth and differentiation (9), this NSCLC cell line, focal amplification of the gene encoding and expression of activated PDGFR promotes oncogenic transfor- the PDGFR ligand PDGFC was also detected, and silencing mation (10), suggesting that activating mutations or gene PDGFRA or PDGFC expression by RNA interference inhibited rearrangements could playa role in human tumorigenesis. in vitro in vivo proliferation. A similar codependency on PDGFRA and PDGFC Numerous and studies showed that inhibition of was observed in the sunitinib-sensitive rhabdomyosarcoma PDGFRA signaling disrupts cancer cell survival in the subset of PDGFRA cell line. These findings suggest that, in addition to GISTs with activating mutations (11, 12). In a recent study gastrointestinal stromal tumors, rare tumors that show of 150 NSCLC patient samples, activated PDGFRA was detected in PDGFC-mediated PDGFRA activation may also be clinically 13% of cases (13), suggesting that a subset of these patients might responsive to pharmacologic PDGFRA or PDGFC inhibition. benefit from therapies directed against PDGFRA. Moreover, [Cancer Res 2009;69(9):3937–46] PDGFRA overexpression has been observed in metastatic versus nonmetastatic medulloblastoma patient samples, and disrupting PDGFRA function inhibited the metastatic potential of medulloblastoma cells in vitro (14). We recentlyreported the development of a high-throughput platform for profiling a large panel of human cancer cell lines with Note: Supplementarydata for this article are available at Cancer Research Online molecularlytargeted inhibitors to identifysubsets with significant (http://cancerres.aacrjournals.org/). Requests for reprints: JeffreySettleman, Center for Molecular Therapeutics, sensitivity(15). That analysisrevealed several examples of Massachusetts General Hospital Cancer Center and Harvard Medical School, 149 13th genotype-associated sensitivities to selective kinase inhibitors, Street, Charlestown, MA 02129. Phone: 617-724-9556; Fax: 617-726-7808; E-mail: showing the utilityof this strategyto reveal cell autonomous [email protected]. I2009 American Association for Cancer Research. tumor cell responses to anticancer agents. Here, we describe the doi:10.1158/0008-5472.CAN-08-4327 profiling of 637 cancer cell lines for sensitivityto single-agent www.aacrjournals.org 3937 Cancer Res 2009; 69: (9). May 1, 2009

Cancer Research sunitinib, using a monoculture format that precludes any additional wash in PBS/0.5% BSA, cells were stained with 10 Ag/mL contribution of drug effects on angiogenesis. Our studies revealed propidium iodide (Sigma) and treated with RNase A (Sigma) before two- that the majorityof tested cell lines are highlyrefractoryto dimensional fluorescence-activated cell sorting analysis using CellQuest sunitinib. Of the two cell lines showing sunitinib sensitivity, both software (Becton Dickinson). SNP and gene expression analyses. Gene copynumbers were were found to express high levels of PDGFRA and PDGFC mRNA determined as previouslydescribed using the GeneChip Human Mapping and phosphorylated PDGFRA protein. ShRNA knockdown of 250K. The arraywas then scanned on the GeneChip Scanner 3000 7G and PDGFRA was as effective as sunitinib in decreasing cell analyzed using GTYPE version 4.0 with the Dynamic Model Mapping proliferation in both cell lines, and targeting the PDGFC ligand Algorithm and the GeneChip Human Mapping 500K Set libraryfiles alone was similarlyeffective. (Mapping 250K_Nsp). Our findings suggest that whereas antiangiogenesis activity For gene expression studies, RNA was extracted using the Qiagen RNA probablyaccounts for the majorityof the clinical benefit associated easykit (P/N 74106) and amplified and biotin labeled with the Arcturus with sunitinib treatment in solid tumors, in rare cases, beyond RiboAmp RNA Amplification Kit using biotinylated ribonucleotides (Perkin- PDGFRA-mutant GISTs, activated PDGFRA maybe the critical Elmer PN Biotin-11-UTP, NEL543001EA/Biotin-11-CTP, NEL542001EA) in vitro target, and that selective PDGFRA inhibitors maybe useful in the during transcription. Labeled aRNA was hybridized to Affymetric GeneChip Human X3P (GPL1352) using protocols described within the clinical management of a subset of tumors that exhibit PDGFRA Affymetrix GeneChip Expression Analysis Technical Manual (PN701021 Rev. activation. Moreover, in tumors with evidence of PDGFC ligand 3). Data were acquired using the Affymetrix GeneChip 3000 Scanner with overexpression, neutralizing antibodies maybe an equallyeffective autoloader and 7G upgrade. GCOS ver 1.4 software was used to run the therapeutic modality. scanner and analyze the data. The expression value for each gene was calculated using Affymetrix GeneChip software and data were analyzed using dChip software4 (17). Probe sets were filtered using two criteria: (a) Materials and Methods coefficient of variation between 0.5 and 1,000 and (b) P call rate in arrays Human cancer cell lines and cell viability assays. Human cancer cell z20%. lines were obtained from commercial vendors and were maintained and Quantitative PCR. Total RNA was isolated and purified from cells using tested for viabilityusing an automated platform, as previouslydescribed STAT-60 (Tel-Test, Inc.). cDNA was transcribed from 2 Ag of total RNA using (15). Cells were treated for 72 h with 1 Amol/L sunitinib and then assayed the AffinityScript Multi Temperature cDNA Synthesis kit (Stratagene). for cytostatic or cytotoxic responses. We elected to use this concentration Quantitative PCR was done using the QuantiTect SYBR Green PCR kit based on steady-state plasma concentrations of f0.2 Amol/L at clinically (Qiagen) and with an ABI PRISM 7000 real-time cycler (Applied Biosystems). recommended doses of sunitinib in patients and based on the experimental Quantification was based on standard curves for each primer set from a time points addressed in the studies. serial dilution of the NCI-H1703 cell line cDNA. All samples were analyzed Protein detection. Immunodetection of proteins following SDS-PAGE in triplicate. Primers sequences were GAPDH F, GAGTCAACG- was done using standard protocols. Equal protein loading was assessed GATTTGGTCGT; GAPDH R, TTGATTTTGGAGGGATCTCG; PDGFRA using a h-tubulin antibody(Sigma). Akt, extracellular signal–regulated F, AAATTGTGTCCACCGTGATCT; PDGFRA R, AGGCCAAAGTCACA- kinase 1/2 (Erk1/2), phospho-Erk1/2 (T202/Y204), PDGFRA, phospho- GATCTTC; PDGFC F, AACGGAGTACAAGATCCTCAGC; and PDGFC R, PDGFRA (Y720), phospho-PDGFRA (Y754), signal transducer and activator CCATCACTGGGTTCCTCAAC. of transcription 3 (STAT3), and phospho-STAT3 (S727) antibodies were RNA interference studies. ShRNAs targeting sequences within the genes from Cell Signaling Technology. The phospho-Akt (S473) antibody was from encoding either PDGFRA (n = 10) or its ligand PDGFC (n = 5) were BioSource International. All antibodies were used at 1:1,000 dilution, except expressed from the pLKO.1 lentiviral vector (SupplementaryTable S3). NCI- h-tubulin (1:10,000). H1703 and A-204 cells were infected in the presence of polybrene (8 Ag/mL). Kinase inhibitors. Sunitinib was obtained from MGH pharmacy. A cell line showing sunitinib-insensitivity(A549) was used to determine Sorafenib and imatinib were purchased from American Custom Chemicals infection efficiencybased on puromycin resistance and to confirm Corporation. The in vitro kinase specificityprofile of all three compounds is specificity. Protein lysates and RNA were collected 48 h postinfection, and listed in SupplementaryTable S1. cell numbers were determined 72 h postinfection. Fluorescence in situ hybridization. Fluorescence in situ hybridization PDGFC neutralizing antibody experiments. Cells were seeded in (FISH) was done as described previously(16). Probes for PDGFRA and 1% fetal bovine serum medium and treated the following daywith 5 to c-KIT were derived from BAC clones RP11-58C6 (PDGFRA) and RP11-977G3 20 ng/mL of an anti-PDGFC neutralizing antibody(R&D Systems, Inc.). (c-KIT) and purchased from Invitrogen. Normal goat IgG at 20 ng/mL concentration was used as a control. Cells DNA sequencing. Genomic DNA was isolated using the Gentra were fixed and stained 5 d after treatment, and cell viabilitywas measured purification system. PDGFRA, PDGFRB, and c-KIT coding sequences were as previouslydescribed (15). amplified from genomic DNA byPCR. PCR products were purified and subjected to bidirectional sequencing byusing BigDyev1.1 (Applied Biosystems) in combination with an ABI3100 sequencer (Applied Bio- Results systems). Primers used for sequencing are listed in Supplementary Table S2. Rare human cancer cell lines are sensitive to single-agent Electropherograms were analyzed by using Sequence Navigator software sunitinib treatment. Using an automated platform to examine (Applied Biosystems). All mutations were confirmed by at least two drug sensitivityin cancer cell lines (15), we tested the sunitinib independent PCR amplifications. sensitivityof 637 established human cancer cell lines derived from Cell cycle analysis. Cells were pulsed with 10 Amol/L bromodeoxyur- idine (BrdUrd) for 1 to 2 h before collection, centrifuged, and fixed in ice- a wide varietyof solid tumor types(SupplementaryFig. S1; ref. 1). A cold 70% ethanol. Cells were washed with PBS/0.5% bovine serum albumin Cells were treated for 72 hours with 1 mol/L sunitinib and then (BSA) and incubated in denaturing solution (2 mol/L HCl) for 20 min at assayed for cytostatic or cytotoxic responses. Whereas the vast room temperature. After a further wash with PBS/0.5% BSA, the cells were majorityof tested cell lines were largelyrefractoryto treatment, resuspended in 0.1 mol/L sodium borate for 2 min at room temperature. two cell lines (A-204 rhabdomyosarcoma and NCI-H1703 NSCLC) After an additional wash, cells were suspended with anti-BrdUrd monoclonal antibodyfor 20 min (1:500; Becton Dickinson). Cells were washed in PBS/0.5% BSA and the pellet was resuspended in FITC- conjugated antimouse IgG (1:50; Vector Laboratories) for 20 min. After an 4 http://biosun1.harvard.edu/complab/dchip/

Cancer Res 2009; 69: (9). May 1, 2009 3938 www.aacrjournals.org

Activated PDGFRA Sensitizes Cancer Cells to Kinase Inhibition

Figure 1. A, pie chart representation of the sensitivity of 637 human cancer cell lines to treatment with 1 Amol/L sunitinib. The drug effect was calculated as the fraction of untreated cells present after 72 h of treatment. The color scheme corresponds to the relative inhibitory effect of treatment, with ratios reflecting the number of cells remaining following exposure to inhibitor. Details about the most sensitive cell lines identified are shown in the chart, and the cell lines are shown in order of decreasing sensitivity (top to bottom). B, pie chart representation of the sensitivity of the 103 NSCLC cell lines to 1 Amol/L sunitinib. Copy number data were generated from 250K Nsp SNP array profiles (or FISH, as indicated by asterisk). displayed significant sunitinib sensitivity, as indicated by a >50% absent from the panel of tested lines. A few additional lines showed reduction in cell number (Fig. 1A). We note that cell lines derived a relativelyweaker response to sunitinib. from GISTs, which show clinical sunitinib sensitivity, reflecting The sunitinib-sensitive NSCLC-derived cell line harbors inhibition of mutationallyactivated PDGFR or c-KIT kinases, were focal PDGFRA gene amplification. Among 103 NSCLC cell lines

Table 1. Elevated PDGFRA copy number in a subset of NSCLC cell lines

Chromosome Gene NCI-H1693 NCI-H1703 NCI-H2085 NCI-H23 NCI-H661

4 PDGFRA 4.88 4.36 3.72 3.28 3.61 4 KIT 4.88 1.98 3.77 2.98 3.62 4 PDGFC 1.75 5.93 1.94 1.07 1.74 5 PDGFRB 2.56 2.29 2.03 1.63 1.91 11 PDGFD 2.33 1.68 2.33 1.57 2.15 22 PDGFB 1.54 2.34 1.87 1.73 1.99

NOTE: Copynumbers >3 are in boldface. Data were derived from AffymetrixNsp 250K SNP arraydata from 88 NSCLC cell lines.

www.aacrjournals.org 3939 Cancer Res 2009; 69: (9). May 1, 2009

Cancer Research

Figure 2. A, SNP array analysis of chromosome 4 for the five NSCLC cell lines exhibiting elevated PDGFRA copy number shows increased PDGFC ligand copy number (5.93) in NCI-H1703 cells. The blue tracing indicates the degree of amplification of each SNP in the array. The red line underlying the blue tracing indicates copy number of 2. B, PDGFRA and PDGF ligand mRNA expression in 90 NSCLC cell lines. NCI-H1703 is indicated by red lettering. Probe sets for ligand PDGFB are excluded following a filter based on P call rate in arrays <20%. C, relative PDGFRA mRNA expression levels in NSCLC and rhabdomyosarcoma cell lines as determined by quantitative reverse transcription-PCR.

tested, significant sunitinib sensitivitywas observed onlyin the The SNP arraydata revealed similarlyelevated PDGFRA gene adenosquamous NCI-H1703 line (Fig. 1B). SNP arraydata available copynumber in four other NSCLC cell lines (NCI-H1693, NCI- for 88 of these lines revealed that NCI-H1703 cells harbor focal H2085, NCI-H23, and NCI-H661); however, these lines were PDGFRA gene amplification (Fig. 1B). This was confirmed by sunitinib insensitive (Table 1; Fig. 2A). FISH analyses of these cell interphase FISH analysis (Supplementary Fig. S2A). There was no lines confirmed PDGFRA amplification (SupplementaryFig. S3). evidence of either c-KIT or PDGFRB genomic amplification or However, analysis of the transcriptional expression profile of protein expression in these cells (data not shown). Sequence tyrosine kinase signaling pathway–associated genes in the 90 analysis of the entire coding sequence of PDGFRA, PDGFRB, and NSCLC cell line panel revealed that onlyNCI-H1703 showed c-KIT in this cell line revealed a single mutation in exon 9 of significant expression of PDGFRA mRNA (SupplementaryFig. S4). PDGFRA (S478P), within the extracellular domain, which would not Furthermore, when the gene expression profile of NCI-H1703 cells be expected to result in PDGFR activation. was compared with the other 89 NSCLC cell lines for the most

Cancer Res 2009; 69: (9). May 1, 2009 3940 www.aacrjournals.org

Activated PDGFRA Sensitizes Cancer Cells to Kinase Inhibition significant up-regulated and down-regulated mRNA transcripts, the Inhibition of PDGFRA activation in NCI-H1703 cells disrupts most highlyexpressed mRNA in NCI-H1703 cells corresponded to downstream signaling. Treatment of NCI-H1703 cells with PDGFRA (fold change of 213; Table 2). When we focused on those sunitinib for 6 hours resulted in complete inhibition of PDGFRA probes involved in PDGFR signaling, none of the other four NSCLC protein phosphorylation as well as that of Akt, a PDGFR effector cell lines with increased PDGFRA copynumber displayedincreased (Fig. 3C). Sunitinib had no effect on such signaling in the sunitinib- PDGFRA mRNA expression (Fig. 2B). The observed increase in insensitive cell lines (data not shown). To verifythat PDGFRA- PDGFRA mRNA expression in the NCI-H1703 cells was confirmed dependent signaling was indeed the basis for the observed byquantitative PCR (Fig. 2 C). sunitinib sensitivityof NCI-H1703 cells, we treated the cells with Sunitinib dose-response curves for the NCI-H1703 cell line versus two additional PDGFRA kinase inhibitors, sorafenib and imatinib. a panel of NSCLC cell lines with normal (Fig. 3A) or increased Both compounds exhibited a similar activityto that of sunitinib PDGFRA gene copynumber (Fig. 3 B) confirmed the unique (Fig. 3C), whereas none of the sunitinib-insensitive NSCLC cell sensitivityin NCI-H1703 cells. Moreover, expression of phosphor- lines displayed sensitivity to either agent (data not shown). ylated and total PDGFRA protein was only detected in NCI-H1703 Furthermore, like sunitinib, both compounds suppressed Akt cells (Fig. 3A and B), and PDGFRA protein was not detected in any signaling in NCI-H1703 cells (Fig. 3C). Together, these findings of the sunitinib-insensitive cell lines. In fact, when we extended this suggest that the NCI-H1703 NSCLC cells are dependent on panel to include an additional 26 NSCLC sunitinib-insensitive cell activated PDGFRA signaling. lines, we were unable to detect expression of PDGFRA in anyother To investigate the underlying mechanism for the ability of lines (SupplementaryFig. S5). Therefore, the increased transcrip- sunitinib to reduce cell number in NCI-H1703 cells, we examined tional expression of PDGFRA in NCI-H1703 results in increased PARP cleavage, an indicator of apoptosis, and cell cycle profile. PDGFRA protein and is associated with elevated phospho- There was no evidence of PARP cleavage following treatment with PDGFRA, which potentiallymediates sensitivityto sunitinib. 1 Amol/L sunitinib at 24, 48, or 72 hours in this cell line (data not To assess PDGFRA amplification in clinical NSCLC cases, we shown), whereas cell cycle analysis confirmed a significant S-phase analyzed 143 NSCLC primary tumor specimens by FISH and arrest at each of these time points (SupplementaryFig. S6), detected 3 of 81 (3.7%) cases of focal PDGFRA amplification in consistent with a cytostatic response to drug exposure. squamous cell carcinomas (SupplementaryFig. S2 B). PDGFRA PDGFRA activation is associated with sensitivity to sunitinib amplification was not detected in anyof 62 adenocarcinoma cases in a rhabdomyosarcoma cell line. As described above, in the analyzed. Thus, focal PDGFRA gene amplification arises at initial screen of 637 cell lines for sunitinib sensitivity, a relativelylow frequencyin NSCLC and maybe more common in rhabdomyosarcoma cell line, A-204, was the most highly drug- the squamous cell setting. sensitive line detected (Fig. 1A). To determine whether the

Table 2. The most highly up-regulated and down-regulated mRNAs in the NCI-H1703 cell line compared with all of the NSCLC cell lines

Gene Chromosome Fold change LBFC UBFC

PDGFRA 4q11 213.13 148.75 340.59 PDGFRA 4q11 39.88 33.38 49.42 FLT4: fms-related tyrosine kinase 4 5q35 8.24 6.70 10.52 FGFR1: fibroblast growth factor receptor 1 8p11 4.85 4.01 6.11 SHC1: SHC transforming protein 1 1q21 2.89 2.57 3.27 PLCE1: phospholipase C, epsilon 1 10q23 2.45 2.08 2.95 SEMA3C 7q21 1.71 1.52 1.94 HMGA1: high mobilitygroup AT-hook 1 6p21 1.55 1.37 1.77 HMGA1: high mobilitygroup AT-hook 1 6p21 1.45 1.28 1.67 EGFR: epidermal growth factor receptor 7p12 À1.59 À1.30 À1.91 EGFR: epidermal growth factor receptor 7p12 À1.63 À1.38 À1.88 VEGF: vascular endothelial growth factor 6p12 À1.89 À1.66 À2.14 MET: met proto-oncogene 7q31 À2.55 À2.20 À2.94 DDR1: discoidin domain receptor family, member 1 6p21 À2.69 À2.33 À3.07 RGS2: regulator of G-protein signaling 2, 24 kDa 1q31 À3.32 À2.32 À4.42 MET: met proto-oncogene 7q31 À3.49 À2.76 À4.24 EGFR: epidermal growth factor receptor 7p12 À3.70 À2.93 À4.53 IRS1: insulin receptor substrate 1 2q36 À3.93 À3.27 À4.78 EPS8: epidermal growth factor receptor pathwaysubstrate 8 12q13 À4.91 À3.76 À6.15 IRS1: insulin receptor substrate 1 2q36 À6.85 À5.87 À7.94

NOTE: Gene expression data were available for 90 of the NSCLC cell lines screened with sunitinib. Genes were included if the fold change was >1.2 or <1.2. All data were analyzed using the dChip software. Abbreviations: LBFC, the lower bound of the 90% confidence intervals of fold change; UBFC, the upper bound of the 90% confidence intervals of fold change.

www.aacrjournals.org 3941 Cancer Res 2009; 69: (9). May 1, 2009

Cancer Research observed sensitivitycould be extended to other rhabdomyosarco- mutations. However, as in NCI-H1703 cells, we detected a ma cell lines, a panel of six additional rhabdomyosarcoma lines substantial (15-fold) increase in PDGFRA mRNA expression in A- were tested for sunitinib sensitivity(Fig. 4 A). Of the tested lines, 204 cells (Fig. 2C). Moreover, sunitinib treatment completely onlyA-204 showed sunitinib sensitivity,and in onlythis cell line abolished Akt signaling in this line compared with a sunitinib- was PDGFRA protein detectable (Fig. 4A, lane 1). Unlike in NCI- insensitive rhabdomyosarcoma line (Fig. 4C). In addition, treat- H1703 cells, FISH analysis did not reveal PDGFRA gene amplifica- ment of A-204 cells with sorafenib and imatinib also disrupted Akt tion in anyof these lines (Fig. 4 B), and DNA sequence analysis of signaling (Fig. 4D) and similarlyinhibited proliferation (data not PDGFRA, PDGFRB, and c-KIT in A-204 cells did not reveal any shown). These results suggest that rare rhabdomyosarcoma cells

Figure 3. Dose-response curves showing the effect of sunitinib on cell numbers 72 h after treatment for NCI-H1703 and a panel of NSCLC cell lines with either normal (A) or increased (B) PDGFRA copy number and immunoblots corresponding to these same cell lines showing total PDGFRA and phospho-PDGFRA levels. C, dose-response curves showing the effect of the additional PDGFR inhibitors imatinib and sorafenib on cell numbers 72 h after treatment in the NCI-H1703 cell line. Immunoblots showing the effect of treating the NCI-H1703 cell line for 6 h with the indicated concentrations of sunitinib, imatinib, and sorafenib on phosphorylation of PDGFRA and the downstream effectors STAT3 and Akt. Note that p-STAT3 levels are largely unaffected by drug treatment, whereas p-Akt levels are reduced.

Cancer Res 2009; 69: (9). May 1, 2009 3942 www.aacrjournals.org

Activated PDGFRA Sensitizes Cancer Cells to Kinase Inhibition

Figure 4. A, dose-response curves showing the effect of sunitinib on cell numbers 72 h posttreatment for several rhabdomyosarcoma cell lines. Right, immunoblots showing expression of phospho-PDGFRA and total PDGFRA in these lines, with h-tubulin as a loading control. B, FISH analysis of sunitinib-sensitive A-204 cells using PDGFRA (RP11-58C6; red) and c-KIT probes (RP11-977G3; green). C, immunoblots showing the effect of treating the A-204 (sunitinib-sensitive) and A673 (sunitinib-resistant) cell lines for 6 h with 1 Amol/L sunitinib on phosphorylation of PDGFRA and the downstream effectors STAT3 and Akt. D, effect of treating A-204 for 6 h with the PDGFR inhibitors sunitinib, imatinib, and sorafenib on phosphorylation of PDGFRA and the downstream effectors STAT3, Akt, and Erk1/2. are dependent on activated PDGFRA signaling, associated with a similar extent as sunitinib treatment (Fig. 5A). Furthermore, increased expression of PDGFRA mRNA. knockdown of PDGFC expression also reduced proliferation in Amplification of the gene encoding the PDGFRA ligand both lines, and the observed decrease was of the same magnitude PDGFC mediates PDGFRA activation. Gene expression profiles seen following sunitinib treatment (Fig. 5A). of 90 NSCLC cell lines using a filtered list of genes involved in We also examined the activityof a neutralizing anti-PDGFC PDGFR signaling revealed that NCI-H1703 was the onlyline antibodyto confirm the ligand knockdown findings and to assess displaying significant transcriptional up-regulation of PDGFRA the potential therapeutic value of anti-PDGFC antibodies in such together with the gene encoding one of its ligands, PDGFC tumor cells. We treated three cell lines (A549, NCI-H1703, and (Fig. 2B). The increased PDGFC mRNA in NCI-H1703 cells (and in A-204) with a concentration range of the anti-PDGFC antibody. A-204 cells) was confirmed byquantitative PCR (Supplementary Whereas there was no detectable effect on the proliferation of A549 Fig. S7A). Onlythe NSCLC cell line NCI-H661 (sunitinib insensitive) cells, the antibodyreduced proliferation in the NCI-H1703 and showed similarlyelevated PDGFC mRNA, but in the absence of A-204 cell lines to a similar extent to that seen following sunitinib expression of PDGFRA mRNA or protein. Further analysis of SNP treatment (Fig. 5B). Notably, the effect was observed in A-204 cells arraydata from 88 NSCLC lines revealed a unique coamplification even at the lowest antibodyconcentration, potentiallyreflecting of the PDGFRA (4q12) and PDGFC (4q32) genes on chromosome 4 relativelyhigher PDGFC expression in the NCI-H1703 cells in NCI-H1703 cells, which was not observed in anyof the other cell (SupplementaryFig. S7 A). Combining sunitinib and the anti- lines (Fig. 2A). PDGFC antibodydid not result in anyadditive inhibitoryeffects on ShRNA-mediated knockdown of PDGFRA and PDGFC was used these cells (data not shown). ShRNA-mediated depletion of to directlyassess their functional requirement in both the NCI- PDGFRA and PDGFC was used to determine the effect on PDGFRA H1703 and A-204 cell lines (SupplementaryFig. S7 B). There was no activation and downstream signaling in the NCI-H1703 cells effect of these shRNAs on a sunitinib-insensitive cell line (A549) (Fig. 5C). ShRNA-mediated depletion of both receptor and ligand that lacks PDGFRA expression. In contrast, knockdown of PDGFRA resulted in decreased PDGFRA phosphorylation and inhibition of in NCI-H1703 and A-204 cells significantlyreduced proliferation to Akt and Erk1/2 phosphorylation. Together, these results indicate www.aacrjournals.org 3943 Cancer Res 2009; 69: (9). May 1, 2009

Cancer Research

Figure 5. A, lentiviral-delivered shRNAs were used to target GFP (negative control), PDGFRA, and PDGFC in A549, NCI-H1703, and A-204 cells, and cell numbers were measured 72 h postinfection. Treatment with 1 Amol/L sunitinib served as positive control. B, A549, NCI-H1703, and A-204 cells were treated with a neutralizing anti-PDGFC antibody (2.5–20 ng/mL) or normal IgG control antibody (at 20 ng/mL). Cell numbers were measured 5 d posttreatment. C, effect of shRNA-mediated depletion of PDGFRA and PDGFC in NCI-H1703 cells on PDGFRA phosphorylation and downstream signaling 24 h (PDGFRA) and 48 h (PDGFC) postinfection. that both of the sunitinib-sensitive cell lines show a similar ment for angiogenesis in that disease setting. However, the ability dependencyon increased PDGFRA and PDGFC expression for of sunitinib to target additional kinases, such as PDGFR, might sustained proliferation. contribute to its clinical activityin renal cancer. We note that our cell line panel included 19 renal cancer cell lines, none of which showed significant sunitinib sensitivity. This suggests that PDGFR Discussion is not likelyto provide a critical dependencysignal in renal cancer; Our cancer cell line profiling analysis with the multikinase however, a contributing role of PDGFR inhibition in the clinical inhibitor sunitinib has revealed that drug sensitivityin a activityof sunitinib cannot be excluded. Whereas in a conventional monoculture context is restricted to a small number of lines xenograft model, anyobserved consequence of drug treatment exhibiting activated PDGFRA signaling. Moreover, in these cells, on tumor growth could potentiallyreflect direct effects on tumor PDGFRA activation is coupled to critical downstream effectors cells as well as effects on the stroma and vasculature, our such as Akt, and disrupting these pathways seems to mediate the monoculture-based platform provides a means to isolate the tumor inhibitoryeffects of sunitinib on proliferation. Previous reports of cell–autonomous drug response. PDGFRA activation in cancer have been largelyconfined to GISTs In both of the sunitinib-sensitive cancer cell lines identified, (activating PDGFRA mutations) and rare cases of idiopathic PDGFRA activation seems to be mediated byincreased expression hypereosinophilic syndrome (FIP1L1-PDGFRA fusion transcripts; of the receptor as well as one of its ligands, PDGFC. This is in refs. 18, 19). Our findings suggest that in additional rare cases of contrast to other models of receptor tyrosine kinase activation NSCLC and sarcoma, PDGFRA activation maybe important in associated with gene amplification, wherein ligand-independent maintaining the malignant phenotype. activation is typically postulated (20, 21). In NCI-H1703 cells, The clinical success of sunitinib in renal cancer has been activation of the PDGFRA signaling pathways is a consequence of suggested to reflect its role as a VEGF receptor inhibitor and the focal PDGFRA and PDGFC gene coamplification. To our knowledge, consequent effects on angiogenesis. Notably, renal cancers are this is the first report in NSCLCs of overexpression of both an highlyvascularized tumors, suggesting a potential critical require- oncogenic receptor tyrosine kinase and its ligand, although

Cancer Res 2009; 69: (9). May 1, 2009 3944 www.aacrjournals.org

Activated PDGFRA Sensitizes Cancer Cells to Kinase Inhibition coexpression of the PDGFRA or PDGFRB receptors with their PDGFRA gene transcription. Similarly, it remains unclear as to the cognate ligands at higher levels than seen in adjacent normal tissue molecular mechanism underlying increased PDGFRA or PDGFC has been reported for some gliomas and osteosarcomas (22, 23). mRNA expression in the A-204 cells. Sarcomas often harbor Intriguingly, targeting PDGFC had a greater effect on proliferation chromosomal translocations giving rise to oncogenic activation, in both sunitinib-sensitive cell lines than targeting PDGFRA. This and these can affect PDGFR signaling. For example, dermatofi- raises the possibilitythat PDGFRA is not the sole critical target of brosarcoma protuberans and giant cell fibroblastomas harbor PDGFC in these cells. chromosomal rearrangements involving chromosome 17 and 22, in Our findings also suggest that antibodies directed against which the collagen type Ia1(COLIA1) gene undergoes fusion with PDGFR ligands mayhave therapeutic potential in PDGFRA- the gene encoding PDGFB (27). In one studyof 42 cases of uterine dependent cancer. Traditionally, therapeutic antibodies have been sarcoma, 70% of tumors displayed increased PDGFRA expression targeted to cell surface receptors implicated in tumor cell compared with that seen in adjacent normal tissue (28). Likewise, proliferation or maintenance, rather than against their cognate in a studyof 54 osteosarcoma patients, increased PDGFRA and ligands (24). Such antibodies typically show a more favorable PDGFRB expression was observed in tumors in more than 75% toxicityprofile than small-molecule kinase inhibitors, and when of cases (29). Notably, most Ewing sarcomas are associated with considered in the context of significant toxicities associated with a gene fusion that produces a transcription factor (EWS/FLI-1) sunitinib, our findings suggest potential clinical advantages of that promotes PDGFC mRNA expression (30). However, imatinib antibody-mediated targeting of the PDGFC ligand in some cancers. therapyin this setting shows minimal clinical activity(31). In these Our observation that the PDGFRA gene amplification in the NCI- tumors, which are notoriouslyrefractoryto chemotherapy, H1703 adenosquamous NSCLC cell line was also seen in a subset of targeting PDGFR signaling pathways may provide a useful squamous cell NSCLC clinical samples but in none of the alternative therapy. adenocarcinoma samples screened byFISH raises the possibility In summary, our findings show that ligand-mediated activation that this represents an oncogenic mechanism unique to this of PDGFRA signaling maybe a critical mediator of cell proliferation histologic subtype. In agreement with our findings, Rikova and in a small subset of NSCLCs and rhabdomyosarcomas and may colleagues (13) detected PDGFRA activation using a phospho- sensitize these cancer cells to either selective small-molecule proteomic screen in eight NSCLC patient samples as well as in the PDGFR kinase inhibitors or ligand-neutralizing antibodies. Our NCI-H1703 cell line. Whereas NSCLC adenocarcinoma patients are findings suggest that sunitinib as well as other PDGFR kinase being activelyrecruited into clinical trials of epidermal growth inhibitors may provide genotype-associated clinical benefit beyond factor receptor (EGFR) tyrosine kinase inhibitors (in the setting of the setting of PDGFR-mutant or c-KIT-mutant GISTs. activating EGFR mutations) and anaplastic lymphoma kinase ALK inhibitors ( translocations), to date, no drug-sensitizing Disclosure of Potential Conflicts of Interest genotypes have been identified for squamous cell NSCLC patients (25, 26). It remains to be seen whether retrospective analyses of No potential conflicts of interest were disclosed. sunitinib-responsive NSCLC patients will reveal enrichment for PDGFRA gene amplification or expression, and whether such Acknowledgments patients’ tumors show squamous histology. Received 11/17/08; revised 1/27/09; accepted 2/25/09; published OnlineFirst 4/14/09. Curiously, PDGFRA expression was only detected in the NCI- Grant support: National Cancer Institute Specialized Program of Research H1703 NSCLC cells, despite the fact that four other cell lines Excellence in Lung Cancer award P20 CA090578-06. The costs of publication of this article were defrayed in part by the payment of page showed increased PDGFRA gene copynumber. Thus, focal charges. This article must therefore be herebymarked advertisement in accordance amplification of the PDGFRA gene mayuniquelyyieldhigh level with 18 U.S.C. Section 1734 solelyto indicate this fact. PDGFR We thank the members of the Settleman laboratoryfor helpful discussion expression, potentiallyreflecting an additional genomic throughout the course of these studies, and Michelle Longworth for assistance with alteration within this locus that influences the regulatoryregions of the cell cycle analysis.

References 6. Sandler A, GrayR, PerryMC, et al. Paclitaxel- 13. Rikova K, Guo A, Zeng Q, et al. Global surveyof carboplatin alone or with bevacizumab for non-small- phosphotyrosine signaling identifies oncogenic kinases 1. Mendel DB, Laird AD, Xin X, et al. In vivo antitumor cell lung cancer. N Engl J Med 2006;355:2542–50. in lung cancer. Cell 2007;131:1190–203. activityof SU11248, a novel tyrosine kinase inhibitor 7. Andrae J, Gallini R, Betsholtz C. Role of platelet- 14. MacDonald TJ, Brown KM, LaFleur B, et al. targeting vascular endothelial growth factor and plate- derived growth factors in physiology and medicine. Expression profiling of medulloblastoma: PDGFRA and let-derived growth factor receptors: determination of a Genes Dev 2008;22:1276–312. the RAS/MAPK pathwayas therapeutic targets for pharmacokinetic/pharmacodynamic relationship. Clin 8. Valius M, Kazlauskas A. Phospholipase C-g1 and metastatic disease. Nat Genet 2001;29:143–52. Cancer Res 2003;9:327–37. phosphatidylinositol 3 kinase are the downstream 15. McDermott U, Sharma SV, Dowell L, et al. 2. Motzer RJ, Hutson TE, Tomczak P, et al. Sunitinib mediators of the PDGF receptor’s mitogenic signal. Cell Identification of genotype-correlated sensitivity to versus interferon a in metastatic renal-cell carcinoma. 1993;73:321–34. selective kinase inhibitors byusing high-throughput N Engl J Med 2007;356:115–24. 9. Ross R, Raines EW, Bowen-Pope DF. The biologyof tumor cell line profiling. Proc Natl Acad Sci U S A 2007; 3. Demetri GD, van Oosterom AT, Garrett CR, et al. platelet-derived growth factor. Cell 1986;46:155–69. 104:19936–41. Efficacyand safetyof sunitinib in patients with 10. Gazit A, Igarashi H, Chiu IM, et al. Expression of the 16. McDermott U, Iafrate AJ, GrayNS, et al. Genomic advanced gastrointestinal stromal tumour after failure normal human sis/PDGF-2 coding sequence induces alterations of anaplastic lymphoma kinase may sensitize of imatinib: a randomised controlled trial. Lancet 2006; cellular transformation. Cell 1984;39:89–97. tumors to anaplastic lymphoma kinase inhibitors. 368:1329–38. 11. Heinrich MC, Corless CL, Demetri GD, et al. Kinase Cancer Res 2008;68:3389–95. 4. Socinski MA, Novello S, Brahmer JR, et al. Multicenter, mutations and imatinib response in patients with 17. Lin M, Wei LJ, Sellers WR, Lieberfarb M, Wong WH, phase II trial of sunitinib in previouslytreated, advanced metastatic gastrointestinal stromal tumor. J Clin Oncol Li C. dChipSNP: significance curve and clustering of non–small-cell lung cancer. J Clin Oncol 2008;26:650–6. 2003;21:4342–9. SNP-array-based loss-of-heterozygosity data. Bioinfor- 5. Hurwitz H, Fehrenbacher L, NovotnyW, et al. 12. Corless CL, Schroeder A, Griffith D, et al. PDGFRA matics 2004;20:1233–40. Bevacizumab plus irinotecan, fluorouracil, and leuco- mutations in gastrointestinal stromal tumors: frequency, 18. Heinrich MC, Corless CL, Duensing A, et al. PDGFRA vorin for metastatic colorectal cancer. N Engl J Med spectrum and in vitro sensitivityto imatinib. J Clin activating mutations in gastrointestinal stromal tumors. 2004;350:2335–42. Oncol 2005;23:5357–64. Science 2003;299:708–10. www.aacrjournals.org 3945 Cancer Res 2009; 69: (9). May 1, 2009

Cancer Research

19. Cools J, DeAngelo DJ, Gotlib J, et al. A tyrosine kinase Expression of PDGF and PDGF receptors in human tion and fluorescence in situ hybridization assays. Hum created byfusion of the PDGFRA and FIP1L1 genes as a astrocytoma operation specimens supports the exis- Pathol 2008;39:184–93. therapeutic target of imatinib in idiopathic hyper- tence of an autocrine loop. Int J Cancer 1995;60:168–73. 28. Adams SF, Hickson JA, Hutto JY, Montag AG, eosinophilic syndrome. N Engl J Med 2003;348:1201–14. 24. Adams GP, Weiner LM. Monoclonal antibodytherapy Lengyel E, Yamada SD. PDGFR-a as a potential 20. Smolen GA, Sordella R, Muir B, et al. Amplifica- of cancer. Nat Biotechnol 2005;23:1147–57. therapeutic target in uterine sarcomas. Gynecol Oncol tion of MET mayidentifya subset of cancers with 25. Sequist LV, Martins RG, Spigel D, et al. First-line 2007;104:524–8. extreme sensitivityto the selective tyrosinekinase gefitinib in patients with advanced non-small-cell lung 29. Kubo T, Piperdi S, Rosenblum J, et al. Platelet-derived inhibitor PHA-665752. Proc Natl Acad Sci U S A cancer harboring somatic EGFR mutations. J Clin Oncol growth factor receptor as a prognostic marker and a 2006;103:2316–21. 2008;26:2442–9. therapeutic target for imatinib mesylate therapy in 21. Brennan PJ, Kumagai T, Berezov A, Murali R, Greene 26. Soda M, Choi YL, Enomoto M, et al. Identification of osteosarcoma. Cancer 2008;112:2119–29. MI. HER2/neu: mechanisms of dimerization/oligomer- the transforming EML4-ALK fusion gene in non-small- 30. Zwerner JP, MayWA. PDGF-C is an EWS/FLI induced ization. Oncogene 2000;19:6093–101. cell lung cancer. Nature 2007;448:561–6. transforming growth factor in Ewing familytumors. 22. Sulzbacher I, Traxler M, Mosberger I, Lang S, Chott A. 27. Patel KU, Szabo SS, Hernandez VS, et al. Dermatofi- Oncogene 2001;20:626–33. Platelet-derived growth factor-AA and -a receptor brosarcoma protuberans COL1A1-PDGFB fusion is 31. Bond M, Bernstein ML, Pappo A, et al. A phase II expression suggests an autocrine and/or paracrine loop identified in virtuallyall dermatofibrosarcoma protu- studyof imatinib mesylatein children with refractoryor in osteosarcoma. Mod Pathol 2000;13:632–7. berans cases when investigated bynewlydeveloped relapsed solid tumors: a Children’s OncologyGroup 23. Guha A, Dashner K, Black PM, Wagner JA, Stiles CD. multiplex reverse transcription polymerase chain reac- study. Pediatr Blood Cancer 2008;50:254–8.

Cancer Res 2009; 69: (9). May 1, 2009 3946 www.aacrjournals.org

Ligand-Dependent Platelet-Derived Growth Factor Receptor (PDGFR)- α Activation Sensitizes Rare Lung Cancer and Sarcoma Cells to PDGFR Kinase Inhibitors

Ultan McDermott, Rachel Y. Ames, A. John Iafrate, et al.

Cancer Res 2009;69:3937-3946. Published OnlineFirst April 14, 2009.

Updated version Access the most recent version of this article at: doi:10.1158/0008-5472.CAN-08-4327

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2009/04/13/0008-5472.CAN-08-4327.DC1

Cited articles This article cites 31 articles, 10 of which you can access for free at: http://cancerres.aacrjournals.org/content/69/9/3937.full#ref-list-1

Citing articles This article has been cited by 17 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/69/9/3937.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/69/9/3937. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.