Effect of a Novel Antimicrobial Peptide (Kk-20) in Combination with Antibiotics on Pseudomonas Aeruginosa

Veterinary Practitioner Vol. 20 No. 2 December 2019

EFFECT OF A NOVEL ANTIMICROBIAL PEPTIDE (KK-20) IN COMBINATION WITH ANTIBIOTICS ON PSEUDOMONAS AERUGINOSA

Rekha Panwar, Ram Kumar, Basant, Kritika Gahlot, Mukul Purva and Sunil Maherchandani Department of Veterinary Microbiology and Biotechnology, College of Veterinary and Animal Science Rajasthan University of Veterinary and Animal Sciences, Bikaner-334 001, Rajasthan, India

Received on: 21.07.2019 ABSTRACT Accepted on: 13.11.2019

In the present study a novel antimicrobial peptide identified from β defensin of Tharparkar breed of cattle in our laboratory was studied for its efficacy in combination with two antibiotics (Gentamicin and Ceftazidime) on Pseudomonas aeruginosa isolates. Both the antibiotics in combination with KK-20 gave a synergistic effect against Pseudomonas aeruginosa, however the extent of the effect varied with both the antibiotics. KK-20 in combination with Ceftazidime, was highly effective against both planktonic and biofilm form of bacteria where as in combination with the Gentamicin it showed synergistic effect only against planktonic form as there was reduction in minimal inhibitory concentraton.

Key words: Antimicrobial peptide, Nisin, KK-20, ceftazidime, gentamicin

Introduction et al., 2018). To study its efficacy in combination with antibiotics Antibiotics have been one of the greatest discoveries of (Ceftazidime and Gentamicin) the present study was conducted the 20th century for controlling infections. Currently, antibiotic and the results were compared with an established lantibiotic resistance has become a global problem (Cohen, 1992; AMP Nisin on P. aeruginosa isolates. Helmuth, 2000 and WHO 2017). Antimicrobial drug resistance is increasing at an alarming rate due to its excessive use and Materials and Methods misuse in medicine, food industry and agriculture. ESKAPE Isolation and species level confirmation pathogens i.e. Enterococcus faecium, Staphylococcus aureus, The preliminary isolation of P. aeruginosa was carried out Klebsiella pneumoniae, Acinetobacter baumannii, from different clinical conditions such as burn, wound and Pseudomonas aeruginosa and Enterobacter species urinary tract infections (Quinn et al., 1994; Cowan and Steel, representing the most recalcitrant bacteria, are resistant to 1974). The organisms were confirmed on the basis of cultural almost all common antibiotics and are the leading causes of characteristics and biochemical profiling. Further confirmation hospital acquired infections (Santajit and Indrawattana, 2016). was done using 16S rRNA gene based identification (Spilker The discovery or the development of new antibiotic is a et al., 2004) and MALDI-TOF based identification (Singhal et time taking and costly process. Very few new classes of al., 2015). antibiotics have been introduced during the last decade and Biofilm production that to are exclusively directed against Gram-positive pathogens Biofilm production of the isolates was assessed through (Marr et al., 2006). Whereas, the emergence of drug resistance slime production by observing for dark red and wrinkled in microbes against currently all available antibiotics raises colonies on Congo Red Agar (Friedman and Kolter, 2004), concerns about a post-antibiotic era with no antimicrobial pellicle formation at air-liquid interface (Chabane et al., 2014) treatment options. Therefore, new treatment options for drug and microtiter plate assay (O’Toole, 2011). Presence of biofilm resistant bacterial infections are desperately needed to tackle related gene algD using PCR confirmed the isolates for their these organisms. Currently, Antimicrobial Peptides (AMPs) or ability to form biofilms (Wolska and Szweda, 2009). Host Defense Peptides (HDPs) are emerging as an alternative therapeutic option to antimicrobial therapy. Thereby, Minimum inhibitory concentration (MIC) and Minimum bac- considerable research has been performed with an aim to tericidal concentration (MBC) develop new antibiotics to overcome bacterial resistance. AMPs The MIC is the lowest concentration of antibiotics that are a wide group of peptides which are part of the innate inhibits the growth of microbes whereas MBC is the lowest immunity of all living organisms, ranging from bacteria, insects concentration of the antibiotic that completely kills and plants to vertebrates (Yeaman and Yount, 2003). Since microorganism thereby,the organisms fail to grow on discovery of the first AMP i.e. lysozyme by Alexander Fleming in subsequent sub-culturing. Minimum Inhibitory concentration 1920, over 2,300 AMPs have been isolated and characterized and MBC were determined for the two antibiotics i.e. according to the online updated APD (Antimicrobial Peptide Gentamicin, which interrupt protein synthesis and Ceftazidime, Database) (Wang and Wang, 2004). which inhibit the cell wall synthesis in isolation or in combination In our laboratory in a previous in silico study, an AMP KK- with AMPs, KK-20 and Nisin on Pseudomonas aeruginosa 20 was identified having high support vector machine(SVM) using microdilution method described previously by James score and antibiofilm property. This Peptide fragment was (James, 1990). The AMPs were used at a fixed concentration identified from β-defensins of Tharparker breed of cattle (Gurao of 10 µg/ml.

Corresponding author: email: [email protected]

147 Veterinary Practitioner Vol. 20 No. 2 December 2019

Determination of minimum biofilm inhibitory concentration alternative therapeutic option are greatly needed to treat such (MBIC) and Minimal biofilm eradication concentration (MBEC) multidrug resistance infections and AMPs are being explored Minimum biofilm inhibitory concentration determines the as one of the potential options (Wang and Wang, 2004). sensitivity of bacteria in their biofilm phase (sessile phase) of In this study one of the AMP’s used for comparison was development and is the lowest concentration of an Nisin a lantibiotic which uses Lipid II as a “docking molecules’’ antimicrobial substance at which there is no time-dependent to form pores on the cell membrane surface and effectively kill increase in the mean number of biofilm viable cells. Whereas, bacteria (Garg et al., 2013). Previously, it was reported that the MBEC is defined as the lowest concentration of antibiotic that combination of Nisin with antibiotic improved the antibacterial completely kills all the organisms in the biofilm phase. The and antibiofilm activity against methicillin-resistant MBIC and MBEC were determined for the antibiotic alone or in Staphylococcus aureus (Mataraci and Dosler, 2012; Okuda et combination with peptides (KK-20 and Nisin) for P. aeruginosa al., 2013) and Enterococcus faecalis (Tong et al., 2014). (Sandoe et al., 2006; Mataraci and Dosler, 2012). Besides this, Nisin has shown antimicrobial action against distinct group of clinical and veterinary-relevant bacteria such Results and Discussion as saliva derived multi-species biofilms (Shin et al., 2015) and Isolation and characterization of P. aeruginosa Staphylococcus pseudointermedius (Field et al., 2015). The A total of 10 P. aeruginosa were confirmed from 65 clinical other AMP used was KK-20 which had been identified in our samples processed on the basis of biochemical characters, laboratory from β defensin group of AMPs from indigenous 16srRNA gene-based typing and MALDI-TOF. Further, all the Thaparkar breed of cattle. It was found to have high SVM score isolates produced biofilms and had algD gene. and predicted to form a hydrophilic channel and resulting in Evaluation of MIC, MBC, MBIC and MBEC large scale damage or small defects that dissipate the (a) Effect of Ceftazidime in combination with KK-20 and Nisin transmembrane potential, finally leading to cell death (Wimley The average MIC, MBC, MBIC and MBEC in µg/ml of and Hristova, 2011; Jorge et al., 2012). Ceftazidime a cell wall synthesis inhibitor alone was 145.6, Amongst the two AMPs KK-20 proved to be a much better 358.4, 409.6 and 819.2, respectively on all the 10 P. aeruginosa AMP in combination with Ceftazidime as there was a 9-fold isolates. But, when it was used in combination with Nisin there decrease in MBC, 6-fold decrease in MBIC and 3-fold decrease was an overall decrease in MIC (15-fold), MBC (3.45-fold), MBIC in MBEC as compared to Ceftazidime-Nisin combination. (2-fold) and MBEC (2-fold). However, when Ceftazidime was Although, Nisin was effective with both the antibiotics but the used with KK-20 there was significant reduction in MIC (16- extent of its efficacy was only significant in reducing MIC. fold), MBC (32-fold), MBIC (12.19-fold) and MBEC (6.74-fold) In conclusion, KK-20 can be explored as a potential (Fig. 1). The overall reduction in MIC, MBC, MBIC and MBEC of alternative AMP as it could significantly act upon the planktonic Ceftazidime were reported when it was combined with both and biofilm morphology of a resilient bacteria like the antimicrobial peptides. Pseudomonas aeruginosa.

(b) Effect of Gentamicin in combination with KK-20 and Nicin Acknowledgement The average MIC, MBC, MBIC and MBEC in µg/ml of The authors are highly thankful to the Bioinformatics Gentamicin alone were 1.25, 2.6, 9.6 and 36.8, respectively on project, Department of Veterinary Microbiology and all the 10 Pseudomonas aeruginosa isolates. But when it was Biotechnology, RAJUVAS, Bikaner for funding this project. used in combination with Nisin there was an overall decrease References in MIC (13.51-fold), MBC (4.33-fold), MBIC (2-fold) and MBEC Branda SS, Vik Å, Friedman L and Kolter R (2005) Biofilms: the matrix (1.64-fold). However, when KK-20 was used in combination revisited. Trends in Microbiol. 13: 20-26. with gentamicin there was only decrease in the MIC (4.54-fold) Chabane YN, Marti S, Rihouey C, Alexandre S, Hardouin J, Lesouhaitier but, no change in the MBC. But, MBIC and MBEC of Gentamicin O, Vila J, Kaplan JB, Jouenne T and Dé E (2014) increased up to 1.16 and 1.39-fold, respectively in combination Characterisation of pellicles formed by Acinetobacter with KK-20 (Fig. 2), indicating that KK-20 peptide has no effect baumannii at the air-liquid interface. PLoS One. 9: e111660. on biofilm form of Pseudomonas aeruginosa when it combines Cohen ML (1992) Epidemiology of drug resistance: implications for a post-antimicrobial era. Sci. 257: 1050-1055. with gentamicin. In the present study P. aeruginosa a Grams- Cowan ST and Steel KJ (1974) Enterobacteriaceae. Bergey’s Manual negative bacteria having a comparatively large genome, coding of Determinative Bacteriology. 8th ed. Eds RE Buchanan and for a large proportion of regulatory enzymes important for NE Gibbons. The Williams & Wilkins Co., Baltimore, 290-293. metabolism, transportation and efflux of organic compounds Field D, Gaudin N, Lyons F, O’Connor PM, Cotter PD, Hill C and Ross RP was selected as it is resilient to many antibiotics. The intrinsic (2015) A bioengineered nisin derivative to control biofilms of resistance of P. aeruginosa includes low outer Staphylococcus pseudintermedius. PLoS One. 10: membrane permeability, expression of efflux pumps that expel e0119684. antibiotics out of the cell and the production of antibiotic- Friedman L and Kolter R (2004) Two genetic loci produce distinct carbohydrate-rich structural components of the inactivating enzymes. Further production of biofilm by it also Pseudomonas aeruginosa biofilm matrix. J. Bacteriol. 186: makes this organism one of the difficult organisms to be treated 4457-4465. (Schweizer, 2003). As per the WHO report 2017 Pseudomonas Garg N, Salazar-Ocampo LM and Van der Donk WA (2013) In vitro aeruginosa is as a member of ESKAPE pathogens which is activity of the nisin dehydratase NisB. Proceedings of the resistant to almost all common antibiotics and are the leading National Academy of Sciences. 110: 7258-7263. causes of hospital acquired infections (Branda et al., 2005; Gurao A, Kataria R, Singh R, Kashyap SK and Singh R (2018) Silhavy et al., 2010; Santajit and Indrawattana, 2016). Therefore, Sequence Characterization and Insilico Anti-Biofilm Activity 148 Veterinary Practitioner Vol. 20 No. 2 December 2019

A Reduction in MIC and MBC of Ceftazidime when B Reduction in MBIC and MBEC of Ceftazidime when combine with antimicrobial peptides combine with antimicrobial peptides

Fig.1: Reduction of MIC, MBC, MBIC and MBEC of Ceftazidime when combine with Nisin and KK-20.

A Change in MIC and MBC of Gentamicin when B Change in MBIC and MBEC of Gentamicin when combine with antimicrobial peptides combine with antimicrobial peptides

Fig.2: Effect of MIC, MBC, MBIC and MBEC of Gentamicin when combine with Nisin and KK-20

Prediction of β defensin 103A in Tharparkar Cattle Breed Resistance in ESKAPE Pathogens. Biomed Res Int. 2475067- and Taurine Cattle. Int. J. Livestock Res. 8 (10). 2475067. Helmuth R (2000) Antibiotic resistance in Salmonella. CABI Publishing Spilker T, Coenye T, Vandamme P and LiPuma JJ (2004) PCR-based Oxon, UK. assay for differentiation of Pseudomonas aeruginosa from James PA (1990) Comparison of four methods for the determination of other Pseudomonas species recovered from cystic fibrosis MIC and MBC of penicillin for viridans streptococci and the patients. J. Clinical Microbiol. 42: 2074-2079. implications for penicillin tolerance. J. Antimicrobial Chemo. Schweizer HP (2003) Efflux as a mechanism of resistance to 25: 209-216. antimicrobials in Pseudomonas aeruginosa and related Jorge P, Lourenco A and Pereira MO (2012) New trends in peptide- bacteria: unanswered questions. Genet Mol. Res. 2: 48- based anti-biofilm strategies: a review of recent 62. achievements and bioinformatic approaches. Biofouling. 28: Shin JM, Ateia I, Paulus JR, Liu H, Fenno JC, Rickard AH and Kapila YL 1033-1061. (2015) Antimicrobial nisin acts against saliva derived multi- Ley RE, Lozupone CA, Hamady M, Knight R and Gordon JI (2008) species biofilms without cytotoxicity to human oral cells. Worlds within worlds: evolution of the vertebrate gut Frontiers in Microbiol. 6: 617. microbiota. Nat. Rev. Microbiol. 6: 776-788. Silhavy TJ, Kahne D and Walker S (2010) The bacterial cell envelope. Marr AK, Gooderham WJ and Hancock RE (2006) Antibacterial peptides Cold Spring Harbor perspectives in Biology. 2: a000414. for therapeutic use: obstacles and realistic outlook. Current Singhal N, Kumar M, Kanaujia PK and Virdi JS (2015) MALDI-TOF mass Opinion in Pharmacol. 6: 468-472. spectrometry: an emerging technology for microbial Mataraci E and Dosler S (2012) In vitro activities of antibiotics and identification and diagnosis. Frontiers in Microbiol. 6: 791. antimicrobial cationic peptides alone and in combination Tong Z, Zhang Y, Ling J, Ma J, Huang L and Zhang L (2014) An in vitro against methicillin-resistant Staphylococcus aureus biofilms. study on the effects of nisin on the antibacterial activities of Antimicrob. Agents Chemoth. 56: 6366-6371. 18 antibiotics against E. faecalis. PLoS One. 9: e89209. O’Toole GA (2011) Microtiter dish biofilm formation assay. JoVE (Journal Wang Z and Wang G (2004) APD: the Antimicrobial Peptide Database. of Visualized Experiments), 47: 2437. Nucleic acids Res. 32: D590-D592. Okuda K-i, Zendo T, Sugimoto S, Iwase T, Tajima A, Yamada S, Sonomoto Wimley WC and Hristova K (2011) Antimicrobial peptides: successes, K and Mizunoe Y (2013) Effects of bacteriocins on methicillin- challenges and unanswered questions. J. Membrane Biol. resistant Staphylococcus aureus biofilm. Antimicrob. 239: 27-34. Agents Chemoth. 57: 5572-5579. Wolska K and Szweda P (2009) Genetic features of clinical Quinn P, Carter M, Markey B and Carter G (1994) Veterinary Clinical Pseudomonas aeruginosa strains. Pol. J. Microbiol. 58: Microbiology. Wolfe Publication, London, UK, 254-258. 255-260. Sandoe JA, Wysome J, West AP, Heritage J and Wilcox MH (2006) Yeaman MR and Yount NY (2003) Mechanisms of antimicrobial peptide Measurement of ampicillin, vancomycin, linezolid and action and resistance. Pharmacological Rev. 55: 27-55. gentamicin activity against enterococcal biofilms. J. Antimicrob. Agents Chemoth. 57: 767-770. Santajit S and Indrawattana N (2016) Mechanisms of Antimicrobial

149 Veterinary Practitioner Vol. 20 No. 2 December 2019

ISOLATION AND IDENTIFICATION OF SALMONELLA IN FARM AND BACK- YARD CHICKEN SAMPLES IN AND AROUND JAIPUR

Madan Mohan Mali 1*, D.S. Meena, Sandeep Kumar Sharma2, Samita Saini3, Sheela Choudhary4, Sanjita Sharma5 and A.P. Singh6 Department of Veterinary Medicine, Post Graduate Institute of Veterinary Education and Research N.H. -11, Agra Road, Jamdoli, Jaipur-302031 Rajasthan University of Veterinary and Animal Sciences, Bikaner-334 001, Rajasthan, India

Received on: 27.09.2019 ABSTRACT Accepted on: 25.11.2019

In present study, 480 samples comprised of cloacal swabs and caecal contents were collected aseptically from commercial farms and backyard chicken flocks located in and around Jaipur region. The samples were pre enriched in Rappaport Vassiliadis, Fluid Selenite Cystine and Tetrathionate Brilliant Green broths and selective plating was done on XLD and HE agar. The highest isolation percentage (41.93%) was observed on SCB followed by Tet-B (32.25%) and RVS (25.80%), respectively whereas the XLD agar showed a high isolation percentage (54.84%) in comparison to HE agar (45.16%).

Key words: Salmonella, isolation, chicken, zoonotic, polymerase chain reaction

Introduction Materials and Methods Salmonellosis is a hyper endemic disease in India Sample collection affecting both man and animals (Kumar et al., 2011). A total of 480 cloacal swabs and caecal contents samples Salmonella genus represents the most common food borne (120 samples of each from commercial farm chicken and zoonotic pathogens frequently isolated from food-producing backyard chicken) were collected aseptically from different animals, regarded as a serious concern to public health, places located in and around Jaipur region. All samples were animals and food industry worldwide. Salmonella enterica collected randomly from apparently healthy chicken as well as represents the most pathogenic species and includes more from sick birds showing signs of diarrhoea. The detail of than 2600 serovars. Salmonella can be transmitted to humans samples collected for present investigation is presented in along the farm-to-fork continuum, commonly through Table 1. contaminated foods of animal origin including poultry and poultry-related products. Some Salmonella serovars are Isolation and Identification of Salmonella restricted to one specific host commonly referred to as “host- Isolation and identification of Salmonella was conducted restricted” whereas others have broad host spectrum known according to standard guide lines of Global Salm-Surv, as “host-adapted” serovars (Jajere, 2019). In India, more than laboratory protocols as per Salmonella ISO 6579:2002(E); 235 serovars (more than 53 from poultry birds alone) have Hendriksen (2003). After collection, the samples were been reported and this number is increasing continuously homogenized and pre-enriched by adding 10 ml of Buffered (Singh et al., 2004; Singh, 2005). Conventional bacterial culture Peptone Water (HiMedia, Mumbai, India) and centrifuged at methods are being used routinely not only to isolate but also to 5000 rpm for 10 minutes. Supernatant was taken in fresh sterile identify phenotypic characteristics of the Salmonella that require tubes and incubated at 37°C for 18-20 hours. From pre- at least 3-11 days. The standard culture methods for detecting enriched culture 500 µl volumes were transferred into 3 fresh Salmonella spp. in poultry include non-selective pre-enrichment sterile tubes each containing 5 ml of Rappaport Vassiliadis followed by selective enrichment and plating on selective and (RVS), Fluid Selenite Cystine (SCB) and Tetrathionate Brilliant differential agars (Menghistu, 2011). Green (Tet-B) HiVeg broths, respectively and incubated at 37°C According to Cohen (1994) and Cheng (2008) continuous for 18-20 hours. advancements of polymerase chain reaction (PCR) and Real A loop-full culture from each broth was streaked on Xylose time PCR techniques, the specific amplification of particular Lysine Deoxycholate (XLD) and Hektoen Enteric (HE) agar target segments of DNA has become a real practice for rapid plates (HiMedia, Mumbai, India) and incubated at 37°C for 18- detection of this public health and animal associated 20 hours. The plates were examined for typical black centred pathogens. This study was aimed to isolate and identify the colonies of Salmonella (Fig. 1 and 2). Salmonella in cloacal swabs and caecal contents samples of Extraction of genomic DNA and PCR amplification commercial and backyard chicken flocks, located in and around The DNA from each isolate was extracted by snap chilling Jaipur region. procedure as described by Ramya et al. (2012). Molecular

1*Part of Ph.D. Thesis of first author and corresponding E-mail: [email protected]; 2Assistant Professor, Dept of Veterinary Microbiology, PGIVER; 3Assistant Professor, Dept of Animal Genetics and Breeding, PGIVER; 4Professor and Head, Dept of Animal Nutrition, PGIVER; 5Professor and Head, Dept of LPM, PGIVER; 6Professor and Head, Dept of Vet. Cli. Med., E.& J., CVAS, Bikaner

150 Veterinary Practitioner Vol. 20 No. 2 December 2019 confirmation of isolates for Salmonella was done by targeting the invA gene as described by Chiu and Ou (1996). The PCR amplification of isolates was done by using Nexus gradient Master cycler (Eppendorf, U.S.A.). The electrophoresis was done in 1.5% Agarose gel of TBE buffer with ethidium bromide. The amplified PCR products were visualized under UV transilluminator and the specific band size of 244 bp was detected in all isolates of Samonella (Fig. 3)

Results and Discussion In present study, 6 isolates were detected in farm L1 L2 L3 L4 M chicken in RVS broth that comprised of 2 isolates of cloacal Fig. 3: PCR Amplified product (bp=244) of invA gene of Salmonella swab and 4 isolates of caecal content samples, respectively enterica L1 – L4 positive samples M 100 bp DNA Ladder whereas in backyard chicken only 2 isolates were detected that included 1 isolate of cloacal swab and caecal content Likewise, 10 isolates of Salmonella were detected in Tet- samples, respectively. The per cent rate of isolation of B broth that comprised of 5 isolates in farm chicken (3 and 2 Salmonella in RVS broth was recorded as 25.80% (Table 3). isolates in cloacal swab and caecal content samples, In SCB broth, 13 Salmonella were isolated that included 7 respectively) along with equal number of isolates (n = 5) isolates of farm chicken (1 and 6 isolates in cloacal swab and detected in backyard chicken (2 and 3 isolates in cloacal swab caecal content samples, respectively) and 6 isolates of and caecal content samples, respectively). The rate of isolation backyard chicken (2 and 4 isolates in cloacal swab and caecal in Tet-B broth for Salmonella isolates (n=31) was detected as content samples, respectively). The rate of isolation of 32.25%. The findings recorded for isolation of Salmonella in Salmonella in SCB broth for was found as 41.93%. three different non-selective broth media revealed a high isolation rate in SCB broth compared to RVS and Tet-B broths however statistically non-significant difference were present among three broths used for isolation of Salmonella in cloacal swab and caecal content samples of farm chicken and backyard chicken. Findings of present study are not in

Table 1: Details of samples collected from farm and backyard poultry

Type of Source of S. Sample Sample Total No. Farm Backyard Poultry Poultry Cloacal 1 120 120 240 swabs Caecal 2 120 120 240 contents Total 240 240 480

Table 2: Detail of Salmonella isolates recovered in three broth media S. Plate % Isolation Farm Chicken Backyard Chicken Over all Total Fig.1: Salmonella colony on XLD plate No. media (n= 31) Cloacal Caecal Cloacal Caecal Cloacal Caecal

swabs contents swabs contents swabs contents 1 XLD 3 8 2 4 5 12 54.84 2 HE 3 4 3 4 6 8 45.16

6 12 5 8 11 20 Total

Table 3: Detail of Salmonella isolates recovered on two selective media plates % S. Farm Backyard Over all Broth Isolation No. Chicken Chicken Total (n = 31) Cloacal Caecal Cloacal Caecal Cloacal Caecal swabs contents swabs contents swabs contents 1 RVS 2 4 1 1 3 5 25.80 2 SCB 1 6 2 4 3 10 41.93 3 Tet -B 3 2 2 3 5 5 32.25 Fig. 2: Salmonella colony on HE plate Total 6 12 5 8 11 20 151 Veterinary Practitioner Vol. 20 No. 2 December 2019

agreement reported by Ramya et al. (2012) who isolated References Salmonella in poultry and meat samples by cultural and PCR Bhuvaneswari M, Shanmughapriya S and Natarajaseenivasan K methods and it was reported that selective enrichment with (2015) Prevalence of Multidrug-Resistant (MDR) Salmonella Rappaport-Vassilidias and Tetrathionate broths were superior enteritidis in Poultry and Backyard Chicken from over Selenite cysteine broth. Tiruchirappalli, India. Microbiol. J. 5(2): 28-35. Cheng CM, Lin W, Van KT, Phan L, Tran NN and Farmer D (2008) Rapid In XLD agar, a total of 11 isolates were detected in farm detection of Salmonella in foods using real time PCR. J. chicken that comprised of 3 and 8 isolates in cloacal swab Food Protection. 71(12): 2436-41. and caecal content samples, respectively whereas 6 isolates Chiu C and Ou JT (1996) Rapid identification of Salmonella serovars in were detected in backyard chicken that included 2 and 4 faeces by specific detection of virulence genes, invA and isolates of cloacal swab and caecal content samples, spvC, by an enrichment broth culture-multiplex PCR respectively. The rate of isolation on XLD agar for Salmonella combination assay. J. Clin. Microbial. 34(10): 2619-2622. isolates (n=31) was detected as 54.84 % (Table 2). Cohen ND, Wallis DE, Neibergs HL, McElroy AP, McGruder ED, DeLoach The results of isolation of Salmonella on HE agar plate JR, Corrier DE and Hargis BM (1994) Comparison of the polymerase chain reaction using genus specific showed an equal number of isolates (7 isolates) for both, farm oligonucleotide primers and microbiologic culture for the chicken and backyard chicken samples that included again detection of Salmonella in drag-swabs from poultry houses. equal number of isolates (3 and 4 isolates) belonged to cloacal Poultry Sci. 73 (8):1276-1281. swab and caecal content samples, respectively. The rate of Hendriksen RS (2003) Global Salm-Surv: A global Salmonella isolation on HE agar plate was detected as 45.16%. The detail surveillance and laboratory support project of the World of Salmonella isolates recovered on two selective media plates Health Organization. Laboratory Protocols for Isolation of th is presented in Table 3. These findings revealed that XLD agar Salmonella as per Salmonella ISO 6579:2002(E) 4 edn., have a high isolation rate as compared to HE agar media pp. 1-19. Jajere SM (2019) A review of Salmonella enterica with particular however statistical analysis of results showed that a non- focus on the pathogenicity and virulence factors, host significant difference was present among XLD and HE agar specificity and antimicrobial resistance including multidrug media used for selective enrichment of Salmonella in cloacal resistance. Vet. World. 12 (4): 504-521. swab and caecal content samples collected from farm chicken Kumar RS, Sazawal A, Sinha S, Sood S and Bhan MK (2011) Typhoid and backyard chickens. fever: contemporary issues as related to the disease in In the present study, a total of 31 isolates of Salmonella India. Round Table Conference Series on Water Borne th enterica were detected and confirmed by PCR among 480 Diseases. 12 ed. Ranbaxy Science Foundation, New Delhi, cloacal swabs and caecal contents samples of farm chicken India. pp. 31-36. Menghistu HT, Rathore R, Dhama K and Agarwal RK (2011) Isolation, and backyard chicken flocks present in and around Jaipur Identification and Polymerase Chain Reaction (PCR) Detection region. Among these 31 isolates, 18 were recovered from farm of Salmonella species from Field Materials of Poultry Origin. chicken birds whereas 13 isolates were detected in samples Int. J. Microbiol. Res. 2(2): 135-142. belonged to backyard chicken. The overall prevalence of Ramya P, Madhavarao T and Rao LV (2012) Study on the incidence of Salmonella was recorded as 6.46 %. Findings of present study Salmonella enteritidis in poultry and meat samples by cultural were in agreement as reported by Savita et al. (2007) in diarrheic and PCR methods. Vet.World. 5(9): 541-545. chickens in Madhya Pradesh, India and are in contrast to Savita S, Kusumakar AL and Malik YPS (2007) Prevalence of findings of Bhuvaneswari et al. (2015) who investigated the diarrheagenic Escherichia coli and Salmonella among poultry in Madhya Pradesh. Indian J. Anim. Sci. 77: 933- prevalence and seasonal variation of Salmonella enteritidis in 936. Tiruchirappalli, Tamil Nadu, India and reported the total rate of Singh, B.R, Singh, VP, Agarwal M, Sharma G and Chandra M (2004) isolation of Salmonella as 26.8% (n = 87) that included 32.5% Haemolysins of Salmonella, their role in pathogenesis and (n = 51) in poultry and 21.4% (n = 36) in backyard chicken, subtyping of Salmonella serovars. Indian J. Expt. Biol. 42: respectively along with highest isolation rate recorded during 303-313. summer while the lowest was recorded during winter. Singh BR (2005) An overview of conventional and molecular tools for diagnosis of animal salmonellosis. National Symposium on Acknowledgement “Molecular Techniques for Diagnosis of Major Bacterial The authors gratefully acknowledge the Dean, PGIVER, diseases. IVRI, Izatnagar, 21st and 22nd February 2005. Jaipur and P.I., RKVY Project, C.D.S.R.Z.D., PGIVER, Jaipur for pp.16-34. providing financial assistance for this study.

152 Veterinary Practitioner Vol. 20 No. 2 December 2019

SENSITIVITY AND SPECIFICITY OF MULTIPLEX PCR ASSAY FOR DETECTION OF YERSINIA ENTEROCOLITICA IN PIGS AND FOODS OF PORCINE ORIGIN

Rupa Boral1*, R.S. Rathore1, A.K. Mishra2 and Ashok Kumar2 Division of Veterinary Public Health, Indian Veterinary Research Institute, Izatnagar, Bareilly -243 122, Uttar Pradesh, India

ABSTRACT Received revised on: 29.04.2018 Accepted on: 30.05.2018

Yersinia enterocolitica, an important food and water-borne gastrointestinal agent is regarded an emerging pathogen world wide. Animals that recover frequently become asymptomatic carriers of the disease. Most human illness is caused by Y. enterocolitica which causes a variety of symptoms depending on the age of the person infected often in young children. In the present study, a polymerase chain reaction (PCR) based assay was used for rapid detection of Y. enterocolitica targeting 16S rRNA, ail and yst genes in pig faeces, tongue, tonsils and ground pork samples. The primers were found to be highly specific for Y. enterocolitica and did not yielded any amplification with other Gram positive and Gram negative bacteria. The minimum detection level was found up to 103 cells/ml for all the genes targeted in present assay. Prevalence rates were 5.83% in pig faeces; 6.67% in pig tongues; 18.3% in pig tonsils; 6.67% in pork, respectively. Overall prevalence rate was reported 8.34% with highest prevalence found in pig tonsils and lowest in pig faeces. PCR technique was found to be more efficient with 97.5% sensitivity than the cultural methods with only 90% sensitivity. Comparison studies revealed that the PCR assay was more rapid, specific, sensitive and efficient over conventional cultural and biochemical detection methods. To conclude, we could say that the PCR based detection is not only a sensitive but also a rapid and reliable method for detection of Y. enterocolitica in different sample matrices as clearly demonstrated by the results in present study.

Key words: Yersinia enterocolitica, polymerase chain reaction, sensitivity, specificity, pigs

Introduction factor) (Bhagat and Virdi, 2007). Pathogenic strains of Y. Yersinia enterocolitica is regarded as an important human enterocolitica produce a heat-stable enterotoxin, Yersinia stable entero-invasive pathogen with a global distribution and toxin-a (YST- a) (Delor and Cornelis, 1992) at temperatures recognized as an emerging food borne enteric pathogen below 30°C. Two genetic loci that confer invasiveness, and are causing enterocolitis and other gastrointestinal disorders in necessary for virulence have been identified as the inv animal species and in human beings (Bottone, 1999). (invasion) locus of Yersinia spp. and the ail (attachment- Yersiniosis is considered third most common food borne invasion locus) region of Y. enterocolitica. All the isolates of Y. zoonoses, and it is most commonly found in pork and its enterocolitica that show virulence in humans contain DNA products (EFSA, 2015). Owing to its psychrophillic nature, Y. sequences homologous to the ail locus, whereas avirulent enterocolitica is capable of multiplying at refrigeration environmental isolates do not. Unlike ail-homologous DNA, temperature and in vacuum packed foods, which describes inv- homologous DNA is present in all strains, but the invasion its significant importance in food hygiene (Hanna et al., 1976, protein is not expressed in environmental isolates (Kwaga et Lee et al., 1981). Pigs are reported to be a major source of Y. al., 1992). enterocolitica, harbouring the organism in their throat, tongue Due to its increasing incidences, both conventional and and tonsils (Funk et al., 2000) as well as shedding it in their molecular techniques for detection of Y. enterocolitica have faeces (Rasmussen et al., 1995). It has been frequently gained momentum lately. Conventional microbiological isolated from slaughter line pigs (Bonardi et al., 2003; Liang et cultivation and identification methods are commonly based al., 2012). on sample processing, enrichment, isolation in selective Among 60-70 serotypes, only a few are associated with media, cultural identification and biochemical assays. These disease in humans, viz. serotypes O: 3, O: 9, O: 8, O: 5, 27 etc. methods are cumbersome and time-consuming and the The main reservoir of serotype O: 3 and O: 9 are healthy pigs results may be limited due to poor sensitivity, slow growth and (Nesbakken et al., 2003). There are six biovars/biotypes (1A, poor viability, particularly in case of fastidious organisms like 1B and 2-5) which can be distinguished on the basis of their Y. enterocolitica (Ahomaa and Korkeala, 2003). With the advent biochemical properties. The virulence of pathogenic Y. of molecular techniques such as, polymerase chain reaction enterocolitica biotypes (1B and 2–5) is mainly due to the (PCR) which is widely used for the detection of microbial presence of a 70-kb plasmid pYV (plasmid for Yersinia pathogens in foods including Y. enterocolitica (Olsen et al., virulence) and certain chromosomal genes. The plasmid- 1995; Xu et al., 2012). Several PCR assays have been encoded virulence factors are Yersinia adhesin A (YadA) and developed to detect Y. enterocolitica in clinical, food and Ysc-Yop type III secretion system (TTSS). The chromosomal environmental samples (Ahomaa and Korkeala, 2003). The virulence genes are inv (invasin), ail (attachment and invasion ail, inv and yst genes, located in the chromosome of locus), yst (Yersinia stable toxin) and myfA (mucoid Yersinia pathogenic Y. enterocolitica strains, are the most frequently

1*Corresponding author: Asst. Dir. (Admin), Dept of ARD, South 24 Parganas Dist., Govt. of West Bengal. [email protected], 9903840236, Division of Veterinary Public Health, Indian Veterinary Research Institute, Izatnagar, Bareilly 243122 U.P.; 2Division of Animal Health, Central Institute for Research on Goats, Makhdoom, Mathura 281122 U.P. 153 Veterinary Practitioner Vol. 20 No. 2 December 2019

used targets (Lambertz et al., 2000, 2008; Lambertz and Tham, DNA, 2.5 µl10x PCR buffer (Fermentas, Germany), 1.0 µl MgCl2 2005). In addition, some PCR assays using the Yersinia- (50 mM), 0.2 µl dNTP (25 mM), 1.0 µl (20 pmole/µl) of each specific region of the 16S rRNA gene have been also designed forward and reverse primer, 0.2 µl Taq DNA polymerase (5 IU/ to detect Yersinia spp. (Wannet et al., 2001). µl) and nuclease free water to make 25 µl total volume. The The present study was undertaken with the intention of reaction mixture was initially incubated in a Thermocycler standardization of a rapid multilocus PCR technique targeting (Eppendorf, Germany) at 940C for 5 min for initial denaturation the ail, yst and 16S rRNA genes for detection of Y. enterocolitica and then a total 35 cycles of reaction were performed with in pigs and foods of porcine origin. denaturation at 940C for 45 seconds, primer annealing at 620C for 45 secs, strand extension at 720C for 45 secs followed by Materials and Methods final extension at 720C for 7 min. The amplification of specific Reference bacterial strains PCR product was checked by gel electrophoresis in 2% The bacterial strains used in this study have been listed agarose gel. in Table 1 along with their sources. All the strains were maintained by subculturing in brain heart (BHI) slants every Multiplex PCR of ail and yst genes detection month. PCR protocol was standardized for detection of Y. enterocolitica by using the oligonucleotide primer set 2 and Collection and processing of samples set 3 (Table 3) (Lambertz et.al. 2000). The reaction was carried A total of 300 samples from various sources were collected out in 25 µl volume containing 5.0 µl (20 ng) of genomic DNA, from different farms and slaughter houses in and around 2.5 µl 10x PCR buffer (Fermentas, Germany), 1.0 µl MgCl2 (50 Bareilly, Uttar Pradesh (Table 2) India. All the samples were mM), 0.2 µl dNTP (25 mM), 1.4 µl (10 pmole) of each forward collected in sterile cold conditions, and transported to the and reverse primer (primer set 2), 1.0 µl (10 pmole) of each laboratory as quickly as possible for further processing forward and reverse primer (primer set 3) 0.2 µl Taq DNA maximum within three hours. polymerase (5 IU/µl) and nuclease free water up to 25 µl. The Enrichment and culturing reaction mixture was initially incubated in a thermocycler 0 Isolation and identification of Y. enterocolitica was done (Eppendorf, Germany) at 94 C for 3 min for initial denaturation according to the standard methods (Cowan and Steel, 1975; and then a total 30 cycles of reaction were performed with 0 0 ISO, 2003; Markey et al., 2013). Final isolation was done on denaturation at 94 C for 45 secs, primer annealing at 60 C for 0 Cefsulodin Irgasan Novobiocin (CIN) plates following 1 min, strand extension at 72 C for 1 min followed by final 0 incubation at 220C for 21 days. Plating was also done on extension at 72 C for 5 min. The amplification of specific PCR Bismuth Sulphite agar (BSA). product was checked by gel electrophoresis in 2% agarose gel. Genomic DNA isolation For standardization of PCR the genomic DNA was Determination of specificity of the PCR assays extracted from the reference cultures following the technique In order to determine the specificity of primers and the outlined by Sambrook et al. (2001) with minor modifications. PCR assays, Y. enterocolitica and non Y. enterocolitica species For detection of Y. enterocolitica from the test samples, as listed in Table 1 were tested by ail, yst and 16S rRNA gene genomic DNA was extracted from overnight grown culture, using directed PCR. The bacterial isolates were inoculated in BHI the EZ-10 Spin Column Genomic DNA Miniprep Kit broth, incubated overnight, subjected to heat lysis/snap chill (Thermofisher Scientific) following the manufacturer’s treatment (Sambrook et al., 2001). PCR was performed as instructions. described previously, and agarose gel (2%) electrophoresis The purity and concentration of the extracted DNA was was carried out to check presence of any product generated by checked by UV spectroscopy and agarose gel electrophoresis. other bacteria. One microlitre of the DNA solution was added to 1 µl of TE Determination of sensitivity of the PCR assays (minimum buffer (pH 8.0), the optical density (OD) of the sample was then detection level) read at 260 nm and 280 nm in a UV spectrophotometer To detect the threshold sensitivity of the PCR assays, (Lambda 25 UV-vis spectrometer, Perkin-Elmer) after adjusting overnight BHI broth culture of Y. enterocolitica was taken in a the absorbance to zero with the blank (TE buffer, pH 8.0). The centrifuge tube and centrifuged at 8000 rpm for 10 min. The purity of the DNA samples was estimated by calculating the pellet was washed twice with phosphate buffered saline (PBS), ratio of A and A . The concentration of DNA was calculated 260 280 and then resuspended in PBS and the concentration was from the A value using the formula: concentration of DNA (ng/ 9 260 adjusted to 10 cells/ml with the help of McFarland’s µl) = A x 50. After quantification, working solutions were 260 nephelometer tube. From this bacterial suspension, serial 10 prepared by adjusting the concentration of DNA to 20 ng/5 µl. fold dilutions were made up to 1 cell/ml in PBS. From each Five µl of the working solution were used as template in all dilution, 1 ml was taken and DNA was extracted by heat lysis/ PCR reactions. snap chill treatment (Sambrook et al., 2001), and used as PCR amplification of 16S rRNA gene of Y. enterocolitica template in PCR as described previously. The PCR products PCR protocol was standardized for detection of Y. were analyzed by agarose gel (2%) electrophoresis. enterocolitica by using the oligonucleotide primer set 1 (Table Artificial inoculation/Spiking studies 3) as described by Neubauer et al. (2000). The PCR was The experimental inoculation studies were carried out to carried out in 25 µl volume containing 5.0 µl (20 ng) of genomic compare the vis-à-vis efficacy of the standardized PCR and

154 Veterinary Practitioner Vol. 20 No. 2 December 2019 routine cultural methods for the detection of Y. enterocolitica in Artificial inoculation/Spiking studies samples under laboratory conditions. PCR negative natural Typical dark red colonies surrounded by transparent samples were spiked with positive cultures of Y. enterocolitica border; usually flat with smooth border and entire edge giving for the purpose. Enrichment and cultural methods and PCR a characteristic “Bulls-Eye” appearance were considered as assay as described previously were employed. For presumptive for Y. enterocolitica, and then subjected to Gram’s microbiological confirmation, Gram’s staining, motility and staining and biochemical characterization. On the basis of battery of biochemical tests (like Oxidase, Urease, Citrate tests, motility at 25°C, and biochemical properties, the presence of acid and alkali reaction on Kligler Iron Agar (KIA) slants, Lysine, Y. enterocolitica was confirmed. PCR had a clear edge over Arginine and Ornithine decarboxylase tests, Voges-Proskauer the cultural methods for detection of Y. enterocolitica. Out of 10 test, Methyl Red Test, Phenylalanine deaminase test) were spiked pig faecal samples 8 were positive by cultural methods used. All these tests were performed as per standard protocols and 9 were positive by PCR. Among the 10 spiked pig tongue (Bercovier and Mollaret, 1984; Holt et al., 1994). and pig tonsils 9 were detected positive by conventional methods whereas, PCR technique detected 10 as positive Results and Discussion (Table 4). However, in case of spiked raw pork samples both Isolation studies cultural and PCR yielded identical results. A total of 7 samples were found positive for Y. enterocolitica Yersinia enterocolitica is an important emerging food and from 120 pig faeceal samples. Four out of 60 samples from water borne enteric pathogen that causes acute gastroenteritis pig tongues were found positive, 11 cases out of 60 samples and enterocolitis, symptoms may vary from acute enteritis with from pig tonsils and 2 samples out of 60 raw pork were found fever to occasionally bloody watery diarrhea, especially in positive, respectively as shown in Table 2, by ail, yst and 16S children (Tadesse et al., 2013). Pigs are considered to be the rRNA PCR. major reservoir source of infection as the pathogen has been Cultural/Colony Characteristics frequently isolated from pork and pork products (Ahomaa et In case of reference and spiked samples typical dark red al., 2007). With the growing popularization of ready to eat frozen colonies surrounded by transparent border; usually flat with pork products, the importance of Y. enterocolitica has rocketed smooth border and entire edge giving a characteristic “Bulls- owing to its capability to grow under refrigeration temperatures. Eye” appearance, were observed after 72 hrs of incubation in In terms of occurrence and importance in developing countries, CIN agar, whereas on Bismuth sulphite agar colonies were yersiniosis is listed as third most common food borne black enamel like. zoonoses (Zadernowsks et al., 2014). Timely and prompt detection is the first step for the prevention and control of any PCR amplification of 16S rRNA gene of Y. enterocolitica food borne infection, but the conventional methods for the In case of positive amplification a clear band was observed isolation of Y. enterocolitica involve cold enrichment followed at 330 bp (Fig.1A), which confirmed the presence of Y. by isolation on selective agar which may take as long as 4 enterocolitica. weeks (Ahomaa and Korkeala, 2003) for confirmation thus pose limitations of their use. Moreover, the conventional Multiplex PCR of ail and yst genes of Y. enterocolitica microbiological methods for detection are labour intensive, A positive amplification was evident by showing the which may be a possible explanation to the fact that there are presence of two amplicons, corresponding to 145 bp for yst fewer reports of such an important pathogen particularly from gene and 454 bp for ail gene, respectively (Fig. 1B), thereby India. However, with the advent of molecular techniques such confirming Y. enterocolitica species . as PCR for detection of food borne pathogens in foodstuffs, Specificity of the PCR assays the entire scenario has improved and detection of such The standardized PCR assay directed against 16S rRNA, pathogens had become easier in less time with minimum yst and ail gene was tested by using DNA from other bacterial labour investment. In the present study, attempt has been made organisms as indicated in Table 1 for checking the specificity to detect Y. enterocolitica in pigs and food of porcine origin by of the assay. No product was amplified from bacterial strains PCR directed towards multiple genetic loci. other than Y. enterocolitica in either 16S rRNA assay (Fig. 2A) PCR amplification of 16S rRNA gene revealed an amplicon or the ail and yst gene (Fig. 2B) targated PCR assay. corresponding to 330 bp which confirmed the presence of Y. enterocolitica. The results of the 16S rRNA gene PCR Sensitivity of the PCR assays correlated well with the findings of Neubauer et al. (2000). 16S The sensitivity of the standardized PCR assays was rRNA gene has been used frequently for detection of pathogens evaluated by subjecting DNA extracted from serial 10 fold due to its conserved nature, and could differentiate Y. dilutions of DNA extracted from pure culture of Y. enterocolitica enterocolitica from a broad spectrum of both Yersinia and non- (ranging from 109cells/ml to 10 cells/ml) to amplification with Yersinia spp. (Wannet et al., 2001). Duplex PCR targated for primer directed towards 16S rRNA, ail and yst genes. The detection of yst and ail genes revealed specific amplicons at minimum detection level was found to be 103 cells/ ml for 16S 145 bp and 454 bp, respectively, which suggested the presence rRNA gene (Fig. 3A). Similarly, the minimum detection level of pathogenic Y. enterocolitica. Virulence of Y. enterocolitica was 103 cells/ml for ail gene and yst gene (Fig. 3B). The depends upon the expression of both plasmid and samples of higher concentration were found to produce signals chromosomal genes. However, there is frequent loss of of increasing intensity. virulence plasmid under laboratory after subculturing and

155 Veterinary Practitioner Vol. 20 No. 2 December 2019

Fig. 2A: Specificity of 16S rRNA gene PCR Lane M: 100bp DNA ladder Fig. 2B: Specificity of Duplex PCR Lane A: Yersinia enterocolitica of ail (454 bp) & ys t Lane B: Comylobacter jejuni (145bp) gene Lane C: Arcobacter butzleri Lane M: 100bp DNA ladder Lane D: Listeria monocytogenes Lane Y: Yersinia enterocolitica Fig. 1A: PCR targeting 16S Fig. 1B: Duplex PCR targeting ail Lane E: Staphylococcus aureus Lane C: Campylobacter jejuni rRNA gene of Y. & yst rRNA gene of Y. Lane F: E. coli Lane A: Arcobacter butzleri enterocolitica enterocolitica Lane G: Aeromonas hydrophila Lane L: Listeria monocytogenes Lane M : 100bp DNA ladder Lane M: 100 bp DNA ladder Lane S: Staphylococcus aureus Lane S : 330 bp amplicon of Lane S: 454 bp amplicon of ail Lane E: E. coli 16S rRNA gene and 145 bp amplicon of Lane Ae: Aeromonas hydrophila yst gene

Table 2: Samples collected and samples positive in the present study

S.No. Sample type Sample No. Sample positive by PCR (%) 1 Pig faeces 120 7 (5.83 %) 2 Pig tongues 60 4 (6.67 %) 3 Pig tonsils 60 11 (18.34 %) 4 Raw Pork 60 4 (6.67 %) Total number of samples 300 25 (8.34 %)

Table 3: Oligonucleotide primers used in the study Fig.3A: Sensitivity of 16S rRNA Fig. 3B: Sensitivity of ail (454 bp) Primer Primer Name and Sequence Product Size PCR of minimum & yst (145 bp) gene PCR detection level of minimum detection level Set No. Lane M: 100 bp DNA ladder Lane M: 100 bp DNA ladder 1 16S rRNA (Neubauer, et al., 2000) 330 bp Lane 1: 10 cells/ml Lane 1: 10 cells/ml F: 5’AAT ACC GCA TAA CGT CTT CG’3 Lane 2: 102 cells/ml Lane 2: 102 cells/ml R: 5’CTT CTT CTG CGA GTA ACG TC’3 Lane 3: 103 cells/ml Lane 3: 103 cells/ml 2 Attachment invasion locus ail (Lambertz et al., 2000) 454 bp Lane 4: 104 cells/ml Lane 4: 104 cells/ml F: 5’GTT TAT CAA TTG CGT CTG TTA ATG TGT ACG’3 Lane 5: 105 cells/ml Lane 5: 105 cells/ml R: 5’CTA TCG AGT TTG GAG TAT TCA TAT GAA GCG’3 6 Lane 6: 10 cells/ml Lane 6: 106 cells/ml 3 Yersinia stable toxin yst (Ibrahim et al., 1997) 145 bp 7 7 Lane 7: 10 cells/ml Lane 7: 10 cells/ml F: 5’AAT GCT GTC TTC ATT TGG AGC’3 Lane 8: 108 cells/ml Lane 8: 108 cells/ml R: 5’ATC CCA ATC ACT ACT GAC TTC’3 Lane 9: 109 cells/ml Lane 9: 109 cells/ml

Table 1: Bacterial isolates used in the study and their sources Table 4: Detection of Y. enterocolitica in spiked samples by culture & PCR S. Name of the organism Source Sample No. of Samples Samples No. 1 Yersinia enterocolitica (MTCC 840) IMTECH, Chandigarh Type Samples positive by positive by 2 Yersinia enterocolitica (MTCC 859) -Do- culture PCR 3 Yersinia enterocolitica (MTCC 861) -Do- Pig faeces 10 8 9 4 Campylobacter jejuni VPH Division, IVRI Pig tongues 10 9 10 5 Listeria monocytogenes -Do- 6 Escherichia coli -Do- Pig tonsils 10 9 10 7 Arcobacter butzleri -Do- Raw pork 10 10 10 8 Staphylococcus aureus -Do- Total 40 36 (90 %) 39 9 Aeromonas hydrophila -Do- (97.5 %) 156 Veterinary Practitioner Vol. 20 No. 2 December 2019 therefore may not be considered as an ideal target for the On comparison of cultural and PCR based detection of Y. detection of pathogenic Y. enterocolitica strains. The enterocolitica from spiked fecal samples and raw milk chromosomal virulence genes, viz. the inv (invasin), ail samples, PCR technique was found to be more efficient with (attachment and invasion locus), yst (Yersinia stable toxin) 97.5% detection than the cultural methods with only 90% gene, have been increasingly used as PCR targets for detection detection (Table 4). For the detection of Y. enterocolitica from of pathogenic Y. enterocolitica in natural samples (Ahomaa pig tonsil, tongue and pork samples both cultural and PCR and Korkeala, 2003). In the present study, two chromosomal based detection showed satisfactory results. To conclude, we virulence marker genes were targeted, such type of duplex could say that the PCR based detection described here is not PCR using two different set of primers have been highly only a sensitive but also a rapid method for detection of Y. recommended by several other investigators (Lambertz and enterocolitica in different sample matrices as clearly Tham, 2005). Using more than one set of primers may provide demonstrated by the results. better identification, detection and nullify the variations involved with DNA extraction and sample processing and most Acknowledgements importantly differentiate between pathogenic and non The authors thankfully acknowledge Director, Indian pathogenic subtypes (Lambertz and Tham, 2005). Therefore, Veterinary Research Institute and Joint Director, CADRAD for it may be emphasized that the dual level PCR used under the the facilities provided. present study was efficient for the detection of 16S rRNA as References well as for differentiation of pathogenic Y. enterocolitica on the Ahomaa MF and Korkeala H (2003) Low occurrence of pathogenic basis of ail and yst genes which are mainly reported from Yersinia enterocolitica in clinical, food and environmental pathogenic strains. The sensitivity of the 16S rRNA PCR assay samples: a methodological problem. Clin. Microbiol. Rev. was found up to 103 cells/ml, which meant that the minimum 16: 220-229. detection level was up to 5 bacterium considering the fact that Ahomaa MF, Bucher M, Hank C, Stolle A and Korkeala H (2001) High only 5 µl was used as template in PCR. However, even lower prevalence of Yersinia enterocolitica 4:03 on pig offal in threshold detection limit using the same protocol have also southern Germany: a slaughtering technique problem. Syst. Appl. Microbiol. 24: 457-463. been reported (Wannet et al., 2001). The sensitivity of the ail Ahomaa MF, Stolle A and Stephan R (2007) Prevalence of pathogenic 3 and inv gene directed duplex PCR was also found up to 10 Yersinia enterocolitica in pigs slaughtered at a Swiss cells/ml, indicating that even minimally infected samples could abattoir. Int. J. Food Microbiol. 119(3): 207-212. also be identified by the technique used in present study. Ahomaa MF, Wacheck S, Koenig M, Stolle A and Stephan R (2009) Specificities of all the 3 primer sets were found satisfactory as Prevalence of pathogenic Yersinia enterocolitica and no amplicons were seen in case of pathogens other than Y. Yersinia pseudotuberculosis in wild boars in Switzerland. enterocolitica hence primers very specific detected only Y. Int. J. Food Microbiol. 135: 199-202. enterocoilitica strains. Arora D (2010) Development of indirect-ELISA for detection of Yersinia enterocolitica in pork. M.V.Sc. Thesis, Haryana Agricultural Out of the 300 natural samples tested, 25 were positive University, Hisar, India. for the presence of Y. enterocoilitica, corresponding to 8.34% Baghel SS and Kumar A (2017) Occurrence of Yersinia enterocolitica incidence. Categorically, 5.83% (7 out of 120) of pig fecal in raw pork. Haryana Vet. 56(1): 83-86 samples were positive, which corresponds with earlier reports Bercovier H and Mollaret HH (1984) Yersinia. In Bergey’s Manual of (Buchner, 2001; von Altrock et al., 2006). In case of raw ground Systematic Bacteriology. Vol.1 ed. Kreig, N.R. Baltimore: pork the incidence was found 6.67 % (4 out of 60), which was Williams & Wilkins. pp. 498-506. much higher than study done by Latha et al. (2017) but lesser Bhagat N and Virdi JS (2007) Distribution of virulence-associated than that reported from India (Baghel and Kumar, 2017). In genes in Yersinia enterocolitica biovar 1A correlates with clonal groups and not the source of isolation. FEMS case of pig tongue samples the incidence was 6.67% (4 out of Microbiol. Lett. 266:177-83. 60), which were much lesser than earlier reports from US, Bonardi S, Brindani F, Pizzin G, Lucidi L, D’Incau M, Liebana E and Germany (Ahomaa et al., 2001) and India (Singh et al., 2003). Morabito S (2003) Detection of Salmonella spp., Yersinia Pig tonsil samples showed the highest incidence 18.34% (11 enterocolitica and verocytotoxin producing Escherichia coli out of 60). The prevalence was comparable with that of 17.2% O157 in pigs at slaughter in Italy. Int. J. Food Microbiol. 85: reported by Letellier et al. (1999) and less than 20%, as found 101-110. by Nowak et al. (2006). Likewise, earlier investigators have Bottone EJ (1999) Yersinia enterocolitica: overview and epidemiologic also reported higher rate of prevalence of Y. enterocolitica in correlates. Microbes Infect. 1: 323-333. Buchner M (2001) On the epidemiology of Yersinia enterocolitica in pig tonsils and tongue, while low incidence was reported in slaughter by-products from pigs with particular ground pork (De Boer and Nouws, 1991; Ahomaa et al., 2009; consideration of methods. Dissertation (in German). Arora, 2010; Baghel and Kumar, 2017). Arora (2010) in a study Veterinary faculty. Ludwig Maximilians University, Munich, also reported higher isolation of Y. enterocolitica in pig tonsil Germany. (34.74%) as compared to ground pork (4.35%), which is similar Cowan ST (1974) Cowan and Steel’s Manual for the Identification of to the finding of the present study. The variations in prevalence Medical Bacteria. 3rd edn. Cambridge University Press, rates observed may be attributed to difference in methods of Cambridge. sample collection, enrichment broths, enrichment methods De Boer E and Nouws JF (1991) Slaughter pigs and pork as a source of human pathogenic Yersinia enterocolitica. Int. J. Food and incubation steps used. Apart from that difference in Microbiol. 12: 375-378. slaughtering, poor hygiene and management practices of Delor I and Cornelis GR (1992) Role of Yersinia enterocolitica Yst animals may have contributed to the differences in the toxin in experimental infection of young rabbits. Infect. prevalence rates observed in this study. Immun. 60: 4269-4277. 157 Veterinary Practitioner Vol. 20 No. 2 December 2019

EFSA (European Food Safety Authority) and ECDC (European Centre Nesbasken T, Eckner K, Hoidal HK and Rotterud OJ (2003) Occurrence for Disease Prevention and Control) (2015) The European of Yersinia enterocolitica and Campylobacter spp. In union summary report on trends and sources of zoonoses, slaughter pigs and consequences for meat inspection, zoonotic agents and food-borne outbreaks in 2014. EFSA slaughtering, and dressing procedures. Int. J. Food J. 13(12): 4329. Microbiol. 80: 231-240. Funk JA, Troutt HF, Davis SA and Fossler CP (2000) In vitro susceptibility Neubauer H, Hensel A, Aleksic S and Meyer H (2000) Identification of of Yersinia enterocolitica isolated from the oral cavity of Yersinia enterocolitica within the genus Yersinia. Syst. Appl. swine. J. Food Prot. 63: 395-399. Microbiol. 23:58-62 Hanna MO, Zink DL, Carpenter ZL and Vanderzant C (1976) Yersinia Nowak B, Mueffling T, Caspari K and Hartung J (2006) Validation of a enterocolitica -like organisms from vacuum packaged beef method for the detection of virulent Yersinia enterocolitica and lamb. J. Food Sci. 41: 1254-1256. and their distribution in slaughter pigs from conventional Holt JG, Krieg NR, Sneath PHA, Staley JT and Williams ST (1994) and alternative housing systems. Vet. Microbiol. 117: 219- Bergey’s Manual of Determinative Bacteriology. 9th edn., 228. Williams and Wilkins, Baltimore. Olsen JJ, Aabo S, Hill W, Notermans S, Wernars K, Granum PE, Popovie ISO 10273 (2003) Microbiology of Food and Animal Feeding Stuffs - T, Rasmussen HN and Olsvik O (1995) Probes and Horizontal Method for the Detection of Presumptive Polymerase Chain Reaction for the detection of food-borne Pathogenic Yersinia enterocolitica (ISO 10273:2003). bacteril pathogens. Int. J. Food Microbiol. 28: 1-78. International Organization for Standardization, Geneva, Rasmussen HN, Rasmussen OF, Christensen H and Olsen JE (1995) Switzerland. Detection of Yersinia enterocolitica O:3 in fecal samples Kwaga J, Iversen JO and Misra V (1992) Detection of pathogenic and tonsil swabs from pigs using IMS and PCR. J. Appl. Yersinia enterocolitica by polymerase chain reaction and Bacteriol. 78: 563-568. digoxigenin-labelled polynucleotide probes. J. Clin. Ratnam S, Mercer E, Picco B, Parsons S and Butler R (1982) A Microbiol. 30: 2668-2673. nosocomial outbreak of diarrhoel disease due to Yersinia Lambertz ST, Nilsson C, Hallanvuo S and Lindblad M (2008). Real time enterocolitica serotype O:5, biotype 1A. J. Infect. Dis. 145: PCR method for detection of pathogenic Yersinia 242- 247. enterocolitica in food. Appl. Environmen. Microbiol. 10: 6060- Sambrook J, Russell DW, Irwin N and Janseen KA (2001) Molecular 6067. cloning - A laboratory manual. 3rd edn. Cold Sping Harbor Lambertz ST and Tham MLD (2005) Identification and characterization Laboratory Press, Cold spring harbor, New York. pp. 6.1- of pathogenic Yersinia enterocolitica isolates by PCR and 6.62. pulsed-field gel electrophoresis. Appl. Environ. Microbiol. Singh I, Bhatnagar S and Virdi JS (2003) Isolation and characterization 71: 3674-3681. of Yersinia enterocolitica from diarrhoeic human subjects Lambertz ST, Lindqvist R, Ballagi-Pordnoy A and Tham MLD (2000) A and other sources. Curr. Sci. 84: 1353-1355. combined culture and PCR method for detection of Tadesse DA, Bahnson PB, Funk JA, Morgan Morrow, WE, Abley MJ, pathogenic Yersinia enterocolitica in food. Int. J. Food. Ponte VA, Thakur S, Witturn T, De Graves FJ, Rajala-Schultz Microbiol. 57: 63-73. PJ and Gebreyes WA (2013) Yersinia enterocolitica of Latha C, Anu CJ, Ajaykumar VJ and Sunil B (2017) Prevalence of porcine origin: carriage of virulence genes and genotypic Listeria monocytogenes, Yersinia enterocolitica, diversity. Food borne pathogens disease. 10(1): 8086. Staphylococcus aureus, and Salmonella enteric Typhimurium Von Altrock A, Louis AL, Rösler U, Alter T, Beyerbach M, Kreienbrocks in meat and meat products using multiplex polymerase chain L and Waldmann KH (2006) The bacteriological and reaction, Vet. World. 10(8): 927-931. serological prevalence of Campylobacter spp. and Yersinia Lee WH, Smith RE, Damare JM, Harris ME and Johnston RW (1981) An enterocolitica in fattening pig herds in Lower Saxony Berl evaluation of virulence test procedures for Yersinia Munch. Tierarztl Wochenschr. 119: 391-9. enterocolitica recovered from foods. J. Appl. Bacteriol. Wannet WJB, Reessink M, Brunings HA and Maas HME (2001) Detection 50: 529-539. of pathogenic Yersinia enterocolitica by a rapid and sensitive Letellier A, Messier S and Quessy S (1999) Prevalence of Salmonella duplex PCR assay. J. Clin. Microbiol. 39: 4483-4486 spp. and Yersinia enterocolitica in finishing swine at Xu YG, Cui LC, Tian CY, Li SL, Cao JJ, Liu ZM and Zhang GC (2012) A Canadian abattoir. J. Food Prot. 62: 22–25. multiplex polymerase chain reaction coupled with high Liang J, Wang X, Xiao Y, Zhingang C, Shengli X, Qiong H, Jinchuan Y, performance liquid chromatography assay for simultaneous Longze L, Shukun W, Kewei L, Haoshu Y, Wenpeng G, detection of six foodborne pathogens. Food Control. 25: Jianguo X, Biao K and Huaiqi J (2012) Prevalence of Yersinia 778-783. enterocolitica in pigs slaughtered in Chinese abattoirs. Appl. Zandernowska A, Chajecka-Wierzchowska W and Laniewska- Environ. Microbiol. 78(8): 2949-2956. Trokenheim L (2014) Yersinia enterocolitica: A dangerous, Markey B, Leonard F, Archembault M, Cullinane A and Maguire D (2013) but often ignored foodborne pathogen. Food Reviews Clinical veterinary microbiology. Mosby Elsevier, New York International. 30: 53-73. (USA). Nesbaken T, Kapperud G, Sorum H and Dommarsnes K (1987) Structural variability of 40-50 Mdal virulence plasmids from Yersinia enterocolitica. Acta Path. Microbiol. Scand. 95: 167-173.

158 Veterinary Practitioner Vol. 20 No. 2 December 2019

INFLAMMATORY CYTOKINES, HELPING TOOL IN VETERINARY DIAGNOSTICS: FROM BASICS TO ADVANCEMENT

Zul-I-Huma Syed1, Neelesh Sharma1*, Amit Kumar Singh2, Anand Kumar Pathak3, Iva Bacic4, Goran Bacic5, Nino Macesic5 and Dong Kee Jeong6 Division of Veterinary Medicine, Faculty of Veterinary Science and Animal Husbandry Sher-e-Kashmir University of Agricultural Sciences and Technology of Jammu, R.S. Pura-181 102, Jammu, India

ABSTRACT

Early diagnosis and treatment of any disease of animals is important for best results in the veterinary clinics, hence present paper is formulated with the emphasis on updated early diagnostic markers in veterinary science. Besides this cytokines are being used as immunomodulators, biomarkers and may further be used for different diagnostic purposes but the need for automated assays and standardization of test protocols are the prime challenges to be faced in this field.

Key words: Inflammation, proinflammatory cytokines, acute phase response, acute phase proteins, serum amyloid A

Introduction protocol (Crisman et al., 2008). Detection and monitoring of inflammation, as a result of innumerable disease processes becomes a primary challenge Cytokines and acute phase response in medicine (Crisman et al., 2008). A thorough history and physical Acute phase response is the varied response of the body to examination often reveals how to stratify the patient, however in infection, trauma resulting into hormonal alterations, muscle protein subtle diseases, mild and early signs of infection and inflammation depletion which further leads to a combined effect of minimized may be occult yet significant (Rose, 2015). Any alteration in the tissue damage and enhancement of tissue repair. Once a cell state of well being of an animal leads to triggering of both the gets injured, it triggers the response, releasing arachidonic acid innate and acquired immune response of body. Although innate metabolites and products of oxidative stress, which leads to immune system covers all those aspects of the host defence elaboration of cytokines such as IL-1β, IL-6 and tumour necrosis mechanisms, which includes production of antibody, stimulating factor-α (TNF-α) from macrophages and monocytes. Many of the leukocyte activity and also plays a role in host’s metabolic cardinal signs of inflammation are due to these cytokines, and processes. However, the varied reactions of the host to infection, their increase in circulation stimulates the hepatic APR releasing inflammation, or trauma are collectively known as the acute phase APPs (Fig. 1). Sometimes target cells are exposed to a single response (APR), resulting into varied pathophysiological cytokine but the combinations of cytokines on various target cells responses such as pyrexia, leukocytosis, hormone alterations, has either a stimulatory or suppressive effect. For example, the and muscle protein depletion combining to minimize tissue elaboration of serum amyloid A (SAA) requires IL-6 and IL-1 or damage while enhancing the repair process. To these diseases TNFα, whereas IL-1 and TNF-α inhibit the induction of fibrinogen a systemic response is generated in which there is an increase in (Fb) by IL-6. Similarly glucocorticoids upregulate the stimulatory the production of plasma proteins by liver which are collectively effect whereas insulin has an inhibitory role on production of APPs known as the acute phase proteins (APPs) (Jain et al., 2011). (Crisman et al., 2008). The mechanism for stimulation of hepatic Cytokines, the protein hormones act as messengers between production of APPs by proinflammatory cytokines has been the local site of injury and the hepatocytes, which synthesize the extensively studied. Induction of the APPs by IL-1 following binding APPs and help the body in inducing acute phase response (Jain to the IL-6 receptor causes phosphorylation and degradation of et al., 2011). Inflammation that goes unnoticed or is not displayed inhibitor kappa B (IkB). The inhibitor of transcription factor nuclear well with its obvious clinical signs results in subclinical infection, factor kappa B (NF-kB) leads to the release of NF-kB and which leads to subsequent impairment in growth and subsequent activation of acute-phase gene in nucleus (Jain et al., performance. Until now, efforts have been made on biochemical 2011). In different species these APPs respond differently, signifying identification of these APPs as markers for the degree and time major, moderate or minor responses. The one’s showing the course of inflammation, as these are quickly released into the major response has a low serum concentration in healthy as <11 blood stream on the onset of any infection or injury. Their g/L which increases drastically by 100-1000 folds on stimulation, concentrations have been found to be directly proportional to the 5-10 fold increase is seen in moderate responders (Eckersall severity of the underlying cause. Thus, their quantification provides and Bell, 2010) valuable diagnostic and prognostic information on the outcome of Cytokine–based diagnostics the disease as well as helps in establishing a better treatment Until last few years the only prime tool used in diagnostic of a

1Division of Veterinary Medicine, SKUAST-J, R.S. Pura, Jammu, India, *Corresponding author email: Email: [email protected], Phone: +91-1923-250242; Fax: +91-1923-250639; 2Laboratory for Animal Experiments, National Jalma Institute of Leprosy and Other Mycobacterial Diseases, Agra (U.P.), India; 3Division of Animal Nutrition, SKUAST-J, R.S. Pura, Jammu, India; 4Faculty of Veterinary Medicine, University of Zagreb, Zagreb, Croatia; 5Clinic for Reproduction and Theriogenology, Faculty of Veterinary Medicine, University of Zagreb, Zagreb, Croatia; 6Department of Animal Biotechnology, Faculty of Biotechnology, Jeju National University, Jeju, Republic of Korea 159 Veterinary Practitioner Vol. 20 No. 2 December 2019 disease was detection and identification of pathogens mainly encoded by DNA vaccine. Until now the soluble cytokines have relying on the identification-specific antibody (Ab). However, this been successfully used for modulation of immune response in method is not suitable for all infections. Infact, when there is short cattle, sheep, pigs and poultry but the larger doses have to be term infection; the half life of antibodies is also relatively short, thus used, which often result in side effects. In order to avoid this, slow declining the Ab titre and also limits the utility of Ab-based diagnostic release devices that help in delivering of cytokines over a period of tests. Providentially, when a foreign body invades host, they lead to weeks may be considered. In an experiment carried out by generation of long-lasting memory T-cell that can be used as a Lofthouse and co-workers in 2002, it was demonstrated that avidin marker of infection. For example, Mycobacterium bovis infection injected together with ovine IL-1 resulted in an Ab response of was previously being diagnosed by tuberculin testing that was comparable magnitude to avidin in alum alone but this Ag with visualized by skin reaction. This was a time consuming process ovine IL-1 delivered in a slow release device results in considerably as well as cumbersome as each infected animal was to be higher Ab titres. handled twice (Scheerlinck and Yen, 2005). However, now the Alternatively, for an extended release of cytokines over a period development of a sensitive capture ELISA for the detection of IFN- of time it can be delivered as a gene encoded on a plasmid γ (Wood et al., 1990b), thus paving the way for development of an (Scheerlinck, 2001) improved diagnostic test for tuberculosis in cattle (Wood et al., 1990a). Animals suffering from M. bovis infection were detected Acute phase protein as biomarkers as early as 4 weeks PI using this kit (Fifis et al., 1994). In a yet The acute phase proteins (APPs) are blood proteins that can another study conducted by Pyorala in 2003, he found that the be used to assess the innate immune system’s systemic response most promising parameter for monitoring sub clinical mastitis is to infection, inflammation or trauma (Murata et al., 2004; Petersen by observing the activity of N-acetyl-D-glucosaminidase. As the et al., 2004; Ceron et al., 2005). These proteins change their sub clinical mastitis is accountable for the majority of losses serum concentration by >25% in response to proinflammatory incurred to the dairy industry, so its early diagnosis will help in cytokines stimulated during the disease process. And being a decreasing these heavy losses to a great extent. Weber and his good quantitative biomarker of disease, we can use APPs in co-workers in 2006 conducted a study on clinically affected animals diagnosis, prognosis and monitoring response to therapy, as and found out that SAA3 appears to be predominant bovine SAA well as in general health screening. They are highly sensitive Isoform expressed by mammary epithelial cells during lactation indicators of inflammation (Eckersall and Bell, 2010). and a simulated gram-negative bacterial infection (Larson et al., Acute phase protein in canine medicine 2005). In the dog, C-reactive protein, haptoglobin and serum amyloid The results regarding high levels of IL1-β, TNF-α and IFN-γ A have been identified as significant diagnostic ‘markers’ of steroid- were detected in pigs with viral respiratory disease (Van Reeth responsive meningitis-arteritis. There is a considerable species and Nauwynck, 2000) and cattle with bacterial infection (Pace et variation in the pathophysiology of CRP, similar is the case with al., 1993; Horadogoda et al., 1994; Morsey et al., 1999; dogs wherein CRP is a major APP and its serum concentration Kasimanickam et al., 2013; El-Deeb and Elmoslemany, 2016). In can increase rapidly from <1 mg/L to >100 mg/L as part of a addition, the expression of IL1- β and TNF-α were elevated in the number of infectious diseases including babesiosis, respiratory airways and lung lesions of diseased calves with leishmaniosis, leptospirosis, parvovirus infection and E. coli pneumonic pasteurellosis (Malazdrewich et al., 2001). El-Deeb endotoxaemia (Ceron et al., 2005), where as large increases in and Elmoslemany (2016) conducted a similar study in ovines in CRP are witnessed in arthritis and lymphoma and moderate levels 2016 and found out that there is significant increase in APPs and in canine inflammatory bowel (Jergens et al., 2003) and cytokines, with greatest increase observed in the levels of Hp, haematological diseases (Tecles et al., 2005). The recent surge highlighting the value of APP and cytokines as diagnostic markers of interest in the use of APPs in canine medicine demonstrates of naturally occurring pneumonic pastuerellosis. the extent of application of these biomarkers in areas such as Cytokines as immune-modulators for vaccines gastric mucosal injury (Bayramli and Ulutas, 2008), pancreatitis Understanding the mechanism of how the immune response (Holm et al., 2004; Hori et al., 2006), systemic inflammatory is generated by the body, following vaccination, biasing the induction responses and sepsis (Gebhardt et al., 2009), mammary of immune response could be aimed, using the vaccine adjuvants neoplasia (Planellas et al., 2009), lymphoma (Merlo et al., 2007, including cytokines (Scheerlinck, 2005). Because cytokines control 2008; Mischke et al., 2007; Nielsen et al., 2007), autoimmune the development and regulation of an immune response, many haemolytic anaemia (Mitchell et al., 2009), immune mediated studies have investigated their use as immunomodulators (Blecha, polyarthritis (Kjelgaard-Hansen et al., 2006; Ohno et al., 2006), 1997; Godson et al., 1997). They have also been used as hyperadrenocorticism (McGrotty et al., 2005; Caldin et al., 2009), immunomodulators in food animals; cytokines primarily used for impaired wound healing (Knapp et al., 2009), obesity (Veiga et this purpose are IL-1, IL-2, IL-6, INF-γ, colony stimulating factors al., 2008), cardiac disease (Rush et al., 2006; Saunders et al., and TNF-α (Richards et al., 1995; Chen and Ainsworth., 1992; 2009) and pyometra (Dabrowski et al., 2009). Sordillo et al., 1991). These cytokines have profound effects on Acute phase proteins in ruminant medicine immunologic and physiologic responses and, in many cases, For ruminants haptoglobin (Hp) is the major APP, its beneficial effects on the clinical course of infection. Since it is concentration in normal has been observed as <20 mg/L and expensive to produce recombinant cytokines, another strategy of may increase up to >2g/L within 2 days of infection. It has been manipulating an immune response is by using substances that found to be effective in diagnosis and prognosis of mastitis, enteritis, induce cytokine regulatory cascades (Blecha, 2001). They are peritonitis, pneumonia, endocarditis and endometritis (Murata et delivered in two basic forms: as soluble proteins or as genes

160 Veterinary Practitioner Vol. 20 No. 2 December 2019

acute lesions, relative to healthy beef-type animals (Tourlomousis et al., 2004)

Acknowledgments Present study was supported by the Animal Science Division, Indian Council of Agricultural Research (ICAR), New Delhi under ICAR-Extramural Project.

References Bayramli G and Ulutas B (2008) Acute phase protein response in dogs with experimentally induced gastric mucosal injury. Vet. Clin. Pathol. 37: 312-316. Blecha F (1997) Cytokine applications in pigs. In Horzinek MC, Schijns VECJ (eds): Cytokines. Blecha F (2001) Immunomodulators for prevention and treatment of infectious diseases in food- producing animals. Vet. Clin. North Am. Food Anim. Pract. 17: 621-633. Caldin M, Tasca S, Carli E, Bianchini S, Furlanello T, Martinez-Subiela S and Fig. 1: Representation of the induction of APR (Cray et al., 2009) Ceron JJ (2009) Serum acute phase protein concentrations in dogs with hyperadrenocorticism with and without concurrent inflammatory conditions. Vet. Clin. Pathol. 38: 63-68. Ceron JJ, Eckersall PD and Martynez-Subiela S (2005) Acute phase proteins in dogs and cats: current knowledge and future perspectives. Vet. Clin. Pathol. 34: 85-99. Chen D and Ainsworth AJ (1992) Glucan administration potentiates immune defence mechanisms of channel catfish, Ictalurus punctatus Rafinesque. J. Fish Dis. 15: 295-304. Cray C, Zaias J and Altman NH (2009) Acute phase response in animals: A Response. Comp. Med. 59: 517-526. Crisman MV, Scarratt WK and Zimmerman KL (2008) Blood proteins and Inflammation in horse. Vet. Clin. Equine. 24: 285-297. Dabrowski R, Kostro K, Lisiecka U, Szczubial M and Krakowski L (2009) Usefulness of C-reactive protein, serum amyloid A component and haptoglobin determinations in bitches with pyometra for monitoring early postovariohysterectomy complications. Theriogenology. 72: 471-476. Eckersall PD and Bell R (2010) Acute phase proteins: Biomarkers of infection and inflammation in veterinary medicine. Vet. J. 185: 23-27. Eckersall PD, Young FJ, McComb C, Hogarth CJ, Safi S, Weber A, McDonald T, Nolan AM and Fitzpatrick JL (2001) Acute phase proteins in serum and milk from dairy cows with clinical mastitis. Vet. Rec. 148: 35-41. El-Deeb WM and Elmoslemany AM (2016) The diagnostic accuracy of acute phase proteins and proinflammatory cytokines in sheep with pneumonic Pastuerellosis. Peer J. 4: e2161. Fig. 2: Inflammatory response triggered by foreign body leads to Fifis T, Corner LA, Rothel JS and Wood PR (1994) Cellular and humoral production of proinflammatory cytokines like IL-1, IL-6 which further immune responses of cattle to purified Mycobacterium bovis on lead to release of APP generating APR which results into opsonization antigens. Scand. J. Immunol. 39: 267-274. and resolution (KEGG, Biocarta) Gebhardt C, Hirschberger J, Rau S, Arndt G, Krainer K, Schweigert FJ, Brunnberg L, Kaspers B and Kohn B (2009) Use of C-reactive al., 2004; Petersen et al., 2004). On other context, bovine serum protein to predict outcome in dogs with systemic inflammatory amyloid A (SAA) is elevated more by acute rather than chronic response syndrome or sepsis. J. Vet. Emerg. Crit. Care. 19: inflammatory conditions. Its mammary Isoform (M-SAA3) is 450-458. secreted in milk of cows and ewes with mastitis (Eckersall et al., Godson DL, Baca-Estrada ME and Babiuk LA (1997) Applications of bovine 2001; Winter et al., 2003; Nielsen et al., 2004; Jacobsen et al., cytokines. In Horzinek MC, Schijns VECJ (eds): Cytokines in 2005). In experimental models demonstrated by Gronlund and Veterinary Medicine. Wallingford, axon, UK, CAB International, pp. 3-13. his co-workers in 2003 found out that both Hp and M-SAA3 were Hirvonen J, Hietarkopi S and SALONIEMI H (1997) Acute phase response synthesized in the infected gland, thus paving the way for their use in emergency slaughtered cows. Meat Sci. 3: 249-257. as biomarkers of this condition. It is suggested that APPs could be Holm JL, Rozanski EA, Freeman LM and Webster CRL (2004) C-reactive employed in the assessment of animal health and welfare and protein concentrations in canine acute pancreatitis. J. Vet. ante-mortem as an aid to meat inspection. Six fold increases in Emerg. Crit. Care. 14: 183-186. Hp concentration were found in dairy cows with infectious and Horadagoda A, Eckersall PD, Hodgson JC, Gibbs HA and Moon GM (1994) metabolic disease at slaughter compared to animals with minor Immediate responses in serum TNFa and acute phase protein lesions (Hirvonen et al., 1997), and 40-fold and 7-fold increases in concentrations to infection with Pasteurella haemolytica A1 in calves. Res. Vet. Sci. 57: 129-132. HP and SAA, respectively, were found in culled dairy cattle with

161 Veterinary Practitioner Vol. 20 No. 2 December 2019

Hori Y, Indou A, Yamaguchi S and Uechi M (2006) The time course of C- Nielsen L, Toft N, Eckersall PD, Mellor DJ and Morris JS (2007) Serum C- reactive protein in a dog suffering acute pancreatitis. J. Japan reactive protein concentration as an indicator of remission status Vet. Med. Assoc. 59: 619-622. in dogs with multicentric lymphoma. J. Vet. Intern. Med. 21: Jacobsen S, Niewold TA, Kornalijnslijper E, Toussaint MJM and Gruys E 1231-1236. (2005) Kinetics of local and systemic isoforms of serum amyloid Ohno K, Yokoyama Y, Nakashima K, Setoguchi A, Fujino Y and Tsujimoto H A in bovine mastitic milk. Vet. Immunol. Immunopathol. 104: 21- (2006) C-reactive protein concentration in canine idiopathic 31. polyarthritis. J. Vet. Med. Sci. 68: 1275-1279. Jain S, Gautam V and Naseem S (2011): Acute-phase proteins: As Pace L, Kreeger J, Bailey K, Turnquist S and Fales W (1993) Serum levels diagnostic tool. J. Pharm. Bioall. Sci. 1: 118-27. of tumor necrosis factor-á in calves experimentally infected Jergens AE, Schreiner CA, De Frank, Niyo Y, Ahrens FE, Eckersall PD, with Pasteurella haemolytica. Vet. Immunol. Immunopathol. 35: Benson TJ and Evans R (2003) A scoring index for disease 353-364. activity in canine inflammatory bowel disease. J. Vet. Intern. Petersen HH, Nielsen JP and Heegaard PM (2004) Application of acute Med. 17: 291-297. phase protein measurements in veterinary clinical chemistry. Kasimanickam RK, Kasimanickam VR, Olsen JR, Jeffress EJ, Moore DA Vet. Res. 35: 163-187. and Kastelic JP (2013) Associations among serum pro- and Planellas M, Bassols A, Siracusa C, Saco Y, Gimenez M, Pato R and anti-inflammatory cytokines, metabolic mediators, body condition, Pastor J (2009) Evaluation of serum haptoglobin and C-reactive and uterine disease in postpartum dairy cows. Reprod. Biol. protein in dogs with mammary tumors. Vet. Clin. Pathol. 38: Endocrinol. 11: 103. 348-352. Kjelgaard-Hansen M, Jensen AL, Houser GA, Jessen LR and Kristensen Pyorala S (2003) Indicators of inflammation in the diagnosis of mastitis. Vet. AT (2006) Use of serum C-reactive protein as an early marker Res. 34: 565-578. of inflammatory activity in canine type II immune-mediated Richards CD, Scamurra RW and Murtaugh MP (1995) Interleukin-6. In polyarthritis: case report. Acta. Vet. Scand. 48: 9. Myers MJ, Murtaugh MP (eds): Cytokines in Animal Health and Knapp A, Schrodl W, Grevel V and Oechtering G (2009) C-reactive protein Disease. New York, Marcel Dekker, pp.153-182. (CRP) serum-concentration in dogs with impaired post-operative Rose NW (2015) How to interpret Serum Amyloid A concentrations. Clin. wound healing. Tierarztl. Prax. Ausg. K. Kleintiere. Heimtiere. Pathol. 61: 130-137. 37: 21-27. Rush JE, Lee ND, Freeman LM and Brewer B (2006) C-reactive protein Larson MA, Weber A, Weber AT and McDonald TL (2005) Differential concentration in dogs with chronic valvular disease. J. Vet. expression and secretion of bovine serum amyloid A3 (SAA3) Intern. Med. 20: 635-639. by mammary epithelial cells stimulated with prolactin or Saunders AB, Smith BE, Fosgate GT, Suchodolski JS and Steiner JM (2009) lipopolysaccharide. Vet. Immunol. Immunopathol. 107: 255- Cardiac troponin I and C-reactive protein concentrations in dogs 264. with severe pulmonic stenosis before and after balloon Lofthouse, SA, Kajihara M, Nagahara S, Nash A, Barcham GJ, Sedgmen valvuloplasty. J. Vet. Cardiol. 11: 9-16. B, Brandon MR and Sano A (2002) Injectable silicone implants Scheerlinck JPY (2001) Genetic adjuvants for DNA as vaccine delivery vehicles. Vacc. 20: 1725-1732. vaccines. Vaccine. 19(17-19): 2647-2656. Malazdrewich C, Ames TR, Abrahamsen MS and Maheswaran SK Scheerlinck JY and Yen H (2005) Veterinary applications of cytokines. (2001) Pulmonary expression of tumor necrosis factor alpha, Vet. Immunol. Immunopathol. 108: 17-22. interleukin-1 beta, and interleukin-8 in the acute phase of bovine Sordillo LM, Snider M and Hughes HPA (1991) Pathological changes in pneumonic pasteurellosis. Vet. Pathol. 38: 297-310. bovine mammary glands following intramammary infusion of McGrotty YL, Arteaga A, Knottenbelt CM, Ramsey IK and Eckersall PD recombinant interleukin 2. J. Dairy Sci. 7: 4164- 4174. (2005) Haptoglobin concentrations in dogs undergoing trilostane Tecles F, Spiranelli E, Bonfanti U, Ceron JJ and Paltrineiri S (2005) Preliminary treatment for hyperadrenocorticism. Vet. Cl. Pathol. 34: 255- studies of serum acute-phase protein concentrations in 258. hematologic and neoplastic diseases of the dog. J. Vet. Intern. Merlo A, Rezencle BCG, Franchini ML, Monteiro PRG and Lucas SRR Med. 19: 865-870. (2008) Serum amyloid A is not a marker for relapse of multicentric Tourlomousis P, Eckersall PD, Waterston M and Buncic S (2004) A lymphoma in dogs. Vet. Cl. Pathol. 37: 79-85. comparison of acute phase protein measurements and meat Merlo A, Rezencle BCG, Franchini ML, Simoes DMN and Lucas SRR (2007) inspection findings in cattle. Foodborne Pathog. Dis. 1: 281- Serum C-reactive protein concentrations in dogs with multicentric 290. lymphoma undergoing chemotherapy. J. Am. Vet. Med. Assoc. Van Reeth K and Nauwynck H (2000) Proinflammatory cytokines and viral 230: 522-526. respiratory disease in pigs. Vet. Res. 31(2): 187-213. Mischke R, Waterson M and Eckersall PD (2007) Changes in C-Reactive Veiga APM, Price CA, de Oliveira ST, dos Santos AP, Campos R, Barbosa protein and haptoglobin in dogs with lymphatic neoplasia. Vet. PR and Gonzalez FHD (2008) Association of canine obesity J. 174: 188-192. with reduced serum levels of C-reactive protein. J. Vet. Diagn. Mitchell KD, Kruth SA, Wood RD and Jefferson B (2009) Serum acute Investig. 20: 224-228. phase protein concentrations in dogs with autoimmune hemolytic Weber A, Weber AT, McDonald TL and Larson MA (2006) Staphylococcus anaemia. J. Vet. Intern. Med. 23: 585-591. aureus lipotechoic acid induces differential expression of bovine Morsey M, Van Essel, Mori A, Popowych Y, Godson Y, Campos D and serum amyloid A3 (SAA3) by mammary epithelial cells: Babiuk L (1999) Cytokine profiles following interaction between Implications for early diagnosis of mastitis. Vet. Immunol. bovine alveolar macrophages and Pasteurella Immunopathol. 109: 79-83. haemolytica. Microb. Pathog. 26: 325-331 Winter P, Fuchs K, Walshe K and Colditz IG (2003) Serum amyloid A in the Murata H, Shimada N and Yoshioka M (2004) Current research on acute serum and milk of ewes with mastitis induced experimentally phase proteins in veterinary diagnosis: an overview. Vet. J. with Staphylococcus epidermidis. Vet. Rec.152: 558-562. 168: 28-40. Wood PR, Corner LA and Plackett P (1990a) Development of a simple, rapid Nielsen BH, Jacobsen S, Andersen PH, Niewold TA and Heegard PM in vitro cellular assay for bovine tuberculosis based on the (2004) Acute phase protein concentrations in serum and milk production of g-interferon. Res. Vet. Sci. 49: 46- 49. from healthy cows, cows with clinical mastitis and cows with Wood PR, Rothel JS, McWaters PG and Jones SL (1990b) Production and extramammary inflammatory conditions. Vet. Rec. 154: 361- characterization of monoclonal antibodies specific for bovine 365. g-interferon. Vet. Immunol. Immunopathol. 25: 37-46.

162 Veterinary Practitioner Vol. 20 No. 2 December 2019

HISTOPATHOLOGICAL STUDY OF SKIN OF BIRD SPONTANEOUSLY INFESTED BY THE RED MITE OF POULTRY, DERMANYSSUS GALLINAE

S. Bora*, Manoranjan Das1, Saidul Islam2, Shameem Ara Begum3 and Ranjeet Neog4 Department of Parasitology, College of Veterinary Science Assam Agricultural University, Khanapara, Guwahati - 781 022, Assam, India

ABSTRACT

The present study was carried out to study the histopathological changes in the skin of local chicken reared in free ranged system infested with the red mite of poultry, Dermanyssus gallinae. A total of 646 samples were screened for gross and histopathological changes, of which, 92 (14.24%) samples was found positive for D. gallinae infestation. Biopsy materials collected from infested skin were fixed in 10% formalin and routine histopathological sections were prepared using haematoxyline and eosin staining method. The histopathologic changes observed were infiltration of mononuclear cells, eosinophils, heterophils with oedema, haemorrhage, parakeratosis and hyperkeratosis in the dermal layer. The deepr layers were not found affected.

Key words: Dermanyssus gallinae, local chicken, histopathology, skin

Introduction the pathological alterations. Dermanyssus gallinae, the red mite, is one of the most important haematophagous ectoparasites of poultry and is Results and Discussion ubiquitous in distribution as an economically important pest The mites collected during the present study was throughout the globe (Shanta et al., 2006; Mungube et al., 2008 morphologically similar to Dermanyssus gallinae as described and Sparagano et al. 2009). A loss of £ 130 million annually by Sen and Fletcher (1962) and Soulsby (1982). Out of a total due to Dermanyssus infestation in poultry have been estimated 646 chicken examined, 92 (14.24%) birds were found infected by European Union’s egg industry. Though D. gallinae are with D. gallinae. Grossly, there were colonies of red mites reported to be specific for avians, increasing reports of attacks visible at the lesion site (Fig.1a). Infected skin was hyperaemic to non-avian host including man is on the rise. Apart from direct and nodules were found over the skin. Petechial haemorrhage affects as ectoparasite, its role in transmission of other was observed in certain areas of skin. Histopathologically, the diseases affecting both livestock and humans have been infested skin revealed destruction of the superficial layer of reported (Carlos et al., 2008). In view of the economic and epidermis at the biting site. Mild spongiosis were observed in zoonotic significance and the lack of information from this part superficial epidermal layer characterized by vacuolation along of the country, the present study was undertaken. with infiltration of eosinophils and heterophils. Heavy infiltration of mononuclear cells throughout the entire region of the dermis Materials and Methods was noticed (Fig.1b & Fig.1c). Haemorrrhages along with Collection and identification of mites congestion were also observed. The keratin layer was A total of 646 live chicken reared in free range system in imperfectly formed with retention of nuclei in the stratum and around Guwahati were examined for the presence of typical corneum indicating parakeratosis (Fig.1d) in certain areas of lesions due to Dermanyssus galiinae. Mites were collected the epidermis. However, the deeper layers of the skin were not from the infected lesions with a fine brush, and brought to the affected. Since D. gallinae is a non-burrowing mite and laboratory for morphological identification using the key of Sen interrupted feeder, hence the deeper layer was probably not and Fletcher (1962) and Soulsby (1982). affected. Mites may produce pruritus or allergic reactions through Gross pathology salivary proteins deposited during feeding. Lesions caused Gross pathological lesions due to the affection with D. by mites are pruritic, somewhat erythematous eruptions gallinae were recorded. composed of papules that may or may not be associated with Histopathologic studies a wheal. The hyper sensitive type of reaction observed during For histopathological studies, skin biopsies from the the present study has similarities with tick bite lesions in breast , thigh and leg region of the the chicken infested with D. mammal. Histopathological changes observed during the gallinae were collected and fixed in 10% formalin. These were present investigation were almost identical to the findings of processed and paraffin blocks were prepared following routine Hobbenaghi et al. (2012) and Steene et al. (2004). Heavy laboratory histopathological techniques. Sections of 5 -6 µm infiltration of mononuclear cells throughout the entire region of thickness were prepared and stained with Delafield’s dermis was observed in the present study. As opined by haematoxylin and eosin staining method (Luna, 1968). The Hobbenaghi et al. (2012), this might be due to subcutaneously stained sections were examined under microscope to record induced immune response because of the blood sucking

*Corresponding author, e-mail: [email protected], Present address: ICAR for NEH, Umiam, Meghalaya; 1e-mail: [email protected]; 2e-mail: [email protected]; 3e-mail:[email protected]; Present Address: Deptt. of Pathology; 4e-mail:[email protected]

163 Veterinary Practitioner Vol. 20 No. 2 December 2019

Fig. 1a: Skin lesions caused by red mite Fig.1b: Skin showing mononuclear cell infiltration in the dermis (H&E, X100)

Fig.1c: Skin showing mononuclear cell infiltration the dermis (H&E, Fig.1d: Skin showing parakertosis (H&E, X400) X400)

activity of the mite. Subcutaneous oedema and haemorrhage Forum. 3:205-208. were observed in the present study may also be attributed to Luna LG (1968) Manual of Histologic Staining Methods; of the Armed the increased vascular damage leading to its permeability. Forces Institute of Pathology 3rd ed. Mc. Graw Hill., New Mite biting induces proliferation of epidermal cells resulting in York. Retrieved from www.googlescholar.com dated 29/ hyperkeratosis. Present histopathological finding 05/2017. substantiates the previous findings of Shanta et al. (2006) Mungube, EO, Bauni SM, Tenhagen BA, Wamae LW, Nzioka SM, who recorded the development of hyperkeratosis and Muhammed L and Nginyi JM (2008) Prevalence of parasites of local scavenging chicken in a selected semi arid zone of parakeratosis in mite bite lesions in poultry. Eastern Kenya. Tropical Anim. Hlth. Prod. Bull. 40: 101- Acknowledgement 109. Sen SK and Fletcher TB(1962) Veterinary Entomology and Acarology Authors acknowledges the Dean, Faculty of Veterinary for India.(1st ed.) ICAR, New Delhi Science, Assam Agricultural University, Khanapara, Guwahati Shanta IS, Begum N, Anisuzzaman AS and Karim MJ (2006) Prevalence - 781 022, Assam, India for providing the necessary facilities to and clinico-pathological effects of ectoparasites in backyard carry out the present study. poultry. Bangl. J. Vet. Med. 4: 19-26. Soulsby EJL (1982) Helminths, Arthropods and Protozoa of References Domesticated Animals. 7th ed. Bailliere Tindall. pp. 809. Carlos JDL, Arkle S, Harrington D, David RG, Jonathan HG and Sparagano Sparagano O, Pavlicevic A and Murano T (2009) Prevalence and key OAE (2008) The poultry red mite, Dermanyssus gallinae as figures for poultry red mite Dermanyssus gallinae infections a potential carrier of vector-borne diseases. Annal. New in poultry farm system. Exp. Appl. Acarol. 48: 3-10. York Academy Sci. 1149: 255-258. Steen CJ, Carbonaro PA and Schwartz RA (2004) Arthropods in Hobbenaghi R, Tavassoli M, Alimehr M, Shokrpoor S and dermatology. J. Am. Acad. Dermatol. 50: 819-842. Ghorbanzadeghan M (2012) Histopathological study of the mite biting (Dermanyssus gallinae) in poultry skin. Vet. Res.

164 Veterinary Practitioner Vol. 20 No. 2 December 2019

PREVALENCE STUDY AND ANALYSIS OF POTENTIAL RISK FACTORS FOR CRYPTOSPORIDIUM SPP. INFECTION IN CATTLE CALVES OF JAMMU REGION

Alveena Ganai, Anish Yadav1, Rajesh Katoch and Rajesh Godara Division of Veterinary Parasitology, Faculty of Veterinary Sciences and Animal Husbandry Sher-e-Kashmir University of Agricultural Sciences and Technology of Jammu, R.S Pura-181 102, Jammu, India

Received on: 27.06.2019 ABSTRACT Accepted on: 21.10.2019

The objective of this study was to record prevalence of Cryptosporidium species in cattle calves of Jammu region. Examination of 614 faecal samples of cattle calves by using diethyl ether sedimentation technique (DEES) followed by modified Ziehl-Neelsen staining technique revealed an overall positivity of 144 animals (23.45%) for screening of Cryptosporidium spp. infection. As per district wise prevalence in Jammu region, significant highest prevalence of Cryptosporidium spp. was recorded in Samba (28.57%) followed by Udhampur (23.25%), Kathua (22.75%) and then least in Rajouri (18.18%). The highest prevalence of this infection was recorded in <1 month of age animals (43.24%) varied significantly (p<0.05) than other age group. Diarrhoeic animals revealed significantly (p<0.05) higher prevalence (29.51%) of Cryptosporidium infection. Highest prevalence of Cryptosporidium infection was recorded (34.65%) in winter months and lowest in summer season (8.55%). Cattle calves having mucus in the faeces showed significantly (p<0.05) higher prevalence (37.33%) of cryptosporidiosis than those having blood (11.76%). Male calves showed significantly (p<0.05) higher incidence of Cryptosporidium infection (46.34%; diarrhoeic, 30.61%; non-diarrhoeic) than female calves. The intensity of Cryptosporidium infection among positive samples was also measured based on the number of oocysts observed.

Key words: Cryptosporidium, cattle calves, Jammu, modified Ziehl-Neelsen technique

Introduction Materials and Methods In India, about 199.1 million of cattle and ranking first in Collection of faecal samples and study area the world in terms of cattle population. Over 65% population of Faecal samples of cattle calves of three age groups (<1 India is living in rural area wherein agriculture is the main month, 1-6 months, >6 months) were collected from four sources of livelihood (Gautam et al., 2007). More than 75% districts of Jammu region (Rajouri, Samba, Kathua and population of rural India is deprived of fertile soils and assured Udhampur) and minimum of fifty samples from each age group water for irrigation and dependent on livestock for per district were collected. At the time of faecal sample collection, supplementary income. The livestock sector plays a vital role data related to the age, sex of the animals and consistency of in country’s agricultural economy, contributing to about 30 % of faeces were recorded. To carry out the work the permission GDP of agriculture, allied sector and milk accounts for nearly was taken from Institutional Animal Ethical Committee of 67% of total value of livestock products in the GDP. SKUAST, Jammu. Cryptosporidium is a coccidian parasite occurs in different species of hosts and is known to infect more than 150 species Sample examination of animals belonging to mammalian, avian, reptiles, amphibian Faecal samples were collected and subjected to diethyl and fish (Fayer et al., 2008). Worldwide, cattle are commonly ether sedimentation technique (DEES) followed by modified infected with Cryptosporidium species infection and is primarily Ziehl-Neelsen staining technique (Henricksen and Pohlenz, apatent infection in young calves till they attain immunological 1981) for screening of Cryptosporidium spp. infection maturity which is invariably associated with neonatal diarrhoea Diethyl ether sedimentation technique (DESS) technique with higher morbidity than mortality, thus resulting into weight About 5 gm of faeces was mixed thoroughly with an equal loss and delayed or stunted growth reflecting substantial volume of phosphate buffer saline (PBS) solution (w/v) and economic losses. In India, cryptosporidiosis was reported for strained first through a wire mesh of 400 µ pore size and then the first time in faeces of cattle by Nooruddin and Sarma (1987) of 200 µ pore size. The faecal sample was then mixed with an and in human night soil by Mathan et al. (1985). equal volume of diethyl ether in a 15 ml centrifuge tube and Cryptosporidium has also gained attention of scientific vigorously shaken. The sample was centrifuged at 500 x g for community as an emerging zoonoses due to its public health 10 minutes. The fat plug and other fat soluble materials in the significance. Considering the importance of livestock sector upper organic/aromatic layer were discarded. The lower and the various economic losses, growth and poor aqueous phase was taken in another 15 ml centrifuge tube, management in dairy farms in the country, the present mixed with equal volume of PBS and centrifuged at 1000 x g for investigation was undertaken to note the prevalence of 15 minutes. The sediment was taken and stained by mZN Cryptosporidium spp. infection in cattle calves in the districts technique. of Jammu region. Hence, the present communication reports the prevalence and risk factors associated with Examination of stained faecal smear after diethyl ether sedi- Cryptosporidium spp. in cattle calves of Jammu region. mentation technique (DESS) A faecal smear was made from the sediment taken on 1Corresponding author email: [email protected]

165 Veterinary Practitioner Vol. 20 No. 2 December 2019

calves with relation to the prevalence study was analyzed through Chi-square test. A P value <0.05 was required for significance. Odd ratio and 95% confidence level (C.I) were calculated using each group as reference.

Results and Discussion In the current study, total of 614 faecal samples were collected from cattle calves of Jammu region out of which total 144 animals (23.45%) were found positive for Cryptosporidium spp. infection. The Cryptosporidium oocysts stain dark pinkish (Modified Ziehl Neelsen staining) and 4-7 µm in diameter and have the crescenteric forms of the sporozoite (Fig. 1 and Fig. 2). Among animals of four districts of Jammu region, the prevalence of Cryptosporidium infection in Udhampur (23.25%) varied significantly (p<0.05) than in Samba (28.57%), followed by Kathua (22.75%) and Rajouri (18.18%) districts. Young Fig. 1: Cryptosporidium oocyst in faeces using modified Ziehl - animals of <1 month (43.24%) of age varied significantly Neelsen staining x 400 (p<0.05) with other age groups (<1month, 1-6 months and >6 months) followed by 1-6 months (23.58%) and lowest prevalence was recorded in >6 months of age animals (12.54%). Regarding faecal consistency, the prevalence was significantly (χ2- value, 10.47, p<0.05) higher in diarrhoeic animals (29.51%) than non diarrhoeic animals (18.09%). Male animals showed significantly (p<0.05) higher incidence of Cryptosporidium infection (46.34%; diarrhoeic, 30.61%; non- diarrhoeic) as compared to females (22.81%; diarrhoeic, 12.71%; non-diarrhoeic). The animals with Cryptosporidium infection having mucus in the faeces showed significantly (p<0.05) higher prevalence (37.33%) than those having no mucus and blood (17.79% ) whereas, lowest prevalence (11.76%) was recorded in faeces having blood. Seasonal analysis of data suggested that highest prevalence of Cryptosporidium infection was recorded in winter (34.65%) season and it varied significantly followed by post monsoon Fig. 2: Cryptosporidium oocyst in faeces using modified Ziehl - (26.57%), monsoon (22.06%) and least recorded in summer Neelsen staining x 1000 (8.55%) season. The same has been shown in Table. 1. Statistical analysis also revealed that among districts of clean grease free microscopic slide. The smear was air dried Jammu region, Cryptosporidium spp. infection was 2.210 times and stained by modified Ziehl-Neelsen technique (mZN) higher (95 % C.I: 1.017-4.821, χ2- 4.033) in cattle calves of (Henricksen and Pohlenz, 1981). The air dried smear was Udhampur district than others. The present study recorded fixed with methanol for 5 minutes, air dried and then the smear that Cryptosporidium spp. infection in cattle calves of<1 month was transiently fixed over flame and kept on staining rack. age groups was 8.462 times higher (95 % C.I: 3.992-18.120) Concentrated carbol fuchsin was poured over the smear and than > 6 month age group animals. Similarly, the likelihood of kept for 30-40 minutes. The slide was washed thoroughly under Cryptosporidium infection in cattle calves with diarrhoeic faeces running tap water for 5 minutes, decolourized using 10% was 1.895 times (95 % C.I: 1.275-2.818) higher than non sulphuric acid for 15-30 seconds and then washed in water. diarrhoeic faeces. The chances of occurrence of The smear was counterstained with 5% malachite green for 5 Cryptosporidium spp. in cattle calves in winter is 5.67 times minutes. The slide was again washed in running tap water for higher than summer season (OR-2.855-11.450). 5 minutes. After drying, examined using the high-power, dry The intensity of Cryptosporidium spp. oocysts present in objective (40 fold magnification) and confirmed the morphology the faecal smear (stained by mZN technique) of cattle calves using oil immersion. was also assessed in Jammu region. Among all the districts, Intensity of infection was measured by counting the maximum number of animals showed 1+ oocyst intensity. In number of Cryptosporidium oocysts in the faeces among the present study, it was observed that 57.81% animals of <1 positive samples (by DESS followed by mZN staining) and month of age were having highest (3+) oocyst intensity, whereas was measured based on the number of oocysts observed 47.82% and 29.41% animals of 1-6 month age and >6 month under x 40 objective lens (OIE, 2008) i.e. 1+; less than 5 oocysts age animals showed maximum intensity, respectively. per slide, 2 +; 1 to 10 oocysts per field of view and 3 +; 11 or Diarrhoeic (50.58%) animals had high oocyts intensity (3+) more oocysts per field of view. than non diarrhoeic animals of Jammu region. Higher number Statistical analysis of animals (Male; 48.52%, Female; 46.05%) showed 2+ oocyst The association of Cryptosporidium infection in cattle intensity whereas 27.94% of male and 25.0% of female showed

166 Veterinary Practitioner Vol. 20 No. 2 December 2019

Table 1: Prevalence of Cryptosporidium spp. in cattle calves of bovine calves from Izatnagar, UP. In the same manner a Jammu region prevalence rate of 11-23 per cent was recorded in the Eastern Total number of animals part of India by Chattopadhyay et al. (2000) and Das et al. Parameters Examined Positive % Positive (2004b). Similarly Kumar et al. (2004) reported 25% infection District Rajouri 121 22 18.18% from south India. PCR based diagnosis has reported higher Samba 154 44 28.57% prevalence of Cryptosporidium spp. Paul et al. (2008) reported Kathua 167 38 22.75% 30.20 % infection from neonatal bovine calves across the Udhampur 172 40 23.25% different regions of India. Singla et al. (2013) from five organized Age < 1month 148 64 43.24% dairy farms of Ludhiana (Punjab) reported Cryptosporidium 1-6 month 195 46 23.58% positivity in 23.52% and 12.50%, respectively in buffalo and >6 month 271 34 12.54% Faecal consistency Diarrhoeic 288 85 29.51% cattle calves by lateral flow immunoassay, whereas by modified Non diarrhoeic 326 59 18.09% Ziehl-Neelsen stain, it was 17.65% and 6.25%, respectively. Sex Male 180 68 37.77% On the other hand Bhat et al. (2014) from Ludhiana district Female 434 76 17.51% (Punjab) reported 25.0% and 47.0% positivity for the oocyst of Season Summer 152 13 8.55% Cryptosporidium spp. by direct faecal smear technique and Monsoon 145 32 22.06% nested PCR, respectively. In contrary, Paul et al. (2008) detected Post-monsoon 143 38 26.57% only 12.5 per cent infection in 6-24 month old bovines in the Winter 176 61 34.65%

Fig. 3: Seasonal intensity of Cryptosporidium oocysts of cattle calves in Jammu region highest oocyts intensity (3+). Animals having mucus (57.14%) state of Andhra Pradesh by PCR assay, which was due to in the faeces showed highest oocysts intensity (3+) than having availability of less number of samples for examination. Further blood in the faeces. On seasonal analysis, it was found that Khan et al. (2010) reported lower prevalence of the maximum oocyst intensity (3+) of cattle cryptosporidiosis Cryptosporidium in cattle calves of Kolkata as 11.7% through was highest in winter season (52.45%) followed by monsoon nested PCR, whereas higher prevalence (39.65%) of (39.06%), post monsoon (31.57%), while it was lowest in Cryptosporidium spp. was reported using nested PCR of 18S summer season (15.38%) as shown in Fig. 3. SSU rRNA from South India by Venu et al. (2012). The study In India, proper epidemological data are lacking on revealed that the infection was highest in Puducherry (86.67%) zoonotic parasitic diseases, and newer diseases are emerging and lowest in Kerala (17.65%). The prevalence of 48.5% in the current scenario (Das et al., 2014). During the last 20 Cryptosporidium infection in cattle calves examined from dairy years, 70% of the emerging diseases have been found to be farms of Jammu region in the present study varies from earlier zoonotic in nature and about 300 diseases are common to study carried by Yadav (2010) from Jammu district only. In the man and animals (Thapliyal, 1999). previous study, although an overall prevalence was 26.52%, The rate of prevalence of infection in cattle calves (23.45%) but it was 48.39% in organized farms as compared to 21.31% of Jammu region as recorded in the present study agreed with in unorganized farms or individual animal units. It has also many other workers in India who surveyed the Cryptosporidium been observed that overall prevalence of cryptosporidiosis can infection adopting modified acid fast staining of faecal smears, vary remarkably depending on the age of calves (Santin et al., Dubey et al. (1992) recorded 17.7 per cent infection whereas, 2008) and the detection method used because molecular Jeyabal and Ray (2005) recorded 35.5 per cent infection in methods are more sensitive and accurate than microscopic 167 Veterinary Practitioner Vol. 20 No. 2 December 2019

methods. observed in few calves in present study. The results of the present study revealed almost similar This data suggests that the prevalence of infection of prevalence of Cryptosporidium spp. infection found in four Cryptosporidium is not only related to the presence of animals districts (Samba, Udhampur, Kathua and Rajouri) of Jammu at risk but is also related to the presence of suitable climatic region. The difference can be attributed to demographic condition for viability and spread of the parasite. The present location of the districts. But among animals of all four districts, study revealed that the prevalence of Cryptosporidium infection slightly higher prevalence was observed in Samba district which was found to be highest in winter (34.65%) followed by post is located on plain irrigated belt with less area for open grazing monsoon (26.57%), monsoon (22.06%) and summer (8.55%). for animals. Therefore, animals are mostly kept in sheds which In winter, the temperature in study area is suitable for viability results in more close contact with more chances of spread of and survival of Cryptosporidium oocysts. Similar findings were infection. Kathua district shares the border with Samba and recorded by many workers (El-Khodrey and Osman, 2008; almost similar prevalence was found in this area. On contrary, Hingole et al., 2017). Further, it was observed that animals in Udhampur and Rajouri districts blocks are located mainly on organized farms were overcrowded in winter months, resulting non irrigated foot hills i.e. kandi area where farming is rain in easy availability of infective Cryptosporidium oocysts to dependent and animals are kept on open grazing which reduce susceptible calves which were in accordance with the study of chances of direct contact between animals. It has been already many workers (Quigley et al., 1994 and Mohammed et al., established that calves kept on pasture throughout the year 1999). The earlier study of Jammu district by Yadav (2010) had lower probability of Cryptosporidium infection than kept in reported that in organized farms like present study highest cow shed (Kvac et al., 2006). Also, similar block wise prevalence was in winter season whereas in unorganized farms prevalence of Cryptoporidium spp. infection was recorded by it was in monsoon season. Yadav (2010) with difference was estimated on the basis of The number of Cryptosporidium spp. oocysts present in demographic locations of Jammu region. the faecal smear (stained by mZN technique) of cattle calves The result of age wise distribution in the current study was assessed in Jammu region. In the present study, it was demonstrated that the majority of Cryptosporidium spp. observed that more number of male cattle calves with mucus infection was highest in cattle calves less than one month of in there faeces especially of <1 month of age were having age group with diarrhoeic faeces showed very high prevalence highest (3+) oocyst intensity in acid fast smear particularly in of Cryptosporidium infection. The constant association of winter season demonstrates that these animals are important diarrhoea and presence of oocyst of Cryptosporidium in the from an epidemiological point of view and play an important faeces has been recorded by other workers (Singh et al., 2006, source of contamination to water and soil of the area, which Yadav et al., 2012 and Bhat et al., 2014). Occurrence of has resulted in several water borne outbreaks of Cryptosporidium in clinically asymptomatic animals indicated cryptosporidiosis in man and animals (Fayer et al., 2000). The that the particular age group of animals might be reservoir for results are also in accordance with observation of Singh et al. the parasites. The present observation also supports the (2006) and Del Coco et al. (2008). earlier finding of Kumar et al. (2004), Bhat et al. (2014), Hingole Thus, the study concluded that the young cattle calves (<1 et al. (2017) from India. Similarly, Villacorta et al. (1991) recorded month) with mucus in there diarrhoeic faeces are more prevalence of 93.0% in 3-6 days old calves selected randomly susceptible with high prevalence and intensity to and examined twice weekly for one month. Abnormalities in Cryptosporidium spp. infection in Jammu region. Therefore, it the barrier properties of the intestinal epithelium mediated by is recommended that the daily routine diagnostic technique intracellular junctional complexes, contribute to mZN staining for diagnosis of causative agents for diarrhoea Cryptosporidium diarrhoea (Buret et al., 2003). in cattle calves of Jammu region is utmost required. In the present study, the prevalence of Cryptosporidium with the sex of the host showed higher infection in male calves Acknowledgments which are in accordance with the findings of Paul et al. (2008). The authors are grateful to Sher-e-Kashmir University of In India, the male calves are generally neglected as present Agricultural Sciences and Technology, Jammu, India for the day agriculture has become more mechanized, so males are encouragement. We are also grateful to the farmers who not used for draught purpose. Further, due to religious cooperated in conduct of the trial at their farms. sentiments their slaughter is prohibited in many states. All Reference these reasons predispose male bovine calves to poor feeding Bhat SA, Dixit M, Juyal, PD and Singh NK (2014) Comparison of nested and management, which in turn lowers the immunity and PCR and microscopy for the detection of cryptosporidiosis predispose them to various pathogens of biological origin. in bovine calves. J. Parasit. Dis. 38(1): 101-5. Association of mucus with Cryptosporidium infection in Buret AG, Chin AC and Scott KGE (2003) Infection of human and cattle calves of Jammu region recorded in the present study bovine epithelial cells with Cryptosporidium andersoni has also been observed by Del Coco et al. (2008) who reported induces apoptosis and disrupts tight junction ZO-I: effects 37.5% of diarrhoeic faeces without blood were positive, of epidermal growth factor. Int. J. Parasitol. 33(12): 1363- 1371. showing presence of mucus of 83.3% and 66.7% of samples Chattopadhyay UK, Chowdhury D, Dasgupta C and Pramanik AK (2000) with mucus showed an average of 10 oocyst/field. The co- Prevalence of cryptosporidiosis in man and animals in and existence of C. parvum, rota virus, corona virus and around Calcutta. J. Vet. Parasitol. 14: 167-168. Salomonella in calves is already on records (De La Fuente, Das D, Islam S, Bhattacharjee H, Deka A, Yambem D, Tahiliani PS, Deka 1999) and these factors may also be responsible for P, Bhattacharyya P, Deka S, DasK, Bharali G, Deka A and association of blood and Cryptosporidium infection as Paul R (2014). Parasitic diseases of zoonotic importance in 168 Veterinary Practitioner Vol. 20 No. 2 December 2019

humans of northeast India, with special reference to ocular Mathan MM,Venkatesan S, George R, Mathew M and Mathan VI (1985) involvement. Eye Brain. 6: 1-8. Cryptosporidium and diarrhoea in southern Indian children. Das G, Sarkar S, Das P, Sheikh G N and Sarkar S (2004b) Prevalence Lancet, 2(8465): 1172-1175. of Cryptosporidium infection in cattle. J. Vet. Pub. Hlth. 2: Mohammed HO, Wade SE and Schaaf S (1999) Risk factors associated 15-17. with Cryptosporidium parvum infection in dairy cattle in south De La Fuente R, Luzón M, Ruiz-Santa-Quiteria JA, Garc´ýa A, Cid D, eastern New York State. Vet. Parasitol. 83 (1): 1-13. Orden JA, Garc´ýa S, Sanz R and Gómez-Bautista M (1999) Nooruddin M and Sarma DK (1987) Role of Cryptosporidium in calf Cryptosporidium and concurrent infections with other major diarrhoea: In annual report Livestock Advisor. 12: 49. enteropathogens in 1-30-day-old diarrheic dairy calves in Paul S, Chandra D, Ray DD, Tewari AK, Rao JR, Banerjee PS, Baidya central Spain. Vet Parasitol. 80(3): 179-185. S and Raina OK (2008) Prevalence and molecular Del Coco VF, Cordoba MA and Basualdo JA (2008) Cryptosporidium characterization of bovine Cryptosporidium isolates in India. infection in calves from a rural area of Buenos Aires, Vet Parasitol. 153(3-4): 143-146. Argentina. Vet. Parasitol. 158(1-2): 31-35. Quigley JD, Martin KR, Bemis DA, Potgiete LND, Reinemeyer CR, Dubey JP, Fayer R and Rao JR (1992) Cryptosporidial oocysts in Rohrbach BW, Dowlen HH and Lamar KC (1994) Effects of faeces of water buffalo and zebu calves in India. J. Vet. housing and colostrums feeding on the prevalence of Parasitol. 6: 55-56 selected infectious organisms in feces of Jersey calves. J. El- Khodery SA and Osman SA (2008) Cryptosporidiosis in buffalo Dairy Sci. 77(10): 3124-3131. calves (Bubalus bubali): Prevalence and potential risk Santin M, Trout JM and Fayer R (2008) A longitudinal study of factors. Trop. Anim. Health. Pro. 40(6): 419-426. cryptosporidiosis in dairy cattle from birth to 2 years of age. Fayer R, Santin M and Trout JM (2008) Cryptosporidium ryanae n. sp. Vet Parasitol. 155(1-2): 15-23. (Apicomplexa: Cryptosporidiidae) in cattle (Bos taurus). Vet. Singh BB, Sharma R, Kumar H, Banga HS, Aulakh RS, Gill JPS and Parasitol. 156(3-4): 191-198. Sharma JK (2006) Prevalence of Cryptosporidium parvum Fayer R, Trout JM, Graczyk TD and Lewis E J (2000) Prevalence of infection in Punjab and its association with diarrhoea in Cryptosporidium, Giardia and Eimeria infections in post- neonatal dairy calves. Vet. Parasitol. 140(1-2): 162-165. weaned and adult cattle on three Maryland farms. Vet Singla L, Gupta MP, Singh H, Singh ST, Kaur P and Juyal PD (2013) Parasitol. 93: 103-112. Antigen based diagnosis of Cryptosporidium parvum Gautam US, Paliwal DK and Naberia S (2007) Improvement in livelihood infection in faeces of cattle and buffalo calves. Ind. J. Ani security for Small and marginal farmers through front line Sci. 83 : 37,39. demonstrations on oilseed and pulse crops in Central India. Thapliyal DC (1999) In: Diseases of Animals Transmissible to Man. Indian Res. J. Ext. Edu. 7(1): 1-5. International Book Distributing Co. Lucknow, India, pp. 123. Henricksen SA and Pohlenz JFL (1981) Staining of cryptosporidia by a Venu R, Latha BR, Basith AS, Raj DG, Sreekumar C and Raman M modified Ziehl-Neelsen technique. Acta Vet. Scand. 22(3- (2012) Molecular prevalence of Cryptosporidium spp. in 4): 594. dairy calves in southern states of India. Vet. Parasitol. 188(1- Hingole AC, Gudewar JG, Pednekar RP and Gatne ML (2017) 2): 19-24. Prevalence and molecular characterization of Villacorta I, Ares-Mazas E and Lorenzo MJ (1991) Cryptosporidium Cryptosporidium species in cattle and buffalo calves in parvum in cattle, sheep and pigs in Galicia (N.W. Spain). J. Mumbai region of India. J. Parasit. Dis. 41(1): 131-136. Vet. Parasitol. 38(2-3): 249-52. Jeyabal L and Ray DD (2005) Cryptosporidial infection in cattle and Yadav A (2010) Epidemiological pattern and zoonotic potential of bovine buffaloes. J. Vet. Parasitol. 19(2): 165-166. cryptosporidiosis in Jammu district. Ph.D. Thesis. Sher-e- Khan S M, Debnath C, Pramanik AK, Xio L, Nozaki T and Ganguly S Kashmir university of Agricultural Sciences and Technology, (2010) Molecular characterization and assessment of Jammu, India. zoonotic transmission of Cryptosporidium from dairy cattle Yadav A, Katoch R, Katoch M, Agarwal R, Khajuria JK, Godara R and in West Bengal, India. J. Vet. Parasitol. 171(1-2): 41-47. Kalha R (2012) Cross- sectional study and analysis of Kumar D, Sreekrishnan R and Das SS (2004) Cryptosporidiosis in potential risk factors for Cryptosporidium spp. infection in man and animals in Pondicherry. Indian J. Anim. Sci. 74(1): Buffalo calves in Jammu. Vet. Pract. 13(2): 278-281. 261-263. Kváè Martin, KM and Vítovec J (2006) Age-related and housing- dependence of Cryptosporidium infection of calves from dairy and beef herds in South Bohemia, Czech Republic. Vet. Parasitol. 137(3-4): 202-209.

169 Veterinary Practitioner Vol. 20 No. 2 December 2019

HUMAN PARASITISATION WITH NYMPHAL DERMACENTOR AURATUS SUPINO, 1897 (ACARI: IXODOIIDEA: IXODIDAE)

Saidul Islam1, Prabhat Chandra Sarmah2 and Kanta Bhattacharjee3 Department of Parasitology, College of Veterinary Science Assam Agricultural University, Khanapara, Guwahati- 781 022, Assam, India

Received on: 29.09.2019 ABSTRACT Accepted on: 03.11.2019

Human parasitisation with nymphal tick and its morhphology has been described. First author accidentally acquired with three nymphal tick infestation from wilderness. Nymphs were attached in hand and both the arm pits leading to intense itching, oedematous swelling and pinkish skin discolouration at the site of attachment. On sixth day of infestation there was mild pyrexia, the differential leukocytic count showed polymorphs 68%, lymphocytes 27%, monocytes 2% and eosinophils 3%. Though the conditions were ameliorated after steroid therapy, yet, the site of attachment was indurated for 8 months which gradually resolved. A nymph replete with blood meal was put in a desiccator with sufficient humidity at room temperature of 170C for moulting that transformed into adult female in 43 days measuring 5.0 X 5.5 mm in size. Detail morphological study confirmed the species as Dermacentor auratus Supino, 1897. Significance of human tick parasitisation has been reviewed and warranted for transmission of possible vector borne pathogens.

Key words: Dermacentor auratus, nymph, human, India

Introduction Result and Discussion Ticks form a major group of ectoparasites of animals, Tick species and morphology birds and reptiles to cause different types of direct injuries The partially fed nymphs were brown coloured measuring and transmit infectious diseases. Human parasitisation 2.0 X 2.5 mm in size with deep cervical groove, nearly circular by tick, although not common as compared to the animals, small scutum broadest in the middle and 3/3 dentition in the has been recorded in different parts of the world (Wassef hypostome. and Hoogstraal, 1984; Kolonin, 2009). This Engorged nymph after dropping off the host transformed communication describes human infestation with a into adult female (Fig. 1) in 43 days and measured 5.0 X 5.5 species of tick identified to be the nymphal stages of mm in size. The tick soon after moulting was uniformly deep Dermacentor auratus Supino, 1897 which attacked the red in colour and it gradually changed to a brownish red base. present first author during a visit to the Nameri National Microscopic examination revealed presence of short rostrum, Park, Assam for routine health check-up of captive white ornamentation (on the dorsum of rectangular basis elephants in 2009. capitulum, semi circular scutum, legs and triangular spiracles), roughly circular brownish porose areas and 3/3 hypostomal Materials and Methods dentition with 14 rows of denticles (Fig. 2). The scutum During a routine regular health check up of camp possessed numerous brownish punctuations of varying size, elephants of Nameri National Park, (between 27º 00’ 36” the finer ones being more abundant in the scapular region 0 N latitude and 92 47’ 24” E longitude, covering an area and the broader circular ones on the middle and posterior of 200 sq. km) Assam, India in the month of November, region. A dark cleft without ornamentation ran down the midline 2009, 3 nymphal ticks got attached to the body of the first of the scutum with a lateral wavy streak on either side of the author. One of the three ticks was found attached to the median (Fig. 3). Spiracle (Fig. 4) was distinct and all the four skin between the thumb and forefinger of the left hand pairs of legs (Fig. 5, Fig. 6, Fig. 7. & Fig. 8) had characteristic and the other two each in the left and right arm pits. features. Eyes were lateral to the anterior scutum at the level of Though the ticks on the hand and right arm pit were Coxae II, genital opening ventrally between Coxae II with a long th removed on the 4 day of attachment, the third tick genital groove widely divergent at the level of the anus which parasitizing in the left arm pit escaped detection and could was surrounded by the anal groove posteriorly at the level of th be recovered as engorged one, after dropping off on 6 triangular spiracles. Coxa IV was proportionally larger than day of attachment. The skin conditions along with clinical coxae I to III and provided with 2 well separated spurs in each illness experienced as a result of tick attachment were of them. Tarsus I had wavy dorsal border while ventral surface noted. All the ticks were examined grossly and the of Tarsi I to IV possessed 3 spurs, the proximal one of tarsus IV engorged one kept in a desiccator with sufficient humidity being bifid. Posterior border of the tick was provided with 11 0 and at room temperature of 17 C for moulting and brownish festoons without ornamentation. The female tick was morphological study thereafter as per available keys morphologically indistinguishable from Dermacentor auratus, (Yamaguti et al.,1971; Soulsby, 1982). Supino 1897.

1Corresponding author: [email protected]; 2Professor and Head (Retd.), Department of Parasitology, CVSc, AAU, Khanapara, Guwahati -781 022, e-mail: [email protected]; 3Assistant Professor, Department of Parasitology, CVSc, AAU, Khanapara, Guwahati – 781 022, e-mail: [email protected]

170 Veterinary Practitioner Vol. 20 No. 2 December 2019

Fig.2: Hypostome of D. auratus Supino, 1897 showing dentitions Fig.1: An engorged female Dermacentor auratus Supino, 1897 recovered from human body

Fig.3: Porose area, scutum with cleft and punctuations Fig.4: Spiracle of a female D. auratus

Fig.5: One of the first pair of leg Fig.6: One of the second pair of leg

171 Veterinary Practitioner Vol. 20 No. 2 December 2019

Fig.7: One of the third pair of leg Fig.8: One of the fourth pair of leg

Fig.9: Site of attachment of the nymph on left hand (inset) Fig.10: Oedematous swelling at the site of attachment on left hand (inset) compared with non-infested right hand.

Fig. 11: Pinkish discolouration under the right arm pit after removal of Fig.12: Discolouration of the left arm pit after the nymph was replete the nymph with blood feeding 172 Veterinary Practitioner Vol. 20 No. 2 December 2019

Host reaction The study reveals that accidental infestation with nymphal There was neither any visible reaction nor any irritation felt stage of tick in wildlife veterinarians may be a nuisance and within 24 hours of attachment of the nymphal ticks which even serious health risk considering their potential role as disease evaded the usual sanitation measures taken by the host. vector that necessitates measures to adopt unfailing personal However, after 24 hours, there was mild irritation at the site of protection. attachment. The intensity of pruritus and itching gradually increased. On 4th day of attachment, when the nymphal stages Acknowledgements were removed from the left hand (Fig. 9) and the right arm pit, Authors express their kind acknowledgements to the the surrounding area developed oedematous swelling (Fig. Divisional Forest Officer, Nameri National Park, Sonitpur District, 10) with pinkish coloration (Fig. 11) and continuous itching. On Assam, India and the Dean, Faculty of Veterinary Science, 6th day when the nymphal stage on the left arm pit (Fig. 12) was Assam Agricultural University, Khanapara, Guwahati - 781 022 replete, reaction and colouration of skin was found similar to for the facilities to carry out the present study. the other attachment sites. At this stage, with mild pyrexia, the References differential leukocytic count of the subject revealed polymorphs Eddussuriya, Bandu DP and Weilgama DJ (2003) Case reports: 68%, lymphocytes 27%, monocytes 2% and eosinophils 3%. Intraaural tick infestations in humans in Srilanka. Trans. R. The pruritus, itching and pinkish colouration of skin persisted Soc. Trop. Med. Hyg. 97: 412-413. for another 8 weeks, after which these gradually subsided with Ghosh S, Bansal GC, Gupta SC, Ray D, Khan MQ, Ishad H, antiallergic oral medications. However, all the attachment sites Sahidzzuwan SU and Ahmed JS (2007) Status of tick remained indurated for about 8 months and resolved gradually distribution in Bangladesh, India and Pakistan. Parasitol thereafter without any apparent tick transmitted illness. Res. 101: 207-216. Hoogstraal H and Wassef HY (1985) Dermacentor (Indocentor) Dermacentor auratus has been recorded from India and auratus (Acari: Ixodoiidea: Ixodidae): Hosts, Distribution and neighbouring countries like SriLanka, Nepal, Bangladesh, Medical importance in tropical Asia. J. Med. Entomol. 22: Myanmar and China etc. (Ghosh et al., 2007; Kolonin, 2009). It 170-178. has also been recorded from Assam in India (Miranpuri et al., Kirwan EO’G (1935) A tick on the upper eyelid (Dermacentor auratus 1975; Lahkar, 1991). Distribution of this species apparently nymph). Br. J. Ophthalmol. 19: 659-661. centres Indian sub-region where the wild pigs (Sus scrofa) is Kolonin GV (2009) Fauna of Ixodid Ticks of the World (Acari, Ixodidae). the major host for adult ticks which also infest domestic pig, http://www.kolonin.org. bear, rhinoceros, deer and possibly python (Hoogstraal and Lahkar BC (1991) Studies on Ixodid ticks with special reference to Boophilus microplus (Canestrini, 1887). Thesis submitted Wassef, 1985). The immature stages generally feed on to Assam Agricultural University, Khanapara, Guwahati- 781 animals other than wild pigs and also have been reported 022, India, pp. 204. attacking man in India (Kirwan, 1935) and SriLanka Miranpuri GS, Bindra OS and Prasad V (1975) Tick fauna of North- (Eddussuriya and Weilgama, 2003) besides being proved as western India (Acari: Metastigmata). Int. J. Acarol. 1: 31- an efficient vector of Kyasanur forest disease virus in Southern 54. India (Pattnaik, 2006; Kolonin, 2009). Nuttall GHF, Cooper WF, Arthur DR, Warburton C and Robinson LE The present report adds to the list of cases of human (1960) Ticks: a monograph of the Ixodoiidea. Vol. 2, Part 2, pp. 237. parasitisation with D. auratus published elsewhere (Kirwan, Pattnaik P (2006) Kyasanur Forest Disease: an epidemiological view 1935; Eddussuriya and Weilgama, 2003). Host reaction to the in India. Rev. Med. Virol. 16:151-165. nymphal tick bite recorded in the present communication also Soulsby EJL (1982) Helminths, Arthropods and Protozoa of found to be of similar nature as reported by Eddussuriya and Domesticated Animals. 7th ed. ELBS and Baillie Tindal, London. Weilgama (2003) and Hoogstraal and Wassef (1985). Wassef HY and Hoogstraal H (1984) Dermacentor (Indocentor) auratus Morphological description of the female D. auratus (Acari: Ixodoiidea: Ixodidae): Identity of male and female. J. recorded in the present study is in agreement with those Med. Entomol. 21: 169-175 reported earlier by Nuttall et al. (1960), Wassef and Hoogstraal Yamaguti N, Tipon VJ, Keegan HL and Toshioka S (1971) Ticks of Japan, Korea and the Ryukyu Islands. Brigham Young Univ. (1984) and Kolonin (2009). Sci. Bull., Biological Series, 24: 226.

173 Veterinary Practitioner Vol. 20 No. 2 December 2019

FIRST REPORT OF DICHEILONEMA CICONIAE (SCHRANK, 1788) OF A FREE- RANGED BLACK STORK (CICONIA NIGRA) FROM INDIA

Saidul Islam, Sorang Tadap1, Jahan Ahmed2 and Bandanpreet Kour Raisim Department of Parasitology, College of Veterinary Science Assam Agricultural University (AAU), Khanapara, Guwahati-781 022, Assam, India

Received on: 30.09.2019 ABSTRACT Accepted on: 09.11.2019

During post-mortem examination of a free-ranged black stork (Ciconia nigra) at the Biological Park, Itanagar, Arunachal Pradesh, India, spirurid nematodes were recovered from the air sac which were identified as female Dicheilonema ciconiae (Schrank, 1788). Morphological characters have been described and documented. Authors claim this is the first report of occurrence of D. ciconiae from India, outside the European territory already reported elsewhere.

Key words: Dicheilonema ciconiae, Black stork, Ciconianigra, Arunachal Pradesh

Introduction parasite of C. nigra from the Zoological Gardens, Kolkata, India. Storks, spoonbills and ibises are large birds of wetlands Recently, Syrota et al. (2016) has reported the occurrence of that belong to the family Ciconiidae which has two tribes, e.g. Dicheilonema ciconiae (Schrank, 1788), a spirurid parasite Mycteriini and Ciconiini. The latter contains 4 genera of which from the air sacs of C. nigra at Kyiv Zoological Park, Ukraine. the genus Ciconia has 7 distinct species e.g. C. nigra, C. We encountered a chance case wherein nematode parasites abdimii, C. episcopus, C. stormi, C. maguari, C. ciconia and C. could be recovered from a Black stork post-mortem which boyciana (Hancock et al., 2001). Ciconia nigra also known as constitutes the material for the present paper. Black Stork has various local names in its distribution range. In India it is known as Surmal (in Hindi). Ciconia nigra has a Materials and Methods large geographic range, a bird throughout much of the An adult black stork(Ciconia nigra) was rescued by the Palearctic region (Hancock et al., 2001) is native to 106 countries district administration from Yachuli under the Lower Subansiri including Bhutan, India, Nepal and Pakistan and 20 countries District of Arunachal Pradesh, India and immediately where it is vagrant (BirdLife International, 2017). It is a monotypic rehabilitated (Fig. 1) in the Biological Park, Itanagar, Arunachal nd bird which has two discrete populations, while one population Pradesh, India on 2 March, 2019. At the time of rehabilitation breeds in Central Asia and winters in South-western and the left wing was found totally broken. There was profuse Southern Asia, the other breeds in Eastern Russia and winters bleeding from the wound at the broken wing. Though immediate in Eastern China and Korea (Pande et al., 2006). The global veterinary-medical care was resorted, the bird succumbed (Fig. population was estimated to vary from 24,000-44,000 2) due to probable hypovolemic shock 2 days after individuals; though the population trend is not known, yet, it rehabilitation.Post-mortem examination revealed several excludes the threshold under the population trend criteria as parasites in the gizzard (Fig. 3) and air sac (Fig. 4). Parasites well as the population size to include it under Least Concern from the latter space constituted the material for the present (LC) category by the IUCN Red List of Threatened Species communication. Parasitic specimens were cleaned in distilled (BirdLife International, 2017) and Schedule IV species category water and fixed in 10% formalin, thereafter they were cleared in under The Wildlife (Protection) Act 1972 (as Amended up to lactophenol for observation of the structures under a compound 1991) (1994) of India. It is a passage migrant to India, mostly microscope for evaluation of the parasite’s taxonomic status, adults and a few juveniles (Pande et al., 2006). The winter using the key described by Barus et al. (1978). migratory distribution sites in various states of India have been Results and Discussion reviewed by Pande et al. (2006). A few records also indicate Five nematode parasites could be collected in the present that this species migrates to Assam (Barman and Talukdar, study. Owing to improper collection of the worms that were cut 1995), Meghalaya (Choudhary, 2003) and Arunachal Pradesh at different distances, the actual length of some worms could (Datta et al., 1998). This is an uncommon bird about which not be ascertained. While measured the lengths of the less is known on its veterinary-medical aspects to support any available specimens, none fell below 15 cm. The parasites health issues related to captured, rehabilitated, reintroduced, were stout and white in colour. All the parasite specimens quarantined and zoo exhibit cases. Parasitologically, there is were female evidenced by presence of uterus containing eggs. limited information on the parasites of C. nigra either from The parasites had thick cuticle with fine transverse striations birds in captivity or in free-range. While Barus et al. (1978) has (Fig. 5) at 0.0418 mm distances. Anteriorly there were two recorded 9 various nematodes, Mutafchiev and Georgiev (2008) sclerotized tooth-like, flat structures on either side of the mouth has recorded a new species of spirurid nematode from C. opening (Fig. 6 & Fig. 7). Each of these structures was based nigra, all from Europe. Sood (2006) enumerated a spirurid on an oval plate which contained three irregular outgrowths,

1Veterinary Officer, Biological Park, Itanagar, Arunachal Pradesh, India; 2Department of Anatomy, CVSc, AAU, Khanapara, Guwahati- 22

174 Veterinary Practitioner Vol. 20 No. 2 December 2019

Fig.1: An adult black stork (C. nigra) at Biological Park, Itanagar, Fig. 2: The dead black stork before post-mortem examination Arunachal Pradesh, India

Fig. 3: Parasites in the gizzard of the black stork observed during Fig.4: Parasites recovered from the air sac post-mortem

at

Fig. 5: Fine cuticular striations of a female Dicheilonema ciconiae Fig. 6: Anterior end of a female D. ciconiae showing apical (400X) tooth (at), (lateral view) (100X) 175 Veterinary Practitioner Vol. 20 No. 2 December 2019

p p at at p

Fig. 7: En face view of anterior end of a female D. ciconiae showing Fig. 8: Ventral view of posterior end of a female D. ciconiae (100X) apical tooth (at) and papillae (p) (100X)

host. Present information is assumed to be useful for the zoo and wildlife managers from veterinary-medical health point of view.

Acknowledgements Authors are thankful to the Divisional Forest Officer, Biological Park, Itanagar, Arunachal Pradesh, India for the materials and the Dean, CVSc, AAU, Khanapara, Guwahati - 781 022, Assam, India for the facilities to carry out this study.

References Barman R and Taulkdar BK (1995) New record of black stork Ciconia nigra in Deepar beel, Assam. News letter for Bird watchers. 35: 15. Fig. 9: Eggs of D.ciconiae (400X) Barus V, Sergeeva T, Sonin M and Ryzhikov K (1978) Helminths of Fish-eating Birds of the Palaearctic Region. I. Nematoda. two large sub-median and one small median. The large sub- Springer Science + Business Media Dordrecht. pp. 232- median growth contained two rows of papillae, anteriorly and 234. posteriorly (Fig. 7). A small depression indicating the position BirdLife International (2017) Ciconia nigra. The IUCN Red List of of amphid was found between the large sub-median Threatened Species 2017. e.T2697669A111747857. http:// outgrowths. The posterior end of female was round (Fig. 8). dx.doi.org/10.2305/IUCN.UK.2017-1.RLTS. T22697669 Egg size measured 0.05 (0.040-0.064) X 0.019 (0.016-0.024) A11174 7857.en Choudhary A (2003)The birds of Nongkhyllem. News letter for Bird mm (n=11), each egg contained a differentiated larva (Fig. 9). watchers. 43: 52-53. The morphological appearance of the anterior end of female Datta A, Singh P, Athreya RM and Karthikeyan S (1998) Birds of Pakhui in our specimen was similar to the descriptions given by Barus Wildife Sanctuary, in Western Arunachal Pradesh, North et al. (1978) and Syrota et al. (2016) for the species east India. Newsletter for Bird watchers. 38: 91-96. Dicheilonema ciconiae (Schrank, 1788). The egg size Hancock JA, Kushlan JA and Kahl MP (2001) Storks, Ibises and measured in the present specimen had similarities with the Spoonbills of the World. Academic Press. pp. 69-74. description of the Barus et al. (1978) and Syrota et al. (2016) Mutafchiev Y and Georgiev BB (2008) A new acuariid nematode. with slight variations. From the present morphological findings Syncuariamackoin. sp. (Spirurida), from Ciconia nigra (L.) (Ciconiiformes: Ciconiidae) in Europe. Systematic Parasitol. and the predilection site of the parasites, it could be ascertained 70:71-79. that, the present parasitic species were D. ciconiae (Schrank, Pande S, Pawashe A, Deshpande P, Sant N, Kasambe R and Mahabal 1788). The presence of male parasites was probably A (2006) Recent records, review of wintering distribution, overlooked during the post-mortem examination and collection, habitat, choice and associations of Black stork Ciconia nigra if there were any. At some wildlife sanctuaries of Assam, a few in India and Sri Lanka. Biota. 7(1-2): 71-81. black storks are found as endemic birds. However, the present Sood ML (2006) Nematode Parasites of Birds (including poultry) from black stork was not sighted before at the place from where it South Asia. International Book Distributing Co. 1st edn, was rescued. Probably, it was a winter migrant which had Charbagh, Lucknow (UP), India. pp.177-178. Syrota Ya Yu, Kuzmin Yu I, Lyaskivskiy VN, Kobylinsky VV and already picked up this spirurid infection at its native breeding Vasylkivska IB (2016) First record of Dicheilonema ciconiae place during natural feeding. This is the first report of occurrence (Nematoda, Diplotriaenoidea) from Ciconia nigra (Aves, of the parasite from C. nigra from India, beyond the European Ciconiide) in Ukraine. Vestnikzoologii. 50(4): 379-382. DOI territory (Syrota et al., 2016). Neither the life cycle nor the 10.1515/vzoo-2016-004. pathology of this parasite is known. As this is a spirurid The Wildlife (Protection) Act 1972 (As amended up to 1991) (1994).1st nematode, arthropods might be incriminated as intermediate edn. Nataraj Publishers, Dehradun. pp. 130. 176 Veterinary Practitioner Vol. 20 No. 2 December 2019

UROGENITAL MYIASIS IN COMMERCIAL BROILER CHICKEN DUE TO CHRYSOMYA BEZZIANA IN ASSAM AND ITS MOLECULAR CHARACTERIZATION

S. Bora1, M. Das, S. Islam, L. Borkalita2, R. Neog, S. Begum3, P. Kakati and L. Hussain4 Department of Parasitology, College of Veterinary Science Assam Agricultural University, Khanapara, Guwahati - 781 022, Assam, India

Received received on: 30.06.2019 ABSTRACT Accepted on: 04.11.2019

In an exploratory investigation of ectoparasites of poultry commercial broiler chicken with age ranging from 4 to 7 weeks at different seasons of the year was found to suffer from urogenital myiasis varying from 0.52- 2.62 % with an average of 1.34% infestation. Data was generated from a total 4450 broiler chicken where 60 birds were found infested with urogenital myiasis in different seasons of the year, monsoon being the most preferred one. Laboratory bred larvae completed life cycle in 13-18 days at room temperature (20.3-320C) and relative humidity of 85%. Larvae collected from lesions were identified as Chrysomya bezziana and the adult flies were emerged from those larvae were also morphologically identical to C. bezziana. Subsequently molecular characterization of the larvae was conducted. Results of BLAST showed the query sequence having 99% similarity with C. bezziana. Possible economic impact of the urogenital myiasis in poultry has been discussed.

Key words: Chrysomya bezziana, myiasis, molecular characterization, poultry, Assam Introduction pupate and fly emergence was observed as per the method of Myiasis in man and animals has drawn attention of both Sen and Fletcher (1962) under room temperature that varied from medical and veterinary entomologists (Zumpt, 1965). Myiasis in 28.0 to 34.50C and relative humidity of 85%. animals have been well documented in India and abroad (Puttalakshmamma , 2005; Mustaq et al., 2006; Bermudez et al., Experiment No. 2 2007 ; Borkakati , 2012; Bora and Hussain, 2016). Flies that emerged at the end of the experiment No.1 were Information on avian myiasis is scanty except a report of allowed to feed on fresh chicken meat for deposition of egg and Chrysomya bezziana (Jeyathilakan et al., 2011) infection in a 1½ hatching of larva. The larvae were allowed to develop into adulthood - year-old Rhode Island Red cock from Chennai and fly strike as mentioned in experiment No.1. (5.4%) in commercial broilers in Kamrup district of Assam (Bora Experiment No. 3 rd and Hussain, 2016). India being the 3 largest producer of eggs Experiment No. 2 was repeated with similar treatments as th th and the 4 largest producer of broiler (19 Livestock Census, 2012, described above. This was considered as experiment No.3. The Govt. of India), the economic significance of myiasis cannot be time required to lay egg, pupation and emergence of adult flies underestimated if at all the present status of poultry industry is to were recorded. be maintained. Present study was undertaken to record the Wherever adult flies were obtained they were identified based urogenital myiasis in broiler in Assam where the poultry industry is on the characteristic features of head, thorax, abdomen and the gradually picking up as an economically viable enterprise. wing venations (Sen and Fletcher, 1962).

Materials and Methods Molecular characterization A total 4450 numbers of broilers were examined in situ during Isolation of larvae different seasons of the year from March 2015 to February 2016. Larvae isolated from the cloaca of infested birds were Live maggot were collected from the infested tissues (Fig. 1) and subjected to morphologically studies using the key of Sen and brought to the laboratory. The pooled samples were divided into Fletcher (1962). Based on the presence of characteristics of three parts. Each of the representative part of samples was anterior and posterior spiracle conforming to the C. bezziana preserved in 70% ethanol for taxonomic studies, for observation of species (Zumpt, 1965) were utilized for molecular characterization. laboratory breeding and deep freezed for molecular studies. DNA extraction Taxonomic studies A total 5 suspected third stage (L3), laboratory raised C. Larvae were subjected to morphological studies based on bezziana larvae were grind in pestle and mortar with the addition the characteristic features of their posterior spiracle (Sen and of 180 µl Buffer ATL and 20 µl proteinase K. Genomic DNA from the Fletcher, 1962). larval tissues so grind were then extracted following the Laboratory breeding manufacturer’s protocol using commercial kit (Qiagen DNeasy Three laboratory breeding experiments were conducted as Blood and Tissue Kit, Cat No. 69504). described below: Quantification and purity check of extracted genomic DNA Experiment No. 1 The quantity and the purity of the extracted genomic DNA Live maggots collected from the lesions were allowed to samples were examined by using UV-visible spectrophotometer 1Corresponding author: ICAR Research Complex for NEH Region, Umiam, Meghalaya, e-mail: [email protected]; 2Department of Animal Biotechnology, CVSc, AAU, e-mail: [email protected]; 3Department of Pathology, CVSc, AAU, e-mail: [email protected] ; 4Department of Extension Education, CVSc, AAU, e-mail: [email protected] 177 Veterinary Practitioner Vol. 20 No. 2 December 2019

(Nanodrop) at 260 and 280 nm. The 260/280 ratio indicated the Although myiasis of various types of animals and livestock purity of the samples. are well documented (Puttalakshmamma et al., 2005; Bermudez et al., 2006; Mushtaq et al., 2006), the same in poultry is very Polymerase chain reaction (PCR) scanty. Traumatic myiasis, however, in geese in Hungary caused Molecular detection of co1 gene by Wohlfartia magnifica has been reported by Farkas et al. (2001) Cytochrome oxidase (co1) gene of C. bezziana were then and cutaneous myiasis of a Rhode Island Red (RIR) cock has subjected to PCR for detecting the target gene using the self been reported by Jeyathilakan (2011) from Chennai. designed primer sequences (Table 1) and the cycling condition Bora and Hussain (2016) reported about the fly-strike caused as mentioned in Table 2: by C. bezziana larvae in commercial broiler in Assam. They, too, PCR reaction mixture recorded this condition in the pre-monsoon and monsoon To detect the target gene (co1) in extracted genomic DNA a seasons which corroborates with the findings of the present study. simplex PCR was carried out with a reaction volume of 25.0 µl. Breeding of Chrysomia larvae collected from the lesion was The amounts of each reagent in the reaction mixture were as conducted in room temperature (28.0-32.0.0C) with a relative mentioned in Table 3. humidity of 85%. The result has been depicted in Table 6 and Fig. 3. Soulsby (1982) and Wiki (2017) are of the opinion that life-cycle Confirmation and visualization of PCR amplicons is temperature dependent and completes in 24 days at 290C and The PCR amplified products were subjected to agarose gel the shortest time known is 7 days to complete the life cycle (Soulsby, electrophoresis using 1.5% agarose. A volume of 40 ml of 1.5% 1982). Findings of the present studies are almost identical to agarose gel was prepared by adding 0.60 g of agarose in 40 ml of these findings. The emergence of flies from wild larvae (Experiment 1x TAE buffer (Tris base, Acetic acid and EDTA). The mixture was No.1) took lesser time in comparison to the Experiment No. 2 and heated to melt in a microwave oven for 2-3 minutes. By the time a 3 where laboratory bred adult flies were used for the study (Table gel casting tray was set by placing a comb to form the wells for 6). This may be due to effect of the variation in room temperatures. loading the samples. The molten agarose was allowed to cool to Amplified PCR products using agarose gel electrophoresis 56°C and Ethidium Bromide (EtBr, 1 µl/100 ml) was added as a confirmed the presence of desired amplicon (702 bp) (Fig. 4). dye to visualize the amplified products. The 1x TAE containing 1.5 The result of BLAST at NCBI nucleotide database showed g of agarose and 1 µl EtBr is mixed properly and poured on the gel the query sequence of 99% similarly with C. bezziana which casting tray and allowed to solidify. After solidification, the comb corroborates the morphological identification of the parasite in was removed carefully and 1x TAE buffer was poured in the gel different developmental stage. The phylogenetic analysis of the casting tray until the gel was completely submerged. Each well present sequence revealed that, C. bezziana strain of Guwahati was loaded with 5 µl of the amplified product with 1 µl of loading isolates had close relationship with an isolate from Thailand and dye (6X). Along with PCR products a 100 bp DNA ladder (Invitrogen) 2 isolates from Malaysia and distant relationship with other species was loaded in a well to compare the PCR products. of the genus (Fig. 5). The accession number is awaited from Electrophoresis was carried out at 50-60 V (5V/cm of gel size) for NCBI. Salem et al. (2015) previously used the mitochondrial 1 hour at room temperature. The gel was then visualized using cytochrome oxidase subunit I(coI) gene for studies on the Gel documentation system (BioRad, USA) and result was genetically diversified and forensically important Chrysomyia recorded. species available in Egypt confirming the utility of coI gene in the molecular identification of Chrysomyia, which was also used in Sequencing the present studies. Positive PCR products were sent for sequencing by It is evident from the present study that urogenital myiasis outsourcing. Identification of the sequences was done by using which is not recorded so far right play a significant role in economy NCBI BLAST. The identified sequences were than aligned and of the broiler industry in the country. phylogenetic tree was constructed using MEGA. Acknowledgement Results and Discussion Authors are grateful to the Dean, Faculty of Veterinary Science, Prevalence of urogenital myiasis in broiler chicken in terms Assam Agricultural University, Khanapara, Guwahati-22 and the of age and season are shown in Table 4 and Table 5. Monsoon Director of Post-Graduate Studies, AAU, Khanapara for the being the most congenial season for the breeding of flies it is providing the necessary facilities. imperative that, this season revealed highest prevalence rate i.e. 2.66% and there was no infection in winter season. The infestation References was recorded from 5 week of age to the market age only. The Bermudez SE, Espinosa JD, Cielo AB, Clavel F, Subia J , Barrios S and larvae were identified as to be of C. bezianna on the basis of Medianero E (2007) Incidence of myiasis in Panama during the posterior spiracles (Fig. 2). More the age, more was the infestation eradication of Cochliomyia hominivorax (Coquerel 1858 , Diptera rate obviously due to pendulous abdomen which constantly got : Calliphoridae) (2002-2005) Mem. Inst. Oswaldo Cruz. 102 touched with dirt and litter. ISSN 1678-8060. Bora S and Hussain L (2016) Fly strike in commercial broiler farm in Assam. Secretion of the cloaca mixing with dirt made the area suitable In: Proceedings of the National Symposium on Rural Poultry for for attraction of flies which ultimately led to myiasis. The economic Livelihood, Nutritional and Economic Security and 33rd Annual impact of this condition cannot be underestimated as there was Conference of Indian Poultry Science Association held at the reduced weight gain as compared to the non-infected one due to AAU, Khanapara from November 3-5, Abstr. No. OP-VIII.22. constant irritation and abhorrence of consumer that may affect Pp.302. economically to farming community. Therefore, further work in this Borkataki S (2012) Evaluation of maggot therapy in the treatment of dhronic aspect is warranted. wound in Rat. Ph.D. Thesis submitted to the Sher-e-Kashmir 178 Veterinary Practitioner Vol. 20 No. 2 December 2019

Table 1: Details of primers Amplicon Annealing Gene Primer Primer sequence (5′-3′) Reference size temperature (°C) Forward ACACTTCATTCTTTGACCCA co1 Reverse AAGTTGTGTAAGCATCTGGA 702 bp 50.5 Self designed

Table 2: Cyclic conditions for PCR reactions Table 3: Components of PCR reaction mixture Sl. Temperature No. of S. Volume Steps Time Components No. (°C) Cycles No. (µL) Master Mix Initial 1 94 5 min 1 (DreamTaq, Thermoscientific) denaturation 1 Composition: 12.5 2 Denaturation 94 1 min O.O5 U/ µl DNA polymerase, Reaction buffer, 4 Mm MgCl2, 0.4 mM of each dNTP (dATP, dCTP, dGTP, dTTP). 3 Annealing 50.5 45 sec 35 2 Template DNA 5.0 4 Extension 72 1 min 3 Forward primer (10 pmol/µl) 1.0 5 Final extension 72 10 min 4 Reverse primer(10 pmol/µl 1.0 1 6 Hold 20 5 Nuclease Free Water (NFW) 5.5 Total 25.0

Table 4: Seasonal prevalence of urogenital myiasis in broiler Table 5: Age-wise prevalence of urogenital myiasis in broiler chicken due to C. bezziana chicken due to C. bezziana

Season No. of birds No positive Per cent Chi sq. Age in No. of No. positive Per cent X2 value examined prevalence (%) value weeks birds for maggot prevalence Pre-monsoon 950 5 0.52 examined Monsoon 1500 40 2.66 37.25** 4 1000 0 0.00

Post-monsoon 1000 15 1.50 5 1400 15 1.07 6 1200 24 2.00 21.32** Winter 1000 0 0.00 7 850 21 2.47 Total 4450 60 1.34 Total 4450 60 1.34 **p<0.01

Table 6: Laboratory breeding of C. bezziana at room temperature (28-32°C) Stages Expt. Egg Emergence No. of Pupation Emergence No. of Days required No. Adult laying of larvae larvae time of flies eggs (in days) (in days) (in days) (in days) 11-14 I - - - - 20 5-6 6-8 (Larvae to adult) 13-18 II 10 1-2 Plenty 1-2 Plenty 5-6 5-6 (Adult to adult) 13-18 III 30 1-2 Plenty 1-2 Plenty 5-6 5-6 (Adult to adult)

Fig.1: Larvae of infested cloaca Fig. 2: Posterior spiracle of third stage larvae of C. bezziana

179 Veterinary Practitioner Vol. 20 No. 2 December 2019

1-2 days

6-8 days

Fig. 3: Life-cycle of Chrysomyia bezziana

1 2 3 4 5 6 7 8

100 bp 702 bp DNA ladder

Fig. 4: Detection of co1 gene (702bp) by Simplex PCR. Lane1: 100 bp Fig. 5: Phylogenetic tree constructed for Chrysomia bezziana DNA ladder ; Lane 2 : Negative control ; L3 , L4 , L5, L6 , L7 and L8 : Test amplicon

University of Agricultural Sciences and Technology of Jammu. Intas Polivet. 6: 635-636. Farkas R, Szanto Z and Hall M (2001) Traumatic myiasis of geese in Salem AM, Adham FK and Picard CJ (2015) Survey of the genetic diversity Hungary. Vet. Parasitol. 95: 45-52. of forensically important Chrysomya (Diptera: Calliphoridae) Jeyathilakan N, Kavitha S, Murugadas V and Basith SA (2011) Traumatic from Egypt. J. Med. Entomol. 52: 320-328. myiasis in a Rhode Island Red cock. J.Vet. Parasitol. 25: 79-81. Sen SK and Fletcher TB (1962) Veterinary Entomology and Acarology for Livestock Census 19th (2012) Ministry of Agriculture, Department of Animal India. 1st edn. ICAR, New Delhi. Husbandry , Dairying and Fisheries, Krishi Bhawan, New Delhi. Soulsby EJL (1982) Helminths, Arthropods and Protozoa of Domesticated Mustaq AMAH, Khawla BAJ and Salem ZA (2006) A case report of Animals. 7th edn. Bailliere Tindall. Pp. 809. cutaneous myiasis by Chrysomya bezziana (OWS) in camel at Wiki (2017).m.wikipedia.org/wiki/Chrysomyia bezziana. Basra Province. Bas. J. Vet. Res. 11: 108-112. Zumpt F (1965) Myiasis in Man and Animals in the Old World: A Text book Puttalakshmamma GC , Dhanalakshmi H, D’Souza PE and Ananda KJ for Physicians, Veterinarians and Zoologists. Butterworth, (2005) Incidence of myiasis in domestic animals in Bangalore. London.

180 Veterinary Practitioner Vol. 20 No. 2 December 2019

PREVALENCE AND CYSTIC FERTILITY STUDY OF HYDATIDOSIS IN MEAT ANIMALS OF KASHMIR VALLEY

Sanku Borkataki, Pankaj Goswami*, Basarat Ahmed Pandit and Rafiq Shahardar Division of Veterinary Parasitology, Faculty of Veterinary Science and Animal Husbandry Sher-e-Kashmir University of Agricultural Sciences and Technology of Kashmir, Shuhama, Kashmir, India

ABSTRACT Received on: 28.03.2019 Accepted on: 25.09.2019

Hydatidosis is recognized as important helminth zoonosis and also causes great economic losses through condemnation of meat on food animals. A cross sectional study of meat animals of Kashmir Valley was carried out to know the prevalence of hyaditidosis. Out of 482 animals examined 34 (7.05%) were found to harbour hydatid cyst. The species wise infection of hydatidosis in cattle, sheep and goat were recorded as 12.84%, 5.43% and 4.76%, respectively. Laboratory evaluation of 43 recovered cysts from the different visceral organs of animal, 62.79% were fertile while 30.23% and 6.97% were sterile and calcified, respectively. Higher prevalence and fertile cyst in cattle compared to sheep and goat recorded and may suggest prevalence of hydatidosis is higher in larger ruminant.

Key words: Fertility, hydatid cyst, prevalence, ruminants

Introduction consumption were primarily examined by visual inspection Hydatidosis caused by larval stage of Echinococcus and palpation of organ and viscera for the presence of hydatid granulosus is a common infection in ruminants and has been cyst irrespective of age of the animals. Further, incision in to recognized as the most important helminth zoonosis which each organ was made if a single or more cysts found. Thus, continues to be a significant public health problem. liver, lung, heart, spleen, mesentery, omentum of each animal Echinococcosis is a zoonotic infection caused by adult or larval examined grossly. Cysts were collected separately, labelled (metacestode) stage of cestode belonging to genus and subjected to laboratory examination. The sex of the Echinococcus, family Taenidae (Eckert et al., 2001). Dogs are individual animal also recorded for respective species with the usual definitive host of E. granulosus and a large number presence of cyst. Identification of cyst was carried out based of mammalian species including domestic ungulates and man on morphological characteristics as described by Solusby act as intermediate host for the hydatid cyst. Humans are (1982). infected with hydatid cyst by accidental consumption of eggs of E. granulosus through contaminated food and water or from Fertility test of collected cysts environment and direct contact with dog. Animals suffering Microscopic examination of cystic fluid was conducted to from hydatidosis are usually asymptomatic and ante mortem look for the characteristic protoscolices on X40 magnification. diagnosis is difficult. Most of the cases are detected at the time If the protoscolices were present, they were seen as white of post mortem examination. Hydatidosis also causes great dots on the germinal epithelium or brood capsule within the economic losses through condemnation of infected offals suspension and the cyst were categorized as fertile. Fertile especially liver, lung and other organ. Seroprevalence of human cysts were further subjected to viability test. Viability of cyst or hydatidosis is in increasing trend and have been reported in protoscolices were observed for amoeboid like peristaltic many part of North India (Khurana et al., 2007). Occurrence of movement with X40 objective, by pouring a drop of fluid on human hydatidosis is also reported from Kashmir valley microscopic glass slide and covered with coverslip. For clear (Chishti and Ahanger, 1998). The current study was designed vision a drop of 0.1% aqueous eosin solution was added to to investigate the prevalence of hydatidosis in meat animals, equal volume of protoscolies in hydatid fluid on microscope ruminants in particular, of Kashmir Valley as limited information slide with the principle that viable protoscolices should is available from this region. completely or partially exclude the dye while the dead one take it up (Smyth and Barrett, 1980). Sterile hydatid cysts are Materials and Methods characterized by their smooth inner lining usually with a slight Study area turbidity of the contained fluid and typical calcified cyst produced The study was conducted on animals from different meat a gritty sound feeling upon incision (Parija, 2004; Solusby, shops and village meat sellers in different parts of Kashmir 1982). Valley. Jammu and Kashmir- the northern most state of India, being situated between 320.17’ and 360.58’ North Latitude and Results and Discussion 370.26’ and 800.30’ East Longitude. A total of 482 animal carcasses were examined, out of which 34 animals were found to harbour one or more hydatid Collection of infected samples cyst in the visceral organs and overall prevalence was recorded Weekly visit to the market/village meat shop were made in as 7.05%. Ahmad et al. (2010) reported 2.83% prevalence of different localities of Kashmir Valley. Animal carcasses of cattle, hydatidosis out of 34.6% metacestodes infection on sheep and goat brought into the market for human examination of viscera of sheep and goat from Jammu. Abattoir

*Associate Professor, Division of Pathology

181 Veterinary Practitioner Vol. 20 No. 2 December 2019 study on hydatidosis in 1000 slaughtered small ruminants in softer consistency of lung tissue allows easier development Ethiopia by Ermias et al. (2011) also recorded 9.7% prevalence of the cyst (Himonas, 1987). similar to our findings. Animal wise prevalence of hydatidosis Examination of 43 cyst for fertility status revealed 62.79% is shown in Table 1. Accordingly species wise 12.84% (14/ were fertile, 30.23% sterile and 6.97% calcified (Table 2). The 109) cattle, 5.43% (18/331) sheep and 4.76% (2/42) goat were origin of maximum fertile cyst were recovered from cattle found to be infected. In our observation prevalence of (76.19%) followed by sheep (55.55%) and goat (25.00%). This hydatidosis was higher in large ruminants which are in support observation opposes to findings of Pednekar et al. (2009) of other workers (Das and Das, 1998; Sharma et al., 2000). where highest percentage of fertile cyst recorded in sheep According to Roy and Tandon (1989), hydatidosis is more (97.14%), followed by pig (52.78%), cattle (25.0%) and buffaloes frequently occur in cattle than pig and goat. Deka et al. (2008) (22.37%) in India. Hosseini and Eslami (1997), reported fertility also reported highest prevalence of hydatidosis in cattle of hydatid cyst in sheep, goat and cattle were 7.1%, 3.1% and (16.76%) than buffalo (6.52%), goat (4.87%) and pig (0.43%) 7.5%, respectively from Iran. Maximum number of cyst in cattle from Assam. Similar finding was also observed by Pednekar were detected from lungs compared to liver seems more fertile et al. (2009) showed that cattle were found with the highest cyst in former organ. prevalence of hydatid cyst (5.10%) followed by buffaloes From the present study it revealed that cattle and sheep (3.81%), pig (0.87%) and sheep (0.075%) from India. were in higher risk of acquiring hydatid infection. The presence Higher infection rate in Sheep in comparison to goat were of high prevalence and fertile cyst particularly in cattle and sheep reported by various worker (Jobre et al., 1996; Kebede et al., possibly emphasize the enormous role of these animals in 2009; Fekadu, 2003; Ermias et al., 2011) and opined sheep the occurrence of hydatidosis. As the infected offal is potential were seen to suffer higher risk of infection compared to goats. source of infection to dog, hence proper disposal and ban on This could be attributed to the browsing nature of goat that backyard slaughter may be recommended to prevent the made them feed on relatively less contaminated vegetation economic losses and public health hazard associated with than sheep which are relatively grazers (Dalimi et al., 2002). hydatidosis. However in our findings no such kind of difference of infection was observed as less number of goat carcass was examined Acknowledgement in comparison to sheep. In the Kashmir Valley, sheep were The authors are thankful to Dean, F.V.Sc. & A.H., Shuhama, SKUAST-Kashmir for providing all the facilities to carry out the work.

Table 1: Prevalence of Hydatidosis in ruminants of Kashmir Valley Animals Total no of Carcass Male carcass Female carcass examined positive examined positive examined positive Cattle 109 14 (12.84%) 74 8 (10.81%) 35 6 (17.14%) Sheep 331 18 (5.43%) 237 11 (5.18%) 104 7 (6.73%) Goat 42 2 (4.76%) 24 1 (4.16%) 18 1 (5.55%)

Table 2: Fertility cyst status in various ruminant species of Kashmir References Valley Ahmad PA (2010) Prevalence of gastrointestinal helminths in Dogs of Animals No of Fertile Sterile Calcified Jammu. M.V.Sc. Thesis submitted to Faculty of Veterinary cyst cyst (%) Cyst (%) cyst (%) Sciences. SKUAST-Jammu. Chishti MZ and Ahanger AG (1998) Epidemiology and control of human Cattle 21 16 (76.19) 3 (14.28) 2(9.52) hydatidosis in Kashmir, India.Parasitol. Int. 47: 164. Sheep 18 10 (55.55) 7 (38.88) 1 (5.55) Dalimi A, Motamedi G, Hosseini M, Mohammadian B, Malaki H, Goat 4 1 (25.00) 3 (75.00) 0 (0.00) Ghamari Z and Ghaffari G (2002) Echinococcosis/ Total 43 27 (62.79) 13 (30.23) 3 (6.97) hydatidosis in Western Iran. Vet. Parasitol. 105: 161- 171. mostly preferred over goat for selling meat purposes, making Das U and Das AK (1998) Cystic hydatidosis of food animals in greater Calcutta. Indian Vet. J. 75:387-388. less number of goat carcass available for the study. Deka DK, Islam S, Borkakaty M, Saleque A, Hussein I and Nath K The sex wise observation made pertinent to infection did (2008) Prevalence of Echinococcus granulosus in not show any significant difference within the species. This dogs and hydatidosis in herbivores of certain North may be explained by indiscrimination exposure to risk eastern states. Indian J. Vet. Parasitol. 22: 27-30. irrespective of the sex in managemental system of animals. Eckert J, Schantz PM, Gasser RB, Torgerson PR, Bessonov AS The organ wise distribution of cyst showed higher affection and Movsessian SO (2001) Geographic distribution in lungs followed by liver which also support the findings of and prevalence In: WHO/OIE manual on Ermias et al. (2011). However spleen, kidney and other viscera Echinococcosis in Human and Animals: A Public Health problem on Global concern. World organization were free of cystic affection in the study. Lung and liver posses for Anim. Hlth. Paris. 100-142. great capillary site encountered by the migrating Echinococcus Ermias M, Kassahun A, Jemere B, Tadesse A, Mesele A, Kassaye A oncosphere which adopt the portal vein route and negotiate and Rahmeto A (2011) The status of cystic Echinococcosis hepatic and pulmonary filtering system sequentially before any (Hdatidosis) in small ruminants slaughtered at Addi Ababa of the peripheral organ involved (Schantz, 1982) and relatively Municipal Abattoir. J. Anim. Vet. Advances. 10: 1445-1449.

182 Veterinary Practitioner Vol. 20 No. 2 December 2019

Fekadu D (2003) A study on cestode and metacestode of sheep in Parija SC (2004) Textbook of medical Parasitology: Protozoology and Sheno agricultural research centre, North Shewa. DVM helminthology. 2nd edn. India Publisher and Distributors, New Thesis. Faculty of Veterinary Medicine, Addis Ababa Delhi. University, Ethiopia. Pednekar RP, Gaurat RP and Gatne ML (2009) Prevalence fertility Himonas C (1987) The fertility of hydatid cyst in food animals in Greece. rate and protein content of hydatid cysts in food animals In: Helminth Zoonoses. Geerts SV Kumar and J Brandt slaughtered at Deonar abattoir. J. Bombay Vet. Col. (Eds.). Martinus Nijjhof Publishers, the Netherlands. 17: 55-59. Hosseini SH and Eslami A (1997) Investigation on the morphology and Roy B and Tandon V (1989) Metacestodiasis in North-east India: biology of Echinococcus granulosus of sheep and cattle A study on the prevalence of hydatidosis and and human origine. J. Vet. Faculty Univ. Tehran. 52(4) 49- cysticercosis in Mizoram, Nagaland and Assam. Indian 60. J. Anim. Hlth. 28: 5-10. Jobre Y, Lobago F, Tiruneh R, Abebe G and P Dorchies (1996) Schantz P (1982) Echinococcosis. In: Handbook of zoonoses Hydatidosis in three selected region in Ethiopia: An Vol III. Parasitic Zoonoses, CRC Press, Florida, USA. assessment trial on its prevalence, economic and public pp. 213-277. health importance. Revue de Med. Veterinaire. 11: 797- Sharma MD, Deka DK and Borkataky MR (2000) Occurance of 804. hydatidosis and porcine cysticercosis in Guwahati city. Kebede N, Mitiku A and Tilahun G (2009) Hydatidosis of slaughtered J. Vet. Parasitol. 14: 173-174. animals in Bahir Dar Abattoir, North Western Ethiopia. Trop. Smyth JD and Barrett NJ (1980) Procedures for testing the viability Anim. Hlth. Prod. 41: 43-50. of human hydatid cysts following surgical removal, Khurana S, Das A and Malla N (2007) Increasing trends in especially after chemotherapy. Transactions of the seroprevalence of human hydatidosis in North India: a Royal Soc. Trop. Med. Hygiene. 74: 649-652. hospital-based study. Troical. Doctor. 37: 100-102. Soulsby EJL (1982) Helminth, arthopods and protozoa of Parija SC, Sasikala A and Rao RS (1987) Serological survey of domesticated animals. 7th edn., Bailliere Tindall, London. hydatid disease in Pondicheny, India. Transaction of Royal pp. 809. Soc. Trop. Med. Hygiene. 81: 802-803.

183 Veterinary Practitioner Vol. 20 No. 2 December 2019

PATHOLOGICAL FINDINGS OF FIBROSARCOMA IN DOGS

Abhilasha Dadhich1, Manisha Mathur, Manish Agrawal2, Sakar Palecha3 and A.S. Arora4 Department of Veterinary Pathology, College of Veterinary and Animal Science Rajasthan University of Veterinary and Animal Sciences, Bikaner-334 001, Rajasthan, India

ABSTRACT Received on: 21.09.2019 Accepted on: 09.11.2019

In the present investigation, a total of 54 tissue biopsy of neoplastic growths of dogs were examined along with their histopathological observations. The fibrosarcoma were recorded in 5.55 per cent cases. Grossly, these tumours were of variable in size usually irregular and nodular in shape, poorly demarcated and non-encapsulated. Microscopically, the basic pattern of firbrosarcoma consists of whorls and interwoven bundles of immature fibroblasts and moderate number of collagen fibres. These tumours were more cellular and fibre formation generally minimal particularly in highly anaplastic fibrosarcomas.

Key words: Fibrosarcoma, dogs

Introduction Domestic dogs play a unique model for cancer research as they generally experience spontaneous disease. Cancer constitutes the major health problem both in human and veterinary medicine. Establishment of microscopic nature of tumour by histological examination is of par importance. In the past 10 years evidence of variant histology for the clinical relevance cancer has been increasing. This increase has resulted in new classifications of cancers as reported by the WHO in 2016, highlighting the importance of an accurate morphological description of pathological specimens for the therapeutic management of patients with cancer. Fibrosarcomas are slow-growing, malignant (cancerous) tumours most often found in the connective tissue of the skin and beneath the skin. While these tumours may be removed successfully, they frequently recur after surgery. It is rare that Fig. 2: Microscopic photograph of fibrosarcoma with whorls and fibrosarcomas metastasize (spread) to other parts of the body. interwoven bundles of immature fibroblasts (H&E 200X).

Materials and Methods In the present investigation, a total of 54 tissue biopsy of neoplastic growths of dogs of different age groups, sex and breeds were examined along with their histopathological observations. The biopsy samples were collected and

Fig. 3: Microscopic photograph of fibrosarcoma showing hemorrhages (H&E 200X). preserved in 10 per cent formal saline and were processed mechanically for paraffin embedding by acetone and benzene technique (Lillie, 1965). The sections of 4-6 micron thickness Fig. 1: Gross photograph of fibrosarcoma showing variable sized were cut and stained with haematoxylin and eosin method of nodules which were non-encapsulated staining as a routine.

1Ph.D. Scholar, Department of Veterinary Pathology; 2Assistant Professor, Department of Veterinary Pathology, Post Graduate Institute of Veterinary Education and Research, RAJUVAS, Bikaner; 3Assistant Professor, Dept of Vet. Surgery and Radiology, CVAS, Bikaner; 4Assistant Professor, DEE, RAJUVAS, Bikaner 184 Veterinary Practitioner Vol. 20 No. 2 December 2019

Results and Discussion fibrosarcomas. The pleomorphic cells were spindled, fusiform The fibrosarcoma were recorded in 5.55 per cent cases. or polygonal in shape. The nuclei were round or oval and The 22.41 per cent incidences of fibrosarcoma among skin hyperchromatic. Fibrosarmoas were highly vascular, but the tumours reported by Mukhopadhayay and Som (1990) in and blood vessels were poorly formed and haemorrhages were around Calcutta are far above the incidences of 11.96 per cent common (Fig. 3). Microscopically, pattern consisting of whorls recorded in this study but are far below the report of Shakir and and interwoven bundles of immature fibroblasts and moderate Sundararaj (1994) reported only one incidence out of 58 cases number of collagen fibres were also reported by in Madras city. Mukhopadhayay and Som (1990). However pleomorphic Grossly, these tumours were of variable in size usually tumour cells with spindle, fusiform or polygonal shape found irregular and nodular in shape, poorly demarcated and non- in the fibrosarcoma in this study are in accordance with the encapsulated (Fig. 1). Consistency was firm with soft friable Vikram Reddy et al. (1977). areas. Reddish-brown areas of haemorrhages and yellowish areas of necrosis were common. Very variable size and irregular References nodular shape of fibrosarcoma recorded in this study Lillie RD (1965) Histopathologic technique and practice of histochemistry. The Blaskinton Div. McGraw Hill Book. corresponds well with the gross findings of Vikram Reddy et London. al. (1977). Mukhopadhyay S and Som TL (1990) Cutaneous neoplasm in dogs in Microscopically, the basic pattern of firbrosarcoma and around Calcutta. Indian J. Vet. Pathol. 14: 77-78 consists of whorls and interwoven bundles of immature Shakir SA and Sundararaj A (1994) Skin neoplasms of dogs in Madras fibroblasts and moderate number of collagen fibres (Fig. 2). city. Indian Vet. J. 18(2): 154-158. (Vet. Bull. 65 : 6937). These tumours were more cellular and fibre formation Vikram Reddy M, Narashimha Rao RL, Sriraman PK and Mahender M generally minimal particularly in highly anaplastic (1977) Fibroma in a dog. Indian Vet. J. 54: 324-325.

185 Veterinary Practitioner Vol. 20 No. 2 December 2019

OCCURRENCE AND PATHOLOGICAL OBSERVATION OF HYDRONEPHROSIS IN BUFFALO KIDNEY

Brajesh Kumar1, Manish Agrawal, Vikas Galav, S. K. Sharma, Rohitash Dadhich and A.S. Arora2 Department of Veterinary Pathology, Post Graduate Institute of Veterinary Education and Research, Jaipur-302 031 Rajasthan University of Veterinary and Animal Sciences, Bikaner-334 001, Rajasthan, India

Received on : 15.04.2019 ABSTRACT Accepted on: 19.08.2019

The hydronephrosis is an important pathological condition of kidney which involves dilatation of the collecting system of the kidney above the level of the pelvi-ureteric junction. In the present study, a total number of 228 specimens of kidney showing abnormalities were processed for histopathological examination. Out of these, hydronephrosis was recorded in 8 (3.51%) cases. Grossly, the affected kidneys were enlarged and exhibited atrophy of the renal parenchyma along with dilatation of pelvis and loss of medulla. On microscopic examination, dilation of proximal convoluted tubules and cystic dilations in pelvis, calyces and in surrounded tubules were observed. Additionally, degeneration, infiltration and desquamation were also found in the tubular mucosa. The cortex and glomeruli also showed atrophy and mononuclear infiltration in the surrounding interstitial tissue.

Key words: Buffalo, kidney , hydronephrosis

Introduction Urinary system is one of the important systems in the body which excretes toxic metabolites, regulates blood volume and blood pressure, controls level of electrolytes and selective reabsorption and regulates blood pH. Renal diseases bear a major segment of total burden of diseases and considered to be most important cause of illness and death in many animal species including buffaloes. The hydronephrosis is an important pathological condition among various pathological conditions of kidney. It refers as swelling of the kidney due to an obstruction of urine flow in the urinary tract which involves dilatation of the collecting system of the kidney above the level of the pelvi-ureteric junction. It is in this context, the present study was carried out to find out occurrence and pathological observation of various pathological conditions in buffalo kidney. Fig. 2: Microphotograph of kidney having hydronephrosis showing dilatation of renal tubules and atrophy of tubular Materials and Methods epithelium (H & E 100X). A total number of 1054 kidney specimens of buffaloes were collected mainly from various organized and unorganized

Fig.3: Microphotograph of kidney having hydronephrosis showing necrosis and dilatation of renal tubules along with oedematous interstitium (H & E 200X).

slaughter houses of Jaipur division. Out of these, 228 kidney Fig. 1: Photograph of kidney having hydronephrosis showing specimens showing abnormalities were further processed dilatation of pelvis and loss of medulla for histopathological examination. Tissues were processed

1Corresponding author: email id: [email protected]; 2Assistnt Professor, DEE, RAJUVAS, Bikaner

186 Veterinary Practitioner Vol. 20 No. 2 December 2019 by paraffin embedding using acetone and benzene technique References (Lillie,1965). The tissue sections of 4-6 micron thickness were Dhaka VK, Sarita, Dadhich H, Kumar A, Mathur M, and Vyas I (2017) cut and stained with haematoxylin and eosin method of Histopathological observation of hydronephrosis in goats staining. (Capra hircus). Vet. Pract. 18(2): 198-199. Hajikolaei MRH, Nikvand AA, Ghadrdanmashhadi AR, Ghorbanpoor M, Results and Discussion Mohammadian B and Abdollahpour G (2016) Existence of In the present study, hydronephrosis was recorded in 8 Leptospira interrogans in kidney and shedding from urine (3.51%) cases. Lower incidence of hydronephrosis i.e. 2.5 per and relationship with histopathological and serological findings in water buffaloes (Bubalus bubalis). Revue. cent cases in buffalo was reported by Mohammadian et al. Méd. Vét. 167(10): 269-273. (2016), 2.15 per cent cases in cattle by Jat (2016) and 3.31 per Jat MK (2016) Occurrence and pathology of various conditions of cent cases in sheep by Dhaka et al. (2017). However, much urinary system in cattle (Bos indicus). M.V.Sc. Thesis, higher incidence was recorded by Hajikolaei et al. (2016) as College of Veterinary and Animal Sciences, Rajasthan 10.1% cases in buffaloes and 17.65 per cent cases in cattle by University of Veterinary and Animal Sciences, Bikaner. Mesele et al. (2012). Lillie RD (1965) Histopathological technique and practical histochemistry. Grossly, kidneys were swollen and enlarged. There was Mc-Graw Hill Book Co., New York and London. dilatation of the renal pelvis and loss of medulla (Fig. 1). The Mesele G, Guadu T, Bogale B and Chanie M (2012) Pathological conditions causing organ and carcass condemnation and normal renal structure was converted into a large enormous their financial losses in cattle slaughtered in Gondar, sacculated bag, which was filled with watery fluid. Renal cortex Northwest Ethiopia. African J. Basic Appl. Sci. 4(6): 200- was thinner and greyish in colour. These gross findings are in 208. close approximation to the findings recorded by Jat (2016) and Mohammadian B, Nikvand AA, Haji Hajikolaei MR, Ghadrdan Mashhadi Sarita et al. (2017). AR and Ghorbanpoor M (2016) Pathological study of urinary Microscopic examination showed dilatation of renal tubules bladder and kidney in slaughtered water buffalo (Bubalus and atrophy of tubular epithelium (Fig. 2). Another figure was bubalis) at Ahvaz Abattoir. Sci. Res. Iranian Vet. J. 12 No. showing necrosis and dilatation of renal tubules along with 3(52): 69-75. Sarita, Dadhich H, Mathur M, Dhaka VK and Limba AK (2017) oedematous interstitium (Fig. 3). Degeneration, infiltration and Histopathological observation of hydronephrosis in sheep desquamation were also seen in the mucosa of tubules. (Ovis aries). Vet. Pract. 18(1): 63-64. The cortex and glomeruli also showed atrophy where as mononuclear infiltration was depicted by surrounding interstitial tissue. There were cystic dilatations in pelvis, calyces and in surrounding tubules.

187 Veterinary Practitioner Vol. 20 No. 2 December 2019

BIOCHEMICAL EFFECT OF INDUCED SUB ACUTE TOXICITY OF PARTHENIUM HYSTEROPHORUS L. AND ITS AMELIORATION WITH PROSOPIS CINERARIA (L.) DRUCE LEAVES IN WISTAR ALBINO RATS

Anita Rathore*, Rohitash Dadhich, Kamal Purohit, Shiv Kumar Sharma1, Chandra Shekhar Vaishnava2, Bincy Joseph3 and Anirudh Khatri4 Department of Veterinary Pathology, College of Veterinary and Animal Science, Navania, Udaipur-313 601, Rajasthan University of Veterinary and Animal Sciences, Bikaner-334 001, Rajasthan, India

Received on: 30.04.2019 ABSTRACT Accepted on: 17.09.2019

An ameliorative effect of Prosopis cineraria leaves on biochemical parameters against induced sub acute toxicity of Parthenium hysterophorus L. in Wistar albino rats was studied. A total of eighty clinically healthy adult albino rats between 2 and 3 months of age of either sex were divided in eight experimental groups each comprising of ten rats. Parthenium toxicity was induced by oral feeding of ethanolic extract of Parthenium at 150, 300 and 450 mg/kg body weight in group II, III and IV, respectively for 28 days. Group V, VI and VII were fed with ethanolic extract of Parthenium at 150, 300 and 450 mg/kg body along with 200 mg/kg body weight of methanolic extract of leaves of Prosopis cineraria. Group I served as control while group VIII was kept as treatment control and fed only methanolic extract of leaves of Prosopis cineraria at 200 mg/kg body weight. The treated rats showed a significant (P<0.05) increase in alanine aminotransferase (ALT), aspartate transaminase (AST), alkaline phosphate (ALP), serum creatinine and serum urea level receiving the different dose of parthenium which indicated a deleterious effect of parthenium on liver cells. Significant reduction of serum total protein was observed in group II, III and IV. Prosopis cineraria could restore the above in group treated with Parthenium at low dose level.

Key words: Parthenium toxicity, Prosopis cineraria, Wistar albino rats

Introduction of various ailments such as helminthiasis, leprosy, dysentery, Parthenium hysterophorus L. was accounted to be one of bronchitis, asthma, leucoderma, piles, tremours of the muscles the seven most dangerous weed of the world. It is an aromatic and wandering of the mind. Its leaves are fodder for camels, annual and obnoxious invasive herb under Asteraceae family, goats and donkeys. Leaf paste of plant is applied on boils and commonly known as congress grass, chatak chandani, gazar blisters, including mouth ulcers in livestock and leaf infusion ghas, dog flea weed and white heads (Rao, 1956; Vertak, 1968; on open sores on the skin (Kirtikar and Basu, 1984; Nandkarni, Maiti, 1983; Adkins et al., 1996; Ramaswami, 1997). The toxic 2000; Khatri et al., 2010, 2011). The present work is designed chemical in plant parts contains sesquiterpene lactones. The to study the biochemical changes during sub acute toxicity of major components of toxin being ‘Parthenin’ and other phenolic Parthenium hysterophorus L. in Wistar albino rats and the acids such as caffeic acid, vanillic acid, anisic acid, chlorogenic protective property of Prosopis cineraria (L.) Druce during acid, parahydroxy-m-benzoic acid and p-anisic acid which are parthenium toxicity. lethal to human beings and animals (Picman et al., 1982; Narsimhan et al., 1984; Sharma and Kaur, 1989; Bezuneh, Materials and Methods 2015). Parthenium is poisonous to livestock if it is consumed A total of 80 rats will be randomly divided into 8 groups or repeatedly in contact with the weed. Those animals can (Group I, II, III, IV, V, VI, VII and VIII). Group-I (n = 10) served as face-off death, rashes on their body and udders, alopecia, loss control in which 1% Tween 80 suspension (vehicle) was of skin pigmentation, allergic skin reactions, dermatitis, administered. Treatment group II was administered ethanolic diarrhoea, anorexia and pruritus. Parthenium may affect the extract of Parthenium @ 150 mg/kg b.wt, group III received psychological behaviour of animals. During scarceness of ethanolic extract of Parthenium @ 300 mg/kg b.wt, group IV fodder cattle, sheep and goats are forced to eat Parthenium was administered ethanolic extract of Parthenium @ 450 mg/ which can taint their meat and make dairy milk unpalatable kg b.wt., group V was given ethanolic extract of Parthenium + due to its irritating odour (Narsimhan et al., 1977; Tudor et al., methanolic extract of Prosopis @ 150 mg/kg b.wt and 200 mg/ 1982; Ahmed et al., 1988). When human beings often come in kg b.wt., respectively, group VI was given ethanolic extract of contact with this weed, it may cause allergy, dermatitis, eczema, Parthenium + methanolic extract of Prosopis @ 300 mg/kg black spots and blisters around eyes, burning rings and blisters b.wt and 200 mg/kg b.wt, respectively and group VII was given over skin, redness of skin and asthma etc. (Lonker et al., 1974; ethanolic extract of Parthenium + methanolic extract of Prosopis Subba Rao et al., 1976; Verma et al., 2001; Handa et al., 2001). @ 450 mg/kg b.wt., and 200 mg/kg b.wt and group VIII served Prosopis cineraria (L.) Druce {Khejri} is a state tree of Rajasthan as treatment control and fed only methanolic extract of Prosopis 200 mg/kg b.wt orally by gavage. The oral LD of ethanolic has been traditionally used by the rural community for treatment 50

*Corresponding author: E-mail ID: [email protected]; Cell: 9460065074; 1Department of Veterinary Medicine, CVAS, Navania, Vallabhnagar, Udaipur-313601, Rajasthan; 2Department of Animal Nutrition, CVAS, Navania; 3Department of Veterinary Microbiology, CVAS, Navania; 4Department of Pharmaceutical Sciences, M.L.S. University, Udaipur, Rajasthan- 313001, India 188 Veterinary Practitioner Vol. 20 No. 2 December 2019 extract of Parthenium hysterophorus against rats was found to remained normal throughout the period of experiment. Prosopis be 676.64 mg/kg body weight (Maurya and Kushwaha, 2010). cineraria supplementation indicated protective role of plant at The animals were kept in polypropylene cages and low dose toxicity in the rats. acclimatized for one week prior to the experiment to alleviate Plasma levels of urea and creatinine are useful any non- specific stress, in the experimental lab under standard biomarkers of renal function in human and animal studies. An managemental conditions [at a temperature of 25°C (± 5°C), increase levels in the plasma is an indication of the loss of with natural 12 hours light/12 hours dark cycle]. Standard rat renal function (Olayinka and Ore, 2015). Similarly Parthenium feed and water provided ad libitum throughout the experimental intoxication elevates the liver enzymes, including ALT, AST and period. The necessary Institute Animal Ethical Committee ALP, may be due to production of reactive oxygen species, approval was obtained. Collection of plant Parthenium was which may enhance lipid peroxidation and toxic aldehydes done from the surrounding area of CVAS Navania, Udaipur which induce inflammation and necrosis in the liver (Aydin, and Prosopis was collected from desert area of Shekhawati 2011; Duzguner and Erdogan, 2012). Total protein level reflects region (Rajasthan). Authentication (Identification) of plant major functional changes in kidney and liver functions. A materials was done from Botanical Survey of India, Jodhpur significant decrease (P<0.05) in serum total protein was (Rajasthan). Five hundred grams of dried aerial parts of the observed in this study. Toxicity or damage to the liver may result plant Parthenium hysterophorus and two hundred and fifty in decreased levels of total protein in blood (Kaneko et al., grams of dried leaves of the plant Prosopis cineraria was 1997). A significant (p<0.05) improvement in total protein levels grinded into fine powder and subjected to soxhlet extraction and reduction in urea, creatinine, ALT, AST and ALP level after with ethanol for Parthenium and methanol for Prosopis for twelve methanolic extract of Prosopis cineraria supplementation may hours and evaporated by using rotary vacuum evaporator. be due to its antioxidant property which can reduce the free Blood samples was collected in tubes, centrifuged at 2,500 radical-mediated oxidative stress (Dharani et al., 2011; rpm for 15 min and the serum separated and stored at -20°C Bangaruswamy et al., 2015). for analysis. Serum samples was analyzed for determination of alanine aminotransferase (ALT) or glutamic pyruvic References transaminase (SGPT), aspartate transaminase (AST) or serum Adkins SW, Navie SC and McFadyen RE (1996) Control of Parthenium weed: A centre for tropical pest management team effort. In glutamic oxaloacetic transaminase (SGOT), alkaline RCH Shepherd (Ed.) Proc. 11th Aust. Weeds Conf., Weed phosphate (ALP), serum creatinine, serum urea and total Sci. Soc. Victoria, Frankston. pp. 573-578. protein. Ahmed MN, Rao PR and Mahendra M (1988) Experimental introduction of acute toxicity in buffalo calves by feeding Parthenium Results and Discussion hysterophorus Linn. Ind. J. Ani. Sci. 58: 731-734. The effect of oral administration of ethanolic extract of Aydin B (2011) Effects of thiacloprid, deltamethrin and their combination Parthenium and methanolic extract of Prosopis on biochemical on oxidative stress in lymphoid organs, polymorphonuclear parameters are shown in Table 1. The treated rats showed a leukocytes and plasma of rats. Pestic Biochem. Physiol. significant (P<0.05) increase in alanine aminotransferase (ALT) 100: 165-171. or serum glutamic pyruvic transaminase (SGPT), aspartate Bangaruswamy D, Jambunathan S, Padma PR and Sundaravadivelu S (2015) In vitro antioxidant activity of Prosopis cineraria transaminase (AST) or serum glutamic oxaloacetic leaves against H2O2 induced oxidative stress in goat liver transaminase (SGOT), alkaline phosphate (ALP), serum slices. Int. J. Pharm. Pharm. Sci. 7(5): 33-37. creatinine and serum urea receiving the different dose of Bezuneh TT (2015) Phytochemistry and antimicrobial activity of Parthenium. Total protein showed significant decrease in II, III Parthenium hysterophorus L.: A review. Sci. J. Anal. Chem. and IV group as compared to control where as group V, VI and 3(3): 30-38. VII receiving prosopis showed counteract untoward effect of Dharani B, Sumathi S, Sivaprabha J and Padma PR (2011) In vitro Parthenium. Group VIII receiving methanolic extract of Prosopis antioxidant potential of Prosopis cineraria leaves. J. Nat. Prod. Plant Resour. 1(3): 26-32.

Table 1: Effect on biochemical parameters in rats after 28 days oral administration of different dose of ethanolic extract of parthenium and its amelioration with methanolic extract of prosopis Biochemical parameters Groups ALT/SGPT AST/SGOT ALP Serum Serum urea Total protein (IU/L) (IU/L) (IU/L) Creatinine (mg/dl) (g/dl) (mg/dl) I 46.09 ± 1.32e 152.18 ± 2.36e 61.48 ± 1.36e 0.63 ± 0.01e 34.35 ± 0.51d 8.15 ± 0.11a II 58.32 ± 1.10c 179.88 ± 1.66c 87.51 ± 0.90c 0.79 ± 0.01c 43.39 ± 0.81c 7.05 ± 0.09c III 69.77 ± 0.74b 202.59 ± 2.61b 99.91 ± 2.13b 0.92 ± 0.01b 52.02 ± 1.24b 6.41 ± 0.11d IV 78.46 ± 0.93a 247.06 ± 3.39a 133.75 ± 2.09a 1.08 ± 0.02a 65.99 ± 1.63a 5.46 ± 0.11e V 52.22 ± 0.96d 166.91 ± 2.36d 75.97 ± 0.80d 0.72 ± 0.01d 39.56 ± 0.39c 7.68 ± 0.10b VI 65.76 ± 0.97b 194.07 ± 1.40b 90.03 ± 1.06c 0.88 ± 0.01c 50.18 ± 0.97b 6.74 ± 0.08cd VII 76.29 ± 1.16a 241.58 ± 1.64a 127.57 ± 1.09a 1.06 ± 0.02a 65.12 ± 1.52a 5.62 ± 0.05e VIII 45.76 ± 1.40e 151.88 ± 2.58e 61.08 ± 1.08e 0.63 ± 0.01e 34.09 ± 0.61d 8.21 ± 0.09a All values are represent Mean ± SEM; n=10 in each group; values bearing different superscript in the same column differ significantly between groups at P<0.05 in Tukey’s multiple comparison post hoc test 189 Veterinary Practitioner Vol. 20 No. 2 December 2019

Duzguner V and Erdogan S (2012) Chronic exposure to imidacloprid Narsimhan TR, Ananth M, Narayana S, Rajendra B, Mangla A and Rao induces inflammation and oxidative stress in the liver and PV (1984) Toxicity of Parthenium hysterophorus L. Curr. central nervous system of rats. Pestic. Biochem. Physiol. Sci. 46(1): 15. 104:58-64. Olayinka ET and Ore A (2015) Hepatotoxicity, nephrotoxicity and Handa S, Sahoo B and Sharma VK (2001) Oral hyposensitisationin oxidative stress in rat testis following exposure to patients with contact dermatitis from Parthenium haloxyfop-p-methyl ester, an aryloxyphenoxypropionate hysterophorus. Contact Dermatitis. 44: 425-427. herbicide. Toxics. 3: 373-89. Kaneko JJ, Harvey JW and Bruss ML (1997) Clinical biochemistry of Picman AK, Picman J and Towers GH (1982) Cross reactivity between domestic animals. 5th ed. Academic Press, San Diego, sesquiterpene lactones and parthenin in parthenin California, USA. pp. 117-138. sensitized guinea pigs. Contact Dermatitis. 8: 294-301. Khatri A, Rathore A and Patil UK (2010) Prosopis cineraria (L.) Druce: Ramaswami PP (1997) Potential uses of Parthenium. In: Proc. First Int. A boon plant of desert- An overview. Int. J. Biomed. Adv. Conf. on Parthenium Management. pp. 77-80. Res. 4(2): 27-29. Rao RS (1956) Parthenium: A new record for India. J. Bombay Nat. Khatri A, Rathore A and Patil UK (2011) Assessment of anthelmintic His. Soc. 54: 218-220. activity of the bark of Prosopis cineraria (L.) Druce. Indian Sharma SC and Kaur S (1989) Airborne contact dermatitis from J. Nat. Prod. Resour. 2(4): 512-514. Composite plants in Northern India. Contact Dermatitis. 21: Kirtikar KR and Basu BD (1984) Indian medicinal plants, (Vol. II), Leader 1-5. road, Allahabad, India, page no.910. Subba Rao PV, Mangla A, Subba Rao BS and Prakash KM (1976) Lonker A, Mitchell JC and Colnan CD (1974) Contact dermatitis from Clinical and immunological studies on person exposed to Parthenium hysterophorus L. and Annual report of the St. Parthenium hysterophorus L. Experianta. 33: 1387-1388. John’s Hospital Dermatological Soc., London. 60(7): 43-53. Tudor GD, Ford AL, Armstrong TR and Bromage EK (1982) Taints in Maiti GS (1983) An untold study on the occurrence of the Parthenium meat from sheep grazing Parthenium hysterophorus. Aust. hysterophorus L. in India. Ind. Forest. 6(4): 328-329. J. Exp. Agri. Husb. 22(115): 43-46. Maurya S and Kushwaha VB (2010) Effect of ethanolic extract of Verma KK, Sirka CS and Raman C (2001) Contact dermatitis due to Parthenium hysterophorus on haematological paramerttes plants: Challenges and prospects. Ind. Pract. 54(11): 791- in rat. Bioscan. 5(3): 437-440. 796. Nandkarni KM (2000) Indian material medica (Vol. I), Popular prakashan, Vertak VD (1968) Weed that threatens crop and grasslands in Mumbai, pp. 1011. Maharastra. Ind. Fmg. 18: 23-24. Narasimhan TR, Ananth M, Swamy MN, Babu MR, Mangala A and Rao PVS (1977) Toxicity of Parthenium hysterophorus L. to cattle and buffaloes. Experientia. 33(10): 1358-1359.

190 Veterinary Practitioner Vol. 20 No. 2 December 2019

EVALUATION OF CARDIAC TOXICITY IN DOGS BITTEN BY VIPER SNAKE

J.P. Varshney1 and H.D. Monapara2 Nandini Veterinary Hospital, Ghod Dod Road, Surat-395 007, Gujarat, India

Received on: 21.10.2019 ABSTRACT Accepted on: 27.11.2019

Eleven clinical cases of snake bite in dogs, referred at the hospital with in 2.5 to 6 hrs of envenomation, were subjected to cardiac evaluation. The snake bites were characterized by fang’s mark associated with skin discolouration surrounding fang marks in all cases. Cardiac auscultation was almost normal in three dogs while othes showed variations in heart rate. The electrocardiographic examination revealed sinus rhythm with normal heart rate, multifocal continuous atrial tachycardia, sinus bradycardia, sinus tachycar- dia, ventricular premature complexes, ventricular flutter and ventricular tachycardia in 3, 1, 1, 2, 1, 1 and 2 envenomed dogs, respectively. The levels of cTn-I varied from< 0.1 to 5.8 ng/ml. The study revealed varying level of cardio-toxicity (based on cTn-I levels) in seven (63.63%) dogs naturally bitten by viper snakes. The dogs were treated with polyvalent anti-snake venom, tetanus toxoid, dexamethasone, fluid, enrofloxacin and vitamin K. Despite treatment four dogs, with multiple bite marks, severe arrhythmia (multifocal continuous atrial tachycardia, ventricular tachycardia and ventricular flutter) with high level of cTn-I could not survive.

Key words: Atrial tachycardia, cTn-I, dogs, electrocardiography, envenomation, viper

Introduction Detailed clinical examination Snake bites are not uncommon in dogs in India. There All the dogs were thoroughly examined clinically as per are many scattered reports of snake bites in dogs in India standard procedures. (Anada et al., 2009; Hussain et al., 2011; Kumar et al., 2016). In Indian continent Indian cobra, Russell viper and common krait Electrocardiography are the poisonous snakes. The clinical manifestations of All dogs were immediately subjected to electro- envenomation depend on the type of the snake venom and cardiography in right lateral recumbency employing hex axial severity of clinical symptoms depends on the dose of the venom lead system (Magic R - Maestros) in a calm and comfortable injected by the snake and the body weight of the dog. Venom of room. Electrocardiograms were analyzed in details for heart the cobra and krait is neurotoxic and cardiotoxic. Viper and rate, arrhythmias or any other specific changes. elapid venom can cause coagulation defect, local oedema, Estimation of cTn-I neurotoxicity, and direct myocardial damage manifesting as Five milliliter of the blood was drawn and serum was arrhythmias, bradycardia, tachycardia or hypotension in separated. cardiac troponin-I was estimated quantitatively humans (Mehta and Sashindran, 2002). It seems that cardiac (chemiluminescent enzyme immunoassay method (CLEIA) evaluation has not been done in dogs bitten by viper snakes in PATHFAST, Mitsubishi Kagaku Iatron Inc, Tokyo, Japan) . India. The aim of the present investigation was to evaluate cardiac functioning in dogs bitten by vipers in natural conditions Treatment protocol and to provide rational treatment. Treatment was initiated with lyophilized polyvalent anti- snake venom (Bharat Serums and Vaccine Limited, Ambemath Materials and Methods East-421501) after testing it intradermally for any systemic Dogs reaction as per the guidelines. The lyophilized snake venom Eleven clinical cases of snake bite in dogs (Pomeranian antiserum was reconstituted by adding 10 ml sterile water for 2, Labrador 3, German Shepherd 4, Great dane 1 and Boxer 1) injection in it and shaking it gently. The reconstituted snake of both sexes (male 8, female 3), varying age (1.5 year to 10 venom antiserum was further diluted in 500 ml of normal saline year) and weight (9.5 kg to 60 kg), referred at the hospital and was administered intravenously slowly over 2 hrs period. within 2.5 to 6 hours of bite during a period of 10 years, were One to two doses as per body weight and severity of symptoms investigated for cardiac insult employing electrocardiography was given. Dexamethasone (2.0 mg/kg i/m bid for 2 days), and estimation of cardiac troponin-I. All dogs were privately tetanus toxoid (0.5 ml i/m once), Vitamin K (Phytomenadione 1 owned. mg/0.5 ml i/m for 2 days), gentamicin (2.2 mg/kg i/m bid for 4- Snake identification 5 days)/enrofloxacin (5.0 mg/kg i/m once daily for 4-5 days), In most of the cases owners brought photo of the snake were also given. or a killed snake (in 2 cases only). The snakes were identified Results as viper because of their triangular head (wider than neck) Eleven dogs (Pomeranian 2, Labrador 3, German covered with small scales with and without a loreal pit between Shepherd 4, Great dane 1 and Boxer 1) of both sexes (male 8, nostril and eye and elliptical pupils (Ahmed et al., 2008). female 3), varying age (1.5 year to 10 year) and weight (9.5 kg

1Senior Consultant, Veterinary Medicine, Nandini Veterinary Hospital, Surat-395001, email: [email protected], Mobile 9375763020; 2Veterinary Officer, Nandini Veterinary Hospital, Surat-395001, email: [email protected], Mobile 9712027445

191 Veterinary Practitioner Vol. 20 No. 2 December 2019 to 60 kg) with the history of snake bite were examined in detail. atrial tachycardia, ventricular premature complex, ventricular The clinical examination revealed, cyanotic swollen tachycardia and ventricular flutter) in eight envenomed dogs haemorrhagic areas with fang marks (all cases), recumbency (72.72%). Of which multifocal continuous atrial tachycardia, (three cases), tachycardia (seven cases), marked weakness ventricular tachycardia and ventricular flutter observed in four (eight cases cases), shallow respiration (five cases), oliguria dogs were of serious nature. Arrhythmias of ventricular origin (one case), increased temperature (103.8 0F-one case), in dogs bitten by vipers are in agreement with the observations depression and increased salivation (four cases). The fang of Vestberg et al. (2017). Sinus tachycardia and atrial marks were seen on lower lip ( Fig.1) and nose, tongue, thorax arrhythmias have also been reported in dogs envenomed with region (Fig. 2), head, neck, fore limbs and hind limbs (Fig. 3) in viper bites (Palender et al., 2010). Four dogs has very minor 2, 1, 1, 2,1, 1 and 2 cases, respectively. increase in cTn-I (0.1 ng/ml) and other seven significant The findings of electrocardiographic examination and increase varying from 0.3 to 5.80 ng/ml. The variation in cTn-I cardiac troponin-I estimation are given in the Table 1. Out of 11 levels may be due variations in time interval between bite and dogs, three (German shepherd 1, Labrador 1 and Boxer 1) sampling. The increase in cTn-I levels is an indication of had normal electrocardiograms and cTn-I levels (< 0.1 ng/ myocardial injury. Mode of action of viper toxins causing ml). One Pomeranian dog showed multifocal continuous atrial myocardial damage is not entirely clear. However, it has been tachycardia (Fig. 4) with increased level of cTn-I (3.25 ng/ml). suggested that cardiotoxic components of viper venom Sinus bradycardia (H R 55 bpm with R-R interval of 1.09 second) increase cellular membrane permeability to ions; resulting in with increased level of cTn-I (2.8 ng/ml) was observed in a altered fibre excitability damaging the myocardium and cardiac Great dane dog. One Labrador (H.R. 200 bpm, R-R interval 0.3 conduction (Goddard et al., 2011). This may possibly support second and cTn-I 0.3 ng/ml) and one German Shepherd (H.R. arrhythmias seen even in the absence of significant elevation 240 bpm, R-R interval 0.25 second, cTn-I 0.8 ng/ml) showed of cTn-I (Palender et al., 2010). Other source of myocardial sinus tachycardia with slightly increased levels of cTn-I. One injury may be the systemic inflammation caused by the snake Pomeranian had a few isolated ventricular premature bite, (Langhorn et al., 2014). In humans, a rise in cTn-I generally complexes (10 per minute ) with almost normal level of cTn-I occurs 2-3 h after a myocardial injury (Mac Rae et al., 2006) (<0.10 ng/ml). Ventricular tachycardia (Fig. 5) with increased and almost similar is release kinetics of cTn-I in dogs levels of cTn-I was observed in one Labrador (3.75 ng/ml) and (Langhorn and Willesen, 2016). Treatment instituted with one German Shepherd (3.98 ng/ml). polyvalent anti-snake venom, dexamethasone, tetanus toxoid, Ventricular flutter (Fig. 6) with increased level of cTn-I (5.8 antibiotics, fluid was successful in 63.63% cases. Four dogs ng/ml) was observed in one German Shepherd. (36.37%) which collapsed had significant arrhythmias and Diagnosis of the snake bite was based on detection of higher level of cTn-I. Polyvalent anti-snake venom was the fangs marks, local tissue damage, discoloured area rational therapy when it was identified as viper bites. surrounding fang marks and oozing of bloody fluid from them Dexamethasone and fluid therapy was given to avoid shock. and identification of snakes. Prophylactically tetanus toxoid and antibiotics were given to combat bacterial infections as fangs of the snakes may be Discussion contaminated. Sometimes lyophilized polyvalent anti-snake Eleven cases with the history of snake bite, referred at the venom may cause anaphylactic reactions. To avoid this hospital, were evaluated for cardiotoxicity. The characteristic unwanted event intradermal testing of the anti-snake venom fang marks surrounded by skin discolouration, oozing of blood was done in all dogs. In dogs with severe symptoms antivenom mixed fluid, local odema and pain (Aroch and Harrus, 1999); was repeated. No standard guidelines for the dose and and identification of snake as per criterias (triangular head duration of anti snake venom in dogs is available. A unit of covered with small scales with and without a loreal pit between antivenom neutralises a fixed quantity of venom and has nostril and eye and elliptical pupils) described by Ahmed et al. nothing to do with the size of the patient. In view of venom/ (2008) led to diagnosis of viper envenomation in these dogs. mass ratio, small dogs often are worse off than large dogs. Electrocardiograms revealed various types of arrhythmias The dose of antivenom cannot be set in mg/kg or m/kg as for (sinus bradycardia, sinus tachycardia, multifocal continuous traditional drugs.

Table 1: Electrocardiographic findings and level of cardiac troponin-I in dogs bitten by viper snake S.No. Envenomed dogs Electrocardiographic findings cTn-I level 1 Pomeranian Ventricular Premature complexes <0.10 ng/ml 2 Pomeranian Multifocal continuous atrial tachycardia 3.25 ng/ml 3. Labrador Ventricular tachycardia 3.75 ng/ml 4. Labrador Sinus tachycardia (HR 200 bpm) 0.3 ng/ml 5. Labrador Normal heart rate with sinus rhythm <0.10 ng/ml 6. German Shepherd Ventricular flutter 5.8 ng/ml 7. German Shepherd Sinus tachycardia ( HR 240 bpm) 0.80 ng/ml 8. German Shepherd Ventricular tachycardia 3.98 ng/ml 9. German Shepherd Normal heart rate with sinus rhythm <0.10 ng/ml

10. Great dane Sinus Bradycardia (HR 55 bpm) 2.8 ng/ml 11. Boxer Normal heart rate with sinus rhythm <0.10 ng/ml

192 Veterinary Practitioner Vol. 20 No. 2 December 2019

Fig. 1: Fang marks (arrow) on lower lip in a Labrador Fig. 3: Fang marks ( arrows) on foot pad in a German Shepherd dog The study revealed that in many cases of viper envenomation, cardiac injury was associated and affected the survival of the envenomed dogs. In India, this seems to be the first record of cardiotoxicity in dogs bitten by viper snakes.

Acknowledgements The authors are grateful to Managing Trustees and Board of Trustees, Nandini Veterinary Hospital, Shri Surat Panjarapole Trust, Ghod Dod Road, Surat for providing facilities and willing co-operation of the owners.

References Ahmed SM, Ahmed M, Nadeem A, Mahajan J, Choudhary A and Pal J (2008) Emergency Treatment of Snake Bite: Pearls from Fig. 2: Fang marks (arrows) on thorax in a Pomeranian dog

Fig. 4: Electrocardiogram (sensitivity 1, speed 25 mm/second) of a Pomeranian dog bitten by Viper (lesion in Fig. 2) taken at the time of referral (within 2.5 hrs of bite) showing regular ventricular heart rate of 260 bpm, narrow QRS (0.3 mV) and non visible P wave. All complexes have P’ (premature) waves of varying configuration rather than normal P wave. S-T coving is also visible. The tracing was suggestive of multifocal continuous atrial tachycardia

Fig.5: Electrocardiogram (sensitivity 1, speed 25 mm/second) of a Labrador dog bitten by Viper taken at the time of referral (within 6 hrs of bite) showing ventricular tachycardia

Fig. 6: Electrocardiogram (sensitivity 1, speed 25 mm/second) of a German Shepherd dog bitten by Viper taken at the time of referral (within 3 hrs of bite) showing ventricular flutter. 193 Veterinary Practitioner Vol. 20 No. 2 December 2019

Literature. J. Emerg. Trauma Shock. 1: 97-105. snake envenomation and its relation to systemic Anada KJ, Mohan K , Kamran A and Sharda R (2009) Snake bite in inflammation. J. Vet. Emerg. Crit. Care. 24: 174-181. dogs and its successful treatment. Vet. World. 2: 66- Langhorn R and Willesen JL (2016) Cardiac troponins in dogs 67. and cats. J. Vet. Intern. Med. 30: 36-50. Aroch I and Harrus S (1999) Retrospective study of the MacRae AR, Kavsak PA, Lustig V, Bhargava R, Vandersluis R epidemiological, clinical, haematological and biochemical and Palomaki GE (2006) Assessing the requirement findings in 109 dogs poisoned by Viper axanthina for the 6-h interval between specimens in the American palestinae. Vet. Rec. 144: 532-35. heart association classification of myocardial infarction Goddard A, Schoeman JP, Leisewitz AL, Nagel SS and Aroch I in epidemiology and clinical research studies. Clin. (2011) Clinicopathologic abnormalities associated with Chem. 52: 812-818. snake envenomation in domestic animals. Vet. Clin. Mehta SR and Sashindran VK (2002) Clinical features and Pathol. 40: 282-292. management of snake bites. Med. J. Armed Forces Hussain MMA , Joseph C and Basavanagowda MT (2011) India. 58: 247-249. Successfull management of viper envenomation in a Pelander L, Ljungvall I and Häggström J (2010) Myocardial cell Labrador dog. Intas Polivet. 12: 212-213. damage in 24 dogs bitten by the common European Kumar A, Rohi RR, Pawar P, Yadav R and Yadav P (2016) viper (Vipera berus). Vet. Rec. 166: 687-690. Therapeutic management of snake bite in a male dog. Vestberg AR, Tidholm A and Ljungvall I (2017) Twenty four hour Sch. J. Agric.Vet. Sci. 3: 103-104. ambulatory electrocardiography characterizarion of Langhorn R, Persson F, Åblad B, Goddard A, Schoeman JP heart rhythm in Vipera berus envenomed dogs. Acta. and Willesen JL (2014) Myocardial injury in dogs with Vet. Scand. 59: 28.

194 Veterinary Practitioner Vol. 20 No. 2 December 2019

STUDY OF DERMAL MYCOSIS IN CAMELS (CAMELUS DROMEDARIUS) IN AND AROUND BIKANER

Gaurav Kumar Jain1, A. P. Singh, F.C. Tuteja2, Sumnil Marwaha3, Ankita Sharma4, J.P. Kachhawa, S.R. Gupta, A.K. Gaur5 and Jitendra Tanwar6 Department of Clinical Veterinary Medicine, Ethics and Jurisprudence, College of Veterinary and Animal Science Rajasthan University of Veterinary and Animal Sciences, Bikaner-334 001, Rajasthan, India

Received on: 29.05.2019 ABSTRACT Accepted on: 17.09.2019

A study was conducted during the year 2017-2018 in the villages adjacent to Bikaner, Rajasthan. A total of 24 dermal mycoses infected camels of either sex and age groups were included in the present study. Out of 24 infected cases, 14 found infected with dermatophytes which were Trichophyton concentricum, T. interdigitale,T. verrucosum, T. schoenleinii, Microsporam audninii, M. gypseum and Epidermophyton floccosum. Dermal mycoses occur in majority of the camels during post rainy season. The major clinical manifestations were itching, alopecia, hard crusty circular lesions specially concentrated over neck, chest, axillaries, legs and abdomen.

Key words: Dermatophytes, zoonotic, camel

Introduction a glass slide with two or three drops of 20 per cent potassium Dermatophytes are responsible for the dermatophytosis hydroxide and placing a cover slip over it. The sample was warmed which is a common contagious skin disease. Generally these for five minutes over a flame and was then carefully examined fungi are keratophilic in nature, so nails, skin coat, hairs are the microscopically for the presence of hyphae and/or arthroconidia. most affected part of the body. Microsporum, Trichophyton and Epidermophyton of this group are mainly known to cause 3. Cultural examination dermatophytosis and infect the keratinized tissues; hair, skin and Samples were first mixed with Sabouraud’s dextrose nails (Aly et al., 2000; Aman et al., 2001; Elewski, 2000; Nweze, chloramphenicol broth and were incubated for up to 24 hours. 2001; Roldan et al., 2000 and Rubio-Calvo et al., 2001). These are Then these samples were inoculated onto Sabouraud’s dextrose 0 zoonotic in nature that’s why these are important veterinary and chloramphenicol agar (SDCA) plate and were incubated at 28 C human pathogens worldwide (Chretien and Garagusi, 1990). for 3-4 weeks. These plates were examined daily for the growth of the fungi. The resultant growth was examined for the colony Materials and Methods morphology. Microscopic examination was carried out using either The present study in camels was carried out on 24 cases lacto phenol cotton blue or calcofluor white stains using wet mount affected with dermal mycoses (irrespective of sex, age and breed) method (Halley and Standard, 1973). Fungal species were in and around Bikaner district, an arid desert region of Rajasthan. identified on the basis of colony morphology and microscopic Camels showing peculiar skin lesion of mycoses along with other characteristics (Colin et al., 2013). signs and symptoms of pruritis, alopecia were included in the study. All the relevant samples and photographs of the lesions Results and Discussion thought to be necessary were collected. Confirmation of dermal Out of the total 24 cases of dermal mycoses investigated mycoses was done on the basis of direct microscopic examination fourteen cases were found infected with dermatophytes. Various and cultural examination of skin scrappings. dermatophytes identified along with number of animals infected is shown in Table 1. 1. Collection of samples Clinical signs recorded from Trichophyton species infected In affected camels with clear cut skin lesions, debris or faecal camels were dry, hard, crusty, greyish white and granulomatus materials present were first removed with help of scrubber and larger lesions over legs, axillaries, tail and abdomen (Fig. 1). then washed with water and dried with help of clean cloth. Then Whereas, the case infected with Microsporum species showed using a blunt scalpel lesions were firmly scrapped, particularly at white small disc shaped dry, hard, crusty, fast spreading lesions, the advancing border. If multiple lesions were present then the markings typical of ring worm over the thigh, leg, axillaries, tail and most recent were chosen for scrapping as old loose scale is often abdomen (Fig. 10). The case infected with Epidermophyton not suitable. The top of any fresh lesions were removed as the species showed lesions which were very peculiar as if hair burnt fungus is often plentiful in the roof of the lesions. These samples with fire leaving ash behind deposit over skin and lesions found were collected in sterile vials meant for sterile collection of clinical throughout the body (Fig.15). Associated symptoms in all samples. deramtophytosis affected camels were alopecia and itching. Trichophyton concentricum colonies were slow growing, 2. Direct microscopic examination raised and folded, glabrous becoming suede like, white to The examination was performed by placing the scrapping on #1Part of M.V.Sc. Thesis of First author and Corresponding address: Teaching Associate, VUTRC, Bakalia, Nagaur, Rajasthan, RAJUVAS, Bikaner; 2Senior Scientist, ICAR-NRC on Camel, Jorbeer, Bikaner; 3Ph.D. Scholar, Department of Veterinary Medicine, LUVAS, Hisar, Haryana; 4Veterinary Officer, Department of Animal Husbandry, Jhalawar, Rajasthan; 5Assistant Professor, Centre for Ethno-veterinary Practices and Alternative Medicines; 6Teaching Associate, VCC, CVAS, Bikaner 195 Veterinary Practitioner Vol. 20 No. 2 December 2019

Fig.1: Photograph showing lesions caused by Trichophyton species Fig.5: Microphotograph showing slender, clavate, smooth walled, multiseptate macroconidia and spiral hyphae of T. interdigitale

Fig.2: Photograph showing colony of T. Concentricum (front view 10 Fig.6: Photograph showing colony of T. violaceum (front view 10 days) days)

Fig.3: Microphotograph showiing septate hyphae which have “antler Fig.7: Microphotograph showing hyphae of T. violaceum were relatively tips of T. concentricum broad, tortuous, much branched and distorted and show small central fat globules granules

Fig.4: Photograph showing colony of T. interdigitale (front view 10 Fig.8: Photograph showing colony of T. schoenleinii (front view 10 days) days) cream coloured growth in front view of the plate. In reverse view it Trichophyton interdigitale colonies were usually flat, white to was buff to yellow brown to brown (Fig. 2). Microscopically the cream in colour with a powdery to suede-like surface and yellowish culture showed broad, much branched, irregular, septate hyphae to pinkish brown reverse pigmented, often becoming a darker which may have “antler tips”. Chlamydospores were often present red-brown with age (Fig. 4). Numerous subspherical to pyriform in older cultures. Macroconidia and microconidia were usually not microconidia, occasional spiral hyphae and spherical produced (Fig. 3). chlamydospores were present, the later being more abundant in

196 Veterinary Practitioner Vol. 20 No. 2 December 2019

Fig.9: Microphotograph Numerous chlamydospores with Fig.14: Microphotograph showing Macroconidia less barrel shaped, characteristic antler “nail head” hyphae, also known as “favic rounded tips and have 6 or fewer cells of M. gypseum chandeliers” of T. schoenleinii

Fig.10: Photograph showing lesions caused by Microsporum species Fig.15: Photograph showing lesions caused by Epidermophyton species

Fig.11: Photograph showing colony of M.audouinii (front view Fig.16: Photograph showing colony of E. floccosum (front view 10 10 days) days)

Fig.12: Microphotograph showing Thick-walled intercalary Fig.17: Microphotograph showing chlamydospores E. floccosum chlamydoconid iophores of M.audouinii older cultures. Occasional slender, clavate, smooth walled, multiseptate macroconidia were also present in some cultures (Fig. 5). Trichophyton violaceum macroscopically showed glabrous, heaped and folded and violet in colour in front view of plate and a dark red brown in colour at reverse (Fig. 6). Microscopically characteristics hyphae were broad tortuous, much branched and distorted and also show small central fat globules and granules (Fig. 7). Trichophyton schoenleinii colonies were slow growing, waxy Fig.13: Photograph showing colony of M. gypseum (front view 10 or suede-like with a deeply folded honey-comb-like thallus and days) 197 Veterinary Practitioner Vol. 20 No. 2 December 2019

Table 1: Dermatophytes identified along with number of the camels the 50 camels examined 16 were infected with such lesions. affected Baghza et al. (2016) isolated and identified dermatophytes from S. Dermatophyte Affected Percentage 165 suspected camels in Dhamar area, Yemen. The frequency of No. identified camels Trichophyton and Microsporum genera were 89.4% and 10.6% of the isolated genera, respectively. T. schoenlenii showed the E. floccosum 1. 5 35.71% highest frequency (49.6%) followed by T. verrucosum (14.6%), T. 2. M. audouinii 1 7.14% mentagrophytes (13%), T. tonsurans (12.2%), M. audouinii ( 5.7%) 3. M. gypseum 3 21.42% and M. canis (4.9%) of the identified species. Wernery and Kaaden (2002) reported T. schoenleinii, M. gypseum and M. canis were 4. T. concentricum 1 7.14% the dermatophytes reported as causes of ringworm in dromedary 5. T. schoenleinii 1 7.14% camels. Gitao et al. (1998b) reported mixed infection of D. 6. T. violaceum 2 14.28% congolensis and M. gypseum in camels reared on a dairy farm in Saudi Arabia. 7. T. interdigitale 1 7.14% References some sub-surface growth. The thallus was cream coloured to Al-Ani FK, Younes FA and Al-Rawashdeh (2002) Ringworm infection of yellow to orange brown in front view of plate (Fig. 8). Microscopic cattle and horses in Jordan. Acta Veterinaria Brno. 71(1): 55- examination of fungal culture showed no macroconidia and 60. microconidia in routine cultures; however numerous Aly R, Hay RJ, Del Palacio A and Galimberti R (2000) Epidemiology of Tinea chlamydoconidia were present. Characteristic antler hyphae with capitis. Medical Mycology. 38: 183-188. swollen nail head tips were present (Fig. 9). Aman S, Haroon TS, Hussain I, Bokhari MA and Khurshid K (2001) Tinea unguium in Lahore, Pakistan. Medical Mycology. 39: 177-180. Microsporum audouinii : Macroscopically colony on SDCA Baghza, Najla M, Abdulelah H, Al-Adhroey and Abdullatif D Ali (2016) was flat, spreading, greyish white to light tan-white in colour and Isolation and Identification of Potential Zoonotic Dermatophytes have a dense suede like to downy surface suggestive of mouse from Domestic Camels in Dhamar Area, Yemen. Am. J. Hlth fur in texture. Reverse can be buff, with granular to sugary texture Res. 4(3): 4650. imparted by heavy sporulation in front view of plate (Fig. 11). Chatterjee A, Chakraborty P, Chattopadhyay D and Sengupta DN (1978) Microscopically culture showed numerous less barrel shaped Isolation of Trichophyton schoenleinii from a camel. Indian J. macroconidia were typically rounded tips. Microconidia had six or Anim. Health. 17: 79-81. fewer cells (Fig. 12). Morphological characterstics of these colonies Chretien JH and Garagusi VF (1990) Infections associated with pets. Am. Fam. Physician. 41: 831-845. and microscopic features were as described by Colin et al. (2013). Colin K Campbell, Elizabeth M Johnson and David W Warnock (2013) Microsporum gypseum: Macroscopically colony was buff, with Identification of pathogenic fungi, 2nd edn. Wiley Blackwell granular to sugary texture imparted by heavy sporulation in front Publication U.K. view of plate (Fig. 13). Microscopically culture showed numerous Elewski BE (2000) Tinea capitis: a current perspective. J. Am. Acad. less barrel shaped macroconidia with typically rounded tips. Dermatol. 42: 1-20. Microconidia had six or fewer cells (Fig. 14). Gitao CG, Agab H and Khalifalla AJ (1998) An outbreak of a mixed infection Epidermophyton floccosum colonies are usually slow of Dermatophilus congolensis and Microsporum gypseum in growing, greenish brown or khaki-coloured with a suede-like camels (Camelus dromedaríus) in Saudi Arabia. Revue scientifique et technique International Office of Epizootics. surface, raised and folded in the centre, with a flat periphery and 17: 749-755. submerged fringe of growth (Fig. 16). Older cultures may develop Halley LD and Standard PG (1973) Laboratory Methods in Medical Mycology. white pleomorphic tufts of mycelium. A deep yellowish-brown 3rd ed. U S Department of Health, Education and Welfare, reverse pigment is usually present. Microscopic morphology Center of Disease Control, Atlanta, pp. 41- 57. showed characteristic smooth, thin-walled macroconidia which Nweze EI (2001) Etiology of dermatophytoses amongst children in are often produced in clusters growing directly from the hyphae. northeastern Nigeria. Med. Mycol. 39: 181-184. Numerous chlamydospores were formed in older cultures (Fig.17). Roldan YB, Mata-Essayag S and Hartung C (2000) Erysipelas and Tinea Microconidia were not formed. pedis. Mycoses. 43: 181-183. Rubio-Calvo C, Gil-Tomas J, Rezusta-Lopez A and Benito-Ruesca R (2001) Some of the Trichophyton and Microsporum species have The aetiological agents of Tinea capitis in Zaragoza (Spain). world wide distribution while others have a limited geographic Mycoses. 44: 55-58. distribution. These dermatphytes are able to invade keratinized Tuteja FC, Dahiya SS and Narnaware SD (2015) Prevalence of bacterial tissues like hairs, nails, skin due to presence of several enzymes and fungal diseases in dromedary camels in the Rajasthan such as acid proteinases, elastase, keratinases and other state of India. Vet. Pract. 16(1): 28-32. proteinases which act as virulence factors (Weitzman and Tuteja FC, Patil NV, Nagarajan G, Dahiya SS and Narnaware SD (2013) Summerbell, 1995). Camel dermal mycoses caused by dermatophytes. J. Camel Infection with T. schoenleinii (Chatterjee et al., 1978; Al-Ani et Pract. Res. 20(2): 157-165. Weitzman I and Summerbell RC (1995) The dermatophytes. Clin. Micro. al. (1995); Wisal et al., (2010) has been reported in camels. Tuteja Rev. 8: 240-259. et al. (2013, 2015) reported common species of dermatophytes Wernery U and Kaaden OR (2002) Infectious Diseases of Camelids. i.e. Microsporum and Trichophyton isolated from camel skin lesions Blackwell Science, Berlin, pp. 23, 33, 87, 137, 181, 276, 285, in India included M. audouinii, T. schoenleinii, T. concentricum, T. 373. violaceum, and T. rubrum. Tuteja et al. (2013) also reported skin Wisal G Abdalla and Salim MO (2010) Isolation and identification of infection in a herd of 31 camel at Charanwala (Bajju) with fast Dermatophytes from infected Camels. Sudan J. Vet spreading lesions caused by Epidermophyton floccosum. Out of Res. 25: 94-53.

198 Veterinary Practitioner Vol. 20 No. 2 December 2019

EFFECT OF SUBCLINICAL MASTITIS ON HAEMATOLOGICAL AND SERUM MINERAL PROFILE IN INDIGENOUS CATTLE#

Sunita Choudhary*, Anil Ahuja1, A.P. Singh, Anju Chahar2 and Rajesh Nehra3 Department of Clinical Veterinary Medicine, Ethics and Jurisprudence, College of Veterinary and Animal Science Rajasthan University of Veterinary and Animal Sciences, Bikaner-334 001, Rajasthan, India

Received on: 05.06.2019 ABSTRACT Accepted on: 19.09.2019

The present study was conducted to determine the effect of subclinical mastitis (SCM) on haematological parameter and serum mineral profile of indigenous cattle. Samples were collected from 100 indigenous cattle for screening from LRS, Rathi farm, Bikaner. subc;inical mastitis was diagnosed based on bacterial isolation and 54 animals were found positive for subclinical mastitis. Blood sample of positive animals were analyzed for haematological and serum mineral profile. Haematology revealed significantly (P<0.05) higher average values of TLC in subclinically (9.20 x 103/µl) infected animals than healthy animals (6.87x 103/µl). Differential leulocyte counts revealed neutrophilia and lymphopenia. Serum mineral profile of 54 positive SCM animals revealed statistically significant increase (P<0.01) in calcium (13.27± 0.12 mg/dl) and phosphorus (4.85±0.13 mg/dl) levels where as non significant difference in magnesium level (2.27±0.10 mg/dl) compared to healthy control animals. Study on micro minerals in serum revealed that the mean ± SE value of copper (7.01±0.10 µmol/L), manganese (2.93±0.08 µmol/L), zinc (11.56±0.13 µmol/L) and selenium (32.03 ± 0.16 µg/ml) was statistically significantly decreased (P<0.01) in subclinical mastitic animals compared to healthy control group. The changes of haematological and mineral constituents are important indicators of the physiological or pathological state of the animal infected with subclinical mastitis. The requirements of trace minerals like Cu, Zn, Mn and Se were increased in subclinical mastitis as evidenced by their decreased levels in and improved response on their supplementation.

Key words: Subclinical mastitis, haematology, serum mineral profile

Introduction (Muhee et al., 2017). Hence, the present study was undertaken Subclinical mastitis occurs when there are no observable to evaluate the haematological changes and mineral alterations abnormalities of the udder or milk but milk production decrease in indigenous cattle affected with subclinical mastitis. and bacteria are present in milk (Bramley et al.,1996). Mastitis may be clinical or subclinical, with subclinical Materials and Methods infection preceding clinical manifestation. Yet the relationship In the present study 100 indigenous cattle were screened between the two within a herd is not predictable. Most of the for subclinical mastitis in LRS, Rathi farm, CVAS, Bikaner. In dairy farmers in India are hardly aware of subclinical mastitis the present study samples having >5,00,000 somatic cell count and as such attracts no importance to it. In mastitis, there is a and positive for bacterial isolation based on mPCR were break in the blood-milk barrier, along with impaired synthesis considered. Blood samples were collected from jugular vein and secretary activity of udder epithelial cells, which alters the in disodium EDTA (2-3 ml) vials and other in without disodium level of most components (Sarvesha et al., 2016). EDTA vials for serum separation. Blood sample with EDTA The key response of the cow to infection by pathogens is was analyzed for haemoglobin %, packed cell volume %, total localized entry of leukocytes (white blood cells) from the blood erythrocyte count, total leucocyte count and differential count vessels in the infected tissue into the tissue near the site of by using standard procedure of Jain (1986). The serum infection. The leukocytes that enter the milk in the alveoli are separated from blood was analyzed for mineral estimation called somatic cells and the concentration of somatic cells in viz. Ca, P and Mg and micro minerals like Cu, Zn, Mn and Se milk is called somatic cell count (SCC). The greater the SCC, by using Inductively Coupled Argon Plasma Optical Emission the higher the level of inflammation in the tissue. So, SCC in Spectrometer (ICP-OES) (iCAP 7000 series). milk is an important indicator of the inflammation status of the Mineral extraction method from serum udder (Sandholm, 1995). Many researchers have paid attention Digestion of serum samples to the role of oxidative stress in the pathogenesis of diseases Serum samples were digested as per the procedure in cattle recently (Lykkesfeldt and Svendsen, 2007). The described by Kolmer et al. (1951). For this 3 ml of sample observed correlations between Se, Cu and Zn explains their in digestion tubes and equal volume of concentrated HNO3 role in oxidative stress induced by subclinical mastitis was added and mixed well. The tubes were kept overnight at (Ghasemian et al., 2011). room temperature followed by low heat (70- 80ºC) digestion The requirements of trace minerals like Cu, Zn, Mn and until the volume of the samples reduced to 1 ml. To this 3 ml of Se are increased in mastitis and shows improved clinical double acid mixture (HNO3 and HClO4 in 3:1 ratio) was added response on their supplementation. He also concluded that and low heat digestion continued until the digested samples selenium is an essential micronutrient present in tissues became watery clear and emitted white fumes. As per need, throughout the body and is important physiologically because the addition of 3 ml double acid mixture followed by low heat it is an integral component of the enzyme glutathione peroxidise digestion was repeated couple of times. Heating was

#*Part of Ph.D. Thesis of first author; 1Retd. Professior; 2Professor, Dept. of Preventive Veterinary Medicine; 3Assistant Professor, Dept of Animal Nutrition 199 Veterinary Practitioner Vol. 20 No. 2 December 2019 continued until the volume of the samples got reduced to ~0.5 Similar findings were observed by Sarvesha et al. (2016) ml. Final volume of the filtrate was made 10 ml with triple revealed significant (P<0.05) increase in calcium level in distilled deionized water after warming the solution. subclinical mastitis (13.45 mg/dl). Present study was in contrary to the findings of Zaki et al. (2010) who reported Estimation of minerals significant decrease in the average values of calcium in serum Serum calcium, phosphorus, magnesium, copper, of mastitic cows from that of healthy cows. manganese, zinc and selenium were estimated to assess mineral profile of cattle by Inductively Coupled Argon Plasma Serum phosphorus Spectrometer (iCAP 7000 Series). The iCAP 7000 series is a Present study has revealed significant decrease in serum range of Inductively Coupled Argon Plasma Optical Emission phosphorus level (4.85±0.13 mg/dl) compared to healthy Spectrometer (ICP-OES) which use an Echelle optical design control group (6.17±0.33 mg/dl) which could be attributed to its and a Charge Injection Device (CID), solid-state detector to more secretion in milk, due to injury to the udder wall, thus measure trace elemental concentrations in a wide range of more loss in milk. Finding corroborates with the observation of samples. The equipment was set as per instructions supplied Singh et al. (2014) and Dwivedi et al. (2004). by the company. Serum magnesium Results and Discussion In the present study magnesium level of the serum Haematological parameters samples of subclinical mastitic animals (2.27±0.10 mg/dl) The haematological analysis done for 54 positive SCM showed no significant effect compared with healthy control animals showed mean ± SE value of total leukocyte count of animals (2.33±0.26 mg/dl) which correlates with the findings subclinical mastitic animals was 10.03 ± 0.18 x 103 cells/cumm of Siddiqe et al. (2015) and Singh et al. (2014). which was significantly (P<0.05) increased compared to control Similar findings were observed by Dwivedi et al. (2004) group (6.79 ± 0.35 x 103 cells/cumm) (Table 1). and Yildiz and Kaygusuzolu (2005) who reported no significant Haemoglobin and PCV level of mastitic cows showed no variation in the plasma level of Mg in mastitic and healthy significant decrease compared with healthy animals. Finding animals. of present study corroborates with observation of Singh (2014) who observed that PCV and Hb did not exhibit any specific Micro minerals estimation trend in the animals suffering from mastitis however, Sarvesha Serum copper and manganese et al. (2016) reported that anaemia in mastitic cows was due Present study revealed that the mean ± SE value of serum to decrease in Hb, RBC, and PCV levels in subclinical mastitis. copper (7.01±0.10 µmol/L) and manganese (2.93±0.08 µmol/ L) was statistically significantly decreased (P<0.01) in Differential leukocyte count subclinical mastitic animals compared to healthy control group In the present study the mean ± SE value of neutrophil of which was 8.28± 0.28 µmol/ L and 3.76 ± 0.17 µmol/L, subclinical mastitic animals was 63.19 ± 0.42% which was respectively. significantly (p<0.05) increased than control group having In our study the values of copper were low in subclinical 30.125 ± 0.61% value. The mean ± SE value of lymphocytes of mastitic animals as compared to healthy control group. Our control group was 66.25 ± 0.60% and of positive subclinical findings are in agreement with Kleczkowski (2008) and Muhee mastitic animals was 34.02 ± 0.43% showing significant et al. (2017) who also found decreased concentrations of decrease in subclinical mastitic animals (Table 1). Similar copper in animals with clinical mastitis. Copper is an important findings were observed by Sarvesha et al. (2016) and Singh et co-factor of superoxide dismutase, an enzyme, which protects al. (2014) who reported a significant (P< 0.05) increase in cells from the pro-oxidative influence of free radicals neutrophil 65.47±0.28 and 66.88± 0.96, respectively and total (Kleczkowski, 2003). leukocyte count TLC 10.22±0.18 and 9.20 x 10 μl, respectively The present study revealed decreased levels of Mn in along with significant (P< 0.05) decrease in the lymphocyte subclinical mastitis as compared to healthy control group. Our count 30.60±0.35 and 29.44± 0.88, respectively in indiginous findings of decreased values of Mn in clinical mastitis are in cattle affected with subclinical mastitis. These findings could agreement with Erskine et al. (1997), Yang and Li (2015) and be due to persistent infection noticed in SCM (Zaki et al., 2008). Muhee et al. (2017) who also reported that the plasmatic levels of minerals decrease in clinical mastitis. Serum mineral profile Serum calcium Serum zinc and selenium In the present study statistically significant increase Present study revealed that the mean ± SE value of serum (P<0.01) in serum calcium (Ca) (13.27± 0.12 mg/dl) was zinc (11.56±0.13 µmol/ L), and selenium (32.03 ± 0.16 µg/ml) observed in positive subclinical mastitic animals as compared was statistically significant decreased (P<0.01) in subclinical to healthy control animals (9.89 ±0.43 mg/dl). mastitic animals compared to healthy control group which was This could be due to the decline in the milk yield in infected 14.84±0.35 µmol/L, and 38.51 ± 0.44 µg/ ml, respectively (Table animals, thus less of total calcium was excreted in the milk 2). (Wegner and Stull, 1978). The finding of this study are in In the study, zinc levels in animals with subclinical mastitis agreement with Siddiqe et al. (2015) and Singh et al. (2014) were low compared with healthy control animals. Ibrahim et al. who reported significantly (P< 0.05) increased levels of plasma (2016) also found a significant decrease in the values of zinc calcium 12.46±4.00 mg/dl and 13.45±0.46 mg/dl, respectively in cows with clinical mastitis. Low Zn status leads to low quality in animals suffering from subclinical mastitis. milk with high SCC and increased incidence of mastitis (Gaafar

200 Veterinary Practitioner Vol. 20 No. 2 December 2019

Table 1: Mean ± SE value of haematological parameters of subclinical Table 2: Mean ± SE value of serum minerals profile of subclinical positive cattle (n=54) mastitic animals (n=54) S. Parameters Control SCM Significance S. Minerals Control SCM positive Significance No. (P<0.05) No. (P<0.05) 1. Hb (g/dl) 10.5 ± 0.40 9.82 ± 0.13 NS 1 Calcium (mg/dl) 9.89 ±0.43 13.27±0.12 ** 2. PCV (%) 30.34 ± 0.54 28.46 ± 0.23 NS 6 2 Phosphorus (mg/dl) 6.17±0.33 4.85±0.13 ** 3. TEC(x10 cells/cumm) 7.38 ± 0.36 7.02 ± 0.13 NS 3 Magnesium (mg/dl) 2.33±0.26 2.27±0.10 NS 4. TLC(x103 cells/cumm) 6.79 ± 0.35 10.03 ± 0.18 ** 4 Copper (µmol/L) 8.28± 0.28 7.01±0.10 ** 5. Neutrophils (%) 30.125 ± 0.61 63.19 ± 0.42 ** 5 Zinc (µmol/L) 14.84±0.35 11.56±0.13 ** 6. Lymphocytes (%) 66.25 ± 0.60 34.02 ± 0.43 ** 7. Monocytes (%) 2.12 ± 0.35 1.87 ± 0.11 NS 6 Manganese (µmol/L) 3.76 ± 0.17 2.93±0.08 ** 8. Eosinophils (%) 1.5 ± 0.26 1.39 ± 0.09 NS 7 Selenium (µg/ml) 38.51 ± 0.44 32.03±0.16 ** et al., 2010). The present study revealed findings similar to Jain NC (1986) Schalm’s Veterinary Hematology. Lea & Febiger, Philadelphia, PA. Muhee et al. (2017) who also observed decreased levels of Kleczkowski M, Klucinski W, Sitarska E, Sikora J and Kasztelan R Se in clinical mastitis as compared to normal control group. (2003) Influence of mineral nutrition on superoxide dismutase Our findings of low Se values in clinical mastitis are in activity in blood of cows. Bulletin of the Veterinary Institute agreement with Kommisrud et al. (2005) and Muhee et al. in Pulawy. 47: 547-554. (2017). Selenium is an essential micronutrient present in Kleczkowski M, Kluciñski WZ, Jakubowski T, Fabisiak M and Dembele tissues throughout the body and is important physiologically K (2008) Copper status and SOD activity in blood of cows because it is an integral component of the enzyme glutathione affected with clinical mastitis. Bull. Vet. Institute in Pulawy. peroxidase. 52: 387-390. Kolmer JA, Spandling EH and Robinson HW (1951) Approved laboratory Negative significant correlations were found between Se technique. 5th edn., Appleton Century Crofts Inc., New York, and Cu (r = -0.217) and between Se and Zn (r = -0.244). The USA. observed correlations between Se, Cu and Zn in the study Kommisrud E, Osteras O and Vatn T (2005) Blood selenium associated might be explained by their role in oxidative stress induced by with health and fertility in Norwegian dairy herds. Acta subclinical mastitis (Ghasemian et al., 2011). Veterinaria Scandinavica. 46: 229-240. There is a negative correlation between plasma Se Lykkesfeldt J and Svendsen O (2007) Oxidants and antioxidants in concentration and SCC in bulk tank, i.e., as the plasma Se disease: oxidative stress in farm animals. Vet. J. 173: 502- concentration increases, the SCC and prevalence of mastitis 511. Muhee A, Malik HU, Asharaf IO, Shah SA, Muheet Jan, Rather W and would decrease (Weiss et al., 1990). Showkeen Muzamil (2017) Effect of supplementation of anti- Acknowledgements oxidant mineral formulation on milk SCC and DCC in bovine mastitis. Int.J.Curr. Microbiol. App. Sci. 6(7): 4600-4608. We thank the Department of Animal Nutrition, CVAS and Sandholm M, Honkanen-Buzalski T, Kaartinen L and Pyorala S (1995) NRCC, Bikaner for their cooperation and providing the facilities The bovine udder and mastitis. University of Helsinki, Faculty for estimation of minerals. of Veterinary Medicine, Finland, pp. 458-463. Sarvesha K, Satyanarayana ML, Narayanaswamy HD, Rao S, Yathiraj References S, Isloor S and Kamal H (2016) Effect of subclinical and Bramley AJ, Cullor JS, Erskine RJ, Fox LK, Harmon RJ, Hogan JS, clinical mastitis on haemato-biochemical profile and milk Nickerson SC, Oliver SP, Smith KL and Sordillo LM (1996) leukocyte count in indigenous cows. J. Cell Tissue Current concepts of bovine mastitis. 4th edn. National Res. 16(3): 5829-5834. Mastitis Council, Madison, WI. Siddiqe ZF, Islam S, Islam SS, Islam S, Islam S and Das BC (2015) Dwivedi HP, Kumar M and Upadhyay AK (2004) Biochemical changes Haematobiochemical changes in subclinical mastitis affected in cows suffering from mastitis. Indian J. Vet. Med. 24(2): high yielding dairy cows in Chittagong district. Int. J. Nat. 101-102. Social Sci. 2(4): 30-34. Erisir M, Akar Y, Gurgoze SY and Yuksel M (2006) Changes in plasma Singh R, Bhardwaj RK, Azad MS and Beigh SA (2014) Effect of mastitis malondialdehyde concentration and some erythrocyte on haemato-biochemical and plasma mineral profile in antioxidant enzymes in cows with prolapsus uteri, crossbred cattle. Indian J. Anim. Res. 48(1): 63-66. caesarean section, and retained placenta. Revue Wegner TN and Stull JW (1978) Relationship between mastitis test de Médecine Vétérinaire. 157: 80-83. score, mineral composition of milk and blood electrolyte Erskine RJ, Bartlett PC, Herdt T and Gaston P (1997) Effects of profiles in Holstein cows. J. Dairy Sci. 61: 1755-1759. parenteral administration of vitamin E on health of Weiss WP, Hogan JS and Smith KL (1990) Relationships among periparturient dairy cows. J. Am. Vet. Med. Assoc. 211: selenium, vitamin E and mammary gland health in commercial 466-469. dairy herds. J. Dairy Sci. 73: 381. Gaafar HMA, Basiuoni MI, Ali MFE, Shitta AA and Shamas ASE (2010) Yang FL and Li XS (2015) Role of antioxidant vitamins and trace Effect of zinc methionine supplementation on somatic cell elements in mastitis in dairy cows. J. Adv. Vet. Anim. Res. count in milk and mastitis in Friesian cows. Archiva 2(1): 1-9. Zootechnica. 13: 36-46. Yildiz H and Kaygusuzolu E (2005) Investigation of Ca, Zn, Mg, Fe and Ghasemian KO, Safi S, Rahimi Froushani A and Bolourchi M (2011) Cu concentrations in blood and milk of cows with negative Study of the relationship between oxidative stress and and positive CMT results. Bull. Vet. Inst. Pulawy. 49: 209- subclinical mastitis in dairy cattle. Iranian J. Vet. Res., Shiraz 213. Univ. 12(4) Ser. No. 37. Zaki MS, Sharaf NE, Mostafa SO, Fawzi OM and El-Battrawy N (2008) Ibrahim HMM, El-seedy YY and Gomaa NA (2016) Cytokine response Effect of subclinical mastitis on some biochemical and clinic- and oxidative stress status in dairy cows with acute clinical pathological parameters in buffalo. Am. Eura. J. Agr. Environ. mastitis. J. Dairy Vet. Anim. Res. 3(1): 2-6. Sci. 3(2): 200-204.

201 Veterinary Practitioner Vol. 20 No. 2 December 2019

EFFECT OF PREGNANCY STRESS ON LEVEL OF SOME SERUM ENZYMES IN KANKREJ CATTLE

Gajraj Singh1, Anil Moolchandani2, Meenaxi Sareen2, Narendra Singh Rathore2, Amit Pandey2 and Usha Chaudhary3 Department of Veterinary Biochemistry, College of Veterinary and Animal Science Rajasthan University of Veterinary and Animal Sciences, Bikaner-334 001, Rajasthan, India

Received revised on: 14.07.2019 ABSTRACT Accepted on: 15.11.2019

The aim of this study was to determine the difference in some serum enzymes of Kankrej cattle in different pregnant and non pregnant cows. Animals were divided in three groups as non-pregnant, mid-pregnant (4-6 months pregnancy) and late pregnant (6-8 months pregnancy) animal. The present study occurs on serum enzymes AST, ALT ALP and GGT. In following study serum ALT activity significantly lower in last stage of pregnancy in comparison to mid pregnancy. Serum ALP activity significantly (P<0.05) was higher during last stage of pregnancy as compared to non pregnant animal. Serum cholesterol concentration was significantly (P<0.05) lower in pregnant animals. Serum AST and GGT all parameters have non significant (P<0.05) changes during pregnancy.

Key words: Pregnancy, Kankrej, AST, ALT, ALP, GGT

Introduction groups, means and standard errors were calculated. It was Pregnancy itself is a stressful physiological state. In then subjected to one way analysis of variance for each of the pregnancy, maternal tissues are involved in providing energy parameters. Post ANOVA, pairwise comparison of means were for the developing foetus, which may affect values of important carried out by Duncan’s multiple range test as per Snedecor metabolites and enzymes in the maternal circulation. In sheep, and Cochran (2004). during late pregnancy, blood serum lipid profile is characterized by increased concentration of total cholesterol, triglycerides Results and Discussion and lipoproteins (Piccione et al., 2009). The pregnancy is a In present study Mean±SE values of serum ALT was non normal physiological events, associated with normal significantly higher during mid-pregnancy and lower in late physiological changes that aid the nutrition and survival of foetus trimester. However, the values differed significantly (P<0.05) (AL-bdeery and AL-Zubaidy, 2014). between the late pregnant and mid-pregnant animals. Serum In the present study comparative study of various blood AST was continually non significantly decreases with biochemical parameters viz. enzymes ALT, AST, ALP, GGT in advancement of pregnancy. In case of ALP significantly non-pregnant and pregnant (mid and last trimester) kankrej increased with the advancement of pregnancy and in case of cattle were carried out. GGT no significant effect observed. The average mean values of ALT in the present study are Materials and Methods in close agreement with the values reported by Pal and Bhatta The study was conducted on apparently healthy adult cows (2013) in crossbred HF cows (29-74 U/L). The reports of Roy of Kankrej breed. In total 18 adult cows of the following et al. (2010) in Sahiwal cows and AL-Eissa and Alkahtani physiological states were studied. (2012) in Nubian Ibex is well in agreement with the present 1) Non-pregnant cows (n=6) study showing similar pattern in respect to ALT/SGPT activity 2) Cows in mid-pregnancy (4-6 months pregnancy, n=6) with advancement of pregnancy. They attributed the increase 3) Cows in late pregnancy (7-9 months pregnancy, n=6) in activities to several stress factors such as nutritional stress, The animals were managed at Shree Jain Parshvanath environmental stress, emotional stress and physiological Gaushala, Nakoda, Badmer as per the standard predicts stress (pregnancy and lactation). In gestation, ALT activity followed at the farm with ad lib access and drinking water at all increases possibly due to impairment in muscle (Cory cycle) times. Blood samples from jugular vein were collected as per and liver cells due to rapid gluconeogenesis or increased standard procedure in duplicate sterile tubes,one with heparin demand of the body for the development of foetus causing (2 IU/ml) as anticoagulant for collection of whole blood (2 ml) negative energy balance (Beitz, 2004). Although no concrete and another without anticoagulant (8 ml blood) for collection of possible reason could be attributed to the decrease in ALT serum. Serum enzymes (AST, ALT, ALP, GGT) were estimated observed in last trimester of pregnancy in women (Bacq et al., in serum by the IDEXX Vet Test kit, manufactured by IDEXX 1996), it is speculated that it might be due to the haemodilution laboratories, Inc. USA, using standard diagnostic protocol and increase in plasma volume that occurs in the last trimester described by IDEXX for analysis in the Automatic Biochemical of gestation (Bacq, 2013). However, Milinkovic-Tur et al. (2005) Aanalyser (IDEXX, USA). in mare, Yokus and Cakir (2006) in Holstein-East Anatolian The data was grouped for the separate experimental Red crossbred cows reported that the ALT activity declined in

1Part of MVSc Thesis submitted to RAJUVAS, Bikaner by the first author Email: [email protected]; 2Present Address: Department of Veterinary Biochemistry C.V.A.S. Bikaner; 3Veterinary officer Polyclinic Jaipur

202 Veterinary Practitioner Vol. 20 No. 2 December 2019

Table 1: Mean±SE values of serum enzymes (ALT, AST, GGT, ALP) concentration in non- pregnant and pregnant Kankrej breed of cattle Parameters ALT* AST ALP* GGT No. of Mean ± SE Mean ± SE Mean ± SE Mean ± SE Observ. Non pregnant 6 52.16±3.66ab 63.5±2.36a 67.5±5.03a 25.16±4.6a animals (Control (40-64) (57-70) (44-78) (9-37) group) 4-6 months of 6 62.5±4.78b 51.66±6.69a 82.16±9.47ab 16.33±2.3a pregnant animals (44-76) (32-74) (54-124) (9-26) 7-9 months of 6 42±6.38a 45.33±5.16a 95.16±3.38b 16.33±1.76a pregnant animals (22-55) (28-57) (83-105) (12-24) Note: Mean superscribed with different small letters column-wise differ significantly (p<0.05) from each other; NS=Non significant (p>0.05); *=Significant at 5% level (p<0.05); **=Significant at 1% level (p<0.01). Data shown in parenthesis representing respective range late gestation like our findings. reproductive periods in New Zealand white female rabbits. Serum AST activity during pregnancy is in partial AL-quadisiya J. Vet. Med. Sci. 13(1): 102-106. agreement with the results of Roy et al. (2010) in Sahiwal Al-Eissa MS and Alkahtani S (2012) Effect of pregnancy on cows, Al-Eissa and Alkahtani (2012) in Nubian Ibex, who haematological and biochemical profiles in the mountain gazelles (Gazella gazelle). Res. Zool. 2(1): 5-7. reported a decline in serum AST in mid-pregnancy. Lower AST Bacq Y (2013) The liver in normal pregnancy. Madam Curie Bioscience activity in pregnant as compared to non pregnant animals is Database-NCBI Bookshelf. possibly due to uterine and hormonal changes occurring Bacq Y, Zarka O, Brechot JF, Mariotte N, Vol S, Tichet J and Weill J during gestation (Roy et al., 2010). Low activity of AST mid and (1996) Liver function in normal pregnancy: a prospective late gestation either indicates that liver function is normal, or study of 103 pregnant woman and 103 matched cotrols. that liver function has entered into a state of no return after a Am. Assoc. for Study of Liver Disease. 23(5): 1030-1034. high magnitude stress or a prolonged chronic stress. In the Beitz DC (2004) Protein and amino acid metabolism. In: Reece W.O. present study, the lower AST values are more or less reflective (ed.) Duke’s physiology of domestic animals. Cornell Univ. Press Ithaca: 535-553. of a normal liver function as the animals were well fed in Fernandez NJ and Kidney BA (2007)Alkaline phosphatase: Beyond pregnancy than the non pregnant animals, thereby taking care the liver. Vet. Clin. Path. 36: 223-233. of the stress of pregnancy. Milinkovic-Tur S, Peric P, Stojevic Z, Zdelar-Tuk M and Pirsljin J (2005) GGT enzyme activity was highest in control group and Concentrations of total proteins and albumins, and AST, ALT lower values were observed in the mid and late pregnant group. and GGT activities in the blood plasma of mares during There was no change in the GGT activity in the mid and late pregnancy and early lactation. Veterinarski Arhiv. 75(3): pregnant Kankrej cows. A non-significantly lower GGT activity 195-202. during pregnancy has also been observed by Milinkovic-Tur et Pal P and Bhatta R (2013) Determination of blood metabolites in cross HF cattle at pre-parturientstage: reference value. Int. J. al. (2005) in mares. Pharm. Med. Bio. Sci. 2(1): 53-57. The present trend in our study that shows increased activity Piccione G, Caola G, Giannetto C, Grasso F, Runzo SC, Zumbo A and of serum ALP enzymes during pregnancy is in agreement with Pennisi P (2009) Selected biochemical serum parameters in the earlier reports (Soch et al., 2008; Waziri et al., 2010). Waziri ewes during pregnancy, post-parturition, lactation and dry et al. (2010) observed non-significant increase in Sahel Goats. period. Anim. Sci. Papers Reports. 27(4): 321-330. Soch et al. (2008) observed significant and highest level of Roy S, Roy M and Mishra S (2010) Hematological and biochemical ALP activity in the herd of cows pregnant for more than 140 profile during gestation period in Sahiwal cows. J. Vet. days in comparison to non pregnant cows. He attributed this World. 3(1): 26-28. Snedecor GW and Cochran WG (2004) Statistical methods. 8th edn., increase to increased ALP production from placenta during Oxford and IBH Publishing company, Kolkata. pregnancy. The increased placental production is in response Soch M, Pisek L, Broucek J, Kroupova P, Silhava M and Stastna J to higher metabolic rates in advanced pregnant cows as a (2008) Activity of alkaline phosphatase in cattle blood plasma result of nourishing the foetus. ALP is normally produced by according to stage of pregnancy. Slovak J. Anim. Sci. 41(1): syncytiotrophoblast cells of placenta and may be involved in 39-41. migration of primordial germ cell in developing foetus. In Waziri MA, Ribadu AY and Sivachelvan N (2010) Changes in the pregnant cows, increase in ALP may be up to 4 times normal serum proteins, hematological and some serum biochemical during mid and late pregnancy, playing an important role in profiles in the Sahel goat. J. Vet. Arhiv. 80: 215-224. Yokus B and Cakir DU (2006) Seasonal and physiological variations in fetus musculature via transfer of phosphate (Fernandez and serum chemistry and mineral concentrations in cattle. Bio. Kidney, 2007). Trace Element Res. 109: 255-266. References AL-bdeery AHJ and AL-Zubaidy ZJN (2014) Evaluation the effect of placenta on some biochemical parameters during different

203 Veterinary Practitioner Vol. 20 No. 2 December 2019

PERUSAL OF VARYING ENVIRONMENTAL CONDITIONS VERSUS PHYSIOLOGICAL CADENCE IN PUGAL SHEEP FROM ARID TRACTS SUBSUMING SERUM CORTISOL AND GLUTATHIONE STATUS#

G.S. Gottam1 and N. Kataria Department of Veterinary Physiology, College of Veterinary and Animal Science Rajasthan University of Veterinary and Animal Sciences, Bikaner-334 001, Rajasthan, India

ABSTRACT Received on: 17.09.2019 Accepted on: 03.11.2019

The study was conducted to evaluate the impact of varying environmental conditions on a tropical breed of sheep i.e. Pugal sheep found in Semi Arid areas around Bikaner. In present study, effect of various environmental condition on stress parameters i.e. cortisol, glutathione were estimated in Pugal breed of sheep. Though some information is available on stress parameters but data regarding straess parameters in different seasons (hot, rainy and cold) on Pugal breed of sheep is very scanty. Serum cortisol was higher during hot season and highest during hot humid or rainy season and low during cold season. The glutathione levels were lowest during the rainy season indicating lowest antioxidant status due to higher stress of heat and humidity together. It was concluded that Pugal sheep was under severe stress during hot humid or rainy season and comfortable during cold season.

Key words: Environmental condition, physiological cadence, cortisol, glutathione, sheep

Introduction urine. The male and female Pugal sheep were grouped A continuing aspiration for animal scientists has been to according to age as 4-8 months (40 male and 40 female); 8- enhance the biological competence of animals based on 12 months (40 male and 40 female); 12-16 months (40 male increasing production from them. The success of these and 40 female) and 16-20 months (40 male and 40 female) in endeavours depends upon the health status of the animals. each environmental condition. All the samples were collected The enhancement of the efficiency of animals largely depends and processed in duplicate. After collection of blood test tubes upon the efforts to minimize the stressors. Higher were kept in slanting position for 30 minutes to allow clot environmental temperature can influence nutrient utilization in formation. By using a thin stainless steel wire, clot was sheep (Al-Mamun et al., 2008).The arid tracts of Rajasthan are separated from wall of the test tubes and test tubes were the most terrible sufferer of seasonal changes and the design centrifuged at 3000 rpm for 20 minutes. Clear serum was of physiological management in the body of the animal during pipette out into other clear dry test tubes and only non stress states to arrange proper tactics for the wellbeing of hemolysed serum samples were used. After collection, serum livestock. Assessment of concepts is based on stress was stored at -20ºC in a deep freeze. Serum cortisol was responses of animals. There is dearth of the investigation to measured by using ELISA kits and Glutathione by Rapid observe responses of the Pugal sheep to different stressors. colorimetric micro method. To determine the effect of age and Hence, cortisol becomes imperative tool which can help in sex the mean values were compared statistically by using‘t’ detecting very low content of emotional furor in animals (Kataria test from the respective mean value. and Kataria, 2005a). Many antioxidants come for the rescue of the body namely vitamin C, A and E and glutathione offering Results and Discussion -1 protection to detoxify radicals or mend oxidized molecules The mean ± SEM values of serum cortisol (nmol L ) and -1 (Kataria and Kataria et al., 2005a and 2012b). erythrocytic glutathione (µmol gHb ) in the Pugal sheep during varying environmental conditions and different age groups are Materials and Methods depicted in Table 1 and Table 2. Designing of the experiment was done for perusal of varying environmental conditions versus physiological cadence (I) Cortisol in Pugal sheep from arid tracts subsuming environmental Investigations of physiological stress responses to acute variables, antioxidant systems and endocrine responses. or long-term stress routinely use cortisol measurement as an Varying environmental conditions consisting of cold, hot, rainy indicator for the activity of the hypothalamic-pituitary-adrenal and intervening periods of study was considered. Cold (HPA) axis. Wide range of different stressors associated with environmental condition was comprised of months of the temperature, housing, management and handling of December and January; hot condition was comprised of the animals increases HPA axis activity, which can be reflected by months of April, May and June; rainy condition was comprised an increased cortisol, especially when the period of stress of months of July, August and September. Intervening period experience covers weeks or months. The environmental was comprised of the months of October and November. In condition of arid tract Rajasthan is characterized by extreme each environmental condition, 320 animals were screened weather conditions and the survival under these conditions (160 males and 160 females) to obtain samples of blood and depends on the physiological capability of sheep. Quantifying

#1Part of Ph.D. Thesis submitted by First author and present address: Associate Professor, Department of Physiology and Biochemistry, PGIVER, Jaipur, RAJVAS, Bikaner 204 Veterinary Practitioner Vol. 20 No. 2 December 2019

Table 1: Mean ± SEM values of serum cortisol (nmol L-1) in the Pugal Table 2: Mean ± SEM values of erythrocytic glutathione (µmol gHb-1) in sheep during varying environmental conditions the Pugal sheep during varying environmental conditions S. Effects Mean ± SEM values during environmental S. Effects Mean ± SEM values during environmental No. conditions No. conditions Intervening Hot Rainy Cold Intervenin Hot Rainy Cold

1. Overall b b b b g 50.00 80.20 100.00 40.00 1. Overall environmental 4.74b 2.73b 1.84b 4.08b ± 3.41 ±3.62 ± 3.72 ±3.51 environmental conditions (320) ±0.009 ±0.008 ±0.008 ±0.009 2. Age group categorization (I & II categories) conditions (320) I. Male 2. Age group categorization (I& II categories) bg bg bg bg I. Male Overall value of 45.00 75.00 95.00 35.00 bg bg bg bg male (160) ±3.09 ±3.09 ± 3.09 ±3.08 Overall value of 4.63 1.93 1.98 3.78 bc bc bc bc male (160) ±0.005 ±0.006 ±0.006 ±0.006 a. 4-8 months (40) 60.00 90.30 110.00 50.00 bc bc bc bc a. 4-8 months (40) 4.43 1.89 1.79 3.73 ±3.05 ±3.03 ± 3.04 ±3.04 bc bc bc bc ±0.0002 ±0.0003 ±0.0003 ±0.0003 b. 8-12 months (40) 50.00 80.10 100.00 40.00 bc bc bc bc b. 8-12 months (40) 4.58 1.90 1.96 3.77 ±3.02 ±3.03 ± 3.04 ±3.03 bc bc bc bc ±0.0001 ±0.0001 ±0.0001 ±0.0001 c. 12-16 months (40) 40.00 70.20 90.00 30.00 c. 12-16 months (40) 4.63bc 1.99bc 2.00bc± 3.89bc ±3.04 ±3.03 ±3.03 ±3.03 bc bc bc bc ±0.0001 ±0.0001 0.0002 ±0.0002 d. 16-20 months (40) 30.00 60.30 80.00 20.00 d. 16-20 months (40) 4.69bc 2.09bc 2.10bc± 4.00bc ±3.03 ±3.04 ±3.04 ±3.02 ±0.0001 ±0.0001 0.0003 ±0.0001 II. Female II. Female bg bg bg bg Overall value of 55.00 85.00 105.00 45.00 Overall value of 5.68bg 2.93bg 2.98bg 4.79bg female (160) ±3.09 ±3.09 ± 3.09 ±3.08 female (160) ±0.005 ±0.006 ± 0.006 ±0.006 bc bc bc bc a. 4-8 months (40) 70.00 100.30 120.00 60.00 a. 4-8 months (40) 5.23bc 2.79bc 2.79bc 4.78bc ±3.05 ±3.03 ± 3.04 ±3.04 ±0.0002 ±0.0003 ±0.0003 ±0.0003 bc bc bc bc b. 8-12 months (40) 60.00 90.10 110.00 50.00 b. 8-12 months (40) 5.48bc 2.97bc 2.96bc 4.79bc ±3.02 ±3.03 ± 3.04 ±3.03 ±0.0001 ±0.0001 ±0.0001 ±0.0001 c. 12-16 months (40) 50.00bc 80.20bc 100.00bc 40.00bc c. 12-16 months (40) 5.73bc 2.99bc 3.00bc 4.79bc ±3.04 ±3.03 ±3.03 ±3.03 ±0.0003 ±0.0001 ±0.0002 ±0.0002 bc bc bc bc d. 16-20 months (40) 40.00bc 70.30bc 90.00bc 30.00bc d. 16-20 months (40) 5.99 3.19 3.10 5.20 ±3.03 ±3.04 ±3.04 ±3.02 ±0.0003 ±0.0001 ±0.0003 ±0.0001 i. Figures in the parenthesis = Number of Pugal sheep i. Figures in the parenthesis = Number of Pugal sheep ii. ‘b’ = Significant (p<0.05) differences among mean values for a row, ii. ‘b’ = Significant (p<0.05) differences among mean values for a row; iii.‘c’ = Significant (p<0.05) differences among mean values for an EC; iii. ‘c’ = Significant (p<0.05) differences among mean values for an EC; iv.‘d’ = Significant (p<0.05) differences between mean values for an iv. ‘d’ = Significant (p<0.05) differences between mean values for an EC; v.‘g’ = Significant (p<0.05) differences among overall values for an EC; v ‘g’ = Significant (p<0.05) differences among overall values for an EC EC the impact of stress on animal production may be very difficult Higher levels of serum cortisol in haemonchus infected, as many of these manifestations may occur at a subclinical pneumonia affected, having enterotoxaemia and drought level. affected was observed when compared to the healthy group In the present investigation cortisol concentration was by Kataria et al. (2011). The above observation also strengthen significantly (p<0.05) higher during hot and rainy season in the present findings. Under moderate conditions Singla et al. comparison to intervening environmental condition. Highest (2015) found the mean value of serum cortisol in sheep as cortisol was found during rainy season (100.00 nmol L-1) 6.00±0.09 ng/ml and a rise in serum cortisol due to water indicating that the high temperature with humid environment deficit stress was evident. was the most stressful to the sheep. During rainy Thori (2015) attributed higher values of serum cortisol environmental condition, the per cent variation in the overall during hot ambience as a result of stress in Rathi calves. value was found to be maximum. The effect of age was The per cent changes owing to hot ambience in serum significant (p<0.05) on cortisol concentration and its cortisol were higher in female as compared to male calves. It concentration was maximum in 4-8 months (60.00 nmol L-1 in was observed to be 3.56 times higher in post weaning female male and 70.00 nmol L-1 in female) of age group irrespective divulging great degree of stress in this group. Road of sex. Cortisol contributes to hyperglycemia by transportation on metabolic responses and stress in heifers stimulating gluconeogenesis which is essential to meet the was correlated by levels of cortisol and it was restored to the energy crisis during physical stress to the sheep. Pattern of before transportation concentration at 2 4h after transportation changes denoted the impact of environmental condition Kang et al. (2017). irrespective of age groups. These findings were in accordance with Kataria et al. Glutathione (2000b) who also reported increase serum cortisol levels in Glutathione is a well known master antioxidant of the body. dromedary camels during hot and cold ambient periods and It counter balance free radicals and known to perk up antioxidant during biotic stress in goats. The increase was 5.27 times power of blood (Gropper et al. 2004). The ratio of reduced higher in stressed dromedaries. glutathione to oxidised glutathione within cells is used as a Kataria and Kataria (2006g) in Marwari sheep and Kataria measure of cellular toxicity (Pastore et al. 2003). et al. (2010a) in donkeys attributed increased cortisol (4.22 In present investigation influence of hot environmental times higher) due to acute stress associated with hot temperature period was recorded to be significant (p<0.05) -1 ambience. Stress related rise in serum cortisol in dromedaries on erythrocytic glutathione (µmol gHb ) overall mean value affected with wounds and having sand in third compartment (2.73) when compared to intervening period overall mean was also observed by Kataria et al.(2010c). value(4.74 ).The result indicates that there was depletion in

205 Veterinary Practitioner Vol. 20 No. 2 December 2019 the values of glutathione during hot season in comparison to Bernabucci U, Ronchi B, Lacetera N and Nardone A (2002) Markers of other environmental conditions. This showed that antioxidant oxidative status in plasma and erythrocytes of transition defense system was changed to adapt and prevent oxidative dairy cows during hot season. J. Dairy Sci. 85(9): 2173- stress effects because it protects cells from oxidative damages. 2179. Chaturvedi M (2011) Free radical scavenger and associated analytes The result also supported by previous findings in different in the erythrocytes of Marwari goat during extreme animal species. Mean values of erythrocytic glutathione (µmol ambiences. M.V.Sc. Thesis submitted to Department of -1 gHb ) were highest in 16-20 months of age group irrespective Veterinary Physiology, College of Veterinary and Animal of sex. Per cent change in the erythrocytic glutathione mean Science, Bikaner, RAJUVAS, Bikaner, Rajasthan. value was evaluated when environmental temperature was Chaturvedi M and Kataria N (2013) Assessment of role of antioxidants hot as compared to the condition when environmental condition in erythrocytes of Marwari goat from arid tracts in India to was intervening it indicated a drastic effect. It was noted that evaluate oxidative stress. ELBA Bioflux. 5(1): 1-8. antioxidant status of older age group was comparatively Gropper SS, Smith JL and Grodd JL (2004) Advanced nutrition and human metabolism. 4th ed, Thomson Wadsworth Belmont superior than youngest age group. Hence it is proposed that CA, USA. pp. 260-275. nutrition of younger Pugal sheep is required to be Dehghan A, Arabi M, Nahid S and Aminlari M (2010) Changes of supplemented with appropriate antioxidants to make the serum reduced and oxidized glutathione in heat antioxidant status stronger. stressed ram. Asian J. Anim. Vet. Adv. 5(7): 472-477. Bernabucci et al. (2002) observed that cows exposed to Kang HJ, Lee IK, Piao MY, Kwak CW, Gu MJ, Yun, CH, Kim HJ, Kim HB, moderate heat stress due to summer temperature showed Kim GH, Kim S K, KO JY, Ha JK and Baik M (2017) Effects of higher erythrocyte glutathione. These variations could be due road transportation on metabolic and immunological to variations in the ambient temperature as in our study the responses in Holstein heifers. Anim. Sci. J. 88(1): 140-148. Kataria N and Kataria AK (2010a) Assessment of stress due to hot ambient temperature during summer was much higher than ambience in donkeys from arid tracts in India. J. Stress their reporting. Effect of environmental temperature on serum Physiol. Biochem. 6(4): 12-17. glutathione levels was recorded by many earlier researchers Kataria N and Kataria AK (2006g) Endocrine and metabolic responses in animals, as Dehghan et al. (2010) in rams, Chaturvedi (2011) of Marwari sheep in arid tract. Slov. Vet. Res. 43(3):135-142. in goats, and Kataria et al. (2010b) in camels. Erythrocytic Kataria N, Ruby, Singla B, Kataria AK and Arya RS (2005a) A report on glutathione mean value in the buffalo calves was lesser by titratable acidity in Rathi cows. Indian Vet. Med. J. 29 (2): 1.23 times during hot ambience in comparison to moderate 209-210. ambience (Abhimanu, 2013). Erythrocytic glutathione mean Kataria N, Kataria AK, Joshi A, Pandey N and Khan S (2012b) Serum antioxidant status to assess oxidative stress in Brucella value by Chaturvedi and Kataria (2013) in goat was 1.44±0.03 infected buffaloes. J. Stress Physiol. Biochem. 8(2): 5-9. -1 ìmol gHb during moderate ambience and it showed Kataria N, Kataria AK and Maan R (2010b) Evaluation of oxidative outstanding reduction during hot and cold environmental stress due to hot environmental condition in healthy Marwari periods. The extent of reduction was huge during hot than cold goats from arid tract in India. Philipp. J. Vet. Anim. Sci. periods. The remarkable decline in the mean values of 36(2): 175-184. glutathione from erythrocytes during hot and cold ambient Kataria N, Kataria AK, Agarwal VK, Garg SL and Singh R (2000b) temperature periods in non-descript goat from arid tracts was Effect of water restriction on serum aldosterone and cortisol also noticed by Saini (2017). in dromedary camel during winter and summer. J. Camel Prac. Res. 7(1): 1-7 It is concluded that a life with minimal stress is linked to Kataria N, Kataria AK, Chaturvedi M and Sharma A (2011) Changes in happiness, as high stress reflects fear and anxiety. In most serum enzymes levels associated with liver functions in cases, happiness for animals revolves around the daily needs stressed Marwari goat. J. Stress Physiol. Biochem. 7(1): 13- for survival, such as securing food and shelter. By reducing 19. environmental stress among animals, scientists can help them Kataria N, Kataria AK, Pandey N and Gupta P (2010c) Serum biomarkers redirect energy often used for survival to other uses, such as of physiological defense against reactive oxygen species increasing fat reserves and reproduction. The potential during environmental stress in Indian dromedaries. HVM applications are vast, as the studies can be replicated across Bioflux. 2(2): 55-60. Pastore A, Piemonte F, Locatelli M, Lo Russo A, Gaeta LM, Tozzi G and species living in different settings, from camels in cold and hot Federici G (2003) Determination of blood total, reduced, and desert, to sheep in pastureland and arid conditions, and even oxidized glutathione in pediatric subjects. Clin. Chem. 47(8): domestic animals in apartments. It enables researchers to 1467-1469. monitor population health during management interventions. Saini M (2017) Dynamics of change in erythrocyte antioxidant status By ensuring the sheep are stress free, we can improve their and iron indices in non-descript goat from arid tract during productivity in terms of meat quality and reproduction. extreme ambiences. M.V.Sc. Thesis submitted to Department of Vet. Physiology, College of Vet. and Anim. Sci., Bikaner. References Singla B, Kataria AK and Kataria N (2015) Hormonal profile of Marwari Abhimanu (2013) Hot ambience associated variations in erythrocyte sheep during thirst induced water deficit. In: Compendium and plasma free radical scavengers of buffalo calves. of national seminar on translational research in biotechnology M.V.Sc. Thesis submitted to Department of Veterinary for improving animal health and production & 3rd Annual Physiology, College of Veterinary and Animal Science, meeting of Society for Vet. Science and biotechnology. 7-8 Bikaner, RAJUVAS, Bikaner, Rajasthan. Oct. 2015. Raj. Univ. of Vet. & Anim. Sci., Bikaner. pp. 95. Al-Mamun M, Abe D, Kofujita H, Tamura Y and Sano H (2008) Comparison Thori MK (2015) The physiological stress responses and oxidative of the bioactive components of the ecotypes and cultivars stress biomarkers in Rathi calves during hot ambience. of plantain (Plantago lanceolata L.) herbs. Anim. Sci. J. 79: M.V.Sc. Thesis submitted to Dept. of Vet. Physiology, College 83-88. of Vet. and Anim. Sci., Bikaner.

206 Veterinary Practitioner Vol. 20 No. 2 December 2019

SERUM CHOLESTEROL PROFILE AND MINERAL CONCENTRATIONS IN TOGGENBERG GOAT DURING LACTATION#

I.H. Bhat1, J. Devi2 and K. Sarma3 Division of Veterinary Physiology and Biochemistry, Faculty of Veterinary Science and Animal Husbandry Sher-e-Kashmir University of Agricultural Science and Technology-Jammu, R.S.Pura-181102, Jammu & Kashmir, India

ABSTRACT Received on: 19.07.2019 Accepted on: 20.10.2019

The investigation was undertaken to study cholesterol profile and some mineral profile during different stages in different lactations in Toggenberg goats. The study included control group, consisting of dry goats and group I, II, III and IV containing goats in 1st, 2nd, 3rd and 4th lactation period. Further each lactation period was divided into early, mid and late stages. Blood samples were collected at one month interval in all the groups. Samples collected in first two months was considered as early stage, 3rd and 4th months are considered as mid and 5th and 6th months as late lactation stage. Samples were analyzed for different parameters by using analytical kits. Significantly lower (P<0.05) concentrations of total, HDL and LDL cholesterol were observed in mid lactation as compared to early and late stages. When compared to control group, significantly lower (P<0.05) concentrations of total, HDL and LDL cholesterol were observed during different lactation periods. A definite increase of calcium concentrations from early to late lactational stages were observed in all the lactational groups of Toggenberg goats. Significantly (P<0.05) lower calcium concentrations were observed in lactating goats as compared to dry Toggenberg goats. However, phosphorus levels were found significantly lower (P<0.05) in first lactation as compared to other groups. The values were recorded as 4.81±0.13 mg/dl in group I and 5.23±0.11, 5.47±0.15 and 5.01±0.14 mg/dl in group II, III and IV, respectively. The lactation period was more stressful than the dry period. Among different stages of lactation, early and mid stages are more stressful when compared to late stage.

Key words: Lactation, goat, cholesterol profile, calcium, phosphorus

Introduction conducted on Toggenberg goats during their high profile Lactation is considered as metabolic stress, associated production phase in which the animals have to adjust their with alterations in the different blood biochemical profile in biological phenomena towards milk production system. small ruminants (Autunovic et al., 2002; Yildiz et al., 2005 and Ceylan et al., 2009). Blood biochemical parameters including Materials and Methods cholesterol, free fatty acids and triglycerides are important Total thirty number of Toggenberg goats were used in this indicators of metabolic activity in lactating animals study, divided into five groups of six goats each. These included (Karapehlivan et al., 2007). The energy demand of lactating control group which consisted of dry goats and Group I, Group st nd rd th animals in the peak of lactation exceeds the amounts of net II, Group III and Group IV containing goats in 1 , 2 , 3 and 4 energy from diet. A lack of sufficient nutritional components in lactation. The study was started in the month of February with the feed results in the use of body reserves, because in order the onset of lactation in goats and the blood samples were to decrease the energetic deficiency, surplus fat is mobilized collected at one month interval in control as well as lactating and undergoes lipolytic processes. The homeostatic goats. Further each lactation period was divided into three disturbance during this period is crucial for the performance of stages namely early, mid and late stage. The samples collected rd th the dairy animals in current as well as in the next lactations in first two months were considered as early stage, 3 and 4 th th (Bertoni et al., 2009 and Jozwik et al., 2010). The concentrations months was considered as mid and 5 and 6 as late of some important minerals like calcium and phosphorus in lactational stage. Serum was separated and total cholesterol, the serum represent homeostatic mechanisms that are the HDL and LDL cholesterol and calcium and phosphorus levels close relationship with the hormonal regulation and nutritional were estimated by analytical kits. All numerical data was status of the animal (NRC, 1980 and Krajnicakova et al., 2003). processed using the statistical package for social science i.e. Moreover, substantial losses of body minerals occur during SPSS version 16.0 for windows. Analysis of variance (ANOVA) this phase. was done with the help of Tukey’s test. Some earlier studies showed relationship between milk Results and Discussion yield with the level of cholesterol and minerals in milk and Cholesterol Profile blood (Strzalkowska et al., 2009 and Jozwik et al., 2012) in cow Significantly low (P<0.05) concentrations of total during different days of lactation. However, the cholesterol profile cholesterol, HDL and LDL cholesterol were observed in mid in relation to different stages of lactation in different lactations lactation as compared to early and late stages (Table 1), was meagerly investigated in small ruminants especially in probably because during the mid lactation period, there is a goats. In Jammu and Kashmir, the Toggenberg goat is popular strong reduction in lipogenesis and esterification and an one as both milch and meat animal and it constitutes a valuable increase in nor-epinephrine and epinephrine stimulated free component of livestock. Therefore, the study has been fatty acid release. The metabolic shift precedes the energy 1*Part of M.V.Sc. Thesis; 2Professor and Head, Division of Veterinary Physiology and Biochemistry, corresponding author: email id: [email protected]; 3Professor, Division of Veterinary Anatomy, FVSC & AH, SKUAST-Jammu, R S Pura-181102 (J&K)

207 Veterinary Practitioner Vol. 20 No. 2 December 2019 demand for lactation, which is stimulated by prolactin (Nazifi et Table 2: Cholesterol profile (Mean ±S.E.) during different al., 2002). Again, lipogenesis stimulated by insulin might be lactations in Toggenberg goats also responsible for the increased value of total and HDL Parameters Control Group I Group II Group III Group IV cholesterol observed in goats during early lactation (Piccione (n=36) (1st lactation) (2 nd lactation) (3rd lactation) (4th lactation) et al., 2009). However, other scientists (Hagawane et al., 2009 (n=36) (n=36) (n=36) (n=36) and Jozwik et al., 2012) found lowest value in early lactation in Total lactating buffaloes, ewes and goats. Cholesterol 94.45±0.45a 82.83±0.94b 80.07±0.65c 84.33±0.62b 83.99±0.37b In the study, significantly lower concentrations of total LDL (mmol/l) and HDL ( except group III) cholesterol were observed during HDL different lactation periods as compared to control group (Table Cholesterol 51.01±0.51a 42.40±1.33b 40.92±0.83b 39.20±1.14b 42.10±0.92b 2), could be due to lactating goats require increased energy (mmol/l) level and negative energy balance occurs in this crucial period. LDL This result is in agreement with other findings (Karapehlivan Cholesterol 43.43±0.49a 40.43±1.01b 38.74±0.51b 44.60±0.60ac 40.65±0.64b et al., 2007 and Autunovic et al., 2011). (mmol/l) Mean with different superscript in the row differ significantly (P<0.05) Mineral profile All animals require minerals like calcium and phosphorus for growth, reproduction and lactation, which often affect specific Table 3: Mineral (Calcium and Phosphorus) levels (Mean±S.E.) during requirements and serve as catalytic components of enzymes different stages of lactation in Toggenberg goats and regulate several mechanisms involved in lactation (Ahmed Stages of et al., 2000 and Samardjia et al., 2011). In the study (Table 3), Parameters Lactation Early Mid Late a definite increase of calcium concentrations from early to late Lactation lactation lactation lactation lactational stages were observed in all the groups of Number Toggenberg goats, which corroborate the earlier findings of (Groups) different authors (Rowlands, 1990; Nale, 2003 and Hagawane Calcium Control (n=12) 10.16±0.06 9.50±0.08 9.94±0.12 et al., 2009) other species. Especially in the early lactation, (mg/dl) Group I (n=12) 8.92±0.08a 9.06±0.07a 9.40±0.08b a ab b calcium homeostatic mechanism has to react to a tremendous Group II (n=12) 9.25±0.14 9.45±0.13 9.76±0.14 a ab b increase in demand of calcium (Leisegang, 2008). Mobilization Group III (n=12) 9.54±0.13 9.69±0.13 10.04±0.11 of calcium from bone and increased absorption from the gastro- Group IV (n=12) 9.47±0.17 9.70±0.16 9.99±0.15 intestinal tract are required to re-establish homeostasis Phosphorus Control(n=12) 5.35±0.20 5.42±0.18 4.97±0.15 (mg/dl) (Leisegang, 2008). On the other hand, significantly lower Group I (n=12) 5.12±0.21 4.82±0.48 4.48±0.23 Group II (n=12) 5.61±0.19a 5.25±0.18ab 4.85±0.18b (P<0.05) phosphorus concentrations were found in late Group III (n=12) 5.98±0.25 5.32±0.25 5.12±0.25 lactation in group II and IV. Highest levels were recorded in a ab b Group IV (n=12) 5.38±0.25 5.05±0.23 4.57±0.23 early lactation (5.12±0.21, 5.61±0.19, 5.98±0.25 and 5.38±0.25 mg/dl). In contrast, other findings (Hagawane et al., 2009) Mean with different superscript in the row differ significantly (P<0.05) found significantly lowest (P<0.05) level of phosphorus in early lactation as compared to the values of normal control as well Table 1: Cholesterol profile (Mean ±S.E.) at different stages of as the animals of mid and late lactation stages. lactation in Toggenberg goats Perusal to Table 4, significantly lower calcium concentrations were observed in lactating goats as compared Parameters Stages of Early lactation Mid lactation Late lactation Lactation to dry Toggenberg goats. However, phosphorus levels were Number found significantly lower in first lactation as compared to other Groups groups. The phosphorus values ranged between 4.81±0.13 Total Control (n=12) 98.15±0.76 94.51±0.70 90.68±0.79 to 5.47±0.15 mg/dl in lactating goats. Whereas, in dry Cholesterol Group I (n=12) 90.40±0.96a 71.11±1.60b 87.00±1.43a Toggenberg goats the phosphorus level was recorded as (mmol/l) a b a Group II (n=12) 91.67±1.33 67.49±0.54 79.84±0.50 5.24±0.11 mg/dl. Lower values of calcium during lactation Group III (n=12) 88.01±0.68a 72.12±0.99b 91.57±0.59a might be due to drainage of this ion from blood to milk. In a b a another study also (Hagawane et al., 2009) it was found drop Group IV (n=12) 89.18±0.64 74.25±0.53 82.86±0.44 in calcium level during early stage of lactation (8.19±0.83 mg/ HDL Cholesterol Control (n=12) 54.64±1.37 49.59±0.54 48.80±0.55 dl) than the normal healthy buffaloes (11.21±0.19 mg/dl). Other (mmol/l) a b a Group I (n=12) 50.01±2.00 35.84±1.40 41.37±0.87 worker (Ramkrishna, 1991) recorded higher calcium values Group II (n=12) 52.67±0.87a 32.05±0.89b 38.04±0.72a a a b in lactating animals. Again, moderate depression of the levels Group III (n=12) 46.31±1.27 35.40±1.16 36.13±1.26 a a b of phosphorus might be due to the necessity of the ions for the Group IV (n=12) 48.19±1.21 37.95±0.63 38.18±0.53 colostrum synthesis (Rook and Thomas, 1983) and enhanced LDL Cholesterol Control (n=12) 43.51±0.55 44.92±0.33 41.88±0.46 carbohydrate metabolism as also observed in previous (mmol/l) ab a b Group I (n=12) 40.39±1.70 35.27±0.86 45.63±1.75 studies (Zvorc et al., 2006 and Carcangiu et al., 2008). Group II (n=12) 39.00±1.25ab 35.44±0.44a 41.80±0.33b Group III (n=12) 41.70±0.64a 35.99±0.76a 56.17±0.61b References Ahmed MM, Siham AK and Barri MES (2000) Macro-mineral profile in Group IV (n=12) 40.99±0.65ab 36.07±0.57a 44.91±0.38b plasma of Nubian goats as affected by physiological state. Mean with different superscript in the row differ significantly (P<0.05) Small Rumin. Res. 38: 249-254.

208 Veterinary Practitioner Vol. 20 No. 2 December 2019

Table 4: Mineral (Calcium and Phosphorus) levels (Mean±SE) during Krajnicakova M, Kovac G, Kostecky M, Valocky I, Maracek I, different lactations in Toggenberg goats Sutiakoy I and Lenhardt L (2003) Selected clinical- biochemical parameters in the puerperal period of Parameters Control Group I Group II Group III Group IV goats. Bulletin of the Vet. Ins. Pulawy. 47: 177-182. (n=36) (1st lactation) (2 nd lactation) (3rd lactation) (4th lactation) Liesegang A (2008) Influence of anionic salts on bone metabolism (n=36) (n=36) (n=36) (n=36) in periparturient dairy goats and sheep. J. Dairy Sci. Calcium 9.86±0.28a 9.12±0.78b 9.48±0.86b 9.75±0.07b 9.72±0.09b 91: 2449-2460. (mg/dl) Nale RA (2003) Metabolic profiling in buffaloes before and after Phosphorus 5.24±0.11a 4.81±0.13b 5.23±0.11a 5.47±0.15a 5.01±0.14a parturition. M.V.Sc. Thesis submitted to MAFSU, Nagpur. (mg/dl) Nazifi S, Saeb M and Ghavami SM (2002) Serum lipid profile in Mean with different superscript in the row differ significantly (P<0.05) Iranian fat-tailed sheep in late pregnancy, at parturition and during the post-parturition period. J. Vet. Med. 49: Autunovic Z, Noveselec J, Sauerwein H, Speranda M and Vegara 9-10. M (2011) Blood metabolic profile and some hormones NRC (1980) Mineral tolerances of domestic animals. National concentration in ewes during different physiological Research Council, National Academy of Science. status. Bulgarian J. Agr. Sci. 17: 687-695. Washington, DC. Autunovic Z, Sencic D, Speranda M and Liker B (2002) Influence Piccione G, Giovanni C, Claudia G, Alessandro Z and Pietro P of the season and the reproductive status of ewes on (2009) Selected biochemical serum parameters in ewes blood parameters. Small Rumin. Res. 45: 39-44. during pregnancy, post parturition, lactation and dry Bertoni G, Trevisi E and Lombardelli R (2009) Some new aspects period. Anim. Sci. Papers and Reports. 27:321-330. of nutrition, health conditions and fertility of intensively Ramkrishna KV (1991) Comparative studies on certain reared dairy cows. Italian J. Anim. Sci. 8: 491-518. biochemical constituents of lactating and dry Murrha Carcangiu V, Vacca GM, Mura MC, Dettori ML, Pazzola M, Fiori M buffaloes. Livest. Adv. 14: 16-19. and Bini PP (2008) Blood parameters during lactation Rook JAF and Thomas PC (1983) Nutritional physiology of farm and dry period in Sarda sheep breed. Animal. 2:109- animals, Vol. 1. Longman Inc. New York. 113. Rowlands GJ (1990) Changes in albumin, globulin, glucose and Ceylan E, Tanritanir P and Dede D (2009) Changes in some macro- cholesterol concentration in blood of dairy cows in a minerals and biochemical parameters in female healthy late pregnancy and early lactation. J. Agr. Sci. 94: Siirt hair goats before and after parturition. J. Anim. 517-527. Vet. Advances. 8: 530-533. Samardzjia M, Dobranic T, Lipar M, Harapin I, Prvanovic N, Girzelji Hagawane SD, Shinde S and Rajguru D (2009) Haematological J, Gracner G, Dobranic V, Radisic B and Duricic D and blood biochemical profile in lactating buffaloes in (2011) Comparison of blood serum macromineral and around Parbhani city. Vet. World. 2: 467-469. concentrations in meat and Dairy goats during Jozwik A, Strzalowska N, Bagnicka E, Grzybek W, Krzyzewski puerperium. Veterinarski Ahriv. 81: 1-11. J, Polawska E, Kolataj A and Horbanczuk JO (2012) Strzalkowska N, Joswik A, Bagnicka E, Krzyewski J and Relationship between milk yield, stage of lactation, and Horbanczuk JO (2009) Studies upon genetic and some blood serum metabolic parameters of dairy cows. environmental factors affecting the cholesterol content Czech. J. Anim. Sci. 57: 353-360. of cows milk. II. Effect of silage type offered. Anim. Jozwik A, StrzalowskaN, Bagnicka E, Lagodzinski Z, Pyzel B, Sci. Papers Reports. 27: 199-206. Chylinski W, Czajkowska A, Grzybek W, Stoniewska D, Yildiz A, Balikci E and Gurdogan F (2005) Serum mineral levels Krzyzewski J and Horbanczuk JO (2010) The effect at pregnancy and postpartum in single and twin of feeding linseed cake on milk yield and milk fatty acid pregnant sheep. Biol. Trace Element Res. 107: 247- profile in goats. Anim. Sci. Papers reports. 28: 245- 254. 251. Zvorc Z, Mrljak V, Susic, V and Gotal, JP (2006) Haematological Karapehlivan M, Atakisi E, Atakasi O, Yucayurt R and Pancarci and biochemical parameters during pregnancy and SM (2007) Blood biochemical parameters during the lactation in sows. Veterinarski Arhiv. 76: 245-253. lactation and dry period in Tuj ewes. Small Rum. Res. 73: 267-271.

209 Veterinary Practitioner Vol. 20 No. 2 December 2019

PRE-PHACOEMULSIFICATION ELECTRORETINOGRAPHY IN CATARACTOUS DOGS USING HMsERG SYSTEM

S.K. Jhirwal1, R. Singh2, P. Sanel2, N.K. Kumawat2, Anil Kumar2, Munna Lal3, P. Bishnoi4 and T.K. Gahlot5 Department of Veterinary Surgery and Radiology, College of Veterinary and Animal Science Rajasthan University of Veterinary and Animal Sciences, Bikaner-334 001, Rajasthan, India

Received revised on: 30.09.2019 ABSTRACT Accepted on: 09.11.2019

In the present study electroretinographic study was conducted in five dogs (10 eyes) as a pre-phacoemulsification examination for the assessment of retinal status. All the dogs were presented with the history of visual abnormality. After detailed ophthalmic examinations ten eyes were diagnosed with cataract. Electroretinography proved to be a useful adjunct test for pre-operative evaluation of retinal functions in conjunction with cataract surgery.

Key words: PHACO, emulsification, retinography, cataract, dog

Introduction general anaesthesia using a combination of Ketamine HCld The ERGy has been useful for the diagnosis and evaluation (50 mg/ml) @ 5 mg/kg body weight and Xylazine HCle (23.32 of retinal function in dogs in the presence of cataract, mg/ml) @ 1 mg/kg body weight for induction along with atropine hemeralopia, intoxications, sudden acquired retinal sulphatef @ 0.03 mg/kg body weight as premedicant and was degeneration, cortical blindness (Van Der Woerdt, 1991; Sims, maintained with Ketamine HCl till effect. 1999) and vitreous haemorrhage (Gelatt and Wilkie, 2011; The dog was placed in sternal recumbency in an exclusive Ekesten, 2013). Sudden unexplained blindness, with possible dark room and head was positioned by placing a cotton pillow inherited retinal disease, or with opacities of the cornea or under the lower jaw, so that it provided stabilisation and comfort. lens where the retina appears normal or is not visible at all, All the electronic devices viz., mobiles, batteries, etc. were use of this diagnostic technique is desirable to determine more kept off to avoid electrical interference with the ERG unit. specifically the functional integrity of the retina. Retinal diseases Diagnosis was performed by the individual sitting on the front could be ruled out as the cause of blindness or the presence of the patient. Inadvertent entry of personnel’s was avoided. of a normally functioning retina behind a dense cataract could Impedance (electrical resistance from the electrodes to be confirmed. Although there is no one test that evaluates the the ground) and biosignal (electrical potential of the electrodes functional integrity of all the retinal layers, the electroretinogram without a stimulus) were checked every time before starting (ERG) comes closest to the ideal (Aguirre, 1973). the measurement. A normal biosignal should look Electroretinography is valuable in canine ophthalmology approximately like a more or less spiky line and later the in particular, as there are several circumstances in which retinal scotopic ERG was recorded. function cannot be interpreted from the ophthalmoscopic Positioning of electrodes and steps for ERG reading were appearance alone. It is used in the preoperative assessment as per the guidelines of Narfstrom et al. (2002). Needle of retinal function in dogs with advanced cataracts (Mould, electrodes were used as reference and ground electrode. A 2002). reference electrode (black cable) was placed subcutaneously halfway between the temporal canthus and the ear. A similar Materials and Methods subcutaneous ground electrode (blue) was placed at an For ERGy, HMsERG (Hand held multispecies indifferent position i.e. at the central top portion of the head. a Electroretinography) unit (clarity easy trace) was used that The active electrode was placed directly on the cornea after included HMsERG Amplifier, patient cable, LED flash, Ganzfeld topical anaesthesia with 0.5% proparacaineg (Fig. 2). An stimulator, Koijman electrode (active), reference and ground adequate amount of gel hypromellose ophthalmic solutionh electrodes and a display unit (Laptop and a Printer) (Fig. 1). was applied on the inner surface of the Koijman electrode All the animals were fasted for 12 hrs before performing before using it on the cornea. ERG. Maximal pupillary dilation was achieved by topical Scotopic (rod and combined rod-cone) and Photopic (cone b instillation of 1% tropicamide (2 drops every 10 minutes) as and 30-Hz response) flicker LED programme was selected in mydriatic for 30 minutes prior to procedure and for ocular the HMsERG system for a quick ERG recording and the c antisepsis 0.5% Povidine Iodine solution was used for 2-3 photopic and scotopic vision was tested with a standard flash times. (3.0 cd. s/m2). Electroretinographies were recorded The electroretinography of retina was performed under automatically and the a- and b- wave amplitude (µV), and implicit 1Assistant Professor & Corresponding author; 2MVSc. Scholar; 3Teaching Associate; 4Associate Professor & Head; 5Professor (Retd. & Re-employed) aHandheld multi species Electroretinography, Clarity Medical Pvt. Ltd. Mohali, India; bTropicacyl, SUNWAYS (INDIA) PVT. LTD; cTROYDINE, Troikaa Pharmaceuticals Ltd. Gujrat, India; dAneket, NEON, laboratories limited, Mumbai, India; eXylaxin, Indian IMMUNOLOGICALS LIMITED, Hyderabad, India; fAtropine Sulphate injection, MORVEL Laboratories (p) Ltd. Mehsana, India; gPARACAIN, Sunways Pvt. Immunologicals, Ahmedabad, India; hVISCOMET* PF, Unimed Technologies Ltd. Pancmahal, Gujrat, India 210 Veterinary Practitioner Vol. 20 No. 2 December 2019

Fig. 1: HMsERG system (Clarity, Easytrace-1) Fig. 2: Positioning of active electrode

Table 1: Grouping of affected dogs according to their age, sex peak. and breed Case Ocular Unilateral/ Results and Discussion Breed Age Sex Vision Etiology No. affection Bilateral Pre-phacoemulsification ERG was performed in five 01. Spitz 12 yrs M Mature Cataract Bilateral Absent Senile dogs (10 eyes) diagnosed with bilateral mature cataract to 02. GSD 7 months F Mature Cataract Bilateral Absent Unknown evaluate retinal function prior to cataract surgery (Table 1). 03. GSD 8 yrs F Mature Cataract Bilateral Absent Diabetic This was also indicated by Ofri (2002), Ekesten et al. (2013), 04. GSD 10 yrs F Mature Cataract Bilateral Absent Diabetic Wilkie and Colitz (2013), Safatle et al. (2010) and Donzel et 05. Mongrel 10 years M Mature Cataract Bilateral Absent Senile al. (2016). All the dogs under study were examined to confirm the Table 2: Detailed examinations of visual function tests of affected dogs cause of vision deficit before conducting ERGy by performing Case Ophthalmic Eye Menace Corneal PLR STT NCT Fluorescein various ophthalmic examinations such as menace reflex test, No. affection reflex test reflex test (mm/min) (mmHg) dye test corneal reflex test, pupillary light reflex test, Schirmer’s tear 1 Bilateral OS Negative Positive Positive 15 20 Negative test, non-contact tonometry, direct and indirect Mature OD Negative Positive Positive 18 16 Negative ophthalmoscopy, USG and fluorescein dye test (Table 2). Cataract Saroglu and Ekici (2010) and Jeong et al. (2013) also 2 Bilateral OS Negative Positive Positive 17 16 Negative performed pre-diagnostic test such as menace reflex test, Mature OD Negative Positive Positive 16 19 Negative corneal reflex test and pupillary light reflex test before Cataract recording of ERG to rule out any ophthalmic disorder. 3 Bilateral OS Negative Positive Positive 20 22 Negative In all the five dogs pupillary dilation for throughout the Mature OD Sluggish Positive Positive 15 17 Negative procedure was achieved by the instillation of two drops of Cataract 1% tropicamide every 10 minutes for 30 minutes. Safatle et 4 Bilateral OS Positive Positive Positive 16 18 Negative al. (2005) and Saroglu and Ekici (2010) also used 1% Mature OD Negative Positive Positive 18 20 Negative tropicamide in dogs to dilate the pupil of eye prior to ERG. Cataract Prior to placement of active electrode corneas were protected 5 Bilateral OS Negative Positive Positive 20 18 Negative with non-irritating solution, such as hypromellose cellulose mature OD Positive Positive Positive 19 17 Negative cataract as advised by Narfstrom et al. (2002). Preoperative ERG of all the five cataractous dogs under PLR- Pupillary Light Reflex; STT- Schirmer’s Tear Test; NCT- Non Contact study showed decrease in the b-wave amplitude but no Tonometry remarkable changes in the implicit time as compared to the time (ms) were auto generated using the dog diagnostic normal dogs was recorded. Hence, the dogs were a good protocol pre-programmed for this equipment which came from subject to cataract surgery. It was reported that the ERG was the manufacturer that way. slightly reduced in amplitude in a dog with cataract with Wave amplitude and implicit time were determined for normal retina (Aguirre, 1973; Fishman, 2001). The presumed each response. Amplitude of the a-wave was measured from reason for decreased ERG amplitude and prolonged implicit the baseline to the peak of the first negative deflection, and that time in eyes with mature cataract is that cataract acts as a of the b-wave was measured from the peak of the a-wave to filter that reduces stimulus strength. Similar observations the largest positive-trough of the combined rod-cone response. were made earlier by Maehara et al. (2007). For each Implicit times of both waves were measured from the onset of measurement, from both scotopic (Table 3) and photopic the flash stimulus to the peaks of the a- and b-waves. To ERG (Table 4), the mean of a- and b-wave amplitudes, and evaluate the rod and cone responses, a- and b-wave implicit times, as well as b/a ratio were calculated. The mean components were measured. Amplitudes of the 30-Hz flicker ± SE of b/a ratio for dogs with cataract was 9.91± 3.13. Mean were measured from the baseline to the positive peak and the peak to peak amplitudes in the present study seemed to be implicit times were calculated from the light onset to the positive smaller for each dogs with b/a ratio higher than the normal 211 Veterinary Practitioner Vol. 20 No. 2 December 2019

Table 3: Electroretinogram a & b wave analysis of 10 eyes of dogs presentation of canine cataracts in France: a retrospective (Scotopic) study of 404 cases. Vet. Ophthalmol. 1-9. Ekesten B, Komaromy AM, Ofri R, Petersen-Jones SM and Narfstrom S. Ophthalmic Eye Scotopic K (2013) Guidelines for clinical Electroretinography in the No. Affection Rod Combined rod-cone Amplitude Implicit Amplitude Implicit dog: 2012 update. Docum. Ophthalmologica. 127: 79-87. (µv) time (ms) (µv) time (ms) Fishman GA (2001) The electroretinogram. In Fishman GA Brich DG a b A b a b b/a a b Holder GE and Brigell MG (Eds.), Electrophysiologic testing 1 Bilateral OS 0.8 4.3 4.5 18.8 8.5 46.1 5.4 10.9 30.8 (2nd ed., pp. 1-155). The Foundation of the American Mature OD 1.6 3.6 10.9 21.4 4.8 15.7 3.2 10.1 31.5 Academy of Ophthalmology, San Francisco. Cataract Gelatt KN and Wilkie DA (2011) Surgical procedures of the lens and 2 Bilateral OS 1.0 46.0 18.4 67.5 5.5 170.6 31.0 9.8 32.6 cataracts. In: Gelatt KN and Gelatt JP (eds.): Veterinary Mature OD 3.5 52.9 19.5 67.9 26.1 313.7 12.0 10.1 32.6 Ophthalmic Surgery. 1st ed. Saunders Ltd, Phila-delphia, Cataract 3 Bilateral OS 0.0 16.1 28.9 63.0 20.4 23.5 1.1 8.3 18.0 USA, pp. 314-343 Mature OD 2.3 14.7 27.0 63.8 5.6 10.0 1.7 10.1 18.0 Jeong MB, Shin AP, Kim SE, Park YW, Narfstrom K and Seo K (2013) Cataract Clinical and Electroretinographic Findings of Progressive 4 Bilateral OS 1.6 2.5 8.3 17.3 6.9 124.4 18.0 19.1 60.8 Retinal Atrophy in Miniature Schnauzer Dogs of South Korea. Mature OD 17.4 13.2 9.0 18.8 8.8 22.5 2.5 8.3 37.5 J. Vet. Medicine Sci. 75(10): 1303-1308. Cataract Maehara S, Itoh N, Wakaiki S, Yamasaki A, Tsuzuki K and Izumisawa Y 5 Bilateral OS 1.1 8.5 7.9 30.0 8.1 153.7 18.9 12.4 41.3 (2007) The effects of cataract stage, lens-induced uveitis Mature OD 0.5 4.8 12.0 26.6 15.3 82.1 5.3 9.4 31.9 and cataract removal on the ERG in dogs with cataract. Vet. Cataract Mean± SE 2.98 16.66 14.64 39.51 11.00 96.23 9.91 10.85 33.5 Ophthalmol. 10(5): 308-312. ±1.63 ±5.69 ±2.65 ±7.20 ±2.28 ±30.60 ±3.13 ±0.99 ±3.82 Mould JR (2002) Ophthalmic examination. BSAVA Manual of Small Animal Ophthalmology, Second edition, Woodrow House, 1 Telfard Way, Watelwells Business Park, Quedgeley, Table 4: Electroretinogram a & b wave analysis of 10 eyes of dogs Gioucester GL2 4AB. pp. 20. (Photopic) Narfstrom K, Ekesten B, Rosolen SG, Spiess BM, Percicot CL and Ofri S. Ophthalmic Eye Photopic R (2002) Guideline for clinical electroretinography in the No. Affection Cone Flicker dog. Documenta Ophthalmologica. 105: 83-92. Amplitude Implicit time Amplitude Implicit time (µv) (ms) (µv) (ms) Ofri R (2002) Clinical electrophysiology in veterinary ophthalmology- a b A b a b a b the past, present and future. Documenta Ophthalmologica. 1 Bilateral OS 2.7 17.6 5.6 25.9 1.7 6.3 6.4 21.0 104: 5-16. Mature OD 2.3 29.7 7.5 27.8 1.8 6.4 6.4 20.6 Safatle AM, Hvenegaard AP, Otsuki D, Martins TL, Kahvegian M, Cataract 2 Bilateral OS 0.0 235.9 2.6 32.6 3.8 11.5 6.8 22.0 Berezovsky A, Salomao SR and Barros PS (2010) Mature OD Comparision of Full- Field electroretinogram in diabetic and 8.5 189.7 9.0 32.3 4.7 4.7 9.8 23.0 Cataract non-diabetic dogs with cataracts. Pesquisa Veterinária 3 Bilateral OS 0.1 17.8 11.3 40.5 1.1 1.9 10.5 26.3 Mature OD Brasileira. 30(12): 1071-1076. 0.0 18.3 12.0 39.8 1.3 1.0 11.3 24.0 Cataract Safatle AM, Salomao S, Berezovsky A, Sacai P, Fantoni Yazbek K and 4 Bilateral OS 2.6 61.3 9.0 31.1 9.9 8.7 10.9 22.9 Barros PS (2005) Retinal degeneration in pit bull dog: Mature OD 18.2 35.3 18.4 42.8 1.2 1.4 8.6 16.9 Cataract Electroretinographic findings. Arch J. Vet. Sci. 10: 119-124. 5 Bilateral OS 4.7 10.3 8.6 24.8 1.4 5.0 6.4 22.5 Saroglu M and Ekici AB (2010) Electroretinographic Evaluation of Mature OD 2.1 64.8 7.5 30.0 2.6 6.5 7.1 21.0 Photoreceptor Cells in Turkish Shepherd Dogs. Kafkas Cataract Universitesi Veteriner Fakultesi Dergisi. 16(6): 969-976. Mean± SE 4.12 68.07 9.15 32.76 2.95 5.34 8.42 22.02 ±1.76 ±25.04 ±1.33 ±1.98 ±0.86 ±1.05 ±0.64 ±0.77 Sims MH (1999) Electrodiagnostic evaluation of vision. In K. N. Gellat ed. Vet. Opthalmo. 3rd ed. Lippincott Williams and Wilkins, Philadelphia. pp. 483-493. range established earlier by Singh (2017). Singh R (2017) Evaluation of Electroretinography using HMsERG system in Dogs. Post Graduate Thesis submitted to Rajasthan Acknowledgments University of Vet. and Animal Sci., Bikaner, Rajasthan, India. Author is thankful to P.I., AINP-DIMSCA project of ICAR, Van Der Woerdt A, Nasisse MP and Davidson MG (1991) Sudden Govt. of India for providing facilities in the form of instruments acquired retinal degeneration in dog: clinical and laboratory and equipments. findings in 36 cases. Progress in Vet. and Compa. Ophthal. 1(1): 11-18. References Wilkie DA and Colitz CM (2013) 22. Surgery of the lens. In: Gelatt KN, Aguirre GD (1973) Electroretinography in Veterinary Ophthalmology. Gilger BC, Kern TJ (eds.): Veterinary Ophthalmology. 5th ed. J. Amer. Anim. Hospital Assoc. 9: 234-237. Wiley-Blackwell, New Jersey, USA. 1234-1286. Donzel E, Arti L and Chahory S (2016) Epidemiology and clinical

212 Veterinary Practitioner Vol. 20 No. 2 December 2019

TRAUMATIC LATERAL ELBOW LUXATION IN SIX DOGS AND ITS SUCCESSFUL MANAGEMENT BY CLOSED REDUCTION

Mohammad Shafiuzamma, Shahid Hussain Dar1 Shriram Ganesan, Sabrish Babu, S. Dinesh Kumar and Ravi Sundar George Madras Veterinary College, Tamil Nadu University of Veterinary and Animal Sciences, Chennai-600 007, Tamil Nadu, India Received on: 13.06.2018 ABSTRACT Accepted on: 18.07.2019

This paper presents the cases of lateral luxation of elbow joint in dogs. The cases which had history of lameness in the forelimb were included. After complete orthopaedic examination, two radiographic views were taken for final confirmation of the elbow luxation. Haemato-biochemical tests were also performed in all the cases. The total of six cases was presented for elbow luxation and all were having lateral luxation. General anesthesia with propofol was done predemicated with xylazine in all the dogs and maintained with isoflurane before intervention. In all the cases closed reduction was attempted and stabilised with modified Robert jones bandaging and incorporated with aluminium splints. After 15th day all the six dogs had stabilised joints and improvement in lameness was also observed.

Key words: Elbow luxations, orthopedic examination, propofol, xylazine, modified Roberts jones bandage Introduction mg/kg i/m as preanesthetic and then induced with propofol @ The elbow consists of the humeroradial, humeroulnar, 2 mg/kg i/v and the maintained with inhalant 2 per cent and proximal radioulnar joints. The elbow is a ginglymus Isoflurane semiclosed rebreathing system. (hinge) joint allows flexion, extension and a limited ability of The affected limbs were suspended with drip stand for rotation. The elbow joint is regarded as a stable joint as a fifteen minutes prior attempting closed reduction. Then dogs result of the combination of strong surrounding muscular and were putted on lateral recumbency and affected limb on top. ligamentous structures and the presence of the anconeal Reduction was achieved by applying manual traction and gentle process which interlocks into the olecranon fossa when the supination to the antebrachium (with the elbow in a moderately elbow is extended beyond 45 degrees (Schaeffer et al., 1999). flexed >90° position) to distract the coronoid process of the Due to these anatomical features and the nature of the ulna from the olecranon fossa. Pressure was applied to the forces that the elbow is most commonly subjected to during caudal aspect of the olecranon with the other hand. A clunk trauma, fracture of the distal humerus or proximal radius and was felt when reduction of the joint was achieved. Manipulation ulna is more common than elbow joint luxation in the dog of the joint after reduction demonstrated a normal range of (Brien et al., 1992). In over ninety percent of elbow luxations flexion and extension and angle of extension and flexion were the radius and ulna dislocate laterally relative to the humerus checked with goniometer. Stability was assessed with (Schaeffer et al., 1999). Traumatic luxations are usually seen Campbell’s test (Campbell, 1971). After reduction, the joints in cats and dogs older than one year of age. They are mostly were assessed by examination and radiography for evidence caused by traffic accidents, falling from a height or getting the of instability. They were placed in a Modified Robert jones leg caught in something (Denny and Butter worth, 2000). The bandage along with splints (aluminium) (Fig. 4) for two weeks majority of luxations reported in dogs occur due to road traffic and after its removal, owners were instructed to begin gentle accidents (Mitchel, 2011). This paper presents cases of lateral range of motion exercises and controlled limb use for 2 weeks. elbow luxation and successful treatment by closed reduction. All cases were evaluated post operatively by radiographically immediately after stabilization and after 15 days at the time of Materials and Methods removal of modified Robert jones bandage. The cases presented to the Madras Veterinary College Teaching Hospital, Small Animal Section Ortho unit, TANUVAS, Results and Discussion Chennai, from 2016 to 2017, which had complaint of non weight In the present study of one year from 2016 to 2017 a total lameness on forelimbs (Fig. 1). In all the cases, orthopaedic of 6 dogs were presented with elbow luxation. None of the examination were done, and goniometry of elbow joints were animals had fracture of the joint. also performed to measure the angle (Fig. 2). Two radiographic Four of the cases had road traffic accident and two had fall views were taken as anterio-posterior and medio-latero views from height and one had slipped on floor. Four cases were to evaluate radiographically and before reduction of luxated non descript breed, one Doberman pincher and one boxer joints, joints were again evaluated with C-Arm (Fig. 3). while as in cat, Persian cat breed were presented. The age Haematobiochemical tests were performed in all the cases distribution, were one and half year old to 11 years in dogs, before going for reduction. and of these three were female dogs and three male dogs. Before going for closed reduction, general anesthesia The duration of presentation ranges from first day to one week. was given with Xylazine @ 1mg/kg i/m and Butorphanol 0.1 On clinical examination all the animals had non weight

1Corresponding authoor email: [email protected]

213 Veterinary Practitioner Vol. 20 No. 2 December 2019

Table 1: Case details and out come after closed reduction

S. Breed Sex Age Day of Aetiology Reduction Clinical No. presentation outcome 1 Doberman Female 1.5 yrs 7th day Slipped on floor Stable Good Pincher 2 Boxer Female 1.5 yrs 1st day RTA Stable Excellent 3 Non descript Male 2 yrs 4th day Falling from height Stable Good 4 Non Descript Female 6yrs 7th day RTA instable Fair 5 Non Descript Male 3yrs 3nd day RTA Stable Good 6 Non Descript Male 11yrs 2nd day RTA Stable Good Clinical out come; Excellent: Not lame or stiff; Good: Slight lameness when running; Fair: Slight lameness when walking; Poor: Lameness when walking

Fig. 1: Non weight bearing of left elbow joint Fig. 4: Splint (aluminium) applied after reduction of elbow

Fig. 2: Measurement of angle of luxated elbow joint by goniometer Fig. 5: Radiograph of elbow joint after reduction of lateral luxation

Fig 3: Radiograph of lateral luxation of elbow joint Fig. 6: Weight bearing of elbow joint after 2nd week post reduction 214 Veterinary Practitioner Vol. 20 No. 2 December 2019 lameness (grade 5) on the affected forelimb, joint movements All the elbow luxations were treated using closed were limited and pain on extension and flexion of elbow joint reduction as stability of joints were identified from Campbell’s (moderate pain) and crepitation along with moderate swelling test; pronation of the elbows were less than 40 degrees, with and animals were carried the limb with flexed elbow joint. On the elbow and carpus in 90 degrees of flexion, which suggested goniometer all luxated elbow joints had reduced angle of flexion no transection of the medial collateral ligament (Denny and and extension of the elbow joints. In the radiographic Butterworth, 2000). Closed reduction was carried out as early examination of elbow joint all the cases had lateral luxation as possible and fixed stability of the elbow was achieved in all without fracture. cases (Taylor, 1998). To determine the stability of elbows After closed reduction of elbow joint all joints were stable following closed reduction, the Campbell test (Campbell, and had improved angle of extension and flexion and recorded 1971) was used immediately post operatively and after 2-4 with goniometer. Immediately after reduction, radiographs were weeks postoperatively. Following reduction of the luxation, an taken with the help C-Arm to confirm the correct reduction (Fig. application similar to the Robert-Jones bandage and splint 5). None of the animal had more than 40 degree pronation was carried out for a period of 7-10 days. Joint movements which suggested that none of the animal had ligament tear. were restricted after bandage removal for two weeks as One dog had removed Robert jones bandage within 48 suggested by Brinker et al. (2006). hours and had reluxated joint, which was immediately again In the present study the best clinical results in cases of stabilised with closed reduction and Robert jones banging elbow luxation were obtained with an acute closed stable was reapplied. reduction as compared with late reduction and same had been After removing of Robert jones bandage on 15th day, all observed by the O’Brien et al. (1992). In one case the dog had six dogs had stable joint.The clinical outcome was determined removed the Robert jones bandages and had reluxated the on the basis of lameness score during walking and standing joint within 48 hours after reduction and was restabilised with as: excellent in one dog, good in four dogs and fair in dog (Fig. closed reduction method and the outcome was fair. 6). The range of motion in all cases improved while as in one In conclusion, in acute stable elbow luxations, closed case it was moderately increased. reduction carried out under general anaesthesia and stabilised Traumatic elbow luxations are encountered frequently in with Robert jones bandage, provides successful recovery small animal practice. They are usually caused by traffic without damaging joint surfaces and ligaments. accidents, falling from a height or getting the leg caught in something (Denny and Butterworth 2000 and Schaeffer, 1999). References In this study, the elbow luxation’s were also caused by traffic Brinker WO, Piermatte Ý DL and Flo GL (2006) The Elbow joint. In: Handbook of small Animal orthopedics and fracture repair. accidents and falling from height. 4th edn., Philadelphia, W.B. Saunders Company, pp. 325- In the present study the age of dogs and cat were more 358. than one year and same have been observed by the Schaeffer Campbell JR (1971) Luxation and ligamentous injuries of the elbow of et al. (1999). the dog, Vet. Clin. North Amer. 1(3): 429-440. In the clinical examination, it was seen that the affected Denny HR and Butter-Worth SJ (2000) The elbow. In: A guide to forelimbs were not used, that the joints were held in slight canine and feline orthopaedic surgery. 4th edn., Blackwell flexion and abduction as well as rotation in the antebrachium Science, London, pp. 363-388. Mitchell KE (2011) Traumatic elbow luxation in 14 dogs and 11 cats. and that the region were painful and joint movement were Aus. Vet. J. 89(6): 213-216. limited. These clinical findings were consistent with other O’Brien MG, Boudrieau RJ and Clark GN (1992) Traumatic luxation of literatures (Schaeffer et al., 1999 and Brinker et al., 2006). the cubital joint (elbow) in dogs: 44 cases (1978- 1988) J. Radiographic investigation revealed that the luxations Amer. Vet. Med. Assoc. 201(11): 1760-1765. were in the lateral direction (Fig. 2 and 3). The fact that the Schaeffer IGF, Wolvekamp P, Meij BP, Theijse LFH and Hazewinkel medial humeral epicondyle is longer and larger causes more HAW (1999)Traumatic luxation of the elbow in 31 dogs. than 90 per cent of luxations to occur laterally. Luxation may Vet. Comp. Orthop. Traumatol. 12: 33-39. also occur medially or caudally. In the present cases all animals had lateral luxation’s which are also in consistent with the findings of Schaeffer et al. (1999).

215 Veterinary Practitioner Vol. 20 No. 2 December 2019

UROPERITONEUM IN BUFFALO CALF AS A SEQUELAE TO BLADDER RUPTURE OWING TO OBSTRUCTIVE UROLITHIASIS- A CASE REPORT

Manvi Chaudhary1, Ashwani Kumar and N.K. Sood2 Department of Veterinary Medicine, College of Veterinary and Animal Science Guru Angad Dev Veterinary and Animal Sciences University, Ludhiana-141 004, Punjab, India

Received on: 11.09.2019 Accepted on: 19.11.2019

Introduction Tentative diagnosis and its confirmation Uroperitoneum can be defined as the gradual acquisition The animal was tentatively diagnosed with uroperitoneum of urine in the peritoneal cavity caused by dripping of urine which was thought to have occurred due to either rupture of from any part of urinary system (Maxie and Newman, 2007) or urinary bladder, leakage due to trauma to any part of urinary from ruptured persistent urachus (Braun et al., 2006). Any system or due to persistent urachus. The diagnosis was external force or accident causing trauma to the kidney can confirmed by ultrasonography of the abdomen and urinary tract cause harm to the renal capsule and can lead to leakage of in which non echogenic fluid in the abdomen was seen. Further urine in the peritoneal cavity (Grunder, 2002). Ureteral examination of the urinary tract revealed a 1.41 cm calculi seen obstruction can also lead to hydronephrosis in the kidneys in pre scrotal area causing obstruction to urine flow behind and further leakage of urine. A traumatised ureter can also which urine was standing which could possibly had led to the lead to retroperitoneal accumulation of urine referred to as rupture of urinary bladder due to accumulation of urine in the urinoma (Maxie and Newman, 2007). This condition is called urinary bladder. Both the kidneys were normal whereas the as waterbelly in male calves and is characterised by urinary bladder could not be observed. accumulation of urine in ventral abdominal region and inguinal region usually leading to pitting edema (Grunder, 2002). Treatment The animal was treated surgically where approximately 1 History to 1.5 L of urine was evacuated from the abdomen. The ruptured A 1 year and 8 months old buffalo calf was presented to bladder was repaired surgically and the animal revived within the Teaching Veterinary Clinical Complex, GADVASU, Ludhiana one week with submission of clinical signs. in the summer season with a history of complete loss of urination and defaecation for last four days. The animal was Discussion off fed while the water intake was normal. The owner also gave The most common cause of bladder rupture in male cattle the history of distended abdomen and pain which was evident is urolith induced urethral obstruction (Grunder et al., 2002) by kicking of the abdomen by the animal. which leads to uroabdomen which was evident in the present case. The classical clinical sign of bladder rupture is a pear- Clinical observations shaped abdomen attributable to accumulation of urine in the The animal was alert and active. The ventral abdomen peritoneal cavity (Braun and Nuss, 2015) and according to and the inguinal region was highly distended and gave the Braun et al. (2006) there are no distinct signs of pain following abdomen an inflated round appearance. bladder rupture, uroperitoneum is accompanied by, reduced The rectal temperature was recorded 101ºF which was in skin turgor, ruminal atony and gradual deterioration in appetite its normal range. The heart rate and respiration rate were which corroborated with our findings. The urination may be recorded to be 68 beats/min and 24 breaths/min which were normal, absent or there may be stranguria (Braun et al., 2006) again found to be in their normal ranges. The ruminal motility which was absent in the above descripted animal. The only was nil/2 min. The haematological examination revealed Hb diagnostic test for uroperitoneum is measuring creatinine 12.8 g%, total leukocytic count 9680 cumm, PCV 34%, platelets concentration in serum and peritoneal fluid. A peritoneal-to- 325000, absolute neutrophilic count 5808% and absolute serum creatinine concentration ratio of 2 or greater is diagnostic lymphocyutic count 3872%. The blood biochemical of uroperitoneum (Radostits et al., 2007) which was 3 times in examination revealed blood urea nitrogen 63 mg/dL and our findings. The blood urea nitrogen and creatinine creatinine 5.5 mg/dl which were found to be in their higher conenteration was also in their higher ranges which coincided ranges. The examination of peritoneal fluid revealed creatinine with previous findings of Bertone and Smith (1984). level to be 15.2 mg/dL which was approximately three times Ultrasonograms of uroperitoneum show massive fluid that in the blood a typical sign of uroperitoneum. The reagent accumulation involving the entire abdomen and organs that strip analysis of urine revealed presence of glucose, blood, appear suspended in the fluid (Braun and Nuss, 2015) which protein and urobilinogen in the urine of the animal. The pH of was also consistent with the present findings. the urine was alkaline whereas the specific gravity of the urine was low. The microscopic urinalysis revealed 10-20 RBCs/ References hpf, 2-4 pus cells/hpf and waxy casts. Bertone AL and Smith DF (1984) Ruptured bladder in a yearling heifer. J. Am. Vet. Met. Assoc. 184: 981-982.

1MVSc. Scholar; 2Professor, Very. Clinical complex, Department of Veterinary Pathology, GADVASU, Ludhiana

216 Veterinary Practitioner Vol. 20 No. 2 December 2019

Fig. 1: Animal with distended abdomen Fig. 2: Distended abdomen (A close view)

Fig. 3: Anechoic fluid in the abdomen Fig. 4: Hyperechoic calculi in prescrotal area

Fig. 5: Evacuation of urine from abdomen Fig. 6: Ruptured urinary bladder

Braun U and Nuss K (2015) Uroperitoneum in cattle: Ultrasonographic Buchverlag, pp. 719-736. findings, diagnosis and treatment. Acta Veterinaria Maxie MG and Newman SJ (2007) Acquired anatomic variations. In: Scandinavica. 57: 36 Maxie MG, editor. Jubb, Kennedy, and Palmer’s Pathology of Braun U, Nuss K, Wapf P and Lischer C (2006) Clinical and Domestic Animals. Volume 2. Edinburgh: Saunders Elsevier, ultrasonographic findings in five cows with a ruptured pp. 506-507. urachal remnant. Vet Rec. 159: 780-782. Radostits OM, Gay CC, Hinchliff KW and Constable PD (2007) Rupture Gründer HD, Krankheiten Von Harnleiter, Harnblase and Harnröhre of the bladder (uroperitoneum). In: Veterinary Medicine. A (2002) In: Dirksen G, Gründer HD, Stöber M, editors. Innere Textbook of the Diseases of Cattle, Horses, Sheep, Pigs Medizin und Chirurgie des Rindes. 4. Berlin: Parey and Goats. 10th ed. Philadelphia: Saunders Elsevier, pp. 562- 563.

217 Veterinary Practitioner Vol. 20 No. 2 December 2019

EFFECT OF ADDITION OF CHOLESTEROL LOADED CYCLODEXTRIN (CLC) ON SPERM ABNORMALITIES DURING CRYOPRESERVATION OF POITOU JACK SEMEN#

Pramod Kumar1, J. S. Mehta, S. K. Ravi2, G. N. Purohit, Ashok Kumar Chaudhary, Ramesh Kumar Dedar3 and T. R. Talluri3 Department of Veterinary Gynaecology and Obstetrics, College of Veterinary and Animal Science Rajasthan University of Veterinary and Animal Sciences, Bikaner-334 001, Rajasthan, India

Revised Received on: 13.05.2019 ABSTRACT Accepted on: 05.07.2019

The current study was conducted to investigate the effect of addition of cholesterol loaded cyclodextrin (CLC) on sperm morphologi- cal abnormalities of cooled and frozen thawed semen of Poitou jacks. Six adult Poitou jacks aged between 4 to 7 years were used for the present study and eight ejaculates from each jack was collected and were processed immediately after semen collection and subjected to the gross semen quality analysis. The sperm morphologies of fresh semen were analyzed by staining with eosin and nigrosine staining. The semen sample of each Poitou jack was divided into five equal fractions which were incubated for 15 minutes 0 in water bath at 37 C after addition of primary extender without CLC (C); and with 1, 1.5, 2 and 3 mg/ml CLC (T1, T2, T3 and T4, respectively) to obtain 120 × 106 sperm/ml spermatozoa concentration. All the 5 aliquots were cryopreserved. Each cooled and frozen thawed semen samples, after thawing at 370C for 30 sec were analyzed for sperm morphologies. From the current studies it was observed that treatment of Poitou jack semen samples with CLC could not reduce any significant sperm abnormalities at either pre- freeze and post thaw stage and this was also true for addition of different concentration of CLC.

Key words: Cholesterol-loaded cyclodextrins, cryopreservation, Poitou jacks, sperm abnormalities

Introduction et al., 2012). Recently, cholesterol has been incorporated into Artificial insemination (AI) has become an inevitable tool the plasma membranes of spermatozoa using methyl-β- in the breeding management of many of the domestic animals. cyclodextrin as a carrier. Previous studies with stallion (Kirk et Though, AI has been successfully implemented among the al., 2001; Kumar et al., 2019) and donkey (Alvarez et al., 2005) cattle population; it has not been as successful among the cooled spermatozoa showed an increase in motility after equines especially in donkeys. Equine semen is one of the treatment with cholesterol-loaded cyclodextrin (CLC). most difficult to cryopreserve efficiently without causing damage Species differences in the susceptibility of spermatozoa to membrane or apoptosis. The successful use of to cold shock and freezing damage are due to membrane lipid cryopreserved sperm largely depends on cryosurvival rates, composition, particularly the phospholipid: cholesterol ratio. which show large variation among species and individuals of Cholesterol stabilizes membranes and lowers the the same species (Vidament et al., 2009; Wu et al., 2015; temperature at which phase transition occurs. Prien and Iacovides, 2016). Cyclodextrins are cyclic oligosaccharides, which are the During cryopreservation process, the sperm membrane main degradation products of starch. One of the frequently undergoes a series of injuries provoked by variations in used cyclodextrins, methyl-beta-cyclodextrin can solubilize temperature and the modification of its physical state. These hydrophobic molecules such as cholesterol. Some studies include osmotic and thermal stress, the formation of have reported that adding cholesterol loaded cyclodextrin (CLC) intracellular ice crystals, and excessive production of reactive into bull, ram, and stallion semen extenders doubles, even oxygen species (Chatterjee and Gangnon, 2001). These triple the sperm cholesterol content (Purdy and Graham, 2004) changes promote the destabilization of the sperm lipid as well as the cholesterol-phospholipid ratio. As a result of membrane (Trevizan et al., 2018). During the cryopreservation this increase, the semen gets the least damage due to the process, the semen is initially refrigerated at room temperature, temperature changes at the freezing stage. It is reported that that is, from 37ºC to 20ºC, which does not seem to cause great addition of CLC into semen extender generally increases total damage to the spermatozoa. However, the initial stress occurs motility, mitochondrial activity, membrane integrity and viability. when sperm cells pass from body temperature to 5°C, These improvements generally observed ranging from 1-2% characteristic of the transition phase, in which the plasma to 24%, mostly between 10-20% (Purdy and Graham, 2004; membrane changes from the crystalline liquid state to the gel Moce et al., 2010). In addition, there are some reports indicating state. This transition phase occurs both during the freezing that treatment of sperm with CLC decreases the damage in process and thawed (Graham, 1996). By increasing the acrosome, abnormal spermatozoa rate (Mansour, 2009), and cholesterol content of the membranes, there is an DNA fragmentation (Katanbafzadeh et al., 2014). improvement in the sperm parameters after thawing (Blanch With this background information, in order to find any

#1Part of Ph.D. Thesis submitted by first author and corresponding author: email: [email protected]; 2Division of Animal Reproduction, ICAR- Central Island Agricultural Research Institute (CIARI), Port Blair, India; 3Senior Scientist, EPC-NRCE, Bikaner, Rajasthan, India

218 Veterinary Practitioner Vol. 20 No. 2 December 2019 beneficial effect of CLC addition in diminishing the sperm secondary semen extender to make the final concentration abnormalities and thus boosting the semen quality in Poitou 150 X 106 sperm/ml. French medium straws of 0.5 ml capacity jacks was investigated in this current study. were filled with extended semen (C, T1, T2, T3 and T4) by automatic straws filling and sealing machine and kept at 40C Materials and Methods for 2 hours equilibration in cooling cabinet. After equilibration, Experiment animals the straws filled with diluted semen were laid horizontally onto Six apparently healthy Poitou jacks aged between 4 and 7 a wired net and lowered into a styrofoam box containing two years maintained at Equine Production Campus, ICAR- inch level of liquid nitrogen for 10-12 minutes before plunging National Research Centre on Equines, Bikaner under uniform into liquid nitrogen. After 24 hours of its storage straws from conditions of feeding and management were utilized for the each group were thawed at 370C for 30 sec for post-thaw study. evaluation. Chemicals: The chemicals used in the study are listed below with source of their procurement in parentheses. Methyl- Estimation of sperm abnormalities in semen samples β-cyclodextrin (Sigma-Aldrich), Cholesterol (Hi-Media), Eosin Sperm morphology was assessed in fresh, pre-freeze Y (Sigma-Aldrich) and Nigrosine (Hi-Media) etc. and others and frozen thawed semen samples by using eosin-nigrosin once were procured from standard commercial sources. stained smears of semen sample under microscope at 100 X oil immersion (Nikon Instech Co. Ltd., Kanagawa, Japan). CLC preparation Preparation of eosin-nigrosin stain for live-dead sperm Cyclodextrins was prepared as described by (Purdy and count and sperm morphology Graham, 2004). First of all, 200 mg of cholesterol was dissolved 1. 3 g of sodium citrate (dihydrate) was dissolved in 100 ml in 1 ml of chloroform in a glass tube. In second glass tube, 1 distilled water to make 3% solution. gm of methyl-β-cyclodextrin was dissolved in 2 ml of methanol. 2. 1 g eosin B and 5 g nigrosin were taken to dissolve in 100 ml Then, 0.45 ml aliquot of the cholesterol solution was added to 3% sodium citrate (dihydrate). the cyclodextrin solution, and the mixture was stirred until the 3. pH of the stain was adjusted to 7.0 by adding a few drops of combined solution appears clear. After which, the mixture was 0.1 M NaH2PO4 and filtered. This mixture was kept stored at poured into a glass petri dish and solvents were removed room temperature for further use. using a stream of nitrogen gas. The resulting crystals were To prepare smear, one drop of semen (fresh, pre-preeze allowed to dry for an additional 24 hours. The crystals were and post-thawed) was placed on clean, grease free, pre removed from the dish and stored in a glass container at room warmed glass slide and mixed with one drop of eosin-nigrosin temperature. A stock solution of CLC was prepared by adding stain using blunt fine glass rod. A total of 100 spermatozoa 50 mg of CLC to 1 ml of primary extender at 37°C by mixing the were examined for different sperm abnormalities such as solution using a vortex mixer for 30s. Working solutions of abnormal head, detached head, proximal or distal cytoplasmic different concentration of CLCs were prepared from the stock droplet, abnormal mid piece, bent or coiled tail etc. solution (dilution with primary extender) on the day of semen collection. Statistical analysis Data obtained were analysed statistically by one way or Collection of semen and its processing two way ANOVA using the SPSS/PC computer program (version Semen collection and cryopreservation procedures were 20.0), based on the standard procedures outlined by Snedecor followed as previously described by Talluri et al. (2016) and and Cochran (1994). Soni et al. (2018). Briefly, semen was collected by using an artificial vagina (Colorado model) as per the standard method Results twice a week in early morning hours. Total 48 ejaculates from There are few reports on cryopreservation of donkey sperm. 6 jacks (eight from each jack) were collected. Immediately The mean sperm percentage having abnormal head in fresh after collection, the semen sample was subjected to semen of each of the Poitou jacks was 2.43±0.08, 2.20±0.12, macroscopic or gross evaluation (for colour and consistency). 2.53±0.1, 2.53±0.12, 2.17±0.10 and 1.98±0.11%, respectively The semen was filtered into a warm, graduated measuring with an overall mean 2.30±0.05%. Significant difference bottle to get gel free semen. Total volume of semen, gel volume (P<0.05) was found among the jacks for the values. The mean and gel free semen volume were noted. Other fresh semen sperm percentage having abnormal sperm mid piece in fresh stage evaluations like pH using digital pH meter (ERMA INC, semen of each of the Poitou jacks was 2.89±0.13, 3.77±0.08, Japan) and sperm concentration (using Neubars chamber) 3.56±0.07, 3.61±0.09, 3.53±0.14 and 3.34±0.10%, respectively were performed as previously described by Soni et al. (2018) with an overall mean 3.45±0.06%. Significant difference was and Kumar et al. (2019). After fresh stage evaluation, five equal found (P<0.05) among the jacks for the values. The mean value observed for abnormal sperm tail in fresh semen of fractions (C, T1, T2, T3 and T4) of the semen sample were made. All the five aliquots were incubated for 15 minutes in water each of the Poitou jacks was 3.07±0.1, 3.61±0.08, 3.36±0.14, bath at 370C after addition of primary extender without CLC in 3.68±0.10, 3.53±0.08 and 3.29±0.06%, respectively with an C (Control); and primary extender with 1, 1.5, 2 and 3 mg/ml overall mean 3.42±0.05%. Significant difference (P<0.05) was 6 found among the jacks for the values. The mean total sperm CLC in T1, T2, T3 and T4, respectively to obtain 120×10 sperm/ ml as final spermatozoa concentration. The aliquots were abnormality in fresh semen of each of the Poitou jacks was centrifuged in 50 ml centrifuge tube (300 X g for 5 min) at 100C 8.38±0.11, 9.58±0.11, 9.43±0.10, 9.68±0.08, 9.23±0.11 and to get sperm pellet. The supernatant i.e. seminal plasma was 8.61±0.10%, respectively with an overall mean 9.15±0.08% removed and each sperm pellet was then extended with (Table 1). Significant difference (P<0.05) was found among 219 Veterinary Practitioner Vol. 20 No. 2 December 2019 the jacks for the values. 14.38±0.09% in C, T1, T2, T3 and T4 group, respectively. Non- significant difference was found among the jacks. Sperm abnormalities in cooled semen of Poitou jacks The mean percentage of sperm having abnormal head Discussion (Fig. 1) in each of the Poitou jack with different concentration of It has generally been accepted that certain morphological CLC treatments are presented in Table 2. The overall mean structural deviations correlate with male sub-fertility and infertility value observed was 2.69±0.03, 2.67±0.03, 2.65±0.03, (Pesch and Bergmann, 2006). Stallions with good fertility will

2.61±0.03 and 2.65±0.03% in C, T1, T2, T3 and T4 group, often have >60% normal sperm and <5% abnormalities respectively. Non-significant difference was found among the occurring in the acrosome and mid-piece (Samper et al., groups. The mean percentage of sperm observed for abnormal 2007). Numerous factors, for the instance, genetic defects, mid piece in each of the Poitou jack with different concentration disease, nutrition, or temperature can result in abnormal sperm of CLC treatments are presented in Table 2. The overall mean morphology (Barth and Oko, 1989). Any morphological defect value observed was 3.91±0.06, 3.90±0.05, 3.86±0.05, which affects the progressive motility of a spermatozoon can

3.81±0.05 and 3.86±0.04% in C, T1, T2, T3 and T4 group, reduce its ability to reach the oocyte and fertilize (Pereira et al., respectively. Non-significant difference was found among the 2017). groups. The mean percentage of sperms observed for Sperm cryopreservation plays an essential role in the abnormal tail in each of the Poitou jack with different preservation of genetic material of endangered species, as it concentration of CLC treatments are presented in Table 2. allows for the storage of semen for long periods of time. In The overall mean values observed was 3.99±0.05, 3.93±0.05, addition, it facilitates the management of animals, since they

3.88±0.06, 3.85±0.06 and 3.92±0.06% in C, T1, T2, T3 and T4 do not need to be transported over long distances, avoiding group, respectively. Non-significant difference was found the stress caused by transportation, as well as avoiding the among the groups. The overall mean percentage of total sperm potential for contagion of sexually transmitted diseases abnormality in each of the Poitou jack with different (Motamedi-Mojdehi et al., 2014; Errandonea et al., 2018). concentration of CLC treatments are presented in Table 2. However, despite these advantages, the cryopreservation The overall mean values observed was 10.58±0.10, process causes damage to sperm cells, in particular the 10.48±0.10, 10.38±0.10, 10.25±0.10 and 10.42±0.10% in C, plasma membrane. Studies show that, when added to the

T1, T2, T3 and T4 group, respectively. Non-significant difference ejaculate alone, cyclodextrins stimulate the removal of was found among the groups. cholesterol from the sperm membrane. However, when they are preloaded with cholesterol, they stimulate the incorporation Sperm abnormalities in post thaw semen of Poitou jacks therein into the cell membranes. This occurs because the The mean values of sperms having abnormal head in cyclodextrins have an internal hydrophobic core and a high each of the Poitou jack with different concentration of CLC affinity for sterols (Navratil et al., 2003). Thus, several studies treatments are presented in Table 3. The overall mean value have reported improvements in sperm parameters in buffalo observed was 3.53±0.09, 3.49±0.09, 3.46±0.08, 3.43±0.08 and (Rajoriya et al., 2016), bulls (Boscarato et al., 2016; Yadav et 3.47±0.08 % in C, T , T , T and T group, respectively. Non- 1 2 3 4 al., 2017) and stallions (Moore et al., 2005; Hartwig et al., 2014) significant difference was found among the jacks. The mean after the process of sperm cryopreservation, with the addition values of sperms observed for abnormal mid piece in each of of cyclodextrin to the ejaculate. the Poitou jack with different concentration of CLC treatments Although there was decrease in sperm morphological are presented in Table 3. The overall mean value observed abnormalities in treatment groups compared to control but was 5.42±0.06, 5.37±0.06, 5.32±0.06, 5.27±0.05 and there was no significant difference in the sperm morphological 5.32±0.06% in C, T , T , T and T group, respectively. Non- 1 2 3 4 abnormalities among the groups of pre-freeze and post-thaw significant difference was found among the jacks. The mean stages in Poitou jacks. values of sperms observed for abnormal tail in each of the Poitou jack with different concentration of CLC treatments are presented in Table 3. The overall mean value observed was 5.70±0.03, 5.63±0.03, 5.59±0.04, 5.57±0.04 and 5.60±0.04% in C, T1, T2, T3 and T4 group, respectively. Non-significant difference was found among the jacks. The mean values of sperms observed for the total abnormality in each of the Poitou jack with different concentration of CLC treatments are presented in Table 3. The overall mean value observed was 14.64±0.10, 14.48±0.09, 14.36±0.09, 14.26±0.09 and

Table 1: Sperm head, mid-piece, tail and total sperm morphological abnormalities (Mean±SE) in freshly ejaculated semen of Poitou jacks Poitou jack Head Mid-piece Tail Total

(%) (%) (%) (%)

Overall 2.30±0.05 3.45±0.06 3.42±0.05 9.15±0.08 Fig. 1: Microphotograph showing sperm morphological abnormality (Double head) (Eosine-nigrosine, 1000X)

220 Veterinary Practitioner Vol. 20 No. 2 December 2019

Table 2: Sperm morphological abnormalities in head, mid-piece and tail (%) (Mean±SE) in pre-freeze semen of Poitou jacks Poitou Head (%) Mid-piece (%) Tail (%) jack

Groups C T1 T2 T3 T4 C T1 T2 T3 T4 C T1 T2 T3 T4

2.69 2.67 2.65 2.61 2.65 3.91 3.90 3.86 3.81 3.86 3.99 3.93 3.88 3.85 3.92

±0.03 ±0.03 ±0.03 ±0.03 ±0.03 ±0.06 ±0.05 ±0.05 ±0.05 ±0.04 ±0.05 ±0.05 ±0.06 ±0.06 ±0.06

6 Group C, T1, T2, T3, T4 contain 0, 1, 1.5, 2 and 3 mg CLC/120×10 sperm, respectively

Table 3: Sperm morphological abnormalities in head, mid-piece and tail Table 4: Comparative change of different CLC treatment on physico- % (Mean±SE) in post thawed semen of Poitou jacks morphological seminal attributes at fresh, pre-freeze and post-thaw stage of Poitou jacks (Mean± SE) Poitou M-11 M-22 M-28 M-29 M-30 M-31 Over Sperm abnormalities (%) jacks all Stage C T T T T groups 1 2 3 4 Fresh 9.15 9.15 9.15 9.15 9.15 Head 2.87 3.72 3.85 3.97 3.87 2.86 3.53 ±0.08 ±0.08 ±0.08 ±0.08 ±0.08 (%) ±0.13 ±0.12 ±0.14 ±0.13 ±0.14 ±0.13 ±0.09 Pre-freeze 10.58 10.48 10.38 10.25 10.42 Mid- 5.36 5.4 5.43 5.52 5.45 5.34 5.42 ±0.10 ±0.10 ±0.10 ±0.10 ±0.10 piece ±0.19 ±0.13 ±0.13 ±0.12 ±0.13 ±0.19 ±0.06 Post-Thaw 14.64 14.48 14.36 14.26 14.38 C (%) ±0.10 ±0.09 ±0.09 ±0.09 ±0.09 Tail 5.67 5.63 5.72 5.77 5.73 5.65 5.7 %Changed from 60.0% 58.25% 56.94% 55.85% 57.16% (%) ±0.12 ±0.08 ±0.07 ±0.07 ±0.07 ±0.12 ±0.03 fresh to post-thaw Total 13.9 14.75b 14.99 15.26 15.04b 13.86 14.64 (%) ±0.18 ±0.07 ±0.13 ±0.10 ±0.12 ±0.16 ±0.10 Our results observed in the present study are similar to Head 2.85 3.72 3.75 3.92 3.84 2.84 3.49 Inanc et al. (2018) who observed non-significant difference in (%) ±0.14 ±0.12 ±0.14 ±0.13 ±0.15 ±0.15 ±0.09 the abnormal spermatozoa percentage of ram sperm treated Mid- with CLC while Alvarez et al. (2006) in stallions spermatozoa 5.37 5.29 5.34 5.47 5.38 5.35 5.37 piece ±0.19 ±0.15 ±0.15 ±0.12 ±0.11 ±0.20 ±0.06 and Rajoria et al. (2016) in buffalo bull spermatozoa reported T1 (%) that CLC treatments produced a significant decrease (P<0.05) Tail 5.59 5.58 5.61 5.74 5.69 5.57 5.63 in abnormalities percentage than control groups. These results (%) ±0.11 ±0.11 ±0.09 ±0.07 ±0.06 ±0.11 ±0.03 were similar to those reported in studies on frozen–thawed Total 13.8 14.59 b 14.7 15.13 14.90ab 13.76 14.48 (%) ±0.18 ±0.14 ±0.10 ±0.08 ±0.11 ±0.20 ±0.09 semen in horses (Zahn et al., 2002; Moore et al., 2005) and Head 2.82 3.69 3.72 3.89 3.78 2.84 3.46 cattle (Moce and Graham, 2006). However, in other studies on (%) ±0.14 ±0.11 ±0.12 ±0.13 ±0.11 ±0.13 ±0.08 frozen-thawed equine (Combes et al., 2000; Alvarez et al., 2006) Mid- and bovine (Purdy and Graham, 2004) semen, the sperm 5.29 5.26 5.3 5.44 5.32 5.29 5.32 piece ±0.19 ±0.15 ±0.15 ±0.13 ±0.13 ±0.17 ±0.06 quality was increased in terms of sperm abnormalities. T2 (%) In the present study, cholesterol incorporation was Tail 5.54 5.51 5.59 5.73 5.58 5.56 5.59 conducted as described for bulls (Purdy and Graham, 2004) (%) ±0.12 ±0.11 ±0.11 ±0.07 ±0.08 ±0.12 ±0.04 and equine (Moore et al., 2005) semen. Differences between Total 13.65 14.45ab 14.61 15.06 14.67a 13.69 14.36 (%) ±0.1 ±0.11 ±0.13 ±0.10 ±0.07 ±0.10 ±0.09 the current study and those in cattle (Purdy and Graham, 2004), Head 2.82 3.62 3.71 3.86 3.76 2.81 3.43 may be due to species differences in size, shape, lipid (%) ±0.14 ±0.11 ±0.13 ±0.14 ±0.13 ±0.14 ±0.08 composition (Parks et al., 1981; Parks and Lynch, 1992) and Mid- permeability of the sperm membranes (Guthrie et al., 2002). 5.2 5.16 5.29 5.43 5.3 5.19 5.27 piece ±0.19 ±0.15 ±0.15 ±0.13 ±0.13 ±0.15 ±0.05 T3 (%) Acknowledgements Tail 5.54 5.45 5.58 5.72 5.56 5.52 5.57 The authors are thankful to Dean, College of Veterinary (%) ±0.12 ±0.11 ±0.11 ±0.06 ±0.08 ±0.11 ±0.04 and Animal Science, Bikaner for providing facilities and fund a a Total 13.56 14.23 14.57 15.02 14.63 13.51 14.26 during thesis research work, Director, National Research on (%) ±0.08 ±0.10 ±0.14 ±0.13 ±0.10 ±0.13 ±0.09 Equines, Hisar for providing excellent research facilitates for Head 2.83 3.69 3.74 3.94 3.75 2.84 3.47 carrying out the present research study and Incharge, Equine (%) ±0.13 ±0.11 ±0.14 ±0.14 ±0.14 ±0.13 ±0.08 Production Campus for his kind cooperation. Mid- 5.22 5.3 5.31 5.48 5.34 5.23 5.32 piece ±0.19 ±0.14 ±0.15 ±0.12 ±0.15 ±0.14 ±0.06 References T4 (%) Alvarez AL, Serres C, Torres P, Crespo F, Mateos E and Gomez- Tail 5.57 5.49 5.59 5.73 5.62 5.59 5.6 Cuetara C (2006) Effect of cholesterol-loaded cyclodextrin (%) ±0.13 ±0.10 ±0.11 ±0.07 ±0.09 ±0.13 ±0.04 on the cryopreservation of donkey spermatozoa. Anim. Total 13.62 14.48ab 14.63 15.15 14.71a 13.65 14.38 Reprod. Sci. 94 : 89-91. (%) ±0.06 ±0.09 ±0.13 ±0.11 ±0.10 ±0.05 ±0.09 Alvarez AL, Torres P, Serres C, Mateos E, Graham JK, Gomez-Cuetara Note: Mean values with different superscripts between treatment C (2005) Effect of cholesterol-loaded cyclodextrin on cooled groups differ significantly (P<0.05). Group C, T , T , T , T contain 1 2 3 4 semen from Zamorano-Leones donkey. Rep. Domest. Anim. 6 0, 1, 1.5, 2 and 3 mg CLC/120×10 sperm, respectively. 40: 375. 221 Veterinary Practitioner Vol. 20 No. 2 December 2019

Barth AD and Oko RJ (1989) Abnormal morphology of bovine signaling to ERK. J. Biolog. Chem. 278(34): 31593-31602. spermatozoa. Lowa state university press, Ames, USA. Parks JE and Lynch DV (1992) Lipid composition and thermotropic Blanch E, Tomas C, Graham JK, and Moce E (2012) Response of boar phase behaviour of boar, bull, stallion and rooster sperm sperm to the treatment with cholesterol-loaded-cyclodextrins membranes. Cryobiol. 29: 255-266. added prior to cryopreservation. Reprod. Dom. Anim. 47(6): Parks JE, Meachan TN and Saacke RG (1981) Cholesterol and 959-964. phospholipids of bovine spermatozoa. II. Effect of liposomes Boscarato AG, Martins LF, Pinho RO, Silva YFRS, Papa FO and Macedo prepared from egg phosphatidylcholine and choles- terol GG (2016) Effect of adding cyclodextrin loaded with on sperm cholesterol, phospholipids, and viability at 40C and cholesterol prior to semen frozen/tawed of adult Nellore 370 C. Biol. Reprod. 24: 399-404. bulls. Revist Bras de Reprod. Anim. 40(3): 105-110. Pereira R, Rosalia S, Barros A and Sousa M (2017) Major regulatory Chatterjee S and Gagnon C (2001) Production of reactive oxygen mechanisms involved in sperm motility. Asian J. Androl. 19(1): species by spermatozoa undergoing cooling, freez-ing, and 5–14. thawing.Mol. Reprod. Develop. Incorporating Gamete Res. Pesch S and Bergmann M (2006) Structure of mammalian spermatozoa 59(4): 451-458. in respect to viability, fertility and cryopreservation. Micron. Combes GB, Varner DD, Schroeder F, Burghardt RC and Blanchard TL 37(7): 597-612. (2000) Effect of cholesterol on the motility and plasma Prien S and Iacovides S (2016) Cryoprotectants & cryopreservation membrane integrity of frozen equine spermatozoa after of equine semen: a review of industry cryoprotectants and thawing. J. Reprod. Fertil. 56: 127-132. the effects of cryopreservation on equine semen Errandonea N, Fierro S, Vinoles C, Gil J, Banchero G and Olivera- membranes. J. Dairy Vet. Anim. Res. 3(1):1 7. Muzante J (2018) Short term protein sup-plementation Purdy PH and Graham JK (2004) Effect of cholesterol-loaded during a long interval prostaglandin-based protocol for timed cyclodextrin on the cryo survival of bull sperm.Cryobiol. AI in sheep. Theriogenol. 114: 34-39. 48: 36-45. Graham JK (1996). Cryopreservation of stallion spermatozoa. Vet. Rajoriya JS, Prasad JK, Ramteke SS, Perumal P, Ghosh SK, Singh M Clinics of North Am.: Equine Pract. 12(1): 131-147. and Srivastava N (2016) Enriching membrane cholesterol Guthrie HD, Liu J and Critser JK (2002). Osmotic tolerance limits and improves stability and cryosurvival of buffalo spermatozoa. effects of cryoprotectants on motility of bovine spermatozoa. Anim. Reprod. Sci. 164: 72-81. Biol. Reprod. 67: 1811-1816. Samper JC, Pycock JF and McKinnon AO (2007) Current Therapy in Hartwig FP, Lisboa FP, Monteiro GA, Maziero RRD, Freitas-Dell Aqua equine reproduction. Mossouri, USA. Sunders Elseveir. CP, Alvarenga MA and Dell’AquaJr JA (2014).Use of Snedecor GW and Cochran WG (1994) Statistical Methods, 8th edn. cholesterol-loaded cyclodextrin: An alternative for bad cooler Lowa State University Press. stallions. Theriogenol. 81(2): 340-346. Soni Y, Talluri TR, Ashok K, Ravi SK, Mehta JS and Tripathi BN (2018) Inanc ME, Uysal O and Ata A (2018). Cryopreservation and evaluation Effects of different concentration and combinations of of Akkaraman ram semen with 7-dehydrocholesterol. Ankara cryoprotectants on sperm quality, functional integrity in three Univ. Vet. Fak Derg. 65: 187-192. Indian horse breeds. Cryobiol.https://doi.org/10.1016/ Katanbafzadeh H, Barati F and Tabandeh M (2014) Cryoprotectant- j.cryobiol. 2018.12.005. free freezing of the goat epididymal sperm.Cryo Letters. 35: Talluri Rao T, Ravi SK, Singh J, Legha RA, Yash Pal, Gupta AK, Singh 293-298. RK and Tripathi BN (2016). Some reproductive parameters Kirk ES, Graham JK and Squires EL (2001). Increasing membrane of Zanskari mares reared in an organized farm under tropical cholesterol content benefits the motility of cooled equine climate. Indian J. Anim. Sci. 86: 163-167. semen. Anim. Reprod. Sci. 68: 317. Trevizan JT, Carreira JT, Carvalho IR, Kipper BH, Nagata WB, Perri Kumar P, Mehta JS, Ravi SK, Talluri T Rao, Purohit GN and Chaudhary SHV and De Koivisto MB (2018) Does lipid peroxidation and AK (2019) Cholesterol loaded cyclodextrin increases oxidative DNA damage differ in cryopreserved semen cryopreserve ability of Marwari stallion (Equusferus samples from young, adult and aged Nellore bulls? Anim. caballus) spermatozoa by increasing cholesterol to Reprod. Sci. 195: 8-15. phospholipid ratio. J. Anim. Res. 9(2): 227-235. Vidament M, Vincent P, Martin FX, Magistrini M and Blesbois E (2009) Mansour MM (2009) Modification of hypo-osmotic swelling test to Differences in ability of jennies and mares to conceive with evaluate the integrity of stallion sperm plasma membrane. cooled and frozen semen containing glycerol or not. Anim. Glob. Vet. 3: 302-307. Reprod. Sci. 112: 22-35. Moce E and Graham JK (2006) Cholesterol-loaded cyclodextrins added Wu Z, Zheng X, Luo Y, Huo F, Dong H, Zhang G, Yu W, Tian F, He L and to fresh bull ejaculates improve sperm cryosurvival. J. Anim. Chena J (2015) Cryopreservation of stallion spermatozoa Sci. 84(4): 826-33. using different cryoprotectants and combinations of Moce E, Purdy PH and Graham JK (2010) Treating ram sperm with cryoprotectants. Anim. Reprod. Sci. 163: 75-81. cholesterol-loaded cyclodextrins improves cryosurvival. Yadav HP, Kumar A, Shah N, Chauhan DS, Saxena A, Yadav S and Anim. Reprod. Sci. 118: 236-247. Swain DK (2017) Effect of cholesterol loaded cyclodextrin Moore AI, Squires EL and Graham JK (2005) Adding cholesterol to the supplementation on tyrosine phosphorylation and apoptosis stallion sperm plasma membrane improves cryosurvival. like changes in frozen thawed Hariana bull spermatozoa. Cryobiol. 51(3): 241-249. Theriogenol. 96: 164-171. Motamedi-Mojdehi R, Roostaei-Ali Mehr M and Rajabi-Toustani R (2014) Zahn FS, Papa FO, Dell Aqua and JA Jr (2002) Cholesterol incorporation Effect of different levels of glycerol and cholesterol loaded on equine sperm membrane: effects on post-thaw sperm cyclodextrin on cryosurvival of ram spermatozoa. Reprod. parameters and fertility. Theriogenol. 58: 237-240. Dom. Anim. 49(1): 65-70. Navratil AM, Bliss SP, Berghorn KA, Haughian JM, Farmerie TA, Graham JK and Roberson MS (2003) Constitutive localization of the gonadotropin-releasing hormone (GnRH) receptor to low density membrane microdo-mains is necessary for GnRH

222 Veterinary Practitioner Vol. 20 No. 2 December 2019

VARIATION IN BLOOD GLUCOSE LEVELS AND INSULIN IN LEUKOCYTOSIS CANINE, UNDERGOING OVARIOHYSTERECTOMY

Krittee Dejyong1, Sareepah Manmoo2 and Saowakon Indoung2 Faculty of Veterinary Science, Prince of Songkla University, Songkhla, 90110, Thailand

Received on: 14.06.2019 ABSTRACT Accepted on: 08.12.2019

The postoperative inflammatory process consumes energy and resources such as glucose, which is an important cause of postoperative multiple organ dysfunctions and death. Changes in insulin level may play an important role in controlling serum glucose level under anaesthesia and surgery. A test: a group of six leukocytosis canines (WBCs >25,000 cells/µl) was compared with six healthy canines (WBCs<14,100 cells/µl) as a control group. Blood glucose and insulin were evaluated per, peri and post operation. Heart rate, end-tidal carbon dioxide, and peripheral oxygen saturation were significantly lower in the test group (p<0.05). However, there was no statistically significant difference of the insulin and blood glucose level between control and test group (p>0.05), but the serum insulin level was lower in the test group than the references levels. In contrast to the blood glucose, which found higher than the reference. However, the trend in blood glucose and insulin level at 60 minutes after surgery implied the further investigation should be concerned.

Key words: Blood glucose, insulin, ovariohysterectomy, pyometra

Introduction (OVH) remains the key treatment of canine pyometra, Hypoglycemia frequently occurs in patients with postoperative systemic inflammation continuously consumes septicemia in response to increased cellular glucose uptake massive energy and resources such as glucose in combatting against the distributive inflammation together with poor septicemia and endotoxemia, which are important causes of gluconeogenesis due to hepatic disorder. However, the clinical postoperative multiple organ dysfunctions and death signs, which specify hypoglycemia are indistinct in patients (Fransson, 2003; Kumari et al., 2010). suffering from septicemia and some are asymptomatic (Maitra This study aimed to evaluate the effect of the leukocytosis et al., 2000; Nouel et al., 1981). Naturally, leukocytosis is always on blood glucose level and serum insulin level between healthy demonstrated by the inflammatory mechanism (Menkin, 1940). and leukocytosis canines with pyometra who undergo Increase in the number of leukocytes occurs not only in the ovariohysterectomy. Moreover, the preliminary analysis on septicemia patient but also in stressed patients in combination hypoglycemia situation in systemic inflammatory canine under with monocytosis and neutrophilia (Maes et al., 1992).This the surgery and thereby decrease morbidity and mortality and physiological imbalance between glucose uptake and improve postoperative survival of the postoperative leukocytosis generate results in hypoglycemia especially in the patients. postoperative patient with sepsis or severe leukocytosis. An inverse relationship as seen in the number of Materials and Methods leukocytes and blood glucose level. In an in vitro study found Twelve female canines between 2 and 10-year-old of any that serum with normal leukocytes level could metabolize breed were enrolled in the study, which had received ethical glucose at a rate of 0.17 mmol of glucose/L/h (Astles et al., approval from the Institutional Animal Care and Use Committee 1995; Ybarra and Isern, 2003). The decreasing serum glucose (Reference number 55/2017, Project code 2560 - 05 - 053). level has adverse effects on tissue survival especially neurons They were categorized into two equal groups of six; the control and can bring about seizure when the glucose level decreases group being healthy canine patients, whose owner had to approximately 50 mg/dl (Dizon et al., 1999) and lead to the requested contraception using OVH (WBCs<14,100 cells/µl), death when the glucose decline to 18 mg/dl (Auer, 2004). and the test group whose owner had requested treatment for Changes in insulin level may play an important role in controlling uterine enlargement with clinically morbid conditions, which serum glucose level under anaesthesia and surgery via an were confirmed using abdominal radiography and increase in the insulin/glucose ratio (Diltoer and Camu, 1988; ultrasonography to have moderate or severe leukocytosis Saho et al., 1997). Occasionally, the leukocytosis patient (WBC >25,000 cells/µl (Fraser, 1991). Canine patients, that whether caused by sepsis or inflammation needs surgery have previously been administrated granulocyte or other under anaesthesia to save their lives, which may affect the leukocyte stimulating agents were excluded from the study, glucose level by leukocyte production from surgical together with patients, that were diagnosed with endocrine inflammation or even anaesthesia (Loepke et al., 2006). disease including diabetes mellitus, insulinoma, hyper- or One of the common leukocytosis presenting disorders in hypoadrenocorticism and hyper- or hypo- thyrodism. Patients, canine is pyometra, in which the number of leukocytes usually who physically presented pro-oestrous and estrus stage, for exceeds 30,000 cells/µl due to considerable inflammation of instance vulva swelling and bloody vaginal discharge were the uterus (Kumari et al., 2010). Although ovariohysterectomy also excluded.

1Instructor and corresponding author email: dejyong, [email protected], +447793539748; 2Scientist, Faculty of Veterinary Science, Prince of Songkla University, Thailand. 223 Veterinary Practitioner Vol. 20 No. 2 December 2019

However, a severe hypoglycemia patient (blood glucose within 3 days after incubation. However, a variety of bacterial level<50 mg/dl) was immediately excluded from the study due species was found from the uterine mucosal culture in all to the risk of seizure. This patient was administrated dextrose leukocytosis patients, namely Moraxella sp., Streptococcus sp., 25% 2 ml/kg intravenously. The peri-operative major blood Staphylococcus aureus, Streptococcus dysgalactiae (group C), loss (20% of total blood volume) patients were also excluded. Pseudomonas aeruginosa, Klebsiella pneumoniae, In the pyometra diagnosed patients, amoxicillin-clavulanic acid Escherichia coli and Pseudomonas sp. ® (Clavamox , Zoetis, US) were given orally at 12.5 mg/kg from 1 Heart rate, end-tidal carbon dioxide, and peripheral oxygen to 2 days before the operation. saturation of the test group were found significantly lower than The health status of patients in each group was evaluated that in the control group (p<0.05), whereas blood pressure using physical examination and haematology profiles including and rectal temperature were not statistically different (p> 0.05) complete blood cell count and blood chemistry. The (Fig. 1). haematologic profiles of the patients that were in the control The leukocytosis canine patients in the test group must be normal. The hydration status of patients was presented a significant highness level of total white blood cells maintained using non-dextrose crystalloid fluid solution during number (WBCs) than the control group (p<0.05). The WBC’s hospitalization. Under the general anaesthesia protocol, food mean ± SD of the test group was 48,288 ± 16507.12 cells/µl and water were withdrawn for around 8 and 2 hours, and that of the control group was 14,967 ± 3746.99 cells/µl. respectively before the anaesthesia. The patients were There was no statistically significant difference of the prepared aneasthetic induced by given propofol 2-5 mg/kg mean insulin level (µU/ml) between control and test group at (Lipuro®, B Braun, UK) intravenously then an endotracheal any points of time (0, 30 and 60 minutes) (p>0.05) (Table 1). tube was intubated. Anaesthesia was adjusted to the surgical However, the mean of serum insulin in the control group was stage and maintained using isoflurane (Forane®, Baxter higher than that in the experiment group especially at the 60 Healthcare Corporation, US) with 100% oxygen. Multi-vital sign minutes (Fig. 2A). parameters, for example, body temperature (°F), heart rate The mean of the blood glucose level of the pre, peri and (beat per minute: bpm), respiratory rate (beat per minute: bpm), post operation of the control group and the test group (test) oxygen saturation (SpO2 %), blood pressure (mmHg) and end- showed no statistical difference (Table 1). However, the mean tidal carbon dioxide (EtCO2 mmHg) were monitored every 5 of blood glucose level (mg/dl) of the control group showed a minutes. continuous minor increase, which was different from that of Preoperative analgesia was performed by intramuscular the test group, which maintained the same level from 30 to 60 administration of 0.5 mg/kg morphine (The Food and Drug minutes (Fig. 2B). Administration of Thailand) and incisional analgesia by intradermal infiltration of 2 mg/kg Lidocaine HCl (B L H Trading Discussion Co. Ltd, Thailand) and 0.5 mg/kg Bupivacaine HCl (Marcaine®, Normal fasting conscious canine insulin and glucose DKSH, Thailand). level were reported at 8.1-31.9 µU/ml and 81-118 mg/dl, The 0.5 ml of Ethylenediaminetetraacetic acid (EDTA) respectively (Nachreiner et al., 2015). Under the anaesthesia anticoagulated blood from a cephalic vein, 1 ml of whole blood and surgical situation, the levels of insulin in this study in both and 0.6 µl of fresh whole blood from a peripheral capillary the control and the test group were below the minimum was collected using a 22G, 1-inch needle with a 1 ml syringe reference border, while blood glucose concentration was about for CBCs and blood glucose level (BG mg/dl) evaluation using to maximum reference border. Isoflurane anaesthetized patient auto haematology analyzer (BC-5000vet, Mindray Medical study showed that the anaesthesia may impair cellular glucose International Limited, China), and glucometer (Accu-Chek response to insulin and also decreases hepatic glycogenolysis Guide meter, Roche Diabetes Care, Inc., Switzerland) by the increase of plasma growth hormone, cortisol and immediately before anesthetic agent administration, norepinephrine rather than reduction of insulin production from respectively. After that, in the test group, bacterial haemoculture the pancreas, resulting in the increase of blood glucose level was performed on a 3 ml sample of fresh blood withdrawn (Diltoer and Camu, 1988). Moreover, the insulin resistant using a 22G, 1-inch needle with a 5 ml syringe. Blood glucose situation can be continued from 5 to 20 days post- operation level was checked at 0, 15 and 30 minutes during surgery, (Thorell et al., 1994). In the same way, the physiological stress while 1 ml blood was collected for insulin (Ins, µU/ml) level at of the sepsis patient led to acute hyperglycemia from insulin 0 and 30 minutes during surgery. Septic tissue or organ resistant and developed into impaired insulin secretion in bacterial culture was performed postoperatively. Finally, blood patients in a shock state (Clowes et al., 1978; Marik and glucose and insulin level were measured 60 minutes Raghavan, 2004). postoperatively. In this study, it could not be concluded that patients in the test group had a sepsis condition because any bacteria were Statistical methods not found in their bloodstream in leukocytosis group, which The mean and standard error of the mean (SEM) of the may due to antibiotic treatment. However, the rise of the WBC blood glucose level each group was calculated and compared level in the test group resulted from inflammation of the uterus, between the two groups using independent t-test in Prism 7 in which a variety of dangerous bacteria was found. The Graph pad (Graph Pad Software, US). Statistical significances decrease of vital parameters including heart rate, end-tidal were accepted at the p<0.05 level. carbon dioxide, and peripheral oxygen saturation in test group may because of parasympathetic stimulation by acetylcholine Results releasing under chronic inflammatory response (Jeremias et There was no bacterial growth from any blood samples 224 Veterinary Practitioner Vol. 20 No. 2 December 2019

Table 1: The mean ± SD of insulin and blood glucose level (mg/dl) and adjusted p-value of the control and the test group Pre Peri-operation Post-operation Time anaesthesia 0 minute 15 minutes 30 minutes 60 minutes Control Test Control Test Control Test Control Test Control Test Insulin Mean - - 2.80 2.08 - - 3.31 2.03 5.65 2.67 SD - - 2.202 0.758 - - 1.611 1.846 3.432 2.567 p-value - 0.5782 - 0.5444 0.0798 Glucose Mean 92.17 98.33 102.00 105.17 121.00 115.67 149.17 137.83 162.17 136.17 SD 20.663 22.932 29.400 20.478 41.386 36.604 56.354 16.606 60.258 37.253 p-value 0.9885 0.9885 0.9885 0.9741 0.7301

Fig. 1: The intraoperative mean of vital parameters including (A) Heart rate, (B) Blood pressure, (C) Peripheral capillary oxygen saturation, (D) End-tidal Carbon Dioxide, and (E) Temperature between control and test group. al., 2016; Wang et al., 2016). Even though, patients involved in increased over time together with the blood glucose level, which this study physically excluded the estrus stage, there may have obviously represented insulin resistance. Nevertheless, the a possibility of estrogen induce insulin resistance, which mean serum insulin in the leukocytosis group was lower than vaginal cytology or hormonal evaluation were suggested that in the control group. According to Dahn et al. (1987) the (Scaramal et al., 1997). low insulin level in the sepsis patient blood was not caused by The insulin in the control group and the test group the impairment of insulin production but from an increase in

225 Veterinary Practitioner Vol. 20 No. 2 December 2019

Fig. 2: The insulin level (Mean±SEM) (A) and blood glucose level (B) between the control and the test group. the clearance as measured by the changes in urinary C- Kumari Baithalu R, Maharana BR, Mishra C, Sarangi L and Samal L peptide level (Dahn et al., 1987). However, the insulin level in (2010) Canine pyometra. Vet. World. 3(7):340-342. control group was obviously increased at 60 min, while that in Loepke AW, McCann JC, Kurth CD and McAuliffe JJ (2006) The the test group was slightly raised up. By the limitation of this physiologic effects of isoflurane anesthesia in neonatal mice. Anesth. Analg. 102(1):75-80. study, it might possible to observe a difference in insulin and Maes M, Van der Planken M, Stevens WJ, Peeters D, DeClerck LS, blood glucose level in both groups, if the duration were Bridts CH, Schotte Cand Cosyns P (1992) Leukocytosis, extended to at the peak of the inflammatory process at 48 or 72 monocytosis and neutrophilia: hallmarks of severe hours postoperatively. depression. J. Psychiatr Res. 26(2):125-134. Maitra SR, Wojnar MM and Lang CH (2000) Alterations in tissue glucose Acknowledgements uptake during the hyperglycemic and hypoglycemic phases The author would like to acknowledge Mr. Pokchon Khirilak of sepsis. Shock. 13(5):379-385. and Mr. Navapol Kupthammasan for the kind help in hospital Marik PE and Raghavan M (2004) Stress-hyperglycemia, insulin and data collection. This work was financially supported by the immunomodulation in sepsis. Intensive Care Med. 30(5):748- budget revenue of Prince of Songkla University (VET601872N). 756. Menkin V (1940) Mechanism of Leuko-cytosls with Inflammation. The References Nature of the Leukocytosis-Promoting Factor in Exudates. Astles JR, Petros WP, Peters WP and Sedor FA (1995) Artifactual Arch. Pathol. 91 (2361):320-321. hypoglycemia associated with hematopoietic cytokines. Nachreiner R, Refsal K, Rick M, Mazaki-Tovi M and Sist M. (2015) Arch. Pathol. Lab. Med. 119(8):713-716. Endocrinology reference ranges. Diagnostic Center for Auer RN (2004) Hypoglycemic brain damage. Forensic Sci. Int. 146(2- Population and Animal Health. Michigan State University. 3):105-110. Nouel O, Bernuau J, Rueff B and Benhamou JP (1981) Hypoglycemia: Clowes JR, GH Martin H, Walji S, Hirsch E, Gazitua R and Goodfellow a common complication of septicemia in cirrhosis. Arch. R (1978) Blood insulin responses to blood glucose levels in Intern. Med. 141 (11): 1477-1478. high output sepsis and septic shock. Am. J. Surg.135(4): Saho S, Kadota Y, Sameshima T, Miyao J, Tsurumaru T and Yoshimura 577-583. N (1997) The effects of sevoflurane anesthesia on insulin Dahn MS, Lange MP, Mitchell RA, Lobdell K and Wilson RF (1987) secretion and glucose metabolism in pigs. Anesth. Analg. Insulin production following injury and sepsis. J. Trauma. 84 (6):1359-1365. 27(9):1031-1038. Scaramal JD, Renauld A, Gómez NV, Garrido D, Wanke MM and Diltoer M and Camu F (1988) Glucose homeostasis and insulin secretion Márquez AG (1997) Natural estrous cycle in normal and during isoflurane anesthesia in humans. Anesthesiology. diabetic bitches in relation to glucose and insulin tests. 68(6):880-886. Medicina (B Aires). 57 (2):169-180. Dizon AM, Kowalyk S and Hoogwerf BJ (1999) Neuroglycopenic and Thorell A, Efendic S, Gutniak M, Häggmark T and Ljungqvist O. (1994) other symptoms in patients with insulinomas. Am. J. Med. Insulin resistance after abdominal surgery. Br. J. Surg. 81 106(3):307-310. (1):59-63. Fransson B (2003) Systemic inflammarory response in canine Wang DW, Yin YM and Yao YM (2016) Vagal modulation of the pyometra. Ph.D. Thesis, submitted to Swedish University of inflammatory response in sepsis. Int. Rev. Immunol. 35 Agricultural Sciences, Uppsala. (5):415-433. Fraser CM (1991) The Merck Veterinary Manual: a handbook of Ybarra J and Isern J (2003) Leukocytosis-induced artifactual diagnosis, therapy, and disease prevention and control for hypoglycemia. Endocr J. 50 (4):481-482. the veterinarian, 7th ed., Merck and Co Publishers, Rahway N.J., U.S.A Jeremias I, Victorino V, Barbeiro H, Kubo S, Prado C, Lima T and Soriano F (2016) The role of acetylcholine in the inflammatory response in animals surviving sepsis induced by cecal ligation and puncture. Mol. Neurobiol. 53(10): 6635-6643.

226 Veterinary Practitioner Vol. 20 No. 2 December 2019

ROENTGENOGRAPHIC STUDY ON DCP, LCP AND IILN FOR FEMUR FRACTURE REPAIR IN DOGS#

Manjunath Patil1 and D. Dilipkumar2 Karnataka Veterinary, Animal and Fisheries Sciences University, Bidar-585 401, Karnataka, India

ABSTRACT Received revised on: 07.06.2019 Accepted on: 27.11.2019

A study was conducted in 24 clinical cases of femoral fracture in dogs. The age of dogs ranged between 2 months to 3 years. The main etiology for all the fractures was automobile accidents. These cases were divided into three groups each consisting of eight dogs. Group I, II and III dogs were treated with dynamic compression plating, locking compression plating and intramedullary interlock- ing nailing, respectively based on radiographic study of type of fracture. The fractured femur bone was radiographed in two orthogonal views. Plain medio-lateral and cranio-caudal views including hip joint and stifle joint were taken before the operation, immediately after operation, 30th, 60th and 90th post-operative day. Follow up of the animals was done up to 3 months. Based on the periodic radiographs implant position, union of fragments and callus formation was studied and fracture healing was assessed and recorded. It was concluded that bone healed by slight callus in DCP and dynamic IILN and negligible callus in LCP and static IILN, respectively.

Key words: Femur fracture, dogs, bone healing, radiography

Introduction Materials and Methods A fracture is a breach in the continuity of hard tissues like Twenty four dogs of 2 months to 3 years of age with bone, cartilage. Trauma is the most common cause of fractures femoral fractures presented to Department of Surgery and in small animals, and can occur due to bending, torsional, Radiology, Veterinary College, Bidar constituted the present shearing and compression forces, eventually resulting in study material. Clinical symptoms before operation were non- oblique, wedge fragment, spiral or comminuted fractures. weight bearing, swelling on thigh region, evinced crepitating Femur fracture is one among the common orthopedic sound, pain on palpation and limping. Out of 24 dogs, 6 had affections encountered in dogs (Aithal et al., 1999 and short oblique, 5 had transverse, 4 had comminuted, 4 had Raghunath et al., 2007). spiral, 3 had transverse dentate, 2 had long oblique type of The treatment of femoral fractures by plaster cast fractures. Twenty four dogs were divided into three groups each application and external skeletal fixatures does not provide consisting of eight dogs. Group I, II and III dogs were treated stable fixation at the fracture site. As a result, various with dynamic compression plating, locking compression complications such as non-union, malunion, delayed union plating and intramedullary interlocking nailing, respectively (Ehmer, 1929 and Schroeder, 1933) and osteomyelitis (Wong, based on radiographic study of type of fracture. 1984) was observed. With the increase in these affections The fractured femur bone was radiographed in two there is a great need for effective surgical management (Denny, orthogonal views. Plain medio-lateral and cranio-caudal views 1991). So, bone plates like dynamic compression plating (DCP) including hip joint and stifle joint were taken before the or locking compression plating (LCP) achieve fixation of the operation, immediately after operation and at 30th, 60th and fracture by friction generated by the application of a well- 90th post-operative day. The radiographs taken before operation contoured plate to the bone surface with screws. When applied were used for selecting appropriate length of plates, nails and properly, bone plates effectively resist the axial loading, bending screws. Follow up of the animals was done up to 3 months. and torsional forces acting on fractured bones. Plates have Based on the periodic radiographs implant position, union of been developed to minimize interference with blood supply. fragments and callus formation was studied and fracture Similar to bone plates (DCP or LCP), an intra medullary healing was assessed and recorded. interlocking nails (IILN) resist all the forces acting on fractures. The nail provides bending support, whereas, the locking bone Results and Discussion screws or bolts provide axial and rotational support. All animals were subjected to radiography on pre- th th To know location of fracture, type of fracture, density of operative day, immediately after operation, 30 day, 60 day th cortex and medullary cavity, length of bone, implant position and 90 day. The radiographic changes shown in different and healing of fracture radiography is mandatory. It also helps groups of animals are explained in detail as below. the surgeon in choosing best suitable implants for fracture Pre-operative radiographic evaluation fixation there by reducing the post-operative complications. Pre-operative radiographs were taken in all groups of Though it is an old technique, however, for hard tissues still it animals to determine the type of fracture and its location. The is best technique. Hence, the present study reports the use of animals with transverse (Fig.1a), short oblique (Fig.11a), long radiography for different techniques of femur fracture repair in oblique (Fig.12a), spiral, transverse dentate (Fig.5a) and dogs.

#1Part of Ph.D. Thesis submitted by first author & corresponding author present address: Assistant Professor (Animal Science), KVK,Gulbarga- 585101, email: [email protected], Mobile: 9449236868; 2Professor, Dept. of Vet. Surgery and Radiology, Vet. College, Bidar

227 Veterinary Practitioner Vol. 20 No. 2 December 2019 comminuted femoral fractures were selected for study. On day 60, implants were well positioned and fragments Based on the fracture plan made from the pre-operative showed correct alignment. Also, showed appropriate radiograph, in group I, 6 hole of 3.5 mm and 8 hole either of 3.5 progressive healing with slight callus and obliteration of fracture mm or 2.7 mm dynamic compression plate were used in this line (Fig.1d). study. The cortical and cancellous screws were used with a On day 90, implants were well positioned and fragments diameter of 2.7 mm and 3.5 mm and length ranging from 22 showed correct alignment. Also, periosteal bridging callus and mm to 28 mm. cortical continuity was observed (Fig.1e). In group II, 8 hole of 3.5 mm and 6 hole either of 3.5 mm or Six out of eight animals showed the radiographic changes 2.7 mm locking compression plate were used in this study. described above. The results of femur fracture repair were The standard and locking screws were used with a diameter confirmed by the findings of Olds et al. (1973) and Jit singh of 2.7 mm and 3.5 mm and length ranging from 22 mm to 30 and Dhablania (2000) where they noticed continuity of cortex, mm. continuity of medullary canal, mineralized callus and absence The method of implant selection in both the groups were of gap between the fractured fragments. Also, Moed et al. (1986) based on the findings of earlier workers Turnbull (1966), Clarke opined that obliteration of fracture line with the trabeculae (1967) and Shiju et al. (2010). They advocated the two views of indicated perfect radiographic union. radiographic examination for femur fractures. Lateral view was However, remaining two animals showed complications. used to determine the length of the plate, degree and direction One animal got peroneal nerve paralysis on 6th post-operative of bone displacement and cranio-caudal view was used to day due to faulty intra-muscular administration by the para- determine the length and size of the screws. veterinarian and it was treated by bandaging with PVC splints In group III, interlocking nail with diameter ranging from 5 and administration of steroids and nervine tonics. This animal mm to 6 mm and length ranging from 140 mm to 180 mm, the showed periosteal callus and reaction on 30th day, excess screws of 2.7 mm diameter and length ranging from 18 mm to periosteal callus and reaction on 60th day and osteolysis around 28 mm were used in this study. This method of implant selection fracture fragments as of moth eaten appearance indicating was based on the findings of McLaughlin (1999) and osteomyelitis (Fig.2) on 90th post-operative day. This case was Raghunath and Singh (2008). They had stated that the followed up to 120th day. The remaining one animal got radiograph of contralateral normal bone must be used to refractured and plate loosening was seen on 4th day (Fig.3) determine the size of the medullary cavity and select the and it was re-operated with LCP technique (Fig.4). This animal appropriate diameter and length of the nail. The diameter of showed slight callus on 30th day, negligible callus on 60th day the nail selected was 70 to 90 per cent of the bone diaphyseal and periosteal bridging of fracture site and cortical continuity medullary cavity diameter as suggested by Roush and was seen on 90th post-operative day. McLaughlin (1999). The similar complications like osteomyelitis, osteopaenia and loosening of screws were observed by Saravanan et al. Post-operative radiographic evaluation (1999). Also, Field et al. (1999) utilized non-locking plates where Post-operative radiographs were taken immediately after contact between the plate and the bone segments caused the operation to check implant position and fragment alignment. bending moment to concentrate between the ends of the bone th th th On 30 , 60 and 90 post-operative day radiographs were segments regardless the positioning of the screws. taken to determine implant position, fragment alignment and fracture healing. Similarly, Bennet and May (1995), Durall and Group-II (LCP technique) Diaz (1996), Aston et al. (1999) and Haaland et al. (2009) used Radiographs taken immediately after fracture repair (day- post-operative radiography at 2 or 3 weeks interval to assess 0) showed good alignment and excellent reduction in all the the implant position, fracture alignment and fracture healing. animals. The gap existing between the fracture fragments were negligible (Fig.5b). Six hole LCP plates were contoured to six Group-I (DCP technique) animals. Out of six animals, in four animals 6 hole 3.5 LCP Radiographs taken immediately after fracture repair (day- was used. In one animal, 6 hole 3.5 LCP with lag screw and in 0) showed excellent reduction and perfect alignment of fracture another animal 6 hole 2.7 LCP was used. The plates were fragments in all animals of this group (Fig.1b) The gap existing fixed up to distal 3rd of diaphysis of femoral bone in all these six between the fracture fragments was negligible. 8 hole DCP animals. 8 hole 3.5 LCP were used in remaining two animals plates were contoured to six animals. Out of six animals, five and it was fixed up to distal metaphysis. animals were used with 8 hole 3.5 DCP and one animal with On day 30, implants were well positioned and showed 8 hole 2.7 DCP. 8 hole 3.5 DCP plates were fixed up to distal correct fragment alignment. Also, showed appropriate rd 3 of diaphysis of femoral bone in four animals, 8 hole 2.7 progression towards healing with minimal callus and rd DCP plate up to distal 3 of diaphysis in one animal and 8 hole periosteal reaction (Fig.5c). The faint radiolucent line was 3.5 DCP plate up to distal metaphysis in one animal. 6 hole visible at the fracture site. This finding was in agreement with 3.5 DCP were used in two animals. Out of two animals, it was that of Binnington (1990) where he observed that during the rd fixed up to distal 3 of diaphysis in one animal and up to distal initial stages of fracture healing callus would be of fibro- metaphysis of femoral bone in another animal. cartilaginous in nature with low mineral content, and it might On day 30, implants were well positioned and showed not be visible on a radiograph. correct fragment alignment. Also, showed appropriate On day 60, implants were well positioned and fragments progression towards healing with excess callus and presence showed correct alignment. Also, showed progressive healing of radiolucent line was visible at the fracture site (Fig.1c). with negligible callus and obliteration of fracture site (Fig.5d).

228 Veterinary Practitioner Vol. 20 No. 2 December 2019

Similar results were observed by Dernanz et al. (2007), where showed slight callus formation and obliteration of fracture line fracture was found healed when a visible callus bridging at (Fig.11d). On 90th day, showed periosteal bridging callus and least one cortex or disappearance of fracture line in both the cortical continuity (Fig.11e). In dynamic fixation mode, fracture lateral and cranio-caudal radiographic views were seen. site instability and movement caused excessive callus On day 90, implants were well positioned and fragments formation. This finding was in agreement with Anderson (1966), showed correct alignment. Also, periosteal bridging of fracture who treated fractures in dogs by intramedullary nails which site and cortical continuity was seen (Fig.5e). were united by periosteal callus and nail prevented formation The results of radiographic features of DCP and LCP of endosteal callus. showed that callus formation was more in DCP technique In static IILN all animals except one animal, on 30th day when compared to LCP technique. This finding was in showed slight callus, presence of faint radiolucent line and agreement with Braden and Brinker (1976) who observed that mild periosteal reaction at the fracture site (Fig.12c). On 60th mode of osteogenesis in the process of fracture healing was day, showed appropriate progressive healing with negligible due to the stability of fixation device and callus formation was callus (Fig.12d). On 90th day, showed appropriate progressive inversely proportional to stability of fragments. Also, Ackerman healing with periosteal bridging and cortical continuity at the and Silverman (1978) reported that rigid immobilization fracture site (Fig.12e). This finding was in agreement with the resulted in mineral callus formation whereas large callus was findings of Durall et al. (1993), Moses et al. (2002), Duhautois seen in cases of mobility between the fracture fragments. (2003) and Raghunath and Singh (2008). Static intramedullary Five out of eight animals showed the radiographic changes interlocking nailing done in these animals caused stable described above. However, remaining three animals showed fixation which resulted in direct bone healing with bridging complications. In one animal bone got refractured on 4th post- callus. Also, Singh et al. (2007) found periosteal reaction on operative day (Fig.6) and it was re-operated with intramedullary 20th day, signs of bridging callus by 3rd month and cortical and pinning, cerclage stainless steel wiring and anchored with medullary continuity by 4th month in dogs treated with static nylon mesh (Fig.7). This animal showed excess callus on 30th IILN. day, moderate callus and obliteration of fracture line on 60th However, one animal which had been operated with static day and periosteal bridging callus and cortical continuity on IILN had complications viz., nail migration and loosening of 90th day. In another animal due to continuous jumping, plate distal screws near fracture site on 40th post-operative day which bending and elevation was seen on 7th post-operative day resulted in excessive periosteal callus, cortical discontinuity (Fig.8). However, implant remained in situ up to 90 days. This and presence of distinct radiolucent line at the fracture site animal showed excessive periosteal callus on 30th and 60th indicating delayed union (Fig.13). This finding was in agreement day and exuberant periosteal callus, cortical discontinuity at with Diaz et al. (2005), who observed malunion, in a deformed the fracture site indicating malunion on 90th post-operative day femur, and partial unscrewing of one screw were the only (Fig.9). radiographic complications noted at the time of follow-up on The remaining one animal showed slight callus on 30th retrospective study of interlocking nail treatment of long bone post-operative day. This animal showed plate loosening and fractures. displacement of fragments on 45th post-operative day (Fig.10). Dynamic and static fixed animals showed correct fragment However, implants remained in situ up to 90 days. This animal alignment throughout the study. This finding was in accordance showed excess periosteal callus and reaction on 60th day. with Moses et al. (2002), who reported that interlocking nailing Excessive periosteal callus, cortical discontinuity and presence was able to reconstruct the functional length of the bone and of distinct radiolucent line at the fracture site indicated delayed allowed biological osteosynthesis to occur while providing union on 90th post-operative day. adequate support to the fracture site. These findings were in accordance with the observations Static IILN afforded good realignment of fracture fragments, of Cross and Swiontkowski (2008). They reported higher rapid regeneration and union of fracture by negligible callus infection rates with plate fixation of open fractures, so diligence formation which resulted in early functional usage of limb. is needed when the decision is made to use plates. Whereas, in dynamic IILN, movement of fracture site resulted in excess periosteal callus formation, however complete Group-III (IILN technique) obliteration of the fracture site occurred by day ninety in all the Radiographs taken on day ‘0’ in all the animals showed animals. Similar finding was observed by Asif et al. (2010), excellent fracture reduction and perfect fragment alignment. who reported that bony union by negligible callus and early The gap existing between the fracture fragments was bone remodelling and excessive periosteal callus and early negligible. The interlocking nail was seated up to the distal bone remodelling were characteristic findings in static and metaphysis in eight animals. Out of eight animals, in four dynamic intramedullary interlocking nailing. animals nail was positioned in dynamic fixation mode (Fig.11b) Based on above radiographic findings, it was concluded and in remaining four animals with static fixation mode that progression of fracture healing was characterised by (Fig.12b). In one animal cerclage wiring was used along with slight callus formation in DCP and dynamic IILN and dynamic IILN. Out of four animals with static fixation mode, negligible callus formation in LCP and static IILN. The nylon mesh with cerclage wiring and polyamide suture were radiography was useful in evaluation of complications of DCP, used in two animals. LCP and IILN techniques in dogs. In dynamic IILN, on 30 th day all animals showed progression towards fracture healing with excess callus References formation near fracture site (Fig.11c). On 60th day, animals Ackerman N and Silverman T (1978) Fracture healing: radiographic

229 Veterinary Practitioner Vol. 20 No. 2 December 2019

Fig.1. Dynamic compression plating technique (group-I) (medio-lateral view) 1a. Before operation showing complete, transverse, mid diaphyseal, overriding fracture of femur of dog 1b. Immediate post-operative radiograph showing excellent reduction and perfect alignment of fracture fragments 1c. 30th post-operative day showing implants insitu and excess callus at fracture site 1d. 60th post-operative day showing implants insitu, progression towards healing with slight callus and obliteration of fracture site 1e. 90th post-operative day showing well positioned implants, periosteal bridging callus and cortical continuity

Fig. 2, 3 and 4: Complications and treatment of group-I (DCP technique) 2. 90th post-operative day radiograph (medio-lateral view) of Group-I showing osteolysis around fracture fragment as of moth eaten appearance indicating osteomyelitis 3.4th post-operative radiograph (medio-lateral view) of group-I showing loosening of dynamic compression pate at distal region of femoral bone; 4. 15th post-operative radiograph (medio-lateral view) of same animal of group-I showing 8 hole 3.5 Locking compression plate was fixed up to distal metaphysis of femoral bone

Fig.5: Locking compression plating technique (group-II) (medio-lateral view) 5a.Before operation showing complete, transverse dentate, mid diaphyseal, over riding fracture of femur of dog 5b. Immediate post-operative radiograph showing excellent reduction and negligible gap between fractured fragments 5c. 30th post-operative radiograph showing well positioned implants, minimal callus at fracture site and periosteal reaction 5d. 60th post-operative radiograph showing well positioned implants, correct fragment alignment and progressive healing with negligible callus and obliteration of fracture site 5e. 90th post-operative radiograph showing well positioned implants, periosteal bridging of fracture site and cortical continuity 230 Veterinary Practitioner Vol. 20 No. 2 December 2019

Fig.6,7,8,9 and 10: Complications and treatment of group-II (LCP technique) 6. 4th post-operative radiograph (medio-lateral view) showing refracture at distal 3rd of diaphysis of femoral bone 7. 15th post-operative radiograph (medio-lateral view) of same dog, showing treated with intramedullary pinning, cerclage stainless steel wiring and anchored with nylon mesh 8. 7th post-operative radiograph (medio-lateral view) showing plate bending and plate elevation along the length of fractured bone 9. 90th post-operative radiograph (cranio-caudal view) of same animal, showing exuberant periosteal callus and cortical discontinuity at the fracture site indicating malunion 10. 45th post-operative radiograph (cranio-caudal view) showing plate loosening and displacement of fractured fragments

Fig.11: Intramedullary interlocking nailing technique (group-III) (Dynamic IILN) (medio-lateral view) 11a.Before operation showing complete, short oblique, mid diaphyseal, over riding fracture of femur of dog 11b. Immediate post-operative radiograph showing perfect fracture alignment and interlocking nail seated upto distal metaphysis in dynamic mode in same animal 11c. 30th post-operative day showing progression towards healing with excess callus formation 11d. 60th post-operative day showing slight callus formation and obliteration of fracture site 11e. 90th post-operative day showing periosteal bridging callus with cortical continuity

Fig.12: Intramedullary interlocking nailing technique (group-III) (Static IILN) (medio-lateral view) 12a.Before operation showing complete, long oblique, proximal metaphyseal, over riding fracture of femur of dog 12b. Immediate post-operative radiograph showing perfect fracture alignment & interlocking nail seated up to distal metaphysis in static mode in same animal 12c. 30th post-operative day showing slight callus, presence of faint radiolucent line and mild periosteal reaction at the fracture site 12d. 60th post-operative day showed, appropriate progressive healing with negligible callus 12e. 90th post-operative day showed, appropriate progressive healing with periosteal bridging and cortical continuity at the fracture site 231 Veterinary Practitioner Vol. 20 No. 2 December 2019

Durall I and Diaz MC (1996) Early experience with the use of an interlocking nail for the repair of canine femoral shaft fractures. Vet. Surg. 25: 397-406. Durall I, Diaz MC and Morales I (1993) An experimental study of compression of femoral fractures by an interlocking intramedullary pin. Vet. Comp. Orthop. Traumatol. 6(2): 93- 99. Ehmer EJ (1929) The treatment of femoral fractures in the dog. North Am. Vet. 15: 40-42. Field JR, Tornkvist H, Hearn TC, Sumner-Smith G and Woodside TD (1999) The influence of screw omission on construction stiffness and bone surface strain in the application of bone plates to cadaveric bone. Injury. 30(9):591-598. Haaland PJ, Sjostrom L, Devor M and Haug A (2009) Appendicular fracture repair in dogs using the locking compression plate system: 47 cases. Vet. Comp. Orthop. Traumatol. 22(4):309- 315. Mclaughlin R (1999) Internal fixation -intramedullary pins, cerclage wires and interlocking nails. Vet. Clin. North Am. Small Anim. Pract. 29:1097-1115. Fig.13: Complications of group-III (IILN technique) post-operative Moed BR, Kellam JR, Foster RJ, Tile M and Hansen ST (1986) Immediate radiograph (cranio-caudal view), showing nail migration and loosening internal fixation of open fractures of diaphysis of the fore of proximally distal bolt near fracture site, cortical discontinuity and arm. J. Bone Joint Surg. 68-A: 1008-1017. presence of radiolucent line at the fracture site indicating delayed Moses PA, Lewis DD, Lanj OI, Stubbs WP, Cross AR and Smith K union (2002) Intramedullary interlocking nail stabilisation of 21 humeral fractures in 19 dogs and 1 cat. Aust. Vet. J. interprtations. Mod. Vet. Pract. 59: 381-384. 80(6):336-343. Aithal HP, Singh GR and Bisht GS (1999) Fracture in dogs: A survey of Olds RB, Sinibaldi KR, De Angeles MP, Stoll SG and Rosen H (1973) 402 cases. Indian J. Vet. Surg. 20(1): 15-21. Autogenous cancellous bone grafting in small animals. J. Anderson LD (1966) Fracture fixation: How various methods affect Am. Anim. Hosp. Associ. 9: 454-457. healing. Mod. Vet. Pract. 47(7): 53-56. Raghunath M and Singh SS (2008) Intramedullary interlocking nailing Asif MA, Dilipkumar D, Usturge SM, Shivaprakash BV, Vivek R for management of long bone diaphyseal fractures in dogs: Kasaralikar and Ravi Raidurg (2010) Comparative evaluation a study of 17 clinical cases. Indian J. Vet. Surg. 29(2): 106- of static and dynamic veterinary intramedullary interlocking 109. nailing technique for femoral fractures in canines. Vet. Pract. Raghunath M, Singh M, Singh SS and Yadav RK (2007) Distribution 11(2): 146-150. and classification of canine long bone fractures. Indian Vet. Aston JW, Willians SA, Allard RN, Sawamura S and Carollo JJ (1999) J. 84(12): 1243-1246. A new canine cruciate ligament formed through distraction Roush JK and Mclaughlin RM (1999) Using interlocking nail fixation to histogenesis. Clin. Orthop. Rel. Res. 280: 30-36. repair fractures in small animals. Vet. Med. 94(1): 46-52. Bennet D and May C (1995) Joint diseases of dogs and cats. In: Saravanan B, Maiti SK, Hoque M and Singh GR (1999) Radiographic Textbook of Veterinary Internal Medicine: Diseases of the evaluation for the management of comminuted femoral Dog and Cat. Ettinger SJ and Fedman EC (eds). WB fracture in dogs. Indian J. Vet. Surg. 20(2): 106-122. Saunders Company, Philadelphia, pp. 2032-2077. Schroeder EF (1933) Fractures of femoral shaft of dogs. North Am. Binnington AG (1990) Bone remodelling and transplantation. In: Canine Vet. 14: 38. Orthopaedics. WG Whittick (eds). Lea and Febiger, Shiju SM, Ayyappan S, Ganesh TN and Suresh Kumar R (2010) Plate- Philadelphia. pp. 166-189. rod technique for the management of diaphyseal femoral Braden TD and Brinker WO (1976) Radiologic and gross anatomic fractures in dogs. Indian J. Vet. Surg. 31(1): 41-42. evaluation of bone healing in the dog. J. Am. Vet. Med. Singh M, Yadav RK, Raghunath M and Singh SS (2007) Repair of Assoc. 169: 1318-1323. bilateral femur fracture with static intramedullary nailing in Clarke JH (1967) Repairing of pelvic fractures. Mod. Vet. Pract. 53(4): three dogs: a clinical report. Indian J. Vet. Surg. 28: 48-49. 140- 151. Singh P and Dhablania DC (2000) Radiographic studies following Cross WW III and Swiontkowski FM (2008) Treatment principles in the bone grafting in femur of dogs. Indian Vet. J. Surg. 21(1): management of open fractures. Indian J. Orthop. 42(4): 31-32. 377-386. Turnbull NR (1966) Mechanics of fracture repair; first aid. J. Small Denny H (1991) Fracture fixation in small animal practice. In Pract. 7: Ani. Pract. 7: 135-139. 137-143. Wong WT (1984) A survey of fractures in the dog and cat in Malaysia. Dernanz GY, Diaz MA and Jara SF (2007) Early results with the new Vet. Rec. 115: 273-274. internal fixator systems LCP and LISS: a prospective study. Acta.Orthop. Belg. 73(1): 60-99. Diaz MC, Durall I, Franch J, Puchol JL and Sanchez A (2005). Interlocking nail treatment of long-bone fractures in cats: 33 cases (1995- 2004). Vet. Comp. Orthop. Traumatol. 18(3):119-126. Duhautois B (2003) Use of veterinary interlocking nailing for diaphyseal fractures in dogs and cats: 121 cases. Vet. Surg. 32:8-20.

232 Veterinary Practitioner Vol. 20 No. 2 December 2019

MATERNAL, FOETAL, MANAGEMENTAL AND SEASONAL FACTORS PREDISPOSING TO UTERINE TORSION IN BOVINES: A REVIEW

Ashutosh Tripathi*1, M.K. Shukla2, Arbind Singh3, R.K. Singh4 and Rajeshwar Dayal5 Department of Livestock Farm Complex- Gynaecology College of Veterinary and Animal Science, SVPUAT, Meerut-250 110, UP, India

Received on: 22.08.2019 ABSTRACT Accepted on: 23.11.2019

In the present review maternal, foetal, managemental and seasonal factors predisposing bovines to uterine torsion have been discussed in depth. Maternal factors include sub-ilial attachment of broad ligaments, species, breed, posture of dam while sitting down and standing up, enlargement of horn, cornua extending outside bursa supra-omentalis, presence of rumen on left side, large and pendulous abdomen, increasing age and parity, thin musculature of broad ligament, advanced pregnancy, higher level of progesterone and increased uterine flaccidity during parturition. Foetal factors include higher weight and excessive movement of male foetus to female one, reduced amount of amniotic fluid, foetal presentation, foetal anomalies. Managemental factors include type of housing and flooring, wallowing and unsteady walk. Seasonal incidences increase as the total number of calving increase.

Key words: uterine torsion, maternal factors, foetal factors, managemental factors, seasonal factors

Introduction role in predisposing animal to uterine torsion (Morten and Cox, Uterine torsion is rotation of the uterus on its longitudinal 1968; Sloss and Dufty, 1980; Manning et al., 1982; Tripathi and axis (Noakes et al, 2009; Purohit et al., 2011). It has gained Mehta, 2015). However, above said proposed concepts do not much importance in recent times due to its high incidence and always stand true as only some and not all the bovines develop severe outcomes especially in buffaloes (Jeenger et al., 2015; uterine torsion even though all the prevailing conditions remain Tripathi and Mehta, 2016; Thangamani et al., 2019). The same. increasing incidence and severity of uterine torsion affect dairy profitability badly as untreated or euthanized animal may create 1. Maternal destabilizing factors great economic loss to dairy sector. These estimated losses a) Attachment of the broad ligaments may be in terms of calf mortality, reduced milk yield or agalactia The sub-ilial attachment of broad ligaments in case of and handling of postpartum complications, viz. delayed uterine bovines make it less affirm in position and prone to movements involution, postpartum metritis, endometritis and infertility during sudden movement or fall as compared to mares where (Schonfelder et al., 2003, 2005). Moreover, severe degree of the attachment is sub-lumbar making uterine more affirm in torsions may also accompany ovarian vein rupture (Blanchard, its position (Berchtold and Rusch, 1993; Chaney et al., 2007). 1981), haemoperitoneum (Jadhao et al., 1993), intestinal Attachment of the broad ligaments to the lesser curvature of obstruction (Dhaliwal et al., 1992), rotation of ureter, urinary the uterus while the greater curvature lying free into the bladder thus causing nephropathy (Ghuman, 2010; Kochhar abdominal cavity especially as the pregnancy advances make et al., 1994; Jeenger et al., 2015; Tripathi and Mehta, 2016), it unstable and prone to any kind of movements. With the uterine perforation (Pickel et al., 1990) and formation of advancement of pregnancy length of broad ligaments increases adhesions of uterus with surrounding viscera (Siddiquee, very little comparing to the extension of gravid horns beyond 1988). Thus, taking into the consideration of adverse impact of attachment area in to the capacious abdomen also makes it uterine torsion in bovines along with increased cost of treatment less stable (Wright, 1958; Pearson, 1971; Schulz et al., 1975; and heavy casualty chances, the purpose of this review is to Sloss and Dufty, 1980; Manning et al., 1982; Baker, 1988; understand the reasons underlying the predisposition of bovine Roberts, 1986; Noakes et al., 2009). uterus in depth. Till now due importance has been given to the b) Species and breed maternal and foetal factors contributing to uterine torsion but Indigenous cattle are less prone to torsion compared to in the present review equal stress has been given to the exotic, crossbred cattle and buffaloes (Prabhakar et al., 1994; managemental and environmental factors too so that essential Frazer et al., 1996; Srinivas et al., 2007; Aubry et al., 2008) measures can be implemented to reduce incidences. probably because of stable attachment of broad ligaments on Factors affecting the dorsal side in the anterior two-thirds of uterus and on the The maternal and the foetal destabilizing factors behind ventro-lateral side in the posterior one-third of uterus in Bos occurrence of uterine torsion have been reported earlier indicus making it less prone to torsion (Sloss and Dufty, 1980; (Schonfelder and Sobiraj, 2005; Ghuman, 2010; Tripathi and Roberts, 1986) while in Bos taurus cattle, crossbred cattle and Mehta, 2015; Zaher et al., 2017) while seasonal and few buffaloes, pregnant uterus is unstable due to attachment of managemental factors like type of floor and diet also play vital broad ligaments on the ventro-lateral side of uterus (Wright,

*1Assistant Professor, [email protected], COVAS, SVPUAT, Modipuram, Meerut-250 110, Cell: 9588299027; 2Associate Professor, COVAS, SVPUAT, Modipuram, Meerut-250 110; 3Assistant Professor, COVAS, SVPUAT, Modipuram, Meerut-250 110; 4Assistant Professor, COVAS, SVPUAT, Modipuram, Meerut-250 110; 5Assistant Professor/Assistant Director, LRC, COVAS, SVPUAT, Modipuram, Meerut-250110.

233 Veterinary Practitioner Vol. 20 No. 2 December 2019

1958; Sloss and Dufty, 1980; Singh, 1991b). While in one report g) Body frame of the dam indigenous cattle (Rathi and Non-descript) seemed more prone Brown Swiss cattle on account of its large body frame with to torsion than exotic ones (Tripathi and Mehta, 2015). roomy abdomen is likely to have torsion of uterus compared to Additionally, higher incidence of uterine torsion in buffaloes other cattle breeds (Desliens, 1967; Elmore, 1993). Similarly than cattle is partly due to the big length of broad ligaments in capacious and pendulous abdomen seems to facilitate easy buffaloes which makes the pregnant uterus less stable (Singh, rotation of pregnant uterus in buffaloes compared to cattle and 1991b). Also broad ligaments of bovines suffering from uterine in pluriparous buffaloes compared to primiparous buffaloes torsion are thin and have less musculature than their (Sloss and Dufty 1980; Siddiquee 1988; Singh 1991b; Jeenger counterparts with other types of dystocia (Singh, 1991b). et al., 2014; Thangamani et al., 2017; Zaher et al., 2017) the Additionally, broad ligament musculature is better arranged in same has been reported among various breeds of cattle too cattle compared to buffaloes, thus providing better stability to where indigenous cattle probably because of their capacious the pregnant uterus of cattle (Prabhakar et al., 1994; Brar et al., and pendulous abdomen in comparison to small body size 2008). are shown to have higher torsion frequencies than exotic ones (Tripathi and Mehta, 2015). While some authors deny the c) Posture of dam while sitting down and standing up concept of body frame (scapula to tuber sacral distance as The way bovines lie down by bending the forelegs first well as depth of the abdomen at fifth lumbar vertebra) relating and get up by elevating the hindquarters first, makes the gravid to uterine torsion among cattle (Berger-Pusterla, 1995). uterus to suspend temporarily in almost vertical condition in the abdominal cavity and is highly prone to get rotated (Roberts, h) Age and parity of the dam 1986; Drost, 2007; Noakes et al., 2009). Multiparous animals are at greater risk of uterine torsion (70-80%) than primipara (20-30%) (Jeenger et al., 2014; d) Enlargement of the pregnant uterine horn Tripathi and Mehta, 2015; Naik, 2016; Zaher et al., 2017; Asymmetry between the gravid and non-gravid horn Thangamani et al., 2019). The probable reasons may be the causes imbalance between the two and thus the occurrence larger abdominal cavity, stretching of pelvic ligaments, loose of uterine torsion (Amer et al., 2008). Ventral extension of gravid and long broad ligaments together with loosening of uterine cornua without the support of broad ligament on its tip makes tissue, decreased uterine tone and weaker abdominal muscles it less stable and thus it tends to incline towards itself in aged bovines (Berger-Pusterla, 1995; Frazer et al., 1996; (Desliens, 1967; Pearson, 1971). In other opinion 80% cases Drost, 2007; Aubry et al., 2008; Jeenger et al., 2014; Tripathi of uterine torsions were towards the non-gravid cornua (Gloor, and Mehta, 2015). On the contrary, cattle after 4-5 parities were 1973). Moreover, in cattle with didelphic uterus, in which non- at less risk of uterine torsion, as 74% uterine torsions occur in pregnant horn is absent, torsion of the pregnant horn without cattle during second and third parity (Pearson, 1971; Frazer et the involvement of rudimentary accessory horn is reported al., 1996; Jeenger et al., 2014; Tripathi and Mehta, 2015) during consecutive pregnancies (Dhaliwal et al., 1988, 1989). probably with increasing age and parity increase in thickness In rare occurrence torsion has been reported in bicornual of uterine muscles resist loosening and destabilization of pregnancy too (Manning et al., 1982; Roberts, 1986; Wardrope uterine tissue and thus rotation (Mochow and Olds, 1966; and Boyes, 2002). Jeenger et al., 2014; Tripathi and Mehta, 2015). Some authors e) Location of the pregnant uterine horn claim no relation of age with predisposition to torsion in cattle Presence of the gravid cornua inside bursa and buffaloes of age between 2-18 years (Manning et al., 1982; supraomentalis makes it quite stable and as the pregnant Agarwal, 1987; Tamm, 1997) while few reported higher horn extends outside supraomentalis loss of stability occurs incidences of torsion among primiparous than multipara which ends in uterine torsion (Gloor, 1973; Schonfelder and (Matharu and Prabhakar 2001; Amin et al., 2011). Sobiraj, 2005). i) Plasma hormonal profiles f) Rumen High progesterone profile during parturition may tender The location of rumen on left side resist uterine twisting uterus flaccid, and hence increases risk of its torsion (Abdel- toward itself and thus the incidence of right side uterine torsion Ghaffar and Abou-El-Roos, 2002; Prabhakar et al., 2007; Amer are frequent than left ones (Noakes et al., 2009; Jeenger et al., and Hashem, 2008). The improper conversion of progesterone 2014; Tripathi and Mehta, 2015; Zaher et al., 2017; Thangamani to estrogen by non-functional placenta (Agarwal, 1987; et al., 2019). Shifting of diet from roughage towards concentrate Siddique, 1988) and partial degeneration of corpus luteum of leads decrement in ruminal volume and thus creating more pregnancy may be the reason behind (Nanda and Sharma, abdominal space for free movements of gravid conrnua (Morten 1986). and Cox, 1968; Sloss and Dufty, 1980; Manning et al., 1982). j) Stage of pregnancy However, in few reports Bos taurus had more torsions towards Advanced pregnant animals especially during first and left (Pearson, 1971; Manning et al., 1982; Baker, 1988; Frazer second stage of labour are more prone to uterine torsion (Frazer et al., 1996; Aubry et al., 2008). Probably additional muscular et al., 1996; Amer and Hashem, 2008; Ghuman, 2010; Jeenger fold on the right broad ligament in Bos taurus prevents the right et al, 2014; Tripathi and Mehta, 2015; Naik, 2016; Zaher et al., horn to rotate downward (Singh, 1991b). While in buffaloes, 2017) probably some degree of stress, alteration in body the absence of a muscular fold on right broad ligament might metabolism, increase in flaccidity of uterine wall, foetal size add the possibility of right sided torsion (Singh, 1991b; Ghuman, and movements along with decreased quantity of amniotic 2010). fluid in comparison to the size of foetus and uterus may be the 234 Veterinary Practitioner Vol. 20 No. 2 December 2019 possible reasons (Roberts, 1986; Ghuman, 2010; Zaher et to the above Thangamani et al. (2018) denied any correlation al., 2017). Few authors have reported cases of torsion during of presentation of foetus with torsion of uterus. early and mid pregnancy too (Roberts, 1986; Thangamani et al., 2019). d) Reduced amount of the amniotic fluid With decrease in distance between the foetus and the k) Uterine tone uterine wall due to reduction in amniotic fluid during advanced Predominantly uterine torsions are encountered during pregnancy (Zimmermann 1950; Uray, 1956) the foetus feels the late first stage of parturition process (Noakes et al., 2009). abrupt movements of dam as a painful stimulus and in At this stage, conditions favourable for torsion are created response, performs strong reflexive movements which may because cervix has started to dilate; uterus has begun to cause the rotation of uterus. Also reduction in fluid amount contract and gets moulded on foetus (Taylor, 1942). In addition, decreases size of uterus which allows free intra-abdominal at this stage, uterine muscles are not in much tone, thus uterus movement of uterus (Schonfelder and Sobiraj, 2005). is not able to restrict the movement of upper portion of foetus and the relaxed and unstable uterus may be a cause for the 3. Managemental factors occurrence of uterine torsion (Russe, 1963; Schonfelder and a) Type of housing and flooring Sobiraj, 2005). Stall fed bovines are more prone to uterine torsion than pastured ones (Williams, 1948; Agarwal, 1987; Pascal et al., l) Musculature of the broad ligaments 2008; Tripathi and Mehta, 2015; Zaher et al., 2017). The broad ligaments of bovines suffering from uterine Confinement for longer durations may lead to abdominal torsion are thin and have poor muscles compared to other musculature weakness in lack of exercise and therefore are types of dystocia (Singh 1991b). Additionally, better arrangement unable to resist rotation of uterus (Sloss and Dufty, 1980; of broad ligament musculature in cattle provides better stability Roberts, 1986; Yehualaw et al., 2017). Among animals to the pregnant uterus than buffaloes (Prabhakar et al., 1994, managed indoor, the animals which were reared on pakka Brar et al., 2008). floor showed higher incidence of uterine torsion than those reared on kachcha floor possibly chances of slipping are 2. Foetal destabilizing factors higher in animals managed on pakka floor (Elmore, 1993; a) Calf birth weight and sex Berger-Pusterla, 1995; Moore and Richardson, 1995; Aubry et In various studies predominantly calves delivered to al., 2008; Tripathi and Mehta, 2015). However few reports differ torsion-affected dam were male (Jeenger et al., 2014a; Tripathi with the above opinion as the stall fed and pastured cattle and Mehta, 2015; Naik, 2016; Thangamani et al., 2017; Zaher showed similar incidences of torsion (Wright, 1958; Desliens, et al., 2017; Nagaraju, 2018; Thangmani et al., 2019), whereas 1967). few other reported 55-66% as female (Vasishta, 1983) while Sudden push or hit by other animal or while transporting few have opinion that neither sex of calf nor its birth weight has especially in advanced pregnant ones, may create chances any predisposition to torsion (Prabhakar et al., 1997; Berger- for uterine torsion (Schulz et al., 1975; Elmore, 1993; Berger- Pusterla, 1995; Matharu and Prabhakar, 2001). Probably the Pusterla, 1995; Moore and Richardson, 1995; Aubry et al., 2008; greater body weight and vigorous movement of male foetus to Tripathi and Mehta, 2015). In response to above conditions that of female foetus may be the cause (Sloss and Dufty, 1980; the foetus may show violent movements which makes uterus Frazer et al., 1996; Rakuljic, 2002; Zaher et al., 2017). Inability to twist too but the heavy uterus may take time to return to its to flex limbs by oversized foetus properly inside uterus may original position, while the dam may change their position lead to its further entangling in the uterine wall which further quickly to expose unstable gravid uterus to torsion (Russe, provokes continuous excessive vigorous movements 1963; Schonfelder and Sobiraj, 2005). Few authors do not especially by male foetus which may lead to uterine rotation agree with the involvement of sudden movement or push factor (Frazer et al., 1996). Aubry et al. (2008) have reported rare in predisposition to uterine torsion as there was no history of incidence of uterine torsion in cases of foeto-pelvic transportation and fight between animals among the torsion disproportion. affected cases presented at the referral hospital (Nanda and b) Foetal Anomalies Sharma, 1986; Thangamani et al., 2018). Foetal anomalies do not seem to affect incidence of b) Unsteady walk and wallowing torsion (Thangamani et al., 2018) however, uterine torsion with Unsteady walk especially over hilly areas seems to ascitic foetus in a Murrah buffalo has been reported (Singh et predispose animals to torsion (Singh, 1995; Noakes et al., al., 2019) where increase in foetal weight with ascitic fluid 2009). In recent studies the concept of wallowing and unsteady accumulation may be the possible cause. walk predisposing animals to torsion has been disagreed c) Foetal presentation (Ishaque et al., 1960; Singh, 1991a; Nanda and Sharma, 1986; Abnormal presentation may not be a factor in the Thangamani et al., 2018). A study was carried out where development of uterine torsion (Wright, 1958; Sloss and Dufty, advanced pregnant buffaloes were wallowed for an hour daily 1980). In fact, 80-100% calves from uterine torsion-affected for about a month, didn’t result in torsion (Agarwal, 1987; Zaher bovines usually deliver in anterior presentation with majority in et al., 2017; Thangamani et al., 2018). dorso-sacral, dorso-ilial and few in dorso-pubic position 4. Seasonal factors (Pascal et al., 2008; Noakes et al., 2009; Naik, 2016; Zaher et The season doesn’t affect the incidence of torsion and al., 2017; Nagaraju, 2018; Thangamani et al., 2019). Contrary usually coincides with peak calving period i.e. green season

235 Veterinary Practitioner Vol. 20 No. 2 December 2019

(Prabhakar et al., 1994; Frazer et al., 1996; Tripathi and Mehta, für Tierheilkunde 115: 74-80. 2015; Zaher et al., 2017) as incidences of other of dystocia and Ishaque SM, Khan AA, Praced MM, Singh JK and Narayan KG (1960) torsion cases increase simultaneously along with increase in Successful caesarean section in a cow with torsion of total calving (Tripathi and Mehta, 2015). However in one report uterus. Indian Vet. J. 37: 321-25. Jadhao PT, Markandeya NM and Rautmare SS (1993) Uterine torsion higher tendency for uterine torsion cases has been shown in along with haemoperitoneum in a buffalo. Indian J. Anim. summer and winter than spring but there too seasonal effect Reprod. 14: 59. does not seem to play predisposing role in causing uterine Jeengar K, Choudhary V, Maharia S, Anand V and Purohit GN (2014) torsion (Pascale et al., 2008). A Retrospective study on type and extent of uterine torsion in buffaloes. Res. J. Vet. Pract. 3(1): 25-28. References Jeenger K, Purohit GN and Choudhary V (2014a) Foetal gender- a Abdel-Ghaffar AE and Abou-El-Roos MEA (2002) New trends regarding predisposing factor for uterine torsion in buffaloes. Intas the diagnosis, prognosis and treatment of uterine torsion in Polivet. 15(II): 226-227. buffaloes. Assiut Vet. Medical J. 46: 249- 61. Jeenger K, Purohit GN, Mehta JS, Choudhary V and Tripathi A (2015) Agrawal RG (1987) ‘Some studies in uterine torsion with special Prognostic tests for uterine torsion affected buffaloes. reference to its etiology and treatment in buffaloes.’ Theriogenology Insight. 5(1): 33-40. Dissertation, Punjab Agriculture University Ludhiana. Kochhar HPS, Prabhakar S, Singh Prakash, Nanda AS and Singh P Amer HA and Hashem MA (2008) Relationship between clinical and (1994) Rotation of urinary bladder with torsion of uterus in biochemical picture of uterine torsion in Egyptian buffaloes a buffalo. Indian Vet. J. 71: 388-89. (Bubalus bubalis). Int. J. Vet. Med. 4: 1. Manning J, Marsh P, Marshall F and McCorkell R (1982) Bovine uterine Amer HA, Hashem MA and Badr A (2008) Uterine Twisting During torsion: a review illustrated by cases from the Western Pregnancy in Buffaloes: Relatioship between Clinical College of Veterinary Medicine, large animal clinic. Bovine Findings and Biochemical Indices. J. Applied Biological Sci. Practice. 17: 94-98. 2(2): 31-39. Matharu SS and Prabhakar S (2001) Clinical observations and success Amin SM, Amer HA, Hussein AE and Hazzaa AM (2011) Creatine of treatment of uterine torsion in buffaloes. Indian J. Anim. phosphokinase and aspartate aminotransferase profiles and Reprod. 22: 45-48. its relation to the severity of uterine torsion in Egyptian Mochow R and Olds D (1966) Effect of age and number of calvings on buffalo. Anim. Reprod. Sci. 123: 163-168. histological characteristics of the bovine uterus. J. Dairy Aubry P Warnick L D, DesCôteaux L and Bouchard E (2008) A study of Sci. 49(6): 642-46. 55 field cases of uterine torsion in dairy cattle. Canadian Moore AA and Richardson GF (1995) Uterine torsion and foetal Vet. J. 49: 366-72. mummification in a cow. Canadian Vet. J. 36: 705-06. Baker I (1988) Torsion of the uterus in the cow. In Practice. 10: 26. Morten DH and Cox JE (1968) Bovine dystocia. A survey of 200 cases Berchtold M and Rusch P (1993) Birth interference from the mother, met within general practice. Vet. Rec. 83: 530-37. Animal obstetrics, (Eds) Richter J, Gotze R, Grunert E and Nagaraju (2018) Clinical and haemato-biochemical parameters in uterine Arbeiter K. Parey Buchverlag Berlin. pp. 222-244. torsion affected graded Murrah buffaloes (Bubalus Berger-Pusterla J (1995) ‘Investigations on the aetiology of intrapartum bubalis). M.V.Sc. Thesis submitted to Sri Venkateswara uteri torsio in cattle.’ Dissertation, University of Zurich. Veterinary University, Tirupati. Blanchard TL (1981) Uterine torsion with ovarian vein rupture in a Naik BSR (2016) Clinico-biochemical studies on uterine torsion in graded ewe. J. Am. Vet. Med. Assoc. 179: 1402-03. Murrah buffaloes with special references to its prognosis. Brar PS, Saigal RP, Sharma RD and Nanda AS (2008) Histology and M.V.Sc. Thesis submitted to Sri Venkateswara Veterinary histochemistry of broad ligaments in buffaloes. Indian J. University, Tirupati. Anim. Sci. 78: 464-467. Nanda AS and Sharma RD (1986) Studies on serum progesterone Chaney KP, Holcombe SJ, LeBlanc ML, Hauptman JG, Embertson RM, levels in relation to occurrence of uterine torsion in buffaloes Eric Mueller PO and Beard WL (2007) The effect of uterine (Bubalus bubalis). Theriogenology. 26: 383-89. torsion on mare and foal survival: A retrospective study Noakes DE, Parkinson DJ and England GCW (2009) Maternal dystocias. 1985-2005. Equine Vet. J. 39: 33-36. Veterinary reproduction and Obst., 9th ed. Saunders Ltd. Desliens L (1967) Torsion of the uterus in the cow-etiology and practical Pascale A, Lorin D, Luc D and Émile B (2008) A study of 55 field cases considerations. Bulletin de l’Académie vétérinaire de of uterine torsion in dairy cattle. Can. Vet. J. 49(4): 366- France. 40: 147-56. 372. Dhaliwal GS, Prabhakar S and Sharma RD (1989) A note on recurrence Pearson H (1971) Uterine Torsion in Cattle: a review of 168 cases. of uterine torsion in a cow with didelphic uterus. Indian J. Vet. Rec. 89: 597-603. Anim. Reprod. 10: 171-72. Pickel M, Dirksen G and Grunert E (1990) Uterine perforation following Dhaliwal GS, Prabhakar S and Sharma RD (1992) Intestinal obstruction an experiment in the correction of a uterine torsion in the 5th in association with torsion of uterus in a buffalo. Pakistan month of pregnancy. Tierarztliche Praxis. 18: 469-72. Vet. J. 12: 42-43. Prabhakar S, Dhaliwal GS, Sharma RD and Nanda AS (1997) Success Dhaliwal GS, Sharma RD, Singla VK and Prabhakar S (1988) Torsion of treatment and dam survival in bovines with precervical of didelphic uterus in a cow. Indian J. Anim. Reprod. 9: 71- uterine torsion. Indian J. Anim. Reprod. 18: 121-23. 72. Prabhakar S, Matharu SS, Gandotra VK and Brar RS (2007) Corpus Drost M (2007) Complications during gestation in the cow. luteum does not contribute to higher progesterone Theriogenology. 68: 487-91 concentration around parturition in buffaloes with uterine Elmore R (1993) Focus on bovine reproductive disorders: Diagnosing torsion. Indian J. Anim. Sci. 77: 956-59. and treating uterine torsion. Vet. Med. 88: 170-73. Prabhakar S, Singh P, Nanda AS, Sharma RD and Singh P (1994) Frazer G, Perkins N and Constable P (1996) Bovine uterine torsion: Clinico-obstetrical observations on uterine torsion in bovines. 164 hospital referral cases. Theriogenology. 46: 739-58. Indian Vet. J. 71: 822-24. Ghuman SPS (2010) Uterine torsion in bovines: a review. Indian J. Purohit GN, Barolia Y, Shekher C and Kumar P (2011) Maternal Dystocia Anim. Sci. 80(4): 289-305. in cows and buffaloes: A review. Open J. Anim. Sci. 1: 41- Gloor H (1973) Etiology of uterine torsion in the cow. Schweizer Archiv 53.

236 Veterinary Practitioner Vol. 20 No. 2 December 2019

Rakuljic-Zelov S (2002) Haematological and biochemical profile of Taylor WA (1942) Torsion of the uterus: with special reference to cows affected with uterine torsion. Slovenian Vet. Res. 39 epidural anaesthesia. Canadian J. Comparative Med. Vet. (1): 1580-4003. Sci. 6: 102-06. Roberts SJ (1986) Veterinary Obstetrics and Genital Diseases Thangamani A, Chandra Prasad B, Srinivas M, Anusha K, Sadasiva (Theriogenology). 3rd ed. Woodstock, VT published by the Rao K (2017). Recurrence of uterine torsion associated author. 213-359. with roomy abdomen and sex of the foetus: A novel case Russe M (1963) ‘The birth sequence in cattle-an examination of the report. RRJoVST. 6(3): 19-21. functional activity of the normal birth.’ Dissertation, University Thangamani A, Srinivas M, Chandra Prasad B, Anusha K and Sadasiva of Munich. Rao K and L Phani Kumar (2018) Unraveling the mystery of Schonfelder A and Sobiraj A (2005) Etiology of torsio uteri in cattle-a uterine torsion in bovines: a review. Int. J. Sci. Environ. review. Schweizer Archiv für Tierheilkunde 147: 397-402. Technol. 7(2): 561-568. Schonfelder A, Richter A and Sobiraj A (2003) Prognostic indicators Thangamani A, Srinivas M, Sadasiva Rao, K, Hari Krishna NVV (2019) for conservatively incorrectable uterine torsion in the cow. A retrospective study on uterine torsion in graded Murrah Tierärztliche Umschau. 58: 512-17. buffaloes at a referral centre. Pharma Innovation J. 8(4): Schönfelder A, Richter A and Sobiraj A (2005) Stages of surgically 882-884. incorrectable uterine torsion of cows: associations with Tripathi A and Mehta JS (2015) Factors associated with uterine torsion clinical progress. Tierarztliche Umschau. 60: 199-205. in cattle: a retrospective study. Bioscan. 10(3): 1135-1137. Schulz J, Beuche W and Elze K (1975) Torsio uteri in cattle. Mh Vet. Tripathi A and Mehta JS (2016) Studies on the types and prognostic Med. 30: 659-65. approaches for uterine torsion among cattle. J. Anim. Res. Siddiquee GM (1988) ‘Studies on etiopathology and therapeutics of 6(1):129-134. uterine torsion in buffaloes.’ Thesis, Punjab Agriculture Uray H (1956) The bimanual correction of torsio uteri. Wiener University, Ludhiana, India. Tierärztliche Monatsschrift. 43: 610-12. Singh G, Arjun V, Hariom, Kumar A and Dutt R (2019) Dystocia due to Vasishta NK (1983) ‘Torsion of uterus in buffaloes in relation to incidence, pre-cervical uterine torsion and foetal ascites in a cross- etiology and treatment. M.V.Sc. Thesis, Punjab Agriculture bred Jersey cow. Vet. Res. Int. J. 7(1): 40-41. University, Ludhiana, India. Singh M (1991a) Studies on changes in blood and ruminal functions in Wardrope DD and Boyes GW (2002) Uterine torsion in twin pregnancies buffaloes with dystocia. Thesis, Punjab Agriculture in dairy cattle. Vet. Rec. 150: 56. University, Ludhiana, India. Williams WL (1948) The basic causes of dystocia. Torsion of the Singh P (1991b) Studies on broad ligament in relation to uterine uterus (Uterine volvulus). Veterinary Obstetrics, (Ed.) torsion in buffaloes. Thesis, Punjab Agriculture University, Williams W L, Mass, Ethel Williams Plimpton. Worcester. pp. Ludhiana, India. 196-199, 295-307. Singh P (1995) Recent observations on etiology and treatment of Wright JG (1958) Bovine dystocia. Vet. Rec. 90: 347-56. uterine torsion in buffaloes. In: Nanda, A.S. Ed., Recent Yehualaw B, Bassazin G, Sewalem M and Mekonen B (2017) Review Advances in Animal Reproduction and Gynaeoclogy, USG on the Peridisposing Factors, Causes and Economic Impact Publishers and Distributors, Ludhiana, pp. 137-141. of Dystocia in Dairy Cows. J. Reprod. Infertility. 8 (3): 72- Sloss V and Dufty JH (1980) Obstetrical physiology. Obstetrical 81. pathology. Obstetrical procedures. Displacement of the gravid Zaher HA, Swelum AA, Amin S, Eidaroos A, Hazzaa AM and Sharifi S uterus. Handbook of Bovine Obstetrics, (Eds) Williams and Al (2017) Factors affecting incidence of uterine torsion in Wilkins, Baltimore. Egyptian buffaloes (Bubalus bubalis) and its response for Srinivas M, Sreenu M, Lakshmi Rani N, Subramanyam Naidu K and rolling. J. Buffalo Sci. 6: 28-34. Devi Prasad V (2007) Studies on dystocia in graded murrah Zimmermann K (1950) About uterine torsion. Wiener Tierärztliche buffaloes: a retrospective study. Buffalo Bulletin 26: 40-45. Monatsschrift. 37: 130-34. Tamm T (1997) ‘Studies on bovine uterine torsion.’ Dissertation, Tierärztliche Hochschule Hannover.

237 Veterinary Practitioner Vol. 20 No. 2 December 2019

DYSTOCIA DUE TO HYDROALLANTOIS AND ARTHROGRYPOSIS CONDITION AND ITS THERAPEUTIC MANAGEMENT

Arun Kumar1, A.K. Rathore, Vikas Sachan, J.K. Agrawal and Atul Saxena Department of Veterinary Gynaecology and Obstetrics, College of Veterinary Science & Animal Husbandry U.P. Pt. Deen Dayal Upadhyay Veterinary and Animal Sciences University (DUVASU), Mathura-281 001, Uttar Pradesh, India

ABSTRACT Received revised on: 29.05.2019 Accepted on: 23.09.2019

A case of hydroallantois along with abnormal foetus having arthrogryposis of fore and hind limbs, buldged fore head, abnormal lower jaw and its successful therapeutic management has been reported.

Key words: Hydroallantois, arthrogryposis, buffalo, dystocia

Introduction fluid therapy using 4 litres dextrose normal saline, 4 litres ringer Hydroallantois is characterized by excessive accumulation lactate saline, 2 litres intalyte saline intravenously. After 45 hours of foetal fluid in the allantoic sac. The volume of the allantoic of treatment, water bag ruptured and about 70-80 litres of fluid fluid varies up to 273 litres, and such large amounts impose a were drained out. Sudden loss of this large volume of fluid serious strain on the cow and greatly hamper respiration and may result in shock, therefore intravenous fluid therapy was reduce appetite. The diagnosis of bovine hydrallantois is based given at this time. Further, vaginal examination revealed that on the easily appreciable fluid distension of the abdomen, cervix was fully opened and fetus was in posterior presentation. with its associated symptoms, in the last third of pregnancy. Initially it was not possible to take out hindlimbs as both Confirmation may be obtained by the rectal palpation of the hindlimbs were ankylosed from hock and fetlock joints and markedly swollen uterus and by the failure to palpate the foetus flexed towards abdomen of foetus. After efforts of 20-25 minutes, either per rectum or externally (Noakes et al., 2009). The present both hind limbs were pulled out of vagina. But still it was difficult case was further complicated by anomaly such as to expel the foetus because of deformity of vertebral column of arthrogryposis which leads to further difficult birth. foetus. Grossly on physical examination, dead foetus having Arthrogryposis is a musculoskeletal defect observed in buldged fore head, abnormality of lower jaw, ankylosed hind neonates of cattle (Whitlock et al., 2008) and is a severe form limbs at hock and fetlock joints, one inwardly flexed forelimb of contracted tendons in which many of the limb joints flex and another outwardly flexed forelimb at fetlock joints (Fig. 1). permanently (Deviprasad et al., 2010). This communication The dam as treated with 5% Dextrose normal saline 4 litre i/v, reports a rare case of hydroallantois along with arthrogryposis Ceftriazone 4.5 gm i/m, Meloxicam 0.2 mg/kg body weight i/m, condition in a buffalo and it’s therapeutic management. Chlorpheneramine maleate 0.5 mg/kg body weight i/m for 3 days. Four boluses of Cleanex (Dosch Pharmaceuticals Ltd.) History and clinical observation were placed in uterus for 3 days. Animal was discharged A full term pregnant buffalo of first parity aged about 4 advising the follow-up care and management. years was presented to TVCC Mathura with the history of non- progressive straining since last 24 hours. Owner reported that Discussion there was sudden enlargement of abdomen within last 20 to In the present case, there was hydroallantois condition 25 days. Animal was anorectic since last 4-5 days. On general along with abnormal foetus having buldged fore head, examination, animal was dull and depressed. Conjunctiva was congested. Abdomen was bilaterally distended and swollen vulva was noticed. There was loosening of sacrosciatic ligament and udder engorgement. Per-rectal examination revealed enlarged extended uterus due to presence of foetal fluid. Due to extensive foetal fluid in the uterus, foetus and placentomes were not palpable. Transrectal ultrasound revealed anechoic foetal fluid but foetal parts and placentomes were not observed. Therefore, initially the case was diagnosed tentatively as hydroallantois condition.

Line of treatment Vaginal examination revealed closed cervix of normal texture. Therefore parturition was induced with 500 µg of PGF2α, 40 mg of betamethasone, 48 mg of valthemate bromide, and Fig. 1: Foetus showing bulged fore head, abnormal lower jaw, 30 mg diethylstilbestrol, all given intramuscularly along with ankylosed fore and hind limbs

1Corresponding author; [email protected]

238 Veterinary Practitioner Vol. 20 No. 2 December 2019 abnormal lower jaw and ankylosed hind limbs. All cases of and there was early recovery of the animal. It was concluded hydrallantois are progressive but they vary in time of clinical that appropriate diagnosis and its therapeutic management onset and in their rate of progression. Occasionally, the animal is very important for hydroallantois condition along with becomes relieved by aborting. The less severely affected reach abnormal foetus. term in poor condition and, because of uterine inertia frequently require help at parturition. There is gradual loss of the condition, References eventually causing recumbency and death of the animal Devi prasad V, Hari krishna NVV, Sreenu M and Thangadurai R (2010) Arthrogryposis in a calf. Vet. World. 3 (7): 335-336. (Noakes et al., 2009). The possible cause of excessive Noakes D, Parkinson TG and England GCW (2009) Veterinary accumulation of fluid inside allantoic cavity may be due to Reproduction and Obstetrics, 9th ed. Saunders Elsevier. pp. structural and functional changes in allantois chorion including 141-143. its vessels with transudation and collection of fluid differing Palanisamy M, Manokaran S and Selvaraju M (2014) Therapeutic from normal allantoic fluid (Palanisamy et al., 2014). management of hydroallantois in a buffalo. Intas Polivet. Retained placenta and septic metritis are common 15(2): 219-220. complications after such type of cases of hydroallantois. In the Whitlock BK, Kaiser L and Maxwell HS (2008) Heritable bovine foetal present case, the constant post partum care and medicinal abnormalities. Theriogenology. 70: 535-549. treatment along with fluid therapy avoided these complications

239 Veterinary Practitioner Vol. 20 No. 2 December 2019

MOLECULAR BASIS OF ATTENUATION IN RECENTLY CIRCULATING PPRV IN RAJASTHAN

Alka Galavat 1* Sunil Maherchandani2, Vikas Galav3 and Abhilasha Dadhich4 Department of Veterinary Microbiology and Biotechnology, College of Veterinary and Animal Science Rajasthan University of Veterinary and Animal Sciences, Bikaner, Rajasthan 334001, India

Received on: 01.10.2019 ABSTRACT Accepted on: 29.11.2019

The Genomic and Antigenomic Promoter (GP and AGP) regions of peste des petits ruminants virus (PPRV) are composed of 107 bp and 109 bp, respectively. They play crucial role in replication and transcription of PPRV genome and in its pathogenesis. We attempted amplification of GP and AGP of PPRV from different field samples of sheep and goat origin, using 3’ and 5’ RACE PCR. The GP region was successfully amplified though, we could not amplify AGP region of the field isolate probably due to fast degradation of terminal region of RNA genome. Subsequently, amplicons were sequenced and compared with corresponding sequences of standard PPR vaccine strain (PPRV/Sungri96 strain) to identify potential base substitutions. The Multiple Sequence Alignment (MSA) of the GP region of vaccine strain PPRV/Sungri/96 (KJ867542.1), PPRV isolates (Bikaner-Khajuwala: Sheep origin and Hanumangarh-Nohar: Goat origin) from field samples and published sequences of Indian/PPRV strains (KX033350.1, KT270355.1, KT860063.1 KT860064.1 and KT860065.1) were undertaken by Clustal W in MEGA7. On comparative evaluation with the PPRV/Sungri/96, 4 base substitutions were observed in it; these were at position 5 (A & gt; G), 24 (A & gt; C), 47 (A & gt; G) and 102 (C & gt; T) in GP region. We hypothesized that base mutations found in the genomic promoter regions may be associated with attenuating properties of PPRV vaccine strain.

Key words: PPRV, attenuation, mutations, vaccine, GP, AGP

Introduction Mioulet et al., 2001). Peste des petits ruminants (PPR) is an acute and highly In this paper, we attempted to amplify and mapping of devastating disease of small ruminants. It is characterized by mutations in GP and AGP when PPRV virus from clinical high fever, naso-occular discharge, pneumonia with frequent samples were compared with Indian PPRV vaccine strain. occurrence of gastro-intestinal symptoms like stomatitis, diarrohea etc which may result into death of animals (Kumar Materials and Methods et al., 2014). The disease is caused by peste des petits Sample collection and processing ruminants virus (PPRV) which is negative sense single The samples were obtained from outbreaks from stranded non segmented RNA virus of genus Morbillivirus of Khajuwala (Rajasthan, year 2017), Nohar (Rajasthan, year family Paramyxoviridae (Gibbs et al., 1979). The viral genome 2018) and from other places of Rajasthan either as oral, consists of six tandemly arranged transcription units in a order nasal, fecal swabs or blood samples from acutely ill sheep of 3’-N P M F H L-5’ which encodes six structural and two non and goats using pre-sterile swab with viral transport medium. structural proteins (Barrett et al., 1991): Nucleocapsid (N), the Samples were vortexed and centrifuged; subsequently, aliquots Polymerase-associated (P) protein, the matrix (M), Fusion of supernatant were stored -80°C till further use. protein (F), Haemagglutinin (H) and polymerase or large (L). RNA extraction The genome is flanked by extragenic sequences; at the end of The RNA extraction cell lysate/clinical samples was done 3’ the extragenic sequence (52 nucleotides) is referred as using TRI reagent (Cat# T9424, Sigma Aldrich, USA) following leader whereas extragenic sequence (37 nucleotides) at 5’ manufacturer’s protocol. Briefly, 200 µl of aliquot of sample end is called trailer (Walpita, 2004). The leader sequence plus was denatured using 800 µl tri reagent followed by addition of adjacent non-coding region (55 nucleotides) of the N gene at 200 µl of chloroform (C2432, Sigma Aldrich, St. Louis, USA); the 3’ end of the negative-strand constitute genome promoter and after incubation at room temperature, centrifugation was (GP) with total 107 nucleotides. Similarly, the anti-genome done. The RNA was precipitated into pellet from aqueous phase promoter (AGP) includes 109 nucleotides that encompass by adding 500 µl ml isopropanol (I9516, Sigma Aldrich, St. untranslated region of the L gene (72 nucleotides) at its 5’ end Louis, USA). The pellet was washed twice with 70% ethanol and the trailer sequence (37 nucleotides) (Walpita, 2004). The (100983, Sigma Aldrich, St. Louis, USA), dried and dissolved GP region is important both for replication and mRNA in 40 µl of luke warm RNAse/DNAse free water. The RNA thus transcription whereas AGP predominately has regulatory role prepared was stored in deep freezer at -80°C till use. Cell in replication during virus propagation (Bailey et al., 2007). culture adapted PPRV/Shahjadpur/2015 available at NCVTC, Comparison of sequence data from vaccine and virulent strains Hisar, India was used as positive control. of rinderpest and measles viruses identified nucleotide changes throughout the genome, however, those located in Single stand cDNA synthesis and PCR Confirmation the GP and AGP are considered potential mutations The 10 µl of extracted RNA was used as template for cDNA responsible for attenuation of the virus (Banyard et al., 2005; synthesis using First Aid Revert Aid Reverse Transcriptase

1*PhD Scholar and corresponding author email: [email protected]; 2Professor; 3Asst. Professor, Dept. of Pathology, PGIVER, Jaipur; 4Ph.D. Scholar, Department of Veterinary Pathology, CVAS, Bikaner 240 Veterinary Practitioner Vol. 20 No. 2 December 2019

(Cat #EP0411, Thermofisher Scientific, USA). The RNA was adding 10 ml of 2X DreamTaq master mix, 1.5 ml of GSP-1 as incubated with 100 ng of random hexamer primer and heated forward primer (10 pmole/ml), 1.5 ml of AUAP as Reverse to 72°C for 5 minute followed by cooling on ice for 5 min. In Primer (10 pmole/ml), cDNA (2 ml) and 5 ml of nuclease free reaction mix of 20 µl, 4 µl of 5X RT buffer, 1 mM dNTPs, 10 U of water. The PCR consisted of initial denaturation at 95°C for 5 RiboLock RNAse inhibitor and 100 U of Revert Aid H Minus min followed by 35 cycles of denaturation 95°C (30 sec), Reverse Trasncriptase were added and incubated at 25°C for annealing 55°C (30 sec) and extension 72°C (30 sec). The 10 min, 42°C for 50 minutes and 90°C for 10 minutes. final extension was carried out at 72°C for 10 min. The PCR PPRV N gene specific primers were used for PCR product of first PCR was used a template for second round of confirmation of PPRV. For PCR amplification, DreamTaq Green PCR, under identical conditions except that GSP-2 was used master mix (Cat# K1081, Thermofisher Scientific, USA) was as a forward primer. The PCR products were checked on 1% used; each reaction of 20 µl, was prepared by adding 10 µl of agarose gel. 2X DreamTaq Master mix, 1 µl of each Gene specific forward primer & reverse primer (PPRN-FP 5’-ACAGGCGCA 5’RACE (rapid amplification of cDNA ends) PCR GGTTTCATTCTT-3’), (PPRN-RP: 5’-GCTGAGGATATC For 5´ RACE, the total RNA was isolated from infected cell CTTGTCGTT-3’) of working stock (10 pmol/µl ) and 2 µl of lysate/ clinical samples using Trizol reagent as described cDNA. The PCR was conducted with a denaturation step of 10 earlier (section 3.7). The RNA was later reverse transcribed min at 95°C followed by 35 cycles of amplification (30 sec at using GSP1 primers. Briefly, for the first strand cDNA synthesis, 95°C, 30 sec at 55°C, and 30 sec at 72°C), and a final extension 10 µl of RNA was mixed with 2 ml of GSP1 (10 pmole/ml) in a step at 72°C for 10 min. 0.2 ml PCR tube and denatured at 72°C for 10 min. This was followed by a snap chilling of reaction mix on ice for 3 minutes. 3’ RACE (rapid amplification of cDNA ends) PCR 4 µl of 5X RT buffer, 1 mM dNTPs, 10 U of RiboLock RNAse For the 3’ RACE reaction, the total RNA was isolated from inhibitor and 100 U of Revert Aid H Minus Reverse infected cell lysate/clinical samples using Trizol reagent as Trasncriptase were added and incubated at 25°C for 10 min, described earlier (RNA extraction). The RNA was further poly 42°C for 50 min and 90°C for 10 min. The RNA template from adenylated using the poly ‘A’ tailing kit (New England Biolabs, the RNA-cDNA hybrid was degraded by adding RNAse mix (2 Massachusetts, USA) as per manufacturer’s instructions. ml RNAse mix to 20 ml of cDNA prepared) and incubating at Briefly, a reaction mixture consisting of 13 ml of RNA, 1 ml of 37°C for 30 min followed by 65°C for 10 min. The TdT is used PolyA polymerase, 2.5 ml of Poly A buffer, 1 ml rATP and 2.5 ml to add homopolymeric tails to the 3' ends of the cDNA and nuclease free water was prepared and incubated at 37°C for creates the abridged anchor primer binding site on the 3'-end 30 minutes. The reaction was stopped after 30 min and the of the cDNA. The 5' RACE system uses dC tailing to polyadenylated RNA generated which was used for cDNA complement unique Abridged Anchor Primer. The method was preparation in reaction of 20 ml. The reaction mix of 10 ml of carried out as per manufacturer’s instructions. Briefly, the Poly Adenylated RNA and 2 ml of oligo dT (adapter) was reaction mixture consisted of 20 ml of cDNA, 5ml dCTP, 1.5ml denatured at 72°C for 10 min and snap chilled for 3 minutes. of Tailing buffer and 12.5 ml of nuclease free water was heated Subsequently, 8 ml of second master mix containing 4 µl of 5X at 94°C for 3 min followed by cooling at 4°C for 3 min in RT buffer, 1 mM dNTPs, 10 U of RiboLock RNAse inhibitor and thermocycler. Then 2 ml of TdT enzyme was added to the 100 U of Revert Aid H Minus Reverse Trasncriptase were reaction mixture and incubated at 37°C or 10 min followed by added and incubated at 25°C for 10 min, 42°C for 50 min and heat inactivation of TdT at 65°C for 10 min. The resulting cDNA 90 °C for 10 min. The RNA template from the RNA-cDNA hybrid was diluted 10X and stored -20°C till further use. Amplification was degraded by incubating 2 ml RNAse mix to 20 ml of cDNA of a target cDNA synthesized requires priming with two prepared at 37°C for 30 min followed by 65°C for 10 min. The oligonucleotides. The Abridged Anchor Primer, which is specific resulting cDNA was diluted 10X and stored at -20°C till further for the oligo-dC tail added by TdT, GSP2 served as primer for use. For the first PCR, 20μl of reaction mix was prepared by first PCR. For the first PCR, 20 ml of reaction mix was prepared

Table 1: Primers Used in RACE Forward Primer Reverse Primer Product Size Gene Specific Primer-1 5’CCACCATGATATCGCCTCCGGTCC Nil, used for cDNA synthesis 3’ Gene Specific Primer-2 AAP provided with RACE 5’ RACE 5’GTCTTGCTATATTCTGATGACCCG 5’GGCCACGCGTCGACTAGTACGGGIIGG 280 bp 3’ GIIGGGIIG3’ Gene Specific Primer-3 AUAP provided with RACE 240 bp 5’YCAYCTAACCTTTGACTTACAY3’ 5’GGCCACGCGTCGACTAGTAC3’ Oligo dT Adapter Primer Nil, used for cDNA synthesis

GGCCACGCGTCGACTAGTACTTTTT TTTTTTTTTTTT 3’ RACE Gene Specific Primer-1 AUAP provided with RACE 400 bp 5’GTCAGGATCTCCRGCCAATC3’ 5’GGCCACGCGTCGACTAGTAC3’ Gene Specific Primer-2 AUAP provided with RACE 5’CTCCTGAACCTGATGCHGTC3’ 230 bp 5’GGCCACGCGTCGACTAGTAC3’

241 Veterinary Practitioner Vol. 20 No. 2 December 2019 by adding 10 ml of 2X DreamTaq master mix, 1.5 ml of GSP-2 (Ozawa et al., 2004). The method of choice is RACE which (10 pmole/ml), 1.5 ml of Abridged Anchor Primer (10 pmole/ was originally introduced by Frohman et al. (1988). ml), 2 ml of cDNA and 5 ml of nuclease free water. The PCR The PPRV identity of clinical samples was confirmed N consisted of initial denaturation at 95°C for 5 min followed by gene gene specific 337 nucleotide PCR product (Fig. 1). The 35 cycles of denaturation 95°C (30 sec), annealing 55°C (30 PCR products obtained by RACE were run on 1% agarose gel sec) and extension 72°C (30 sec). The final extension was for electrophoresis to check for desired PCR products for GP (400 72°C for 10 min. The PCR product of first PCR was used a bp and 280 bp) and AGP (280 bp and 240 bp). We were able to template for second round of PCR, under identical conditions amplify from the PPRV isolates from study but not directly from except that AUAP and GSP-3 were used as reverse and forward clinical samples (Fig. 2a). The PCR products of GP were primers, respectively. The PCR products were checked on 1% submitted for sequencing, however, amplification of AGP region agarose gel. was not good enough for sequencing (Fig. 2a), so we did not proceed it further. The Multiple Sequence Alignment (MSA) of Agrose gel electrophoresis GP region of vaccine strain, published Indian PPRV isolates Ten microlitres of the amplicon were analysed by and from PPRV isolates of the study were undertaken by Clustal electrophoresis on a gel which was made of 1.5% agarose in W in MEGA7. When compared with the PPRV/Sungri96 strain, Tris-borate-EDTA (TBE) buffer (0.089M Tris base, 0.089M boric 4 base substitutions were observed in vaccine strain at acid and 0.002M EDTA, pH 8.3). The gel was stained with nucleotide position 5 (A>G), 24 (A>C), 47 (A>G) and 102 (C>T) ethidium bromide and the DNA was visualised by UV in GP (Fig. 2b). fluorescence and photographed. The RdRp initiates genome synthesis by binding to the Gel purification of PCR product and sequencing GP region, thereby playing an important role in virus replication For gel purification, DNA from gel slice containing PCR (Bailey et al., 2007). The GP region is considered to be quite amplified products were using a QIAquick Gel Extraction Kit conserved among various strains of PPRV. In Rinderpest virus, (28706, Qiagen, Netherland) according to the manufacturer’s mutation in the GP regions have been associated with instructions. Briefly, three volume QG buffer (1 volume=500 µl) attenuation of the vaccine strain (Banyard et al., 2005; Mioulet to weight of gel slice (considering 100 mg ~ 100 µl), was added et al., 2001). The terminal sequences of RNA virus genomes and incubated at 70°C till gel slice dissolved followed by are particularly vulnerable to deletion or degradation. RNA addition of 1 volume of isopropanol to the same tube and viruses have evolved sophisticated mechanisms to avoid mixing. The material was loaded to QIAquick column which truncation of terminal sequences during replication initiation and was washed with prescribed buffers. The DNA was eluted termination (Poranen et al., 2008). However, despite these using 40 µl of nuclease free water from the column. The gel measures, the termini of virus genomes remain susceptible to purified DNA thus eluted checked on 1% agrose gel and stored host cell-mediated RNA degradation, either through specific antiviral at -20°C till further use. host proteins (Barr and Fearns, 2010) or due to the components The gel purified PCR products were packaged in dry-ice of the normal host-cell RNA-biosynthesis machinery (Houseley & and submitted for Sanger’s dideoxy sequencing (Invitrogen, Tollervey, 2009). This may be probable reason for poor amplification Bengaluru, India). The electropherogram files of the nucleotide of AGP even from PPRV isolates. The RNA degradation of virus in sequences were examined and assembled using BioEdit v7. clinical samples was dependent upon many factors such as swab The sequence of GP and AGP region of already published material, temperature of transportation, duration of storage etc. Indian PPRV isolates (KX033350.1, KT270355.1, KT860063.1 KT860064.1 and KT860065.1) and Indian PPRV vaccine strain i.e. PPRV/Sungri/96 (KJ867542.1) were obtained from GenBank.

Results and Discussion Once virus enters target host cell, RNA dependant RNA polymerase (RdRp) of non-segmented negative viruses uses the GP and AGP to synthesize the messengers RNA and later full length genome copies via replication intermediate strands of the genome. Therefore, it was hypothesized that changes in these regions may have a significant effect on the rate of transcription of viral mRNA or full-length genome replication (Noton and Fearns, 2015). As a first step for looking into the molecular basis of PPRV attenuation in vaccine strain, we decided to compare the GP and AGP of different PPRV strains directly from clinical samples from study, PPRV isolates (Bikaner-khajuwala and Hnumangarh-Nohar) from the study with that of published sequence of Indian PPRV isolates (KX033350.1, KT270355.1, KT860063.1 KT860064.1 and KT860065.1) with that of vaccine strain PPRV/Sungri/96 (KJ867542.1). However, amplification of Terminal ends of a Fig. 1: PPRV N gene based Agrose gel electrophoresis of PCR products. RNA Virus still remains a tedious and fairly costly procedure L= Ladder, P=positive control, N=Negative control, 1= Clinical Sample 242 Veterinary Practitioner Vol. 20 No. 2 December 2019

has been a report which supports condition dependent 5’ to 3’ mRNA degrading pathways in the chloroplast of Chlamydomonas reinhardtii (Salvador et al., 2011). Our study was an attempt identify potential mutations in GP and AGP region which may have been responsible for attenuation in vaccine strain. However, further modern technology like reverse genetics system shall be undertaken for functional analysis of reported mutations to elucidate their role in PPRV replication/ virulence.

Acknowledgements The author acknowledges grant received from Department of science and Technology (DST) leading to these results under Women Scientist scheme (WOS-A), DST (SR/WOS-A/LS-1313/ 2015). We thank Dr. Naveen kumar, Dr. Riyesh T., Dr. Sanjay Barua and Dr. Bhupendra Nath Tripathi, Virology Lab, NCVTC, ICAR- NRCE, Hisar, Haryana for providing technical guidance and laboratory support for the work.

References Bailey D, Chard LS, Dash P, Barrett T and Banyard AC (2007) Reverse genetics for peste-des-petits-ruminants virus (PPRV): Promoter and protein specificities. Virus Res. 126(1): 250-255. Banyard AC, Baron MD and Barrett T (2005) A role for virus promoters in determining the pathogenesis of Rinderpest virus in cattle. J. General Virol. 86(4): 1083-1092. Barr JN and Fearns R (2010) How RNA viruses maintain their genome integrity. J. General Virol. 91(6): 1373-1387. Barrett T, Subbarao SM, Belsham GJ and Mahy BWJ (1991) The Molecular Biology of the Morbilliviruses. In DW Kingsbury (Ed.). The Paramyxoviruses. pp. 83-102. Frohman MA, Dush MK and Martin GR (1988) Rapid production of full- length cDNAs from rare transcripts: Amplification using a single gene-specific oligonucleotide primer. Proceedings of the National Acad. Sci. of the United States of Am. 85(23): 8998-9002. Gibbs PJ, Taylor WP, Lawman MJP and Bryant J (1979) Classification of Peste des Petits Ruminants Virus as the Fourth Member of the Genus Morbillivirus. Intervirology. 11(5): 268-274. Houseley J and Tollervey D (2009) The Many Pathways of RNA Degradation. Cell. 136(4): 763-776. Kumar N, Maherchandani S, Kashyap SK, Singh SV, Sharma S, Chaubey KK and Ly H (2014) Peste Des Petits Ruminants virus infection of small ruminants: A comprehensive review. Viruses. 6(6): 2287-2327. Mioulet V, Barrett T and Baron MD (2001a) Scanning mutagenesis identifies critical residues in the rinderpest virus genome promoter. J. General Virol. 82(12): 2905-2911. Mioulet V, Barrett T and Baron MD (2001b) Scanning mutagenesis identifies critical residues in the rinderpest virus genome promoter. J. General Virol. 82(12): 2905-2911. Noton SL and Fearns R (2015) Initiation and regulation of paramyxovirus transcription and replication. Virol. 479-480, 545-554. Ozawa T, Kondo M and Isobe M (2004) 3’ rapid amplification of cDNA ends (RACE) walking for rapid structural analysis of large transcripts. J. Human Genetics. 49(2): 102-105. Fig. 2: Mutational analysis of GP region. The GP region of the PPRV Poranen MM, Koivunen MRL and Bamford DH (2008) Nontemplated Terminal isolates were amplified by RACE-PCR and checked on gel Nucleotidyltransferase Activity of Double-Stranded RNA electrophoresis (a) and sequenced. The analysis included 2 virus Bacteriophage ö6 RNA-Dependent RNA Polymerase. J. Virol. isolates of this study (PPRV/Bikaner and PPRV/Hanumangarh2), a 82(18): 9254-9264. vaccine strain (PPRV/Sungri/96) and other Indian PPRV. The red boxes Salvador ML, Suay L and Klein U (2011) Messenger RNA degradation is highlights nucleotide base substitutions (b). initiated at the 52 end and follows sequence- and condition- dependent modes in chloroplasts. Nucleic Acids Res. 39(14): (Fereidouni et al., 2012) and usually degradation started at termini 6213-6222. (Poranen et al., 2008). Therefore, terminal region may not have Walpita P (2004) An internal element of the measles virus antigenome been amplified. Though, we could not find any study comparing promoter modulates replication efficiency. Virus Res. 100(2): degradation rate of 3’ and 5’ UTR of RNA virus, however, there 199-211. 243 Veterinary Practitioner Vol. 20 No. 2 December 2019

HAEMATO-BIOCHEMICAL STUDIES IN RENAL AFFECTIONS IN CAMEL (CAMELUS DROMEDARIUS)#

Manisha Mehra1, O.P. Singh2, M. Mathur, H. Dadhich, G. Singh3, S. Rani, I. Vyas, S. Asopa, N. Sharma4 and H. Chouhan5 Department of Veterinary Pathology, College of Veterinary and Animal Science Rajasthan University of Veterinary and Animal Sciences, Bikaner-334 001, Rajasthan, India

Received Revised on 03.04.2019 ABSTRACT Accepted on 17.09.2019

The haemato-biochemical study was conducted in 40 camels of all age group and both sexes that showed urine inconsistency (according to their physiological and microscopic examination) and renal insufficiency. A total 40 numbers of blood samples were collected from Veterinary Clinical Complex, RAJUVAS, Bikaner with anorexia, fever, haemoglobinuria, haematuria, depression, diarrhoea, progressive weight loss, polyuria, oliguria, anuria, dehydration, ascites and pale mucosa, which were the main clinical signs observed in renal affections in camels. Twenty apparently healthy camels were used as control in the present study. In comparison with the healthy the overall mean values of Hb concentration, MCV, and RBCs count showed significant decrease. PCV, MCH and MCHC values revealed insignificant changes in all cases. A significant leucocytosis with significant neutropenia and lymphocytosis were also recorded. In biochemical study, BUN and serum creatinine showed significant increase while serum total proteins and serum albumin showed significant decrease.

Key words: Renal affection, blood, serum, camel

Introduction total leucocyte count (TLC) and differential leucocyte count The camel (Camelus dromedarius) is an important animal (DLC) were estimated by Sahli-Hellige haemoglobinometer, component of the fragile desert eco-system. Camels have a microhaematocrit, haemocytometer method Giemsa’s staining series of physiological adaptations that allow them to withstand and mean corpuscular volume (MCV) and mean corpuscular long periods of time without any external source of water haemoglobin concentration (MCHC) as per the methods (Roberts, 1986). The dromedary camel can drink as seldom described by Jain (1986). Serum separated by making blood as once every 10 days even under very hot conditions and can slant and incubated for 1 hr at 370C. Blood clot broken and lose up to 30% of its body mass due to dehydration. Unlike tube centrifuged at 2500 rpm for 30 minutes. Serum pipetted other mammals, camel’s red blood cells are oval rather than out in small tube and kept immediately in deep freeze (-200C). circular in shape. This facilitates the flow of red blood cells Serum creatinine, blood urea nitrogen (BUN), total serum during dehydration (Eitan et al., 1976), and makes them better protein (TSP) and, serum albumin (SA) were estimated by at withstanding high osmotic variation without rupturing when using IDEXX biochemistry kit. The concentration of serum drinking large amounts of water. The kidney of camel is known globulin (SG) was estimated by subtracting the value of SA to play a vital role in water conservation through the production from that of TSP. of highly concentrated urine that may predispose animal to varieties of renal dysfunction. In camels renal disorders have Results and Disscussion received lesser attention in comparison with other animals, The results of hemato-biochemical parameters are thus there is shortage of information in this area (Gholam et presented in Table 1 and 2. There was significant and al., 2014). nonsignificant decrease level of erythrogram in cases of kidney affections may be attributed to decrease erythropoietin Materials and Methods production in addition to the circulating uremic inhibitors that In the present study, blood samples were collected from may play a role in inhibiting erythropoiesis (Feldman et al., 40 clinical cases suffering from fever, off feed, urine 2000). Increase in lymphocytes due to chronic infection. In inconsistency (according their physiological and microscopic chronic cases CD4+ T lymphocytes binds with foreign antigens examination) etc. which were reported at Veterinary Clinical presented by macrophages and dendritic cells, they release Complex (VCC), RAJUVAS, Bikaner. Total twenty apparently lymphokines that attract lymphocytes into lesions site (Mc healthy camels were also included in this study as control Gavin, 2001). Glomerular membrane doesn’t allow the group. The blood samples were collected from clinical cases elimination of plasma proteins, except for some physiological treated at VCC, CVAS, Bikaner and nearby farms in two vials, states when transformations occur (new-borns, parturition and one with EDTA and another without EDTA for serum separation. oestrus). In some renal disorders (acute renal failure, Blood samples were collected from camels that are suspected glomerulonephritis, chronic nephritis, pyelonephritis, nephritic for urinary system affections. The haemoglobin concentration syndrome), as well as in the renal neoplastic metastases and (Hb), packed cell volume (PCV), total erythrocyte count (TEC), parasitoses, proteinuria were also detected, that causes

#1Part of Ph.D Thesis and corresponding author Email:[email protected]; 2Senior Demonstrator SPMC, Bikaner; 3Assistant Professor, Navania Veterinary College, Udaipur; 4Veterinary Officer, Department of Animal Husbandry, Govt. of Rajasthan, Jaipur; 5Ph.D scholar, Department of AGB, CVAS, Bikaner

244 Veterinary Practitioner Vol. 20 No. 2 December 2019

Table 1: Blood parameters of camels in cases of urine inconsistency (Means ± SE) S. Control group Diseased camel Blood parameters No. (n=20) (n=40) 1 HB (g/dl) 12.487 ± 0.28 9.263 ± 0.18* 2 PCV (%) 25.00 ± 1.00 24.00± 1.00 3 RBC count × 1012/L 10.20 ± 0.11 7.60 ± 0.053* 4 MCV (fl) 32.88 ± 0.25 28.884 ± 0.74* 5 MCHC (g/dl) 36.69 ± 0.14 35.31± 0.07 6 MCH (pg) 11.88 ± 0.18 10.10 ± 0.30 7 TLC(109/L) 8.44± 0.42 9.60±0.48 8 Neutrophils (%) 54.63±4.58 48.54±2.32* 9 Lymphocytes (%) 40.33±5.60 57.23±2.95*** 10 Monocytes (%) 2.30±0.45 3.52±0.63 11 Eosinophils (%) 1.20±0.35 1.5±0.61

***P < 0.001, *P < 0.05

Table 2: Some biochemical parameters of camels in cases of urine inconsistency (Means ± SE) S. No. Blood parameters Control group (n=20) Diseased (n=40) 1 Total protein (g/dl) 5.82 ± 0.02 4.61 ± 0.03* 2 Albumin (g/dl) 3.50 ± 0.04 2.8 ± 0.015* 3 Globulin (g/dl) 2.80 ± 0.02 2.35 ± 0.023* 4 A/G Ratio 1.25±0.02 1.19±0.065* 5 BUN (mg/dl) 25.59 ± 0.079 32.58 ± 0.052*** 6 Creatinine (mg/dl) 1.50 ± 0.00 2.81 ± 0.023*** ***P < 0.001, *P < 0.05 low protein level in blood (Gherariu et al. 2000). Increase Gherariu S, Al Pop, Al Kadar and Marina Spanu (2000) Manual de in level of BUN is due to renal insufficiency, there of laborator clinic veterinary ed. All Bucuresti. accumulation of urea in the blood, because the rate of Gholam AK, Hossein N, Sirous S, Hadi I and Abbas R (2014) blood urea production exceeds the rate of excretion Pathological findings of slaughtered camels’ (Camelus (Mayne, 1994), and these changes may be attributed to dromedarius) kidneys in Najaf-Abad, Veterinary Research Forum. 5(3): 231 - 235 the renal affection by the presence of vacuolation and Jain NC (1986) In Schalm’s Veterinary Haematology. 4th ed. Lea degeneration of renal tubular epithelial with necrotized and Febiger, Philadelphia. pp. 2-200. cellular cast and tubular nephrosis and glomerulo- Latimer KS, Mahaffey EA and Prasse KW (2003) Duncan and nephritis (Latimer et al., 2003). Retention of creatinine in Prasse’s Veterinary Laboratory Medicine: Clinical the body showed that the kidneys were severely affected, Pathology. 4th ed. Ames, Iowa State Press. failing to excrete these catabolic products. Similarly, high Mayne PD (1994) The kidneys and renal calculi. In: Clinical levels of creatinine, particularly in the infected controls, Chemistry in Diagnosis and Treatment, 6th ed. Edward might also be attributed to muscle wasting shown by the Arnold Publications, London. pp. 2-24. Mbaya AW, Aliyu MM, Nwosu CO and Ibrahim UI (2008) Effect of experimentally infected dromedaries during the course Berenil® or Cymelarsan ® on the biochemical changes of the infection (Mbaya et al., 2008). in red fronted gazelles (Gazella ruûfrons) experimentally infected with Trypanosoma brucei. Rev. References Elev. Med. Vét. Pays Trop. 61: 169-175. Eitan A, Aloni B and Livne A (1976) “Unique properties of the McGavin MD, Carlton WW and Zachary JF (2001) Thomson’s camel erythrocyte membrane. Organization of special veterinary pathology. 3rd edn., Mosby, St. Louis. membrane proteins”. Biochimica et Biophysica Acta pp. 264-266. (BBA) - Biomembranes. 426: 647-58. Roberts MBV (1986) Biology: A Functional Approach. Nelson Feldman BF, Zinkl JG and Jain NC (2000) Schalm’s Veterinary Thornes. pp. 234-235, 241. Haematology. 5 ed., Lea and th Febiger, Philadelphia, USA.

245 Veterinary Practitioner Vol. 20 No. 2 December 2019

IN VITRO ASSESSMENT OF ANTIOXIDANT ACTIVITY, ANTIBACTERIAL POTENTIALS AND STABILITY OF COPPER OXIDE NANOPARTICLES

Vijayta Gupta1, Pinki Singh2, Vinay Kant3 and Meena Sharma1 Department of Chemistry, University of Jammu, Jammu & Kashmir

Received on: 12.10.2019 ABSTRACT Accepted on: 27.11.2019

In present study, copper oxide (CuO) nanoparticles were synthesized by chemical method and in vitro evaluated for antioxidant and antimicrobial activities. The suspension of different concentrations of CuO nanoparticles were evaluated for different parameters on day 1, 30 and 60 after its preparations. The CuO nanoparticles synthesized in this study were of 160.6 nm average size with a polydispersity index of 0.521. The CuO nanoparticles scavenge the free radicals in concentration dependent manner. The per cent

inhibitions and IC50 values of CuO nanoparticles against of free radicals were more and less, respectively on day 1 as compared to day 30 and 60. There were no marked reductions in the antioxidant and antibacterial actions of CuO nanoparticles suspensions on storage for 60 days. The CuO nanoparticles showed antibacterial actions against S. aureus and E. coli bacterial strains. Values of MIC and MBC of CuO nanoparticles also showed the action of CuO nanoparticles was more against E. coli than S. aureus. In conclusions, these potentials of CuO nanoparticles can be exploited to counter the diseases/problems associated with free radicals and bacteria in different fields like Veterinary and Medical sciences, agriculture, food sciences, tap water and waste water disinfection etc.

Key words: CuO nanoparticles, antioxidant, antibacterial

Introduction size less than 0.1 μm and properties of nanoparticles are Many disorders or diseases in humans and animals based on size of the nanoparticles (Rajeshkumar and Bharath, associated with the free radicals and the free radicals have 2017). Nanotechnology is a great favor for humanity because been found accountable for producing cancer, diabetes, its importance has covered the way for numerous applications cardiovascular disease, ulcerative colitis, aging, in therapeutics, catalysis, microelectronics and biological atherosclerosis, Alzheimer’s disease, neural disorders, mild sensors (Sutradhar et al., 2014). The investigation of antioxidant cognitive impairment, Parkinson’s disease, alcohol induced properties of nano sized materials has become one of the liver disease etc. (Velavan, 2011). Consumption of dietary important basic studies in nanotechnology. Chemical antioxidants is very helpful to provide defense against free compounds present in the food when exposed to oxygen in radicals, thus, antioxidants may be of great benefit in improving the air causes oxidation reactions, which leads to the loss of the quality of life by preventing or postponing the onset of nutritional value, creating rancidity and causing discolor in food degenerative diseases caused by free radicals (Blokhina et (Fernandez et al., 1997). Consumption of oxidized foods may al., 2003). Further, the antioxidants may be very helpful for causes serious diseases in humans and animals like reducing the cost of health care delivery. Bacterial infections to hepatomegaly or necrosis of epithelial tissues. Lipid peroxides the living organisms are also of serious concern due to the and low molecular weight compounds, responsible for these emergence of antimicrobial resistance at global level. The diseases are produced during the oxidative reactions. Different chances of infections in the human being and animals increase types of natural antioxidants like vitamin A, vitamin C, vitamin E when there is more oxidative or nitrosative stress. Further, the and carotenoids play crucial rule in terminating the oxidative microbial infections also increase the stress in the living rancidity in food by scavenging the free radical which is organisms. The development of antimicrobial resistance has generated during oxidation process (Beltran et al., 2004). Many rise rapidly in past few years due to the indiscriminate use of other synthetic antioxidants have been also investigated to antibiotics, and so many attempts have been made for the inhibit these oxidation reactions. The antioxidants, natural as development of antimicrobial compounds against many well as synthetic, can accept an unpaired electron which leads resistant microorganisms. Almost every human being and to the production of a stable intermediate. This intermediate is animal is exposed to the Staphylococcus aureus (S. aureus) stable for a longer period and interacts in a controlled fashion, and Escherichia coli (E. coli). However, some earlier treatable which stop auto oxidation. The excess energy of surplus electron microorganisms are currently becoming untreatable such as is dissipated without damage to the tissues. The dietary methicillin-resistant Staphylococcus aureus (MRSA) and antioxidants can be able to recycle, which is an indication of vancomycin-resistant enterococcus (VRE) (Henderson, 2006). their physiological essentiality to function as antioxidants. Scientific efforts are going on to reduce the impact of global Recently, among the metal oxide nanoparticles, copper oxide concern of microbial infections. Recently, applications of nanoparticles have attained significant importance because nanotechnology has emerged to plays an important role in of their distinctive properties and their varied range of many fields such as pharmaceutical, electrical and electronic applications such as solar cells, gas sensors, catalytic, optical, industries, environmental remediation, consumer products hydrogen storage materials and medical applications (Rama and medical field etc. Nanoparticles are defined as the particles and Syamasundar, 2013; Verma and Kothya, 2012). CuO

1Ph.D. Scholar and corresponding author email: [email protected]; 2Department of Zoology, Ranchi University, Ranchi; 3Department of Veterinary Pharmacology & Toxicology, LUVAS, Hisar

246 Veterinary Practitioner Vol. 20 No. 2 December 2019 nanoparticles are considered stable, robust and have a longer The ascorbic acid was used as standard antioxidant and shelf life compared to organic agents. In our previous studies, evaluated in parallel similarly as done for CuO nanoparticles. we synthesized the CuO nanoparticles and evaluated its The percentage of inhibition of ABTS•+ radicals at different acoustical parameters for different industrial applications. In concentations were determined by using the following this study, the CuO nanoparticles were synthesized and formulae: •+ evaluated for their antioxidant and antibacterial potentials. % ABTS inhibition = [1 – (A734nm Sample/ A734nm Control)] x 100 Materials and Methods Chemicals used DPPH radical scavenging activity The different chemicals like copper chloride, sodium The potential of CuO nanoparticles to scavenge DPPH hydroxide, dimethyl sulfoxide (DMSO), ascorbic acid, 2,2- radicals was determined according to the method of Hsu et al. diphenyl-1-picryl hydrazyl (DPPH), potassium persulfate, 2,2- (2006) and Kant et al. (2012). The free radical scavenging azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) diammon- activity of CuO nanoparticles was evaluated at different ium salt (ABTS), nitroblue tetrazolium (NBT), nicotineamide concentrations ranges from 2.5 to 160.0 μg/ml. CuO adenine dinucleotide hydrogen salt (NADH), phenazine nanoparticles (different concentrations) were added to DPPH methosulphate (PMS), disodium hydrogen phosphate, solution and DPPH solution without CuO nanoparticles was potassium dihydrogen phosphate, 2- deoxy-D-ribose, used as control solution. Solutions were kept at room potassium dihydrogen phosphate (KH 2PO4), potassium temperature (22 ± 3°C) in the dark for 30 minutes and the hydroxide (KOH), ethylene-diamine tetra acetic acid (EDTA), absorbance of the samples and control solutions were ferric chloride (FeCl3), hydrogen peroxide (H2O2), nutrient broth determined at 517 nm. The ascorbic acid was used as standard (NB), nutrient agar (NA) etc. were of analytical grade and antioxidant and evaluated in parallel similarly as done for CuO purchased from SRL. The two bacterial strains i.e. S. aureus nanoparticles. The % DPPH radical scavenging activity was (MTCC 1430) and E. coli (MTCC 2127) were used in this calculated as follows: study. Tetracycline and gentamicin were used as standard % DPPH radical scavenging activity = [1– (A517nm sample/ antibiotics and procured from Sigma Aldrich, USA. A517nm control)] x 100 Synthesis of CuO nanoparticles Superoxide anion radical scavenging assay CuO nanoparticles were synthesized by the precipitation The superoxide anion radical-scavenging ability of CuO of copper salt in alkaline medium. The sodium hydroxide nanoparticles was assessed by method described by solution (aqueous) was poured in the mixture of aqueous Nishikimi et al. (1972) and Kant et al. (2012). Superoxide anion copper chloride and glacial acetic acid under magnetic stirring radical scavenging activity of CuO nanoparticles was evaluated until the pH of solution reached to 12.5. The suspension (black in concentration ranging from 2.5 to 160.0 μg/ml. In this colored) was formed, which centrifuged to get CuO precipitates. experiment, the reaction mixture contained 1 ml of NBT solution These precipitates were subjected at 400°C for 3 h in ambient (156 μM prepared in phosphate buffer, pH-7.4), 1 ml of NADH atmosphere to get nano CuO. The size of synthesized solution (468 μM prepared in phosphate buffer, pH-7.4) and nanoparticles was determined by Malvern Instruments 0.5 ml diluted sample of different concentrations fraction. Zetasizer Nano-ZS instrument. The synthesized CuO Finally, acceleration of reaction was carried out by adding 100 nanoparticles were suspended in DMSO and further evaluated μL PMS solution (60 μM prepared in phosphate buffer, pH -7.4) for antioxidant potentials against different in vitro free radicals. to mixture. The reaction mixture and control sample (without The in vitro minimal inhibitory concentrations (MIC) and minimal nanoparticles) were mixed properly and incubated at 25°C for bactericidal concentrations (MBC) of synthesized CuO 5 min and absorbance at 560 nm was measured. The ascorbic nanoparticles were determined against S. aureus and E. coli acid was used as standard antioxidant and evaluated in parallel bacterial strains. The suspension of CuO nanoparticles was similarly as done for CuO nanoparticles. Percentage inhibition kept at room temperature and further evaluated for these in of the superoxide anion radicals was calculated using the vitro parameters on day 30 and 60 to determine the stability of following equation: nanoparticles suspension. % superoxide radical scavenging activity = [1– (A560nm sample /A nm control)] x 100 Antioxidant activity of CuO nanoparticles 560 ABTS radical scavenging activity Hydrogen peroxide radical scavenging assay The total antioxidant activity of CuO nanoparticles were A solution of hydrogen peroxide (20 mM) was prepared in determined according to the method of Re et al. (1999) and phosphate buffered saline (pH 7.4). Various concentrations of Kant et al. (2012) based on ABTS•+ scavenging assay. Briefly, 1 ml of the samples and standard were added to 2 ml of diluted ABTS•+ solution giving an absorbance reading of 0.750 hydrogen peroxide solution in PBS. After 10 min the absorbance at 734 nm was used for antioxidant activity of different was measured at 230 nm (Jayaprakasha et al., 2004). concentrations of CuO nanoparticles on different days. CuO % Hydrogen peroxide radical scavenging activity = [1– (A230nm nanoparticles were evaluated in concentration ranging from sample / A230nm control)] x 100 2.5 to 160.0 μg/ml. The radical scavenging capacity was performed by mixing CuO nanoparticles (different Determination of Minimal inhibitory concentrations (MIC) concentrations) with ABTS•+ solution. After proper mixing, the and Minimal bactericidal concentrations (MBC) of CuO absorbance was recorded at 734 nm after 3 min. ABTS•+ nanoparticles solution without nanoparticles was used as control solution. The overnight incubated S. aureus and E. coli bacterial 247 Veterinary Practitioner Vol. 20 No. 2 December 2019

strains suspension were aseptically inoculated (about 106 was observed at different concentrations and there was little CFU/ml) to 10 ml tube nutrient broth medium. Ten dilutions of reduction in the scavenging activity of CuO nanoparticles CuO nanoparticles were prepared (10, 20, 40, 60, 80, 100, against DPPH radicals after 60 days storage of its suspension.

140, 180, 220 and 260 μg/ml) in DMSO were used. Tests were The IC50 value of CuO nanoparticles against DPPH radicals performed in triplicates for each concentrations and for each on day 1 was lesser as compared to day 30 and 60 values. bacterial strain. The inoculated sets were incubated at 37ºC Superoxide anion radical is a reduced form of molecular overnight. After incubation period, the visible turbidity in each oxygen implicated in the initiating of oxidation reactions tube was investigated. The lowest concentration with no turbidity associated with aging and lipid peroxidation. In this study, CuO was considered as the MIC for the tested strain. The tubes nanoparticles markedly scavenge the superoxide anion showing no turbidity were cultured on nutrient agar plates and radicals in concentration dependent manner and reduction in incubated at 37ºC overnight. Bacterial colonies growth was the scavenging activity of CuO nanoparticles against checked and the concentration that showed no growth was superoxide anion radicals was also observed on storage of

considered as the MBC for the tested strain. suspension of CuO nanoparticles. The IC50 value of CuO nanoparticles against superoxide anion radicals on day 1 was Results and Discussions lesser as compared to day 30 and 60 values. The antioxidant CuO nanoparticles synthesized in this study were of 160.6 activity generally also has a mutual correlation with reducing nm average size with a polydispersity index of 0.521. The effect. It is known that hydrogen peroxide is toxic and induces average size of the nanoparticle suspension on day 30 and 60 cell death in in vitro and can attack many cellular energy was 202.3 nm and 310.6 nm, respectively. In our previous production systems deactivating the glycolytic enzyme glyceral- study, the CuO nanoparticles synthesized by the same method dehyde-3-phosphate dehydrogenase (Aoshima et al., 2004). were needle shape and average size by TEM studies was in Scavenging of hydrogen peroxide by different concentrations the range of 9-18 nm (Gupta et al., 2015). The different of CuO nanoparticles in present study was observed in concentrations of ascorbic acid and synthesized CuO concentration dependent manner and reduction in the nanoparticles showed the inhibition of the different in-vitro free scavenging activity of CuO nanoparticles against hydrogen radicals i.e. ABTS (Fig. 1a), DPPH (Fig. 1b), superoxide anion peroxide was also observed on storage of suspension of CuO (Fig. 1c) and H2O2 radicals (Fig. 1d) in a concentration nanoparticles. The IC50 value of CuO nanoparticles against dependent manner on different days. The concentrations hydrogen peroxide on day 1 was also lesser as compared to showing the 50% inhibition of free radicals is known as IC 50 day 30 and 60 values. In present study, ascorbic acid also and the IC50 values of ascorbic acid and synthesized CuO showed inhibitions of ABTS, DPPH, superoxide anion and H2O2 nanoparticles for the total antioxidant activity, free radical radicals in concentration dependent manner and it was more scavenging assay, superoxide radical scavenging activity and potent in scavenging these radicals as compared to the CuO reducing power activity are presented in Table 1. Free radicals nanoparticles synthesized in this study. Additionally, IC50 value are of different chemical entities with one or more unpaired of ascorbic acid was lesser than CuO nanoparticles against electrons, which are highly unstable and cause damage to these radicals. It is known that lower the IC50 values greater the other molecules by extracting electrons from them in order to hydrogen donating ability and thus the antioxidant activity of the attain stability. These free radicals are formed inside the system free radical scavengers. and are highly reactive and potentially damaging the short lived The values of MIC and MBC for the synthesized CuO chemical species. There is continuous production of these nanoparticles on different days against S. aureus and E. coli radicals in the human and animal body due to their role in bacterial strains are presented in Table 2. The CuO detoxification, chemical signaling, energy supply and immune nanoparticles showed antibacterial actions against both the function. ABTS is a chemically produced radical, which bacterial strains which revealed its powerful broad spectrum decolorizes in its non-radical form in the presence of antibacterial activity. The values of MIC and MBC of CuO antioxidants and is often used for screening complex mixtures nanoparticles also showed that their action was more against such as plant extracts, beverages, biological fluids and other the E. coli than S. aureus. It was also evident that the MBC antioxidants. In present study, marked ABTS radical scavenging value of CuO nanoparticles for S. aureus was increased on its activity of CuO nanoparticles was observed. The scavenging storage for two months. This was might be due to its increased activity of CuO nanoparticles was slightly decreased on its size because of agglomerations of the nanoparticles during storage. The IC value of chemically synthesized CuO 50 the storage, which lead to decreased actions of the nanoparticles on day 1, 30 and 60 against ABTS radicals was nanoparticles. However, there was no effect on storage stability 127.93±2.11, 142.18±2.42 and 149.64±2.11, respectively. on the MIC values for both bacterial strains and MBC value for DPPH is another stable free radical, which accepts an E. coli. So, storage of CuO nanoparticles suspension for 60 electron or hydrogen radical to become a stable diamagnetic days at room temperature did not produce marked reduction molecule due to their hydrogen donating ability. The method of in the antibacterial potentials, and it might be suggested that scavenging the stable DPPH radical is a widely used to evaluate the suspension of these nanoparticles is stable at room antioxidant activities in a shorter period of time as compared to temperature for 60 days. Moreover, nanoparticles can lead to other methods (Soares et al., 1997). The stabilized DPPH their tightly adsorption on the surface of the bacterial cells due produce intense violet colour and the loss of this violet colour to their large surface area property. This also impairs the occurs in presence of antioxidant due to of hydrogen donating bacterial membrane permeability leading to the leakage of capacity of antioxidants. The results of this study showed intracellular components and thus killing the bacterial cells marked scavenging of DPPH radicals by CuO nanoparticles (Qi et al., 2004). In present study, the marked antibacterial action 248 Veterinary Practitioner Vol. 20 No. 2 December 2019

Fig. 1: Antioxidant effect of CuO nanoparticles (NPs) on different days against (a) ABTS radicals, (b) DPPH radicals, (c) superoxide

anion radicals and (d) H2O2 radicals. Results are expressed as mean ± SE (n = 3)

Table 1: IC50 values (μg/ml) of CuO nanoparticles against ABTS, DPPH, superoxide anion and H2O2 radicals on different days. Ascorbic CuO nanoparticles Parameters acid Day 1 Day 30 Day 60 Total antioxidant activity (ABTS) (μg/ml) 91.08 ±2.52 127.93±2.11 142.18±2.42 149.64±2.11 Free radical scavenging activity (DPPH) (μg/ml) 87.94±2.81 171.54±1.07 171.85±1.26 193.16±0.63 Superoxide radical scavenging activity (μg/ml) 82.18±3.49 154.07±1.15 163.83±1.39 179.22±0.75 Reducing power activity (μg/ml) 64.60±3.94 126.25±0.73 137.53±1.22 156.18±0.71

Table 2: The MIC and MBC values (μg/ml) of CuO nanoparticles (NPs) against S. aureus and E. coli on different days MIC MBC Bacteria CuO NPs CuO NPs CuO NPs CuO NPs CuO NPs CuO NPs (Day 1) (Day 30) (Day 60) (Day 1) (Day 30) (Day 60) S. aureus 60.0 μg/ml 60.0 μg/ml 60.0 μg/ml 220.0 μg/ml 220.0 μg/ml 260.0 μg/ml E. coli 40.0μg/ml 40.0 μg/ml 40.0 μg/ml 180.0 μg/ml 180.0 μg/ml 180.0 μg/ml of CuO nanoparticles was might be due the strong adherence which results in a disordered helical structure of DNA molecule of the CuO nanoparticles to the bacterial cell membrane. Earlier and causes denaturation of proteins as well as some other reports have revealed that the antimicrobial activity was due to biochemical processes in the cell, leading to complete the fact that the copper ions released form CuO nanoparticles destruction of the bacterial cell (Yallappa et al., 2013). It has permeated the bacterial cell membrane and destroyed the been also known that CuO nanoparticles can be considered structure of the cell membrane by attaching to the negatively better antimicrobial agent in comparison to organic charged cell wall (Ren et al., 2009; Sankar et al., 2014). compounds due to their stability at high temperatures as well Additionally, copper ions are involved in cross-linkage of nucleic as pressures without loss of medicinal properties and also acid strands by binding them with DNA molecule of bacteria, generally regarded as safe materials to human beings and

249 Veterinary Practitioner Vol. 20 No. 2 December 2019 animals (Sondi and Sondi, 2004; Fu et al., 2005). Further, Kant V, Mehta M and Varshneya C (2012) Antioxidant potential and applications of CuO nanoparticles on cellulose bandages, total phenolic contents of seabuckthorn (Hippophae uniforms, bed linen, medical equipment etc. will significantly rhamnoides) pomace. Free Radic. Antioxid. 2: 79-86. reduce bacterial contamination, and reduce the mortality as Nishikimi M, Rao NA and Yagi K (1972) The occurrence of superoxide anion in the reaction of reduced Phenazine methosulphate well as associated costs of treatment to prevent microbial and molecular oxygen. Biochem. Biophys. Res. Commun. infections. The incredible antioxidant and antibacterial activities 46: 849–853. of CuO nanoparticles in present study makes the future studies Qi L, Xu Z, Tiang X, Hu C and Zou X (2004) Preparation and antibacterial interesting in clinical evaluation of its potentials in different activity of chitosan nanoparticles. Carbohyd. Res. 339: 2693 fields. -2700. In conclusion, CuO nanoparticles synthesized in this study Rajeshkumar S and Bharath LV (2017) Mechanism of plant-mediated were stable to show the antioxidant activities (against ABTS, synthesis of silver nanoparticles – a review on biomolecules DPPH, superoxide anion and hydrogen peroxide radicals) and involved, characterisation and antibacterial activity. Chem. Biol. Interact. 273: 219-227. antibacterial properties, and these potentials of CuO Rama M and Syamasundar B (2013) Phytochemical constituents and nanoparticles can be exploited to counter the problems antioxidant activity of extract from the leaves of Ocimum associated with free radicals and bacteria in different fields sanctum green and purple. Int. J. Chem. Pharm. Res. 2(2): like Veterinary sciences, Medical sciences, agriculture, food 55-64. sciences, tap water and waste water disinfection etc. Re R, Pellegrini N, Proteggente A, Pannala A, Yang M and Rice-Evans C (1999) Antioxidant activity applying an improved ABTS References radical cation decolorization assay. Free Radic. Biol. Med. Aoshima H, Taunoue H, Koda H (2004) Aging of whiskey increases 26:1231-1237. 1,1-diphenyl-2-picrylhydrazyl radical scavenging activity. Ren G, Hu D, Cheng EW, Vargas-Reus MA, Reip P and Allaker RP J. Agric. Food Chem. 52: 5240–5244. (2009) Characterization of copper oxide nano particles for Beltrán E, Pla R, Yuste J, and Mor-Mur M (2004) Use of antioxidants to antimicrobial applications. Int. J. Antimicrob. Agents. 33(6): minimize rancidity in pressurized and cogged chicken slurries. 587-590. Meat Sci. 66: 719–725. Sankar R, Manikandan P, Malarvizhi V, Fathima T, Shivashangari KS Blokhina OE, Virolainen and Fagerstedt KV (2003) Antioxidant, oxidative and Ravikumar V (2014) Green synthesis of colloidal copper damage and oxygen deprivation stress: A review. Ann. Bot. oxide nanoparticles using Carica papaya and its application 91: 179-194. in photocatalytic dye degradation. Spectrochim. Acta Mol. Fernandez J, Perez-Alvarez JA and Fernandez-Lopez JA (1997) Biomol. Spectrosc. 121: 746-750. Thiobarbituric acid test for monitoring lipid oxidation in meat. Soares JR, Dins TCP, Cunha AP, Ameida L (1997) Antioxidant activities Food Chem. 59: 345-353. of some extracts of Thymus zygis. Free Radic. Res. 26: Fu L, Liu Z, Liu Y, Han B, Hu P, Cao L and Zhu D (2005) Beaded Cobalt 469-478. oxide nanoparticles along carbon nanotubes: towards more Sondi I and Sondi SB (2004) Silver nanoparticles as antimicrobial agent: highly integrated electronic devices. Adv. Mater. 17: 217- a case study on E. coli as a model for Gram-negative 221. bacteria, J. Colloid Interf. Sci. 275(1): 177-182. Gupta V, Magotra U, Sandarve, Sharma AK and Sharma M (2015) CuO Sutradhar P, Saha M and Maiti D (2014) Microwave synthesis of copper nanofluids: Particle-fluid interaction study using ultrasonic oxide nanoparticles using tea and coffee powder extracts technique. J. Chem. Pharmaceut. Res. 7(8): 313-326 and it’s antibacterial activity. J. Nanostruct. Chem. 4: 86. Henderson DK (2006) Managing methicillin-resistant staphylococci: a Velavan S (2011) Free radicals in health and diseases - A mini review. paradigm for preventing nosocomial transmission of resistant Pharmacol. Newslett. 1: 1062-1077. organisms. Am. J. Infect. Control. 34(5 suppl 1): S46–S54, Verma S and Kothya P (2012) Pharmacological activity of different S64–S73. species of tulsi. Int. J. Biopharma and Phytochemical Hsu B, Coupar IM and Ng K (2006) Antioxidant activity of hot water Res.1(1): 21-39. extract from the fruit of the Doum palm, Hyphaene thebaica. Yallappa S, Manjanna J, Sindhe MA, Satyanarayan ND, Pramod SN Food Chem. 98: 317-328. and Nagaraja K (2013) Microwave assisted rapid synthesis Jayaprakasha GK, Rao LJ and Sakariah KK (2004) Antioxidant activities and biological evaluation of stable copper nanoparticles of flavidin in different in vitro model systems. Bioorg. Med. using T. arjuna bark extract. Spectrochim. Acta Mol. Biomol. Chem. 12: 5141–5146. Spectrosc. 110: 108-115.

250 Veterinary Practitioner Vol. 20 No. 2 December 2019

STATISTICAL INVESTIGATION ON STABLE LACTATION PERIOD OF JERSEY CROSS BREED#

Radhika Thakur1, R.K. Gupta2 and Moneesh Thakur3 Department of Basic Sciences, College of Forestry Dr. Y.S. Parmar University of Horticulture and Forestry Nauni- Solan-173 230, Himachal Pradesh, India

Received revised on: 22.06.2019 ABSTRACT Accepted on: 23.06.2019

Data on milk yield of 4 Jersey cross cows were taken from Dairy Farm of Department of Silviculture and Agroforestry, Dr. Yashwant Singh Parmar University of Horticulture and Forestry Nauni- Solan, Himachal Pradesh from 1978-2014. Data were used on stability analysis of milk yield of Jersey cross cows to find out stable lactation period. Finlay and Wilkinson (1963) considered the regression coefficient as the best measure of stability. Therefore, Finlay and Wilkinson’s Model was used to identify the stable lactation period for milk yield. The interaction was found to be significant for the character. In Jersey cross cow, maximum milk yield (264.69 litres) and minimum milk yield (200.38 litres) were obtained by using Finlay and Wilkinson’s Model. Lactation fifth of Jersey cross cow has

regression coefficient bi was equal to one and mean was high than overall mean. Hence, the fifth lactation period was found to be stable.

Key words: Stability analysis, Finlay and Wilkinson’s model, lactation periods, milk yield, Jersey cross

Cov (l̅ ,y ) Introduction bi = ij j = Jersey is the second most popular specialist dairy var (yj ) breed in the world and has originated from Jersey, the m ̅ Tli Ty ∑j lij , yj − largest Island. This breed is intensively used in India for = m 2 crossbreeding purpose. Jersey is the most important Ty ∑m y2 − dairy breed of cattle known for their high milk yield and j j m quality. The world milk production is estimated around where,

788.5 million tonnes, 137.7 million tonnes out of which CTj = Total of individual cow in jth month th 1.15 million tonnes comes from Himachal Pradesh as GTj = Grand total of j month th th per the 2013-14 figures. Milk production in India has Tij = Total of i lactation in j month increased from 137.7 million tonnes in 2013-14 to 155.5 million tonnes in 2015-16. Stability parameters by using Finlay and Wilkinson’s Model (1963) Materials and Methods Data on milk yield up to seven lactation periods were i) Poor months, above average stability subjected to test the effect of lactation period. Four cows Lactation mean (L) less than overall mean and regression coefficient (b ) <1. of Jersey crossbred were considered up to seven lactation i periods i.e. lactation period 1, lactation period 2, lactation ii) Rich months, above average stability period 3, lactation period 4, lactation period 5, lactation Lactation mean (L) more than overall mean and period 6 and lactation period 7. Analysis of variance was regression coefficient (b ) <1. performed to test the significance of different lactation i periods for each month separately and pooled analysis iii) Poor months, below average stability of variances was performed. Stability model i.e. Finlay Lactation mean (L) less than overall mean and and Wilkinson’s model (1963) was used to identify the regression coefficient (bi) >1. stable lactation period for the production of milk yield. iv) Rich months, below average stability Finlay and Wilkinson’s Model: Lactation mean (L) more than overall mean and

Systematic approach for analysis of milk stability of regression coefficient (bi) >1. lactation period was computed by Finlay and Wilkinson’s A stable lactation period(s) had lactation mean (L) model (1963) by two parameters of stability: more than overall mean and regression coefficient (bi) 1. i) Lactation mean ( ) Results and Discussion ∑m X l̅ = j ij Finlay and Wilkinson’s model was used to identify i m stable lactation period on the basis of two parameters of stability i.e. mean and regression coefficient associated ii) Regression coefficient (b i) as lactation stability with each lactation period. Milk yield showed significant

#Part of Ph.D. Thesis submitted by first author; 1,2Department of Basic Sciences, College of Forestry; 3Department of Veterinary Medicine, College of Veterinary Sciences and Animal Husbandry Selesih, Aizawl, Central Agricultural University, Mizoram- 796014 and Corresponding author email: [email protected] 251 Veterinary Practitioner Vol. 20 No. 2 December 2019

Table 1: ANOVA table for stability based on Finlay and Wilkinson’s Table 2: Parameters of Finlay and Wilkinson’s Model for milk yield Model (1963) of Jersey crossbreed Source of variation d.f. S.S. Jersey Cross m 2 m 2 Lactation Cows(c) in months m(c-1) = j CT j - j GT j CSS Mean bi Conclusion l lc Period(s) 1 (litres) Lactations (l) (l-1) LSS = lT2– C.F. mc i li Lactation Poor lactation m 2 Period 1 period, above Months (m) (m-1) j GT j – MSS = C.F. lc 200.38 0.98 average stability Lactations × Months (l-1)(m-1) lm T2 Lactation Poor lactation LMSS = i j ij – C.F.-LSS – MSS c Period 2 period, below Regression (l-1) 2 l m Xij yj 2 221.79 1.12 average stability RgSS = r {ij 2 ) } yj Lactation Poor lactation Deviation from regression (l-1)(m-1)-(l-1) LMSS- RgSS Period 3 period, below Pooled error m(l-1)(c-1) TSS-CSS-LSS-MSS-LMSS 240.88 1.12 average stability Lactation Rich lactation lactation period × month interaction. The stable lactation period Period 4 period, above 261.25 0.63 average stability was categorized by regression coefficients (bi) and mean performance of lactation period. These results are in agreement Lactation Stable lactation with Miranda et al. (1998), Tai (1971) and Verma et al. (1978). Period 5 260.89 1.00 period Significance of variance due to lactation period, month and Lactation Poor lactation lactation period × month marked the adequacy of analysis of Period 6 period, above the measures of adaptability. This showed that differences 241.18 0.71 average stability among lactation period and among months were substantial Lactation Rich lactation and lactation period gave differential performance in different Period 7 period, below months. In present case, both linear (regression variance) 264.69 1.45 average stability and non-linear (deviation from regression) variances were Overall significant. Significance of linear (regression) variance offered Mean 241.58 adequacy to compute bi associated with each lactation period (Table 1). lactation period 1 was bi (0.98) and lactation period 6 was bi In Jersey crossbred, lactation period 2, lactation period 3 (0.71) was less than unity. It indicated that the lactation period and lactation period 7 showed bi greater than unity. Such 1 and lactation period 6 were suitable to poor month, above lactation period possess ‘below average stability’. This average stability (Table 2). indicated that these lactation periods were highly sensitive to According to Finlay and Wilkinson’s model, in Jersey lactation period changes as the rates of change in ‘lactation crossbred, a stable lactation period is one having mean more period mean’ for every unit. The lactation period 2 had mean than overall mean and regression coefficient bi nearly equal to 221.79 litres which was less than the overall mean and the one. The lactation period 5 had mean 260.89 litres which was regression coefficient bi (1.12) was greater than unity. Also the greater than the overall mean and the regression coefficient of lactation period 3 had mean 240.88 litres which was less than lactation period 5 was bi (1.00). Therefore, the lactation period the overall mean and the regression coefficient bi (1.12) was 5 was found to be most stable lactation period with respect to greater than unity. It indicated that these two lactation periods the milk yield. Thus lactation period 5 had exhibited ‘average were suitable to poor month, below average stability. Whereas stability’, hence possessed general adaptability, i.e. generally the lactation period 7 had mean 264.69 litres which was greater adapted to all monthly conditions as changes in ‘lactation period than the overall mean and the regression coefficient bi (1.45) mean’ go hand in hand with those in ‘monthly mean’. was greater than unity. It indicated that lactation period 7 was suitable to rich month, below average stability. The lactation References period 5 had mean 260.89 litres which was greater than the Finlay KW and Wilkinson GN (1963) The analysis of adaption in a plant overall mean and the regression coefficient b (1.00) was equal breeding programmes. Australian J. Agri. Res. 14(1): 742- i 754. to unity. It indicated that lactation period 5 was stable lactation Miranda GV, Vieria C, Cruz CD and Araujo GA de A (1998) Comparison period. The lactation period, lactation period 4 and lactation between evaluation methods of bean cultivars adaptability period 6 had bi less than unity. These lactation periods were and stability. Acta Scientiarum. 20(3): 249-255. categorized as ‘above average stability’. These lactation periods Tai GC (1971) Genotype stability analysis and its application to potato showed little change in milk yield despite large changes in regional trails. Crop Science. 11: 184-190. months i.e. low sensitivity to month. The lactation period 4 had Verma MM, Chahel GS and Murth BR (1978) Limitations of conventional mean 261.25 litres which was more than the overall mean regression analysis: A proposed modification. Theory Applicat. Genetics. 53: 89-91. and the regression coefficient bi (0.63) was less than unity. It indicated that lactation period 4 was suitable to rich month, above average stability. The lactation period 1 had mean 200.38 litres and lactation period 6 had mean 241.18 litres which was less than the overall mean and the regression coefficient of

252 Veterinary Practitioner Vol. 20 No. 2 December 2019

GENETIC PARAMETERS FOR WOOL PRODUCTION AND QUALITY TRAITS IN MAGRA SHEEP#

H. Singh1, G.C. Gahlot2, H.K. Narula3, U. Pannu4 and A. Chopra5 Department of Animal Breeding and Genetics, College of Veterinary and Animal Science Rajasthan University of Veterinary and Animal Sciences, Bikaner-334 001, Rajasthan, India

Received revised on: 14.05.2019 ABSTRACT Accepted on: 28.07.2019

Data on 2873 records of Magra sheep maintained at Arid Region Campus of Central Sheep and Wool Research Institute, Bikaner (Rajasthan) distributed over a period of 15 years (2000-2014) were analyzed for estimation of genetic parameters of wool traits. Heritability estimates for greasy fleece yield at first, second and third clip were estimated as 0.68 ± 0.08, 0.81 ± 0.10 and 0.66 ± 0.15, respectively, and for staple length, crimp frequency, fibre diameter, pure, hetro, hairy and medullated fibres were estimated as 0.52 ± 0.09, 0.20 ± 0.06, 0.18 ± 0.05, 0.41 ± 0.07, 0.33 ± 0.07, 0.53 ± 0.08 and 0.44 ± 0.08, respectively. Genetic correlations among different wool production traits ranged from 0.33 to 0.87, and that of wool quality traits ranged from -1.00 to 0.93; and phenotypic correlations ranged from - 0.01 to 0.09 and -1.00 to 0.89, respectively for wool production and wool quality traits. Moderate to high heritability estimates for most of the traits indicated the presence of high genetic variance and low environmental variance. Hence, selection may be done effectively for improvement in these traits.

Key words: Greasy fleece yield (GFY), heritability, Magra sheep, wool quality

Introduction Heritability of every economic trait was estimated using Magra is an important carpet wool breed of eastern and paternal half sib analysis (Becker, 1968) using model 2 of southern Bikaner and adjoining area of Nagour, Churu and LSMLMW programme (Harvey, 1990). The sires with less than Jhunjhunu districts of Rajasthan (Vivekanand et al., 2014). It is four progeny were excluded for the estimation of heritability. well known for its lustrous and quality wool as compared to The variance components for estimation of heritability were other sheep breeds of Rajasthan. The prime basis of any obtained from the following model: breed improvement programme is effective utilization of genetic Yij = μ + si + eij variations among the animals (Singh et al., 2012). So, Where, Yij is the measurement of a particular trait, μ is the th estimation of heritability is necessary for predicting response population mean, si = Random effect of the i sire and eij = to selection. Knowledge of heritability estimates is also helpful Random error NID (0, σ2). in determining the method of selection to be adopted, in choosing an efficient system, and in estimating the genetic Results and Discussion gains (Akhtar et al., 2008). Hence, present study was The data structure, least squares mean (LSM), standard undertaken to estimate the genetic and phenotypic parameters deviation (SD) and coefficient of variation for different wool traits viz., heritability, genetic and phenotypic correlations for various under study are shown in Table 1. The least-squares mean for wool traits in Magra sheep, so as to generate information that greasy fleece yield at first, second and third clip were observed will be helpful in developing future breeding plans for to be 690.50 ± 4.71, 754.83 ± 5.57 and 670.93 ± 5.39 g, conservation and genetic improvement of the breed. respectively. The least-squares means were observed to be 6.26 ± 0.04 cm, 0.92 ± 0.01 per cm and 33.31 ± 0.13 μ for Materials and Methods staple length, crimp frequency and fibre diameter, respectively; Data on 2873 animals used in the present analysis were and 54.74 ± 0.59, 33.25 ± 0.42, 12.01 ± 0.29 and 45.26 ± 0.59 collected from the database of Magra sheep maintained at % for the percentage of pure, hetro, hairy and medullated fibres, Arid Region Campus, ICAR- Central Sheep and Wool Research respectively. Institute, Bikaner, over a period of 15 years (2000-2014), divided Heritability estimates for wool production and quality traits into five classes viz. P1 (2000-2002), P2 (2003-2005), P3 (2006- in Magra sheep have been presented in Table 2 and Table 3, 2008), P4 (2009-2011) and P5 (2012-2014). Traits included in respectively. Heritability of greasy fleece yield at first, second the present study were wool production traits viz., greasy fleece and third clips were estimated as 0.68 ± 0.08, 0.81 ± 0.10 and yield at 1st, 2nd and 3rd shearing, and wool quality traits viz., 0.66 ± 0.15, respectively. High heritability estimate for greasy staple length, crimp frequency, fibre diameter, pure fibres, fleece yield at subsequent clips indicate the presence of high hetrofibres, hairy fibres and medullation percentage. The data genetic variability for these traits in the flock which can be were adjusted for the effect of non-genetic factors viz. sex (2 utilized through individual selection. Heritability for greasy fleece levels), season of birth (2 levels) and period of shearing (5 yield at second clip was more than first clip indicating that levels) as fixed effects, sire as random effect and lamb’s age population was exhibiting more genetic variability in second at shearing as a covariate, prior to estimation of genetic and clip than first greasy fleece weight. Nirban et al. (2015) reported phenotypic parameters. higher heritability estimate for first clip and lower estimate for

#1Part of Ph.D. Thesis of first author; 2Presently Dean, PGIVER, Jaipur; 3Principal Scientists, CSWRI, Bikaner; 4Professor; 5Scientist, CSWRI, Bikaner

253 Veterinary Practitioner Vol. 20 No. 2 December 2019 second clip as 0.98± 0.090 and 0.37± 0.065, respectively. estimate for crimp frequency and fibre diameter indicated that Mandal et al. (2002) and Dixit et al. (2011) reported lower most of the variations in these traits were non-genetic in nature. heritability estimates for greasy fleece yield at first clip as Thus, these traits could be improved through managemental 0.23±0.05 and 0.54±0.13; and second clip as 0.38 ± 0.06 and intervention. Though genetic variation is present in the animals, 0.54±0.13, in Muzaffarnagri and Bharat Merino sheep, but the environmental conditions like high humidity and higher respectively. ambient temperature also affects the wool production and The estimates of heritability for staple length, crimp quality. It has thus, suggested that a more critical and careful frequency, fibre diameter, pure, hetro, hairy and medullated selection of breeding stock be adopted in order to control these fibres were estimated as 0.52 ± 0.09, 0.20 ± 0.06, 0.18 ± 0.05, environmental conditions. Results clearly indicate that selection 0.41 ± 0.07, 0.33 ± 0.07, 0.53 ± 0.08 and 0.44 ± 0.08, respectively. may be practiced for heavier fleeces giving negative weightage High estimate of heritability for wool quality traits (except that of to fibre diameter and medullation percentage. Moreover, giving crimp frequency and fibre diameter) suggested that most of negative weightage to fibre diameter will increase the the variations in these traits are genetic rather than percentage of pure fibres of wool and decrease the medullation environmental, that may be improved through selection. percentage which may result in further improvement of the Moderate to high heritability estimates for pure, hetro, hairy wool quality. and medullated fibres suggested that the direct selection for fibre quality traits could be successful if environmental Acknowledgement conditions are more tightly controlled or accounted for the Authors are thankful to the Director, ICAR- CSWRI; Head, selection programme. Dixit et al. (2011) reported higher Arid Region Campus, ICAR- CSWRI; Vice-chancellor, estimates for heritability of staple length and fibre diameter as Rajasthan University of Veterinary and Animal Sciences; and 0.76 ± 0.15 and 0.46 ± 0.13, respectively, and lower values for Dean, College of Veterinary and Animal Science, Bikaner; for medullation percentage as 0.15 ± 0.10 in Bharat Merino sheep. providing the facilities for the execution of work. The technical Nehra et al. (2005) reported lower estimates of heritability for help rendered by Mr. Vimal Mehrotra, CTO at Arid Region pure and hairy fibres as 0.03 ± 0.10 and 0.20 ± 0.08, respectively, in Marwari sheep. Table 1: Descriptive statistics and data structure for wool traits in Estimates of genetic and phenotypic correlations among Magra sheep wool traits are presented in Table 2 and Table 3. Genetic TRAIT RECORDS MEAN SD SIRES correlations among different wool production traits ranged from GFY I 2873 690.50 208.92 112 0.33 to 0.87, and that of wool quality traits ranged from -1.00 to GFY II 2342 754.83 247.01 120 0.93; and phenotypic correlations ranged from- 0.01 to 0.09 GFY III 779 670.93 175.19 27 and -1.00 to 0.89, respectively for wool production and wool STAPLE LENGTH 2073 6.26 1.36 99 quality traits, respectively. The positive and moderate genetic CRIMP FREQUENCY 2073 0.92 0.36 99 FIBRE DIAMETER 2073 33.31 4.74 99 correlation between GFY I and GFY II indicates that lambs with PURE FIBRES 2073 54.74 20.50 99 heavier fleece at first clip might have heavier fleece at second HETRO FIBRES 2073 33.25 14.36 99 clip also. The result was in accordance with the findings of HAIRY FIBRES 2073 12.01 10.26 99 Mandal et al. (2002) and Dixit et al. (2011) in Muzaffarnagri and MEDULLATED FIBRES 2073 45.26 20.50 99 Bharat Merino sheep, respectively. The genetic correlations between different wool quality traits were in accordance with Table 2: Estimates of heritability, genetic and phenotypic correlation the findings of Di et al. (2011) and Ciappesoni et al. (2013) in using sire model for wool yield in Magra sheep Merino; Khan et al. (2015) in Rambouillet and Nehra et al. GFYI GFYII GFYIII (2005) in Marwari breed of sheep. GFYI 0.68 ± 0.08 0.33 ± 0.25 0.55 ± 0.26 The estimates of heritability for wool production and wool quality traits (except that of crimp frequency and fibre diameter) GFYII 0.09 ± 0.02 0.81 ± 0.10 0.87 ± 0.26 indicated the existence of considerable additive genetic GFYIII 0.07 ± 0.04 - 0.007 ± 0.04 0.66 ± 0.15 variance in these traits. The genetic differences in these traits Values at the diagonal are heritability estimates, and values above and can, therefore, be exploited through selection for genetic below the diagonal are genetic and phenotypic correlations, improvement in these traits of Magra sheep. Low heritability respectively

Table 3: Estimates of heritability, genetic and phenotypic correlation using sire model for wool quality traits in Magra sheep

SL CF FD PURE HET HAIRY MED SL 0.52±0.09 -0.15±0.17 -0.11±0.17 -0.15±0.14 -0.05±0.15 0.41±0.13 0.15±0.14 CF 0.04±0.02 0.20±0.06 -0.72±0.25 0.49±0.16 -0.59±0.19 -0.24±0.19 -0.49±0.19 FD 0.06±0.02 -0.20±0.02 0.18±0.05 -0.81±0.23 0.93±0.12 0.44±0.15 0.81±0.10 PURE -0.06±0.02 0.20±0.02 -0.52±0.02 0.41±0.07 -0.93±0.20 -0.86±0.19 -1.00±0.20 HET 0.003±0.02 -0.15±0.02 0.32±0.02 -0.89±0.01 0.33±0.07 0.62±0.11 0.93±0.02 HAIRY 0.12±0.02 -0.20±0.02 0.59±0.02 -0.76±0.01 0.39±0.02 0.53±0.08 0.86±0.05 MED 0.06±0.02 -0.20±0.02 0.52±0.02 -1.00±0.00 0.89±0.01 0.76±0.01 0.44±0.08 Values at the diagonal are heritability estimates, and values above and below the diagonal are genetic and phenotypic correlations, respectively

254 Veterinary Practitioner Vol. 20 No. 2 December 2019

Campus, ICAR- CSWRI, Bikaner, during data collection is Harvey HR (1990) User’s guide for LSMLMW and MIXMDL PC-2 deeply acknowledged. Version. Mixed Model Least Squares and Maximum Likelihood computer programme, PC-2 Version. Ohio State References University, Columbus, USA. Akhtar P, Ali S, Hussain A, Mirza MA, Mustafa MI and Sultan AI (2008) Khan NN, Kumar N, Das AK, Chakraborty D, Taggar RK and Gupta P Heritability estimates of post-weaning performance traits in (2015) Genetic studies on wool production traits in Hissardale sheep in Pakistan. Turk. J. Vet. Anim. Sci. 32(4): Rambouillet crossbred sheep in J & K State, India. Indian J. 275-279. Ani. Res. 49(1): 40-43. Becker WA (1968) Manual of Quantitative Genetics. Academic Mandal A, Rout PK, Pant KP and Roy R (2002) Genetic studies Enterprises, Pullman, Washington DC, USA. on fleece weights of Muzaffarnagri sheep. Indian J. Ciappesoni G, Goldberg V and Gimeno D (2013) Estimates of genetic Small Rum. 8(2): 92-96. parameters for worm resistance, wool and growth traits in Nehra KS, Sharma NK, Beniwal BK and Singh VK (2005) Genetic Merino sheep of Uruguay. Lives. Sci. 157: 65-74. evaluation of Marwari sheep in arid zone: Wool Di J, Zhang Y, Tian K, Lazate Liu J, Xu X, Zhang Y and Zhang T (2011) Production. Indian J. Small Rum. 11(1): 14-17. Estimation of (co)variance components and genetic Nirban LK, Joshi RK, Narula HK, Pannu U, Singh H and Kumar P parameters for growth and wool traits of Chinese superûne (2015) Effect of genetic and non-genetic factors on merino sheep with the use of a multi-trait animal model. greasy fleece yield of first and second clip in Marwari Lives. Sci. 138(1-3): 278-288. sheep. Vet. Pract. 17(1): 131-132. Dixit SP, Singh G and Dhillon JS (2011) Genetic and environmental Singh H, Pannu U, Narula HK and Chopra A (2013) Heritability factors affecting fleece traits in Bharat Merino sheep. Indian estimates of growth traits in Marwari sheep in arid J. Ani. Sci. 81(1): 80-83. region of Rajasthan. Vet. Pract. 14(2): 340-341. Dixit SP, Singh G, Kant N and Dhillon JS (2009) Contribution of genetic Vivekanand, Joshi RK, Narula HK, Singh H and Chopra A (2014) and phenotypic parameters affecting fleece traits in 3/4th Heritability estimates of growth traits in Magra sheep. bred Bharat merino sheep. Indian J. Ani. Res. 43(1): 1-6. Indian J. Small Rum. 20(2): 109-111.

255 Veterinary Practitioner Vol. 20 No. 2 December 2019

ANALYZING EFFICACY OF MILK ADULTERATION TESTING KITS AND CONVENTIONAL BIOCHEMICAL METHODS PREVAILING IN INDIA#

Vipin Kumar1, R.S. Aulakh2, J.P.S. Gill3 and J.S. Bedi4 School of Public Health and Zoonoses Guru Angad Dev Veterinary and Animal Sciences University, Ludhiana-141 004, Punjab, India

Received revised on: 04.06.2019 ABSTRACT Accepted on: 20.07.2019

Milk safety is a challenging global problem of human health concern. It denotes a condition of being protected from physical, chemical and microbiological contamination. The chemical safety of milk for various adulterants was determined by a number of qualitative analytical tests. It is important to know the detection capability of usual biochemical methods and available kits used for preservatives, neutralizing, diluting, thickening and non-dairy fat emulsifying agent to get aware all stake holders and regulatory agencies. Laboratory investigation revealed that the analytical sensitivity of most of studied kits and methods to recognize milk adulteration were up to pph (%) level. Only the formaldehyde and water (nitrate) tests confirmed low level of fraud and able to determine the tested concentra- tions up to ppm level. Other tests showed limitations in detecting the unlawful addition of adulterants at tracer amount and they may not be able to assure the complete absence of these substances in milk. Moreover, a number of variants were available for a particular qualitative test used in practice. Variation in amount of chemicals used in preparation, amount of reagent used in performance, variation in test procedure were also evident in different kits and methods. Therefore, there is an immediate need for development of rapid, easy and sure tests for detection of nature and extent of adulteration, uniform monitoring to regulate milk fraud and to ensure safe and wholesome milk to consumers.

Key words: Milk adulteration, biochemical methods, kits, qualitative analysis, efficacy

Introduction 2013). Therefore, strict analytical control is required for detection Milk is considered as a complete and ideal food for of adulterants in milk to safeguard consumer’s health (FAO, nourishment of mankind since times immemorial. It is an 2013). Qualitative tests based on bio-chemical reaction are indispensable, inexpensive, and highly nutritious item of daily most widely used for this purpose. diet, which is easily accepted, readily digested and absorbed The chemical safety of milk for various adulterants was (Kamthania et al., 2014). Due to its nutritive value, milk is determined by a number of analytical tests. The specific, recommended to all age groups including patients and conventional tests like FSSAI or legislation-described adolescents (Singuluri and Sukumaran, 2014). biochemical tests, and non-specified, commercially and India is the largest producer of milk in the world with institutionally developed kit tests for a particular adulterant are estimated production of 155.5 million tons during 2015-16 readily used for screening of suspected milk samples. It is (NDDB, 2017). Despite being the largest producer of milk in important to know the detection capability of these tests to the world, the illegal production of the synthetic milk has inform general public, food safety activists, researchers, emerged as one of the major problems to India’s dairy industry. industry and regulatory agencies. Keeping in view above points It has negative impact on the economy as dairy is a major and facts, the present study was undertaken to assess efficacy continuous income generating activity for the rural households of various biochemical methods, institutionally developed and (Manohar et al., 2013). In the context of WTO regime, export commercially available milk adulteration testing kits. avenues are open for the milk producers of our country. The sanitary and phytosanitary (SPS) agreement of the WTO Materials and Methods stipulates that the member countries must implement In total, five different qualitative analytical kits and methods necessary measures to ensure that the food products were evaluated. The conventional biochemical tests (A) produced are free from health risks (Hundal et al., 2013). It described by FSSAI (2015), two institutionally developed kits also forms a bridge between food protection and livelihood (B, C) and two commercial kits (D, E) used for screening of concerns (Kumar et al., 2018). This leads to concern especially milk adulteration in India were examined. Three lots of fresh in developing countries like India. It is one of the biggest raw milk (1 liter each) were collected directly from the authentic constraints that stand against the progress of dairying in the source i.e. milk free from adulterants were used for study. The country and the image of milk as healthy food has been kits or methods were investigated for following adulterants: considerably deteriorated due to its adulteration with harmful 1). Preservatives: Formaldehyde and hydrogen peroxide were chemicals (Sharma et al., 2012). tested by slight modification in earlier reported method (Silva The menace of adulteration has taken serious proportion et al., 2015). The raw milk was split into 13 (8 for formaldehyde as highlighted by many reports (FSSAI, 2012a and Gupta et al., and 5 for hydrogen peroxide), 50 ml aliquots, intended for the

#1Part of Ph. D. Thesis and Corresponding author: Assistant Professor, Department of Veterinary Public Health & Epidemiology, College of Veterinary Science and A. H., Mhow, Indore (India); 2Director, School of Public Health and Zoonoses, GADVASU, Ludhiana, Punjab (India); 3Director of Research, Guru Angad Dev Veterinary and Animal Sciences University, Ludhiana, Punjab (India); 4Associate Professor, School of Public Health and Zoonoses, GADVASU, Ludhiana, Punjab (India)

256 Veterinary Practitioner Vol. 20 No. 2 December 2019 experimental addition of preservatives to milk and remaining kits and tests, obtained for formaldehyde and hydrogen peroxide milk was used as a negative control. The formaldehyde (37%) preservatives were presented in Table 2. For formaldehyde used in this study was purchased from Merck, Germany and detection, the analytical sensitivity of the commercially available hydrogen peroxide (3%) was procured from Rankem, India. kits (D and E) was found equal and most highly sensitive among 2). Neutralizer: Sodium bi carbonate was tested by serial all studied methods. Minimum 0.0625 ppm of formaldehyde dilution method (Joshi et al., 2015). The batch of milk was split solution was detected immediately upon addition of test into 6, 50 ml aliquots, 5 intended for the experimental addition reagents, using these kits. The value obtained in present study of neutralizer to milk and one for the negative control. The was much lower than as compared to the value obtained in sodium bi carbonate (99.9%) used in this study was purchased investigation conducted by Silva et al. (2015) to be 50 ppm from Moly Chem, India. (0.005%) in Brazil. The result of present study was also lower 3). Diluting agent: The analytical sensitivity of nitrate test for than 60 ppm (0.006%) for a specific Hehner’s test as reported diluting agent (water) was also assessed by serial dilution by Vilasrao (2015) for formaldehyde detection in Anand, India. method. Each batch of milk was split into 10, 50 ml pieces, 9 The result of our study was comparable with values of intended for the experimental addition of potassium nitrate to Anonymous (2011) literature to be 0.05 ppm, which is provided milk and one for the negative control. The potassium nitrate with the Hi Media commercial adulteration testing of milk kit in (99%) used in this study was purchased from SD Fine India India. Ltd. Regarding hydrogen peroxide detection, 0.05% solution 4). Thickeners: The appraisal of various tests for thickening comparable to usual quantities used in fraud (Saha et al., agents was also assessed by serial dilution method. 2003) was not detected by any of tests and kits used. a. Urea: Milk sample was split into 6, 50 ml pieces, 5 intended Furthermore, minimum 0.1% of solution was detected for the experimental addition of urea to milk and one for the immediately upon addition using the conventional biochemical negative control. The urea (99.5%) used in this study was test (A) and one of commercially available kit (D). Therefore, purchased from Moly Chem, India. LOD values of these two methods were found equal and lowest b. Starch: Each batch of milk was split into 6, 75 ml pieces, 5 among all analysed tests. intended for the experimental addition of starch to milk and The result of present study was in line with the outcome one for the negative control. The starch used in this study obtained by Vilasrao (2015) in Anand, India to be 0.1% for a was purchased from Moly Chem, India. specific iodometery test. A higher LOD value than our study for c. Salt or sodium chloride: Each batch was split into 8, 60 ml hydrogen peroxide detection was reported by Sharma et al. specimens, 7 intended for the experimental addition of (2012) as 0.025% for a different para-phenylenediamine test sodium chloride to milk and one for the negative control. in Karnal, India. Variations in the analytical sensitivity of the test The sodium chloride (99.5%) used in this study was might be due to difference in concentration of preservative in purchased from Merck, Germany. the solution, alteration in purity of reagents, accuracy during d. Cane sugar: Each batch of milk was split into 6, 50 ml conduct of the test, ambient temperature during analysis, pieces, 5 intended for the experimental addition of sucrose changes in milk and used chemical compositions. to milk and one for the negative control. The sucrose used 2). Neutralizer: The limit of detection (LOD) values of various in this study was purchased from Moly Chem, India. kits and tests, obtained for neutralizer were also presented in e. Glucose: Milk sample was split into 8, 50 ml specimens, 7 Table 2. Among the various neutralizer detecting tests, LOD intended for the experimental addition of glucose to milk value of institutionally developed kit (B) was found lowest to be and one for the negative control. The glucose used in this 0.125%. The result obtained in present study was found lower study was purchased from Loba-chemie India. as compared to the value (0.2%) reported in literature (Sharma f. Skim milk powder: Each batch of milk collected was divided et al., 2012; FSSAI, 2015), while higher LOD (0.08%) was into 7, 50 ml portions, 6 intended for spiking of milk powder observed by Vilasrao (2015) for sodium bi carbonate detection to milk and one for the negative control. in Anand, India. The difference in analytical sensitivity found in 5). Non- dairy fat emulsifier and foaming agent: Assessment present study might be due to variation in amount of sodium, of detergent was also performed by serial dilution method. pH and composition of milk, difference in ambient temperature, Each batch of milk was split into 6, 50 ml aliquots, 5 intended purity of the chemicals or reagents and variation in colour for the experimental addition of detergent to milk and one for perception from person to person. the negative control. The detergent (80% Dodecyl benzene 3). Diluting agent: The limit of detection (LOD) values of various sulphonic acid sodium salt) used in this study was purchased kits and tests, obtained for diluting agent were also presented from Loba-chemie India. in Table 2. The LOD value of commercially available kit (D) was The ultimate final concentrations of all the chemical found to be 0.0039%, which was lowest among all the studied adulterants were presented in Table 1. These concentrations tests for pond water or nitrate detection. The result of present were selected based on the ones given in literature. The study was found higher than 0.002% as observed by Chaudhari prepared aliquots were analyzed for the presence of adulterants (2015) in Anand, India. The value of our investigation was found with conventional biochemical method and analytical kit’s tests. lower than 0.02%, as reported by Sharma et al. (2012) for a Three independent repetitions were performed; each batch specific diphenylamine test used in detection of nitrate salt in was analyzed in triplicate. Karnal, India. The difference in analytical sensitivity found in present study might be due to change in test protocol, Results and Discussion chemicals and reagents, milk composition, quality and purity 1). Preservatives: The limit of detection (LOD) values of various of the reagents and individual to individual variation in colour 257 Veterinary Practitioner Vol. 20 No. 2 December 2019 perception. of present study was found higher than that reported earlier by 4). Thickeners: The results of LOD values for thickeners were Sharma et al. (2012) to be 0.02% for a specific Iodine test in presented in Table 2. Among urea detecting tests, LOD value Karnal, India. Another study conducted by Chaudhari (2015) of conventional biochemical test (A) was found lowest to be also reported the same value (0.02%) for Iodine test in Anand, 0.25%. The result obtained in present study was comparable India. with earlier reports. An investigation was conducted by Amongst salt detecting tests, the analytical sensitivity of Chaudhari (2015) in Anand, India and observed analytical conventional biochemical test (A), institutionally developed kit sensitivity of DMAB test for urea detection to be 0.20%. Another (B) and commercially available kit (D) was found equal and study conducted by Sharma et al. (2012) also reported the highest to be 0.0312% of salt was detected immediately upon same value (0.20%) for DMAB test in Karnal, India. Hence, addition of test reagents, using these tests. The result obtained analytical sensitivity found in present study is almost in in present study was found lower as compared to the value accordance with that reported in literature. (0.04%) that observed by Chaudhari (2015) for a specific In between starch detecting tests, the analytical sensitivity potassium chromate test in Anand, India. While, the outcome of conventional biochemical test (A) and commercially available of our study was found higher than that reported earlier by kit (D) was found equal and highest to be 0.0625%. The result Sharma et al. (2012) to be 0.02% in Karnal, India. The literature

Table 1: Spiked concentrations of various chemical adulterants and detection kits, method used for analytical sensitivity experimentation

Chemical adulterant Spiked concentrations Detection kit or method analyzed Conventional biochemical method (A), Institutionally developed kit tests (B, C) Commercial kit tests (D, E) Preservatives Formaldehyde 0.0312, 0.0625, 0.125, 0.25, 0.5, 1, 2 A, D and E and 4 (ppm) Hydrogen peroxide 0.05, 0.1, 0.25, 0.5 and 1(%) A, B, C, D and E Neutralizer Sodium bi carbonate 0.0625, 0.125, 0.25, 0.5 and 1 (%) A, B, C, D and E Diluting agent; Potassium nitrate 0.00195, 0.0039, 0.0078, 0.0156, A, B and D Water 0.0312, 0.0625, 0.125, 0.25 and 0.5(%) Thickeners Urea 0.0625, 0.125, 0.25, 0.5 and 1 (%) A, B, C, D and E Starch 0.0312, 0.0625, 0.125, 0.25 and 0.5 A, B, C, D and E (%) Sodium chloride 0.0156, 0.0312, 0.0625, 0.125, 0.25, A, B, D and E 0.5 and 1(%) Sucrose 0.0625, 0.125, 0.25, 0.5 and 1(%) A, B, C, D and E Glucose 0.0156, 0.0312, 0.0625, 0.125, 0.25, A, B, D and E 0.5 and 1 (%) Skim milk powder 1, 2, 4, 6, 8 and 10 (%) A and D Non- dairy fat Dodecyl benzene 0.0625, 0.125, 0.25, 0.5 and 1 (%) A, D and E emulsifier and sulphonic acid sodium foaming agent; salt Detergent

Table 2: Limit of detection (LOD) values of different milk adulteration kits and tests Qualitative Institutionally Commercially available kit biochemical tests developed kit Chemical adulterant tests (Conventional) tests A B C D E Formaldehyde 0.125 ppm - - 0.0625 ppm 0.0625 ppm Hydrogen peroxide 0.1% 0.5% 0.25% 0.1% 0.5% Sodium bi carbonate 0.25% 0.125% 0.25% 1% 1% 0.0078% 0.0039% Pond water or nitrate 0.0312% - - (78 ppm) (39 ppm) Urea 0.25% 0.5% 1% 0.5% 0.5% Starch 0.0625% 0.125% 0.5% 0.0625% 0.25% Salt 0.0312% 0.0312% - 0.0312% 0.25% Cane sugar 0.125% 0.125% 0.125% 0.5% 0.125% Glucose 0.25% 0.125% - 0.125% 0.25% Skim milk powder 2.0% - - 2.0% - Dodecyl benzene sulphonic 0.25% - - 0.25% 0.5% acid sodium salt

258 Veterinary Practitioner Vol. 20 No. 2 December 2019 of FSSAI (2012b) also reported the same LOD value (0.02%) References for a specific potassium chromate test. Anonymous (2011) Adulteration testing of milk. Instruction manual For cane sugar detecting tests, the analytical sensitivity of (Literature code TL213 A&B_03). Hi Media Laboratories, all methods (A, B, C, and E) except commercially available kit Mumbai- 400086 (India), pp 01-07. (D) method was found equal and highest to be 0.125%. The Chaudhari PR (2015) Evaluation of qualitative tests used for detection of adulterants in milk. M.Tech. Thesis, submitted to Anand result of present investigation was found almost in line with Agricultural University, Anand (Gujarat). earlier study conducted by Chaudhari (2015) as 0.1% for a FAO (2013) Manuals of food quality control - 8. Food analysis: quality, specific resorcinol test in Anand, India. A higher value than our adulteration and tests of identity. Food and Agriculture study was reported by Sharma et al. (2012) to be 0.2 % in Organization of the United Nations. Vialedelle Terme di Karnal, India. Caracalla, 00153 Rome, Italy. The variation of analytical sensitivity of different tests in FSSAI (2012a) Executive summary on national survey on milk present study may be attributed to difference in purity of adulteration, Prevention of food adulteration cases (FAC) chemicals and reagents used, milk composition and variation including Food Safety & Standard act, rules, regulations cases 1972 to 2012 (2) (80 bound volumes). in judgment of color perception from person to person. FSSAI (2012b) Manual of methods of analysis of foods (milk and milk Among all the investigated tests for glucose detection, products) – A Laboratory Manual. Food safety and standards LOD values of institutionally developed kit (B) and commercially authority of India, Ministry of health and family welfare, available kit (D) were found equal and lowest to be 0.125%. Government of India, New Delhi. The results of present investigation are comparable with earlier FSSAI (2015) Manual of methods of analysis of foods (milk and milk reports. A study was conducted by Chaudhari (2015) for products) - Laboratory Manual 1. Food safety and standards evaluation of sensitivity of various qualitative tests used for authority of India, Ministry of health and family welfare, detection of milk adulterants in Anand, India and observed Government of India, New Delhi. Gupta VK, Shukla S, Singh RV and Gupta P (2013) Assessment of milk LOD of Barfoed’s test for glucose detection as 0.1%. Another food safety status: common milk adulterants in rural and study conducted by Sharma et al. (2012) also reported the urban areas of Indian Malwa plateau and their public health same value (0.1%) for Barfoed’s test in Karnal, India. The significance. Vet. Pract. 14(2): 536-539 (Supple 1). literature of FSSAI 2012 also reported the same LOD value Hundal JS, Chandrahas Kaur K, Singh J and Verma HK (2013) Clean (0.1%) for Barfoed’s test. Hence, LOD value found in present milk production awareness among women dairy farmers of study was almost similar to that reported in literature. Punjab. Vet. Pract. 14 (2): 394-397. In between skim milk powder detecting tests, the analytical Joshi AM, Sharath Chandra SM and Agrawal N (2015) Comparison of sensitivity of both the investigated tests (A and D) was found antimicrobial activity of Mupirocin and Chlorhexidine against Enterococcus faecalis using agar diffusion test. Int. J. equal to be 2.0% The result obtained in our study was in line Applied Dental Sci. 1(4): 101-103. with value of Anonymous (2011) literature to be 2.0%, which is Kamthania M, Saxena J, Saxena K and Sharma DK (2014) Milk provided with the Hi Media commercial adulteration testing of adulteration: Methods of detection and remedial measures. milk kit in India. No other LOD values for skim milk powder Int. J. Engineering and Technical Res. 1: 15-20. detection are observed in literature review. Kumar V, Aulakh RS, Gill JPS, Bedi JS and Kashyap N (2018). Risk 5). Non- dairy fat emulsifier and foaming agent: The limit of based analysis of microbial safety of milk from traditional detection (LOD) values of various kits and tests, obtained for dairy markets in Punjab (India). Vet. Pract. 19 (1): 115-116. detergent were also presented in Table 2. Among the various Manohar DS, Bais B, Kachhwah RN, Choudhary VK and Goswami SC (2013) Study on milking management practices of buffaloes detergent detecting tests, the LOD values of conventional in relationship with selected traits of respondents in Jaipur biochemical test (A) and commercially available kit (D) were district of Rajasthan. Vet. Pract. 14 (2): 335-337. found lowest to be 0.25%. The results of present investigation NDDB (2017) Milk production in India. National Dairy Development are found higher sensitive than study conducted by Chaudhari Board, assessed from http://www.nddb.org/information/ (2015), who observed LOD of bromocresol purple test for stats/milkprodindia (12-08-2017). detergent detection to be 2.0%. A lower value than our study Saha, BK, Ali MY, Chakraborty M, Islam Z and Hira AK (2003) Study on the preservation of raw milk with hydrogen peroxide (H O ) was reported by Sharma et al. (2012) to be 0.0125% for a 2 2 qualitative test of detergent detection in Karnal, India. The for rural dairy farmers. Pakistan J. Nutr. 1 (2): 36-42. Sharma R, Rajput YS, Barui AK and Laxmana NN (2012) Detection of difference in analytical sensitivity found in present study might Adulterants in Milk - A Laboratory Manual, I Edn. NDRI be due to change in test reagent and protocol, variation in Publication, Karnal. HR. concentration of active ingredient in detergent salt, difference Silva LCCD, Tamanini R, Pereira JR, Rios EA, Junior JCR and Beloti V in pH, composition of milk, purity of the chemicals or reagents (2015) Preservatives and neutralizing substances in milk: used and variation in color perception from individual to analytical sensitivity of official specific and nonspecific tests, individual. microbial inhibition effect, and residue persistence in milk. Ciência Rural, Santa Maria. 45 (9): 1613-1618. Acknowledgement(s) Singuluri H and Sukumaran MK (2014) Milk adulteration in Hyderabad, The authors are grateful to Dean, Post graduate studies, India -A comparative study on the levels of different GADVASU, Ludhiana for the facility provided. We also adulterants present in milk. J. Chromatography & Separation acknowledged the enormous help acquired from the research Technique. 5: 212. Vilasrao KP (2015) Evaluation of qualitative tests used for detection of scholars whose articles are mentioned and covered in this preservatives in milk. M. Tech. Thesis, submitted to Anand manuscript. Agricultural University, Anand (Gujarat).

259 Veterinary Practitioner Vol. 20 No. 2 December 2019

STUDY OF THERAPEUTIC POTENTIAL OF AQUEOUS AND ETHANOLIC EXTRACTS OF PIPER NIGRUM IN SUBCLINICAL MASTITIS IN CATTLE#

Sumnil Marwaha1, A. P. Singh, J.P. Kachhawa, A. Gaur2, Pratishta Sharma3 and Anju Chahar4 Department of Clinical Veterinary Medicine, Ethics and Jurisprudence, College of Veterinary and Animal Science Rajasthan University of Veterinary and Animal Sciences, Bikaner-334 001, Rajasthan, India

Received revised on: 25.03.2019 ABSTARCT Accepted on: 19.08.2019

The aim of present investigation was to evaluate the therapeutic potential of aqueous and ethanolic extracts of Piper nigrum in subclinical mastitis in cattle. In present study, 12 subclinical mastitis affected cows were grouped in 2 groups of six cows each viz., group I cows were administered with aqueous extract of Piper nigrum @ 200 mg/kg body weight daily for 7 days and group II cows were administered orally daily with alcoholic extract of Piper nigrum @ 200 mg/kg body weight for 7 days. Pre- treatment and post- treatment milk samples were analyzed for various tests. In group I, there was significant decrease in somatic cell count, pH and electrical conductivity between the pre-treatment and post-treatment samples. There was no significant change in fat per cent and protein per cent but the lactose per cent and SNF per cent were significantly increased. In group II, there was significant decrease in somatic cell count, pH and electrical conductivity between the pre-treatment and post-treatment samples. There was no significant change in fat per cent but the protein per cent, lactose per cent and SNF per cent were significantly increased. The bacteriological cure rate for group I and group II were 50 % and 60 %, respectively.

Key words: Subclinical mastitis, Piper nigrum, aqueous and ethanolic extracts, cattle

Introduction pH Sub-clinical mastitis is important disease affecting dairy pH of milk was determined immediately using single industry. The main cause of sub-clinical mastitis is bacteria. electrode Pen type digital pH meter [PH-035 (ATC) of ERMA The inadvertent use of antibiotics are causing problem of Instruments]. antimicrobial resistance. Medicinal plants (herbs) constitute a major source of alternative medicine and are used to treat Electrical conductivity diseases of man and animal since ancient times. Black pepper Electrical conductivity of milk samples was measured by (Piper nigrum) is one such plant that has wide therapeutic Pen type EC-035 (ATC) Conductivity meter of ERMA effects. Black pepper has antimicrobial activities, antioxidant instruments. and radical scavenging properties (Gulcin, 2005; Singh and Changes in milk composition Duggal, 2009 and Warda et al., 2007). It has also analgesic Composition of milk sample was determined by ultrasonic and anti-inflammatory properties (Tasleem et al., 2014). Many milk analyzer Classic LM2 (Milkotester Ltd., Bulgaria). physiological effects of black pepper, its extracts, or its major active principle, piperine, have been reported in recent decades Bacterial isolation and identification (Srinivasan, 2007). Its use has been reported in various The milk samples collected aseptically were shaken ethenoveterinary practices for curing subclinical mastitis (Nag thoroughly. With the help inoculation loop sample was streaked et al., 2007 and Bilal et al., 2009). The in vitro study conducted on 5 % sheep blood agar and nutrient agar plate. These petri by Okmen et al. (2017) showed that the extracts of Piper nigrum dishes were incubated for 24 hours at 37oC. Bacterial colonies have significant antioxidant activity and antibacterial activity were sub-cultured separately for obtaining the pure culture of against the mastitis causing organism. The aim of the present the bacterial isolates. The pure bacterial isolates were study was to evaluate the therapeutic potential of Piper nigrum transferred on the nutrient agar slants which were kept in extracts in subclinical mastitis in cattle. refrigerator at 4°C until subjected to further characterization. Stored pure isolates from slants were streaked on 5% Material and Methods sheep blood agar and incubated at 37°C for 24 h. These freshly Animals cultured isolates were analyzed by Vitek MS (Biomérieux) as For therapeutic trial, 12 subclinical mastitis affected cows per Dubois et al. (2012). were selected positive for subclinical mastitis by CMT, bacterial culture and had somatic cell count above 0.5 million cells/ml, Soxhlet extraction electrical conductivity above 6.00 mS/cm. Soxhlet extraction is done as per Redfern et al. (2014). Piper nigrum was finely ground to the powder form and 200 g Somatic cell count of ground powder was filled in thimbles made from filter paper. The somatic cell count of milk samples was performed These thimbles were then placed in extraction chamber. About as described by Schalm et al. (1971). However, for staining of 2 liters of extracting solvent was filled in bottom flask. For milk smear, Giemsa stain was used (Chahar, 2001 and Bhati preparation of aqueous extract distilled water was used as and Kataria, 2016). #1Part of M.V.Sc. Thesis of first author and corresponding email: [email protected];2Assistant Professor, Centre for Ethno-veterinary Practices and Alternative Medicines; 3Assistant Professor, Dept. of Vet. Pharmacology and Toxicology; 4Professor, Dept. of Vet. Preventive Medicine 260 Veterinary Practitioner Vol. 20 No. 2 December 2019 extracting solvent while for preparation of ethanolic extract There was no significant change in fat per cent and protein 99.9% ethanol was used as extracting solvent. For extraction 8 per cent. There was significant increase in post-treatment reflux cycles were performed for one batch of 200 g of Piper values of lactose per cent and solid not fat (SNF) per cent as nigrum and total of 2 batches of 200 g Piper nigrum were compared to pre- treatment value but the post-treatment values extracted per 2 L of solvent. are still significantly lower than that of the control group. After the Soxhlet extraction, prepared crude extract was The possible reason of significant increase in lactose evaporated under reduced pressure by rotatory evaporator and SNF values, during present study might be the effect of (Heidolph-insturments, Rotavapor, Germany) so that all the aqueous extract treatment on secretory tissues of mammary solvent was nearly evaporated. The concentrated extract thus glands and its ability to reduce the infection which is vividly obtained was left overnight at room temperature to evaporate shown by the significant decrease in somatic cell count and any residual solvent. Finally, extract of a thick paste consistency bacteriological cure rate of 50%. Moreover, aqueous extract of was obtained which was stored in air-tight container at 4°C in Piper nigrum have polyphenol and flavanone (Reddy and refrigerator. Seetharam, 2009). These polyphenols and flavanones might be responsible for improvement in lactose per cent and SNF Therapeutic trial per cent (Mohanty et al., 2014). In group I, cows were administered daily with aqueous extract of Piper nigrum @ 200 mg/kg b. wt. for 7 days. In group Group II II, cows were administered orally daily with alcoholic extract of Values for all the three parameters viz., somatic cell count, Piper nigrum @ 200 mg/kg b. wt. for 7 days. To determine the electrical conductivity and pH were significantly (p<0.05) lower therapeutic efficacy of extracts of Piper nigrum milk samples of than pre-treatment values but still it were significantly higher affected quarters were collected on day 0 as pre-treatment than the pH of the control group (Table 3). After treatment 60% and on the 8th day as post-treatment to record the changes in of the quarters become negative for CMT. In pre-treatment California mastitis test (CMT), somatic cell count, electrical sampling, 10 quarters were found to be positive for conductivity (EC), milk pH and bacterial culture. bacteriological examination while after treatment 6 quarters become negative for bacterial culture. Thus the bacterial cure Results and Discussion rate was 60%. Group I (aqueous extract) Somatic cell count increase in response to infection and Values for all the three parameters viz., somatic cell count, indicates inflammatory reaction of the mammary gland (Kolte electrical conductivity and pH were significantly (p<0.05) lower et al., 2008). Due to antibacterial, anti-inflammatory and than pre-treatment values but still it were significantly higher immune-enhancing properties of the extract infection and than the pH of the control group (Table 1). In pre-treatment inflammation (Butt et al., 2013) subsides resulting in the sampling, 8 quarters were found to be positive for CMT while decrease in somatic cell count. The decrease in pH and after treatment 4 quarters become negative for CMT. In pre- electrical conductivity observed may be also due to anti- treatment sampling, 8 quarters were found to be positive for inflammatory effects of the extract. There are many in vivo bacteriological examination while after treatment only 4 studies that reported therapeutic efficacy of the alcoholic extract quarters showed bacterial growth on culture. Thus the bacterial of Piper nigrum as anti-inflammatory, antibacterial agent. Zhai cure rate was 50%. et al. (2016) reported that piperine showed the significant anti- The aqueous extract of Piper nigrum possess potent inflammatory effect in Staphylococcus aureus endometritis in immunomodulatory activity (Majdalawieh and Carr, 2010; Maha mice by significantly inhibiting the Staphylococcus aureus- et al., 2010; Vaidya and Rathod, 2014 and Abbas, 2016). induced excessive secretion of pro-inflammatory factors (TNF- Secondary metabolites of Piper nigrum possess antibacterial, α, IL-1β, and IL-6) and increasing the secretion of an anti- anti-inflammatory, antioxidant and immune-enhancing inflammatory factor (IL-10). Piperine is the main therapeutically properties (Butt et al., 2013). Flavonoids and phenolic active constituent of ethanolic extract of Piper nigrum. Mahto compound present in aqueous extract of Piper nigrum are (2014) found that ethanolic extract of Piper longum acts as an responsible for its antioxidant activity (Gülçin, 2005 and effective anti-inflammatory and antibacterial agent in Damanhouri, 2014). The antioxidant activity of Piper nigrum Streptococcus agalactiae induced mastitis model in mice which may be responsible for the decrease in somatic cell count. is similar to that of bovine mastitis. Piper nigrum and Piper The positive correlation between somatic cell count and longum both belong to family Piperaceae and have almost superoxide dismutase (SOD) level indicating the oxidative similar phytoconstituents in their alcoholic extracts stress in subclinical mastitis (Hayajneh, 2014). The extract of (Hamrapurkar et al., 2011). Piper nigrum showed effective scavenger activity for hydrogen There was no significant change in fat per cent. Similar peroxide, peroxide and superoxide (Gülçin, 2005). The results were also reported by Gupta (2010) and Shafi et al. polyphenolic compounds, tannins and alkaloid present in (2016) who reported improvement in somatic cell count in aqueous extract contributes to its antibacterial properties subclinical mastitis cases by herbal treatment but changes (Reddy and Seetharam, 2009 and Malvankar and Abhyankar, in fat per cent were non- significant. There was significant 2012). Antibacterial activity against common pathogens increase in post-treatment values of lactose per cent, protein associated with mastitis viz. Staphylococcus spp, per cent and solid not fat (SNF) per cent as compared to pre- Streptococcus spp. , E. coli, Bacillus spp. have been reported treatment value but the post-treatment values are still (Parekh et al., 2006; Reddy and Seetharam, 2009 and Zaki et significantly lower than that of the control group. The al., 2015). improvement in protein per cent, lactose per cent and SNF per

261 Veterinary Practitioner Vol. 20 No. 2 December 2019

Table 1: Changes in pre-treatment and post-treatment parameters in Table 3: Changes in pre-treatment and post-treatment parameters group I in group II

Group I Group II Parameter Control Pre- Post- Parameter Control Pre- Post- treatment treatment treatment treatment a b c Somatic cell count 0.33a 1.03b 0.80c Somatic cell count 0.33 1.15 0.57 (million /ml) ±0.014 ±0.101 ±0.162 (million /ml) ±0.014 ±0.128 ±0.007 6.57a 6.91 b 6.68c pH 6.57a 6.90b 6.71c ±0.018 ±0.038 ±0.036 pH a b c ±0.018 ±0.080 ±0.047 Electrical conductivity 5.28 6.66 5.86 (mS/cm) ±0.044 ±0.072 ±0.080 Electrical conductivity 5.28a 6.64b 6.00c Number of CMT positive 0 10 4 (mS/cm) ±0.044 ±0.072 ±0.160 quarters Number of CMT Number of bacteriological 0 8 4 0 10 4 positive quarters positive quarter Number of bacteriological positive 0 8 4 Values bearing different superscript for individual parameter quarter across row differ significantly (p<0.05). Values bearing different superscript for individual parameter across row differ significantly (p<0.05). Table 2: Pre-treatment and post-treatment mean±SE values of Table 4: Pre-treatment and post-treatment mean±SE values of milk quality parameters in group I milk quality parameters in group II Control Group II Group I Parameter Control Parameter Pre- Post- Pre- Post- treatment treatment treatment treatment a b b 4.53a 3.36b 3.86b Fat % 4.53 3.33 3.87 Fat % ±0.164 ±0.134 ±0.066 ±0.164 ±0.134 ±0.122 3.61a 3.06b 3.29b Protein % 3.61a 3.01c 3.33b Protein % ±0.047 ±0.096 ±0.099 ±0.047 ±0.081 ±0.099 5.13a 4.68c 4.84b Lactose % 5.13a 4.65c 4.86b Lactose % ±0.041 ±0.059 ±0.053 ±0.041 ±0.052 ±0.050 9.34a 8.26c 8.77b SNF % 9.34a 8.39c 8.86b SNF % ±0.074 ±0.154 ±0.135 ±0.074 ±0.116 ±0.074 Values bearing different superscript for individual parameter Values bearing different superscript for individual parameter across row differ significantly (p<0.05). across row differ significantly (p<0.05). cent might be due to the reduction in infection and inflammation Damanhouri ZA (2014) A Review on Therapeutic Potential of Piper of secretory tissue leading to the improved synthetic and nigrum L. (Black Pepper): The King of Spices. Med. Aromatic secretory activity of gland cells. There was a decrease in Plants. 3(3): 1-6. somatic cell count in post-treatment samples of this group; Dubois D, Grare M, Prere MF, Segonds C, Marty N and Oswald E (2012) Performances of the Vitek MS matrix-assisted laser and a negative correlation exists between somatic cell count desorption ionization-time of flight mass spectrometry and protein per cent of milk (Ouedraogo et al., 2008). system for rapid identification of bacteria in routine clinical Polyphenols and flavanones improve fat per cent, lactose per microbiology. J. Cli. Microbiol. 50(8): 2568-2576. cent and protein per cent in milk (Mohanty et al., 2014) and Gülçin I (2005) The antioxidant and radical scavenging activities of Piper nigrum extracts have a high content of polyphenol and black pepper (Piper nigrum) seeds. Int. J. Food Sci. Nut. flavanone (Gülçin, 2005 and Kumar et al., 2014). So, there 56(7): 491-499. was improvement in all the milk quality parameters. Gupta DK (2010) Evaluation of immunotherapeutic and antioxidative effects of some herbs in bovine subclinical mastitis. Ph.D. References Thesis submitted to G.B. Pant University of Agriculture and Abbas WH (2016) Immunomodulatory effect of aqueous extract of Technology, Pantnagar, Uttarakhand. Piper Nigrum L. in mice model. Int. J. Sci. Technol. 143 Hamrapurkar PD, Jadhav K, Kundnani PKM and Zine S (2011) (3077): 1-5. Quantitative estimation of Piperine in Piper nigrum and Piper Bhati T and Kataria AK (2016) A comparative study of somatic cell longum using high performance thin layer chromatography. counts in milk from cross-bred and rathi cattle with subclinical J. Appl. Pharmaceutical Sci. 1: 117-120. mastitis. Int. Educ. Scientific Res. J. 2: 30-31. Hayajneh FMF (2014) Antioxidants in dairy cattle health and disease. Bilal M, Muhammad G, Atif F and Hussain I (2009) Ethno-veterinary Bull. of Univ. of Agr. Sci. Vet. Med. Cluj-Napoca. 71: 104- practices of buffalo owners regarding mastitis in Faisalabad. 109. Int. J. Agr. Appl. Sci. 1 (2): 93-96. Kolte AY, Waghmare SP, Mode SG and Handa A (2008) Efficacy of Butt MS, Pasha I, Sultan MT, Randhawa MA, Saeed F and Ahmed W indigenous herbal preparation on altered milk pH, somatic (2013) Black Pepper and Health Claims: A Comprehensive cell count and electrolyte profile in subclinical mastitis in Treatise. Critical Rev. in Food Sci. Nut. 53(9): 875-886. cows. Vet. World. 1(8): 239-240. Chahar A (2001). Studies on some epidemiological and diagnostic Kumar SP, Rahul B, Sumit V and Rashmi A (2014) Phytochemical aspects of bovine subclinical and clinical mastitis. PhD. Thesis investigation of ethanolic extract of Piper nigrum, Zingiber submitted to Rajasthan Agricultural University, Bikaner, officinale, and Allium sativum and spectrophotometric Rajasthan. detection of piperine, gingerol, and allicin. Int. Res. J.

262 Veterinary Practitioner Vol. 20 No. 2 December 2019

Pharmacy. 5(11): 814-816. Redfern J, Kinninmonth M, Burdass D and Verran J (2014) Using Maha F, Zaid K and Hadeel W (2010) Immunological evaluation and soxhlet ethanol extraction to produce and test plant material acute toxicity study with fertility examination for the effect (essential oils) for their antimicrobial properties. J. Microbiol. of aqueous extract from dried fruits of Piper nigrum in Biology Edu. 15(1): 45-46. mice. Iraq J. Sci. 51(3): 465-470. Schalm OW, Carrol JE and Jain NC (1971) Bovine Mastitis. 1st ed. Lea Mahto RP (2014) Collection, documentation and validation of some and Febiger, Philadelphia, USA., pp. 98-101. ethnic biodynamic agents used by the tribal communities of Shafi TA, Bansal BK, Gupta DK and Nayyar S (2016) Evaluation of West Singhbhum District of Jharkhand against bovine immunotherapeutic potential of Ocimum sanctum in bovine mastitis. Ph.D. Thesis submitted to Indian Veterinary subclinical mastitis. Turkish J.Vet. and Anim. Sci. 40: 352- Research Institute, Izatnagar, Uttar Pradesh. 358. Majdalawieh AF and Carr RI (2010) In vitro investigation of the potential Singh A and Duggal S (2009) Piperine-review of advances in immunomodulatory and anti-cancer activities of Black Pepper pharmacology. Int. J. Pharmaceutical Sci. Nanotechnol. 2: (Piper nigrum) and Cardamom (Elettaria cardamomum). J. 615-620. Med. Food. 13(2): 371-381. Srinivasan K (2007) Black pepper and its pungent principle-piperine: a Malvankar PR and Abhyankar MM (2012) Antimicrobial activity of review of diverse physiological effects. Critical Reviews in water extracts of Trikatu churna and its individual ingredient. Food Sci. Nutr. 47(8): 735-748. Int. J. Pharmaceutical Sci. Res. 3(4): 1087-1089. Tasleem F, Azhar I, Ali SN, Perveen S and Mahmood ZA (2014) Analgesic Mohanty I, Senapati MR, Jena D and Behera PC (2014) Ethnoveterinary and anti-inflammatory activities of Piper nigrum. Asian importance of herbal galactogogues - a review. Vet. World. Pacific J. Trop. Med. 7: 461-468. 7(5): 325-330. Vaidya A and Rathod M (2014) An in vitro study of the immunomodulatory Nag A, Galav P and Katewa S (2007) Indigenous animal healthcare effects of Piper nigrum (black pepper) and Elettaria practices from Udaipur district, Rajasthan. Indian J. cardamomum (cardamom) extracts using a murine Traditional Knowledge. 6(4): 583-588. macrophage cell line. Am. Int. J. Res. in Formal, Applied Okmen G, Vurkun M, Arslan A and Ceylan O (2017) The Antibacterial and Nat. Sci. 8(1): 18-27 activities of Piper nigrum L. against mastitis pathogens and Warda S, Gadir A, Mohamed F and Bakhiet AO (2007) Antibacterial its antioxidant activities. Indian J. Pharmaceutical Edu. Res. activity of Tamarindus indica fruit and Piper nigrum seed. 51(3): Suppl: S170-S175. Res. J. Microbiol. 2: 824-830. Ouedraogo GA, Millogo V, Anago-Sidibe AG and Kanwe BA (2008) Zaki NH, Al-oqaili RMS and Tahreer H (2015) Antibacterial effect of Relationship between somatic cell counts, dairy cattle milk ginger and black pepper extracts (alone and in combination) yield and composition in Burkina Faso. African J. Biochem. with sesame oil. World J. Pharmacy and Pharmaceut. Sci. Res. 2 (2): 56-60. 4(3): 774.784. Parekh J and Chanda S (2007) Antibacterial and phytochemical studies Zhai WJ, Zhang ZB, Xu NN, Guo YF, Qiu C, Li CY, Deng GZ and Guo on twelve species of Indian medicinal plants. African J. MY (2016) Piperine plays an anti-inflammatory role in Biomed. Res. 10: 175-181. staphylococcus aureus endometritis by inhibiting activation Reddy BU and Seetharam YN (2009) Antimicrobial and analgesic of nf-kb and mapk pathways in mice. Evidence-Based activities of trikatu churna and its ingredients. Complement. Alternative Med. 8(5): 208-218. Pharmacologyonline. 3: 489-495.

263 Veterinary Practitioner Vol. 20 No. 2 December 2019

EFFECT OF SUPPLEMENTATION OF TINOSPORA CORDIFOLIA (AT GRADED LEVELS) AND ASCORBIC ACID EITHER ALONE OR IN COMBINATIONS ON HAEMOGLOBIN AND ERYTHROGRAM OF BROILER CHICKENS#

D. Jain1, R.K. Dhuria, T. Sharma, T. Bothra2 and Mangesh Kumar3 Department of Animal Nutrition, College of Veterinary and Animal Science Rajasthan University of Veterinary and Animal Nutrition, Bikaner- 334 001, Rajasthan, India

Received on 23.10.2019 ABSTRACT Accepted on 28.11.2019

The present study was carried out to investigate the effect of Tinospora cordifolia (at graded levels) or ascorbic acid alone and in combinations on haemoglobin, PCV and TEC using 360 one day old broiler chicks in 5×2 factorial experiment within a completely

randomized design and divided into ten dietary treatments groups (T1-T10) in triplicate of 12 chicks per replicate. Diets included: T1-basal diet with no supplementation; T2-basal diet supplemented with 0.25% Tinospora cordifolia; T3-basal diet supplemented with 0.50% Tinospora cordifolia; T4-basal diet supplemented with 0.75% Tinospora cordifolia; T5-basal diet supplemented with 1.0% Tinospora cordifolia; T6-basal diet supplemented with 0.025% ascorbic acid; T7-basal diet supplemented with 0.25% Tinospora cordifolia plus 0.025% ascorbic acid; T8-basal diet supplemented with 0.50% Tinospora cordifolia plus 0.025% ascorbic acid; T9-basal diet supple- mented with 0.75% Tinospora cordifolia plus 0.025% ascorbic acid and T10-basal diet supplemented with 1.0% Tinospora cordifolia plus 0.025% ascorbic acid. A 42 days feeding trial was carried out from Sep. 13, 2016 to Oct. 24, 2016 at the Experimental Poultry Unit, located in poultry farm of College of Veterinary and Animal Science, Bikaner. The average temperature (31oC) during the study period was higher than the recommended normothermia zone i.e. 18-24°C established for poultry, which indicated that birds were in chronic heat stress. Chronic heat stress in present study influenced significant (P<0.01) decrease in haemoglobin, PCV and TEC in control group as compared to various treatment groups. Improvement in haematological parameters of broilers was observed due to supplementation of ascorbic acid or Tinospora cordifolia (Geloi) alone and in combinations. Supplementation of ascorbic acid or Tinospora cordifolia (Geloi) may be of profound effect on haemopoetic system of fast growing broilers during chronic heat stress.

Key words: Ascorbic acid, haemoglobin, PCV, TEC and Tinospora cordifolia

Introduction (T1-T10) and each dietary group was replicated to three sub-

Global warming as a result of environmental degradation groups (R1-R3) to make sure uniformly in various treatment and increased industrialization has led to continuous increase groups. Diets included: T1-basal diet with no supplementation; in ambient temperature thereby making heat stress a major T2-basal diet supplemented with 0.25% Tinospora cordifolia; problem of the poultry sector (Daghir, 2009). Chronic heat stress T3-basal diet supplemented with 0.50% Tinospora cordifolia; may alters many physiological parameters in livestock T4-basal diet supplemented with 0.75% Tinospora cordifolia;

(Adenkola et al., 2009), which, resulting in alteration in body T5-basal diet supplemented with 1.0% Tinospora cordifolia; homeostasis. Nowadays, rapid growth rate is desirable in T6-basal diet supplemented with 0.025% ascorbic acid; T7- chicken with little attention to the effects on haemopoetic system basal diet supplemented with 0.25% Tinospora cordifolia plus of fast growing broilers. Ascorbic acid is a powerful antioxidant, 0.025% ascorbic acid; T8-basal diet supplemented with 0.50% which helps to protect cells from oxidative damage during stress Tinospora cordifolia plus 0.025% ascorbic acid; T9-basal diet conditions. Tinospora cordifolia (Menispermaceae) commonly supplemented with 0.75% Tinospora cordifolia plus 0.025% known as ‘Geloi’, a Hindu mythological term refers to the ascorbic acid and T10-basal diet supplemented with 1.0% heavenly elixir and has ability to scavenge free radicals. Tinospora cordifolia plus 0.025% ascorbic acid. Good quality Adequate and appropriate nutritional strategy is required for of geloi (Tinospora cordifolia) stem was procured from reputed optimal broiler production in the hot season, which can reduce firm of Bikaner (Rajasthan). Thereafter, it was identified and the negative effects of heat stress to the minimum. Therefore, authenticated by the Department of Botany, Govt. Dungar the present trial was planned to observe the effect of Tinospora College, Bikaner (Rajasthan). The commercially available cordifolia (at graded levels) or ascorbic acid supplementation ascorbic acid (99.99% pure), was used. The broiler starter alone and in combinations on haemoglobin, PCV and TEC of and finisher feed contained 21.37% and 20.32% crude protein, broiler chickens during chronic heat stress. respectively. Broilers were maintained under standard managemental practices regarding brooding, feeding, Materials and Methods watering and disease control throughout the trial period. A 42 days feeding trial was carried out from Sep. 13, 2016 Blood was collected at 42nd day from 2 birds per replicate to Oct. 24, 2016 at the Experimental Poultry Unit, located in (6 birds/treatment) at the end of experiment for the estimation poultry farm of College of Veterinary and Animal Science, of different haematological parameters. Blood was collected Bikaner. The 360 experimental day old broiler chicks were in vacutainer tubes containing ethylenediamine tetra acetic equally and randomly divided into ten dietary treatments groups acid (EDTA) for estimation of blood haemoglobin and

1#Part of Ph.D. Thesis and corresponding author email: [email protected]; 2Asst. Prof. Dept. of Livestock Production Management. Cell 9413300048; 3Ph.D Scholar 264 Veterinary Practitioner Vol. 20 No. 2 December 2019 erythrogram. Haematological studies were performed soon significant over 0% Geloi supplemented group. With respect after collection of blood. Haemoglobin and PCV were to effect of ascorbic acid supplementation, an increase in PCV determined by Sahli-Hellige Haemoglobinometer and Micro- (%) was observed in ascorbic acid supplemented group. The Haematocrit method, respectively. Total erythrocyte count (TEC) overall mean values of TEC (106/cumm) were found to be 2.57, was carried out manually through haemocyometer as per 3.15, 3.19, 3.14, 3.14, 3.10, 3.34, 3.28, 3.25 and 3.23 in T1 standard method of Benjamin (1978). The data obtained in (Control), T2, T3, T4, T5, T6, T7, T8, T9 and T10 treatment groups, the experiment were analyzed statistically for main effect of respectively. Regarding effect of Tinospora cordifolia (Geloi) Tinospora cordifolia or ascorbic acid alone as well as supplementation, the mean values were recorded to be 2.84, interaction (Geloi x Ascorbic acid) in factorial design (5*2) as 3.25, 3.23, 3.20 and 3.18 (106/cumm) in 0%, 0.25%, 0.50%, per Snedecor and Cochran (2004) and significance of mean 0.75% and 1% geloi supplementation, respectively. With differences was tested by Duncan’s New Multiple Range Test respect to effect of ascorbic acid supplementation, the mean (DNMRT) as modified by Kramer (1957). values were recorded to be 3.04 (10 6/cumm) in non- supplemented group and 3.24 (106/cumm) in ascorbic acid Results and Discussion supplemented group. Due to interaction, highest TEC value The calculated Thermal Humidity Index (THI) for different 6 (3.34x10 /cumm) was observed in group T7 containing 0.25% weeks was obtained to be in range from 75.26 to 82.06; a geloi with ascorbic acid, which was though comparable with value above the THI threshold of 70, established for poultry T , T , T and T groups, but significant over rest of the groups. o 3 8 9 10 (Bouraoui et al., 2002). The average temperature (31 C) during With respect to Tinospora cordifolia (Geloi) supplementation, the research trial was higher than the recommended the highest TEC value (3.25x106/cumm) was observed in normothermia zone i.e. 18-24°C (Holik, 2009) established for treatment supplemented with 0.25% Geloi, which was poultry in the tropical regions, which indicated that birds were comparable with 0.50%, 0.75% and 1% Geloi supplemented in chronic heat stress. The data of haemoglobin and groups, but significant over 0% Geloi supplemented group. erythrogram recorded in various treatment groups have been With respect to effect of ascorbic acid supplementation, an presented in Table 1 as well as Fig. 1. The overall mean values increase in TEC values (106/cumm) was revealed by statistical of Hb (g/dl) were found to be 7.75, 8.23, 8.27, 8.20, 8.15, 8.22, analysis. 8.52, 8.45, 8.42 and 8.42 in T (Control), T T , T , T , T , T , T , 1 2, 3 4 5 6 7 8 The Hb and PCV values were observed in the normal T and T treatment groups, respectively. Regarding effect of 9 10 physiological range of 7-13 g/dl and 25-45%, respectively Tinospora cordifolia (Geloi) supplementation, the mean values (Banerjee, 1998). Further, the results obtained in present study were recorded to be 7.98, 8.38, 8.36, 8.31 and 8.28 g/dl in 0%, also gets support from Deshmukh (1998) who reported 0.25%, 0.50%, 0.75% and 1% Geloi supplementation, increased Hb concentration with herbal supplementation in respectively. With respect to effect of ascorbic acid broilers. Likewise, significant increase in Hb, PCV and TEC supplementation, the mean values were recorded to be 8.12 are in accordance with the findings of Adenkola and Angani g/dl in non-supplemented group and 8.40 g/dl in ascorbic acid supplemented group. The statistical analysis of data revealed Table 1: Effect of supplementation of Tinospora cordifolia (geloi) and highly significant (P<0.01) effect of Tinospora cordifolia (Geloi) ascorbic acid on haemoglobin and erythrogram and ascorbic acid, but remained non-significant for interaction. With respect to Tinospora cordifolia (Geloi) supplementation, Treatment Hb PCV TEC groups (g/dl) (%) (106/cumm) the highest Hb (8.38 g/dl) was observed in treatment group Geloi X supplemented with 0.25% Geloi, which was comparable with Ascorbic acid 0.50%, 0.75% and 1% Geloi supplemented groups, but a T1 7.75 23.24 2.57 significant over 0% Geloi supplemented group. With respect b T2 8.23 24.75 3.15 bc to effect of ascorbic acid supplementation, an increase in Hb T3 8.27 24.82 3.19 b (g/dl) was revealed in ascorbic acid supplemented group. The T4 8.20 24.53 3.14 b overall mean values of PCV (%) were found to be 23.24, 24.75, T5 8.15 24.41 3.14 b 24.82, 24.53, 24.41, 24.61, 25.53, 25.31, 25.33 and 25.29 in T1 T6 8.22 24.61 3.10 c (Control), T T , T , T , T , T , T , T and T treatment groups, T7 8.52 25.53 3.34 2, 3 4 5 6 7 8 9 10 bc respectively. Regarding effect of Tinospora cordifolia (Geloi) T8 8.45 25.31 3.28 bc supplementation, the mean values were recorded to be 23.93, T9 8.42 25.33 3.25 bc 25.14, 25.06, 24.93 and 24.85 % in 0%, 0.25%, 0.50%, 0.75% T10 8.42 25.29 3.23 and 1% Geloi supplementation, respectively. With respect to SEM 0.0850 0.260 0.058 effect of ascorbic acid supplementation, the mean values were Effect of Geloi 0 % 7.98a 23.93a 2.84a recorded to be 24.35% in non-supplemented group and b b b 25.21% in ascorbic acid supplemented group. The statistical 0.25% 8.38 25.14 3.25 0.50 % 8.36b 25.06b 3.23b analysis of data of PCV (%) revealed highly significant (P<0.01) 0.75% 8.31b 24.93b 3.20b effect of Tinospora cordifolia (Geloi) and ascorbic acid, but b b b 1 % 8.28 24.85 3.18 remained non-significant for interaction. With respect to SEM 0.060 0.184 0.041 Tinospora cordifolia (Geloi) supplementation, the highest per Effect of Ascorbic acid cent PCV (25.14%) was observed in treatment group 0 % 8.12a 24.35a 3.04a supplemented with 0.25% Geloi, which was comparable with 0.025% 8.40b 25.21b 3.24b 0.50%, 0.75% and 1% Geloi supplemented groups, but SEM 0.038 0.116 0.026

265 Veterinary Practitioner Vol. 20 No. 2 December 2019

Fig. 1: Effect of supplementation of Geloi and ascorbic acid on values, which was contrary to present findings with Tinospora haemoglobin and erythrogram cordifolia (Geloi) supplementation in broiler chicken. The increase in TEC might have brought about effective exchange Geloi X Ascorbic acid T1 of gases within the birds due to enhanced oxygen carrying

capacity and carbon dioxide exhaustion from the body, which 30 T2 accumulates in the hot months leading towards alkalosis. The T3 increase in PCV might be attributed to increased haemoglobin 25 level in treated broiler birds through profound effect on T4 20 haemopoetic system and with the increase in haemoglobin T5 containing cells. Further, in the groups supplemented with 15 Tinospora cordifolia (Geloi) and ascorbic acid in combination, T6 improvement in hematological parameters as compared to 10 T7 control indicated synergistic effect of Tinospora cordifolia (Geloi) and ascorbic acid in broilers. 5 T8 T9 Acknowledgement 0 We gratefully acknowledge the help offered by Dean, Haemoglobin and erythrogram Hb (g/dl) PCV (%) TEC106/cumm 106/cumm T10 College of Veterinary and Animal Science, Bikaner and I/C, poultry farm, College of Veterinary and Animal Science, Bikaner for providing infrastructure and necessary facilities to conduct Effect of Geloi the research. References 30 Adenkola AY and Angani MT (2017) Ascorbic acid supplementation effect on season in Southern Guinea Savannah. J. Poult. 25 Res. 14(1): 28-33. 20 0% Adenkola AY, Ayo JO and Sackey AKB (2009) Ascorbic acid induced- modulation of rectal temperature in pigs during the harmattan 0.25% 15 season. J. Thermal Anim. Biol. 34(3): 152 - 154. 0.50% Banerjee GC (1998) A Text Book of Animal Husbandry, 8th edn. Oxford 10 and IBH publishing Co. Pvt. Ltd., New Delhi, India. 0.75% Benjamin MM (1978) Outline of veterinary clinical pathology. 3rd edn., 5 The Iowa State University Press Ames. Iowa, USA. 1% 0 Bouraoui R, Lahmar M, Majdoub A, Djemali MN and Belyea R (2002) 6 The relationship of temperature-humidity index with milk Haemoglobin and erythrogram Hb (g/dl) PCV (%) TECTEC 10 106/cumm/cumm production of dairy cows in a Mediterranean climate. Anim. Res. 51(6): 479-491. Daghir NJ (2009) Nutritional strategies to reduce heat stress in broilers Effect of Ascorbic acid and broiler breeders. Lohmann Information. 44: 6-15 Deshmukh VD (1998) Effect of ashwagandha root powder in broiler. 30 M.V.Sc., Thesis submitted to Dr. Punjabrao Deshmukh Vidyapeeth Akola, India. 25 Dhore RN, Tangade SU and Dhok AP (2014) Effect of herbal and synthetic vitamin C supplementation on performance of 20 broilers under intense summer conditions. Indian J. Poult. Sci. 49(1): 48-51. 15 0% Holik V (2009) Management of laying hens to minimize heat stress. Lohmann Information. 44:16-29. 10 0.025% Jadhav SS (2005) Effect of supplementation of Ashwagandha and ascorbic acid on broiler performance during hot weather. 5 M.V.Sc., Thesis submitted to Maharasta Animal and Fishery Sciences University, Nagpur. 0 Khobragade (2003) Effect of feed supplementation of medicinal plants 6 Haemoglobin and erythrogram Hb (g/dl) PCV (%) TECTEC 106/cumm10 /cumm Tinospora cordifolia and Leptadenia reticulate on performance of broiler. M.V.Sc. Thesis submitted to Maharasta Animal and Fishery Sciences University, Nagpur, (2017) who reported significant effect on Hb, PCV and TEC India. values on supplementation of ascorbic acid in broilers. Further, Kramer CY (1956) Extension of multiple range tests to group means Dhore et al. (2014) reported increased Hb, PCV and TEC values with unequal numbers of replications. Biometrics. 12(3): 307-310. with supplementation of Vitamin C @ 0.025% in broilers. The Sahota AW, Ullah MF and Gillani AH (1992) Haematological studies on findings on TEC are well supported by Sahota et al. (1992) heat stressed chicken supplemented with ascorbic acid. and Jadhav (2005) who reported significant increase in TEC Pakistan Vet. J. 12(1): 28-31. on supplementation of ascorbic acid in chicken. Khobragade Snedecor GW and Cochran WG (2004) Statistical Methods. 8th edn., (2003) found non-significant differences in PCV and TEC Oxford and IBH publishing company, Kolkata.

266 Veterinary Practitioner Vol. 20 No. 2 December 2019

EFFECT OF IMPROVED NUTRITION AND IMPROVED SHELTER ON SERUM PROTEINS OF MAGRA LAMBS IN TWO LAMBING SEASONS UNDER ARID ZONE#

T. Bothra1, A.K. Patel2, Vijay Kumar, S.C. Goswami, H.K. Narula3, D. Jain4 and Mangesh Kumar5 Department of Livestock Production Management, College of Veterinary and Animal Science Rajasthan University of Veterinary and Animal Sciences, Bikaner-334 001, Rajasthan, India

Received on: 23.10.2019 ABSTRACT Accepted on: 03.12.2019

The present experiment was conducted in phased manner to observe the effect of improved nutrition and improved shelter either alone or in combination on serum proteins in Magra lambs. In phase-I, fifteen days old Magra lambs (n=40) born in autumn-winter season were used for present study in a randomized block design up to the six month of age during the period from September 2016 to Feb-March 2017 (up to 5th March) i.e. Autumn-Winter season (Season-1) at ARC-CSWRI and divided into four groups of 10 lambs

in each group (T1-T4). In Phase-II, similar experiment was followed with the lambs born in spring-summer season (Season-II) during the th th period from early February 2017 (from 12 February) to early August 2017 (up to 12 August). Groups included T1-Sole grazing with traditional shelter (tree shade); T2-improved shelter (asbestos sheet-thatched roof/with curtains) with grazing; T3-improved nutrition and traditional shelter and T4- improved nutrition and improved shelter. In groups of (T3-T4) varying plane of nutrition was supplemented with creep mixture @ 1% of their body weight from 15 days of age to weaning while multinutrient mixture @ 1% of their body weight was provided from weaning up to six month of age in both seasons. There was wide variation in temperature and THI during the study period, which indicated that lambs were under thermal stress during various months of trial. Thermal stress caused alteration in mean

values of serum proteins in control group (T1) which might be improved due to amelioration of the negative effects of thermal stress by provision of improved nutrition and shelter.

Key words: Magra, improved nutrition, improved shelter, thermal stress

Introduction used as indices for nutritional status of animal. Serum total protein The socio-economic role of sheep in communities living in and albumin concentration decrease during thermal stress in arid and semi-arid regions will be maintained and expected to goats (Dangi et al., 2012). Postnatal growth rate depends mainly grow further in the coming years (Ben Salem and Smith, 2008). In on nutrition and management, which includes the housing system the arid and semi-arid region of India, sheep are generally exposed (Bach, 2012). Reducing heat stress on sheep requires multi- to various climatic extremes like elevated temperature, feed and disciplinary approaches that include nutrition, housing and health water scarcity during grazing (Maurya et al., 2004; Sejian et al., management (Collier et al., 2003). 2010) hence apart from heat stress and physical strain of grazing activity, the sheep and goats are subjected to feed shortage (Hooda Materials and Methods and Naqvi, 1990). In these regions, there is wide variation in ambient Phased experiment was conducted on 15 days old male temperature, which may increase up to 48oC during summer and Magra lambs at the sheep farm of ARC-CSWRI, Bikaner. In may drop below 3oC during winter, therefore small ruminant kept phase-I, fifteen days old Magra lambs (n=40) born in autumn- on sole grazing expose to stress because of nutritional and winter season were used for serological study in a randomized environmental stressors (Maurya et al.,2004). Environmental block design up to the six month of age during the period from th factors have a profound effect on lamb survival in extensive September 2016 to Feb-March 2017 (up to 5 March) i.e. management (Everett-Hincks et al., 2014). Animals respond to Autumn-Winter season (Season-1) at ARC-CSWRI and divided into four groups of ten lambs in each group (T -T ). In Phase- adverse environment conditions in various ways in order to 1 4 maintain homeostasis. Heat stress evokes a series of drastic II, similar experiment was followed with the lambs born in changes in animal biological functions, which include a decrease spring-summer season (Season-II) during the period from th in feed intake efficiency and use, disturbances in the metabolism early February 2017 (from 12 February) to early August 2017 (up to 12th August). Groups included T -Sole grazing with of water, protein, energy and mineral balances, enzymatic reactions, 1 traditional shelter; T -improved shelter with grazing; T - hormonal secretions and blood metabolites (Marai et al., 2006). 2 3 improved nutrition and traditional shelter and T - improved Extremes in the environmental conditions cause a great impact 4 on physiology and productivity of farm animals (Singh and Upadhyay, nutrition and improved shelter. The traditional shelter means 2009) and these seasonal and nutritional changes may alter the an enclosure without roof structure under tree shade. Improved composition of blood (Burrin et al., 1989). The productive and shelter was in the form of asbestos sheet-thatched roof. reproductive efficiency of animals are associated with the blood Additional protection was provided with curtains in winter period to save the lambs from direct cold waves. In groups of (T -T ) parameters (Abdel-Fattah et al., 2013) and are used to assess 3 4 the nutritional status (Antenovic et al., 2007) of sheep in which varying plane of nutrition was supplemented with creep mixture concentrations of serum total protein and albumin have been @1% of their body weight from 15 days of age to weaning

#1Part of Ph.D. Thesis submitted by first author Assistant Professor and corresponding author; 2Principal Scientist, CAZRI, Jodhpur; 3Principal Scientist, CSWRI, Campus Bikaner; 4Assistant Professor, Dept. of Ani. Nutrition; 5Ph.D. Scholar, Dept of Animal Nutrition

267 Veterinary Practitioner Vol. 20 No. 2 December 2019 while multinutrient mixture @1% of their body weight was months of experimental period but remained non-significant provided from weaning up to six month of age in both seasons. during 3rd month. Further, the statistical analysis of data for Lambs were kept in their respective sheds with their dams up interaction (Treatment x Season) revealed highly significant to weaning and thereafter they were separated from their dams (P<0.01) effect during 4th, 5th and 6th months but remained and let loose for 8 hours grazing in all groups. The lambs of all non-significant during rest of the months of experimental period. groups were supplemented with ad lib groundnut fodder during Due to main effect of treatment, the mean values of serum the whole trial. All experimental lambs reared under strict albumin (g/dl) of lambs varied from 3.00±0.24 (1st month) to rd st management and proper hygienic conditions throughout the 3.47±0.11 (3 month) in T1, from 2.73±0.1 9 (1 month) to rd th st study period. Deworming was carried out for both ecto and 3.02±.0.1 (3 and 4 month) in T2, from 2.72±0.17 (1 month) th nd endoparasites using suitable anthelmintics before the to 3.15±0.14 (5 month) in T3 and from 2.47±0.16 (2 month) th th beginning of the experiment. to 2.68±.17 (4 and 5 month) in T4 group. Due to main effect A digital data logger was used to record air temperature of season, the mean values of serum albumin of lambs varied and relative humidity inside and outside of the shed. The data from 2.83±0.05 (5th month) to 3.13±0.09 (1st month) in season logger was hanged at 1.5 metre above the ground in the middle 1 and from 2.34±0.08 (1st month) to 3.23±0.15 (5th month) in of inside and outside the shed. Climatic variables were season 2. Statistical analysis of variance due to main effect of observed from September 2016 to August 2017. Temperature treatment revealed highly significant (P<0.01) effect on monthly Humadity Index (THI) values were calculated from recorded mean serum albumin (P<0.01) from 2nd to 6th months of meteorological variables by formula given by Marai et al. (2006). experimental period, but remained significant (P<0.05) during Blood samples from experimental lambs were collected in 1st month. Likewise, statistical analysis of variance due to main the morning hours before the feeding and watering of lambs. effect of season was highly significant (P<0.01) during 1st, 2nd Samples were collected at monthly intervals by puncturing and 5th month, while, significant (P<0.05) effect was observed jugular vein following aseptic measures. The blood, so drawn during 4th month of experimental period. Further, the statistical was collected in sterilized test tubes without anticoagulant, analysis of data for interaction (Treatment x Season) revealed and kept in slanting position. These tubes were incubated for highly significant (P<0.01) effect from 3rd to 6th months of 1 h at 37°C. Blood clots were broken and tubes were experimental period, but remained non-significant during rest centrifuged at 2500 rpm for 30 minutes. The serum was of the months of experimental period. pipetted out in small Pyrex tubes and kept for further analysis Due to main effect of treatment, the mean values of serum of serum albumin (ALB), serum globulin and total serum globulin (g/dl) of lambs varied from 3.53±0.21 (5th month) to th nd protein (TP). The data obtained in the present experiment were 4.0±0.04 (6 month) in T1, from 3.57±0.12 (2 month) to th st analyzed statistically for main effect of treatment or season 3.8±0.08 (6 month) in T2, from 3.28±0.16 (1 month) to th st alone as well as interaction (Treatment x Season) in factorial 3.48±0.15 (6 month) in T3 and from 3.22±0.21 (1 month) to th design (4x2) as per Snedecor and Cochran (2004) and 3.58±0.10 (4 month) in T4. Due to main effect of season, the significance of mean differences was tested by Duncan’s New mean values of serum globulin of lambs varied from Multiple Range Test (DNMRT) as modified by Kramer (1956). 3.28±0.07g/dl (5th month) to 3.92±0.05 g/dl (6th month) in season1 and from 3.23±0.11 g/dl (1st month) to 3.83±0.06 g/dl Results and Discussion (5th month) in season 2. Statistical analysis of variance due to The monthly peak values i.e. lowest and highest values of main effect of treatment revealed highly significant (P<0.01) temperature and THI of season 1 and season 2 of inside and effect on monthly mean serum globulin during 1st month and outside shed during experimental period have been presented from 4th to 6th months of experimental period but remained non under Table 1. On reviewing the findings of monthly peak values, significant during 2nd and 3rd month. Likewise, statistical there was wide variation in temperature and THI during the analysis of variance due to main effect of season on monthly study period, which indicated that lambs were under thermal mean serum globulin, revealed highly significant (P<0.01) effect stress during various months of trial. The mean values of serum during 1st month and from 4th to 6th months of experimental albumin (ALB), serum globulin and total serum protein (TP) of period but remained non-significant during 2nd and 3rd months. lambs under different treatment groups at monthly intervals of Further, the statistical analysis of data for interaction (Treatment experiment have been presented in Table 2, 3 and 4. Due to x Season) on monthly mean serum globulin revealed highly main effect of treatment, the mean values of serum total protein significant (P<0.01) effect from 5th to 6th months, whereas, th (g/dl) of lambs varied from 6.80±0.45 (5 month) to 7.35±0.15 significant effect (P<0.05) was observed during 4th month, but (3rd month) in T , from 6.35±0.29 (1st month) to 6.80±0.12 (4th 1 remained non-significant during rest of the months of month) in T , from 6.00±0.30 (1st month) to 6.55±0.16 (4th 2 experimental period. month) in T and from 5.72±0.33 (1st month) to 6.27±0.11 (4th 3 The obtained results indicated that there was numerically month) in T . Likewise, due to main effect of season, the mean 4 lower level of serum proteins in cold period, where as higher values of serum total protein of lambs varied from 6.12±0.08 level of serum proteins was observed in hot period in control th st (5 month) to 6.88±0.14 (1 month) in season 1 and from group than treatment groups i.e. improved shelter and improved st th 5.58±0.15 (1 month) to 7.05±0.17 (5 month) in season 2. nutrition alone or in combination, though they were in normal Statistical analysis of variance due to main effect of treatment physiological range. The present findings of cold period is in revealed highly significant (P<0.01) effect on monthly mean accordance with Salam et al. (2016) who also stated that there serum total protein during all months of experimental period. is decrease in total serum protein in sheep, which may be due Likewise, statistical analysis of variance due to main effect of to poor availability of feed and fodder in cold period. Whereas, season revealed highly significant (P<0.01) effect during all the results of heat stress are in accordance with Okoruwa 268 Veterinary Practitioner Vol. 20 No. 2 December 2019

Table 1: Monthly peak (lowest and highest) values of (2014) who stated that there is increase in total serum protein temperature and THI of season I and II (inside and outside shed) along with albumin and globulin because of dehydration, which Temperature range (ºC) THI range is result of increase in respiration rate in goats. Results of Months of Trial In Out In Out heat stress are on contrary with the findings of Hooda and Season 1 Upadhyay (2014), Dangi et al. (2012) and Sejian et al. (2010) September 23.00 to 40.50 22.50 to 47.00 21.92 to 34.63 21.66 to 39.77 who reported decreased level of total serum protein in heat October 11.50 to 38.50 10.00 to 49.50 11.89 to 33.87 10.55 to 40.85 stress. November 7.00 to 33.00 6.50 to 39.50 7.84 to 28.40 7.31 to 33.12 December 3.00 to 31.00 2.00 to 43.00 3.95 to 27.09 3.13 to 35.69 Acknowledgement January -2.00 to 25.00 -3.00 to 31.50 -1.01 to 23.18 -2.22 to 28.40 We gratefully acknowledge the help offered by Dean, Feb.-Mar. College of Veterinary and Animal Science, Bikaner; Head, ARC- th 3.50 to 34.00 -0.50 to 42.50 4.89 to 29.23 0.68 to 34.96 (up to 5 Mar.) CSWRI, Bikaner; Project coordinator, NWPSI and Director, Season 2 ICAR-CSWRI for providing facilities to conduct the experiment. February th 4.00 to 34.00 2.00 to 42.50 5.90 to 29.23 3.88 to 34.96 (From 12 Feb.) References March 10.00 to 42.00 8.00 to 48.00 11.00 to 78.50 8.77 to 38.94 Abdel-Fattah MS, Hashem ALS, Shaker YM, Ellamei AM and Amer HZ April 14.00 to 46.80 11.50 to 52.50 7.50 to 74.50 12.13 to 41.87 (2013) Effect of weaning age oproductive performance May 21.50 to 46.00 19.50 to 50.00 10.50 to 77.50 18.88 to 41.50 and some plasma biochemical parameters of Barki lambs in June 19.50 to 46.50 19.50 to 50.50 14.50 to 87.50 18.74 to 40.93 Siwa Oasis. Egypt. Global Veterinaria. 10: 189-202. July-Aug th 24.35 to 40.00 26.00 to 41.50 22.93 to 36.41 24.30 to 37.69 Antunovic Z, Maric I, Sencic D, Speranda M and Steiner Z (2007) (up to 12 Aug.) Exterior, productive and metabolic characteristic of

Table 2: Effect of different treatment groups on serum total protein (g/dl) at monthly intervals in two lambing seasons Period (months) Treatment 1 2 3 4 5 6 groups Interaction (Treatment X Season) Treatment Season a a c T1 1 7.57±0.12 7.63±0.03 7.17±0.27 6.07 ±0.09 5.80 ±0.10 7.07 ±0.12 bc b bc T2 1 6.87±0.20 6.60±0.25 6.47±0.03 6.60 ±0.15 6.40 ±0.10 6.83 ±0.12 ab ab bc T3 1 6.63±0.12 6.47±0.09 6.20±0.21 6.27 ± 0.07 6.07 ±0.15 6.77 ±0.38 ab b bc T4 1 6.43±0.12 6.23±0.15 6.30±0.06 6.40 ± 0.15 6.20 ±0.12 6.73 ±0.15 d d d T1 2 6.10±0.06 6.83±0.15 7.53±0.12 7.67 ±0.18 7.80 ±0.15 7.50 ±0.10 c c bc T2 2 5.83±0.32 6.37±0.09 6.70±0.10 7.00 ±0.06 7.10 ±0.06 6.73 ±0.12 c c b T3 2 5.37±0.22 6.17±0.07 6.70±0.35 6.83 ±0.20 7.00 ±0.10 6.30 ±0.06 a b a T4 2 5.00±0.06 5.83±0.12 6.00±0.20 6.13 ±0.12 6.30 ±0.10 5.33 ±0.07 Main effect of treatment b c c b c d T1 6.83 ±0.33 7.23 ±0.19 7.35 ±0.15 6.87 ±0.37 6.80 ±0.45 7.28 ±0.12 ab b b b c c T2 6.35 ±0.29 6.48 ±0.13 6.58 ±0.07 6.80 ±0.12 6.75 ±0.16 6.78 ±0.08 a b ab ab b b T3 6.00 ±0.30 6.32 ±0.08 6.45 ±0.21 6.55 ±0.16 6.53 ±0.22 6.53 ±0.20 a a a a a a T4 5.72 ±0.33 6.03 ±0.12 6.15 ±0.11 6.27 ±0.11 6.25 ±0.07 6.03 ±0.32 Main effect of season Season 1 (S1) 6.88b±0.14 6.73b±0.17 6.53±0.14 6.33a±0.08 6.12a±0.08 6.85b±0.10 Season 2 (S2) 5.58a±0.15 6.30a±0.12 6.73±0.19 6.91b±0.18 7.05b±0.17 6.47a±0.24 Means with different superscripts in a column differ significantly

Table 3: Effect of different treatment groups on serum albumin (g/dl) at monthly intervals in two lambing seasons Period (Months) Treatment groups 1 2 3 4 5 6 Interaction (Treatment x Season) Treatment Season c b ab b T1 1 3.50±0.10 3.63±0.09 3.30 ±0.06 2.83 ±0.09 2.73 ±0.07 3.03 ±0.09 ab b b b T2 1 3.10±0.06 3.07±0.09 2.63 ±0.12 2.90 ±0.15 2.83 ±0.15 2.90 ±0.06 b b b b T3 1 3.03±0.09 2.90±0.15 2.73 ±0.30 2.93 ±0.09 2.87 ±0.09 2.97 ±0.30 bc bc b b T4 1 2.90±0.25 2.80±0.06 2.90 ±0.06 3.03 ±0.12 2.90 ±0.10 2.83 ±0.12 d d d c T1 2 2.50±0.15 3.20±0.17 3.63 ±0.17 3.73 ±0.12 3.80 ±0.10 3.53 ±0.09 bc bc c b T2 2 2.37±0.22 2.77±0.13 2.97 ±0.09 3.13 ±0.03 3.20 ±0.06 3.07 ±0.09 c c c b T3 2 2.40±0.17 2.87±0.09 3.27 ±0.12 3.30 ±0.06 3.43 ±0.09 3.13 ±0.03 a a a a T4 2 2.10±0.17 2.13±0.09 2.27 ±0.09 2.33 ±0.12 2.47 ±0.07 2.30 ±0.12 Main effect of treatment b c c c c c T1 3.00 ±0.24 3.42 ±0.13 3.47 ±0.11 3.28 ±0.21 3.27 ±0.24 3.28 ±0.12 a b b b b b T2 2.73 ±0.19 2.92 ±0.10 2.80 ±0.10 3.02 ±0.09 3.02 ±0.11 2.98 ±0.06 a b b b b b T3 2.72 ±0.17 2.88 ±0.08 3.00 ±0.19 3.12 ±0.09 3.15 ±0.14 3.05 ±0.14 a a a a a a T4 2.50 ±0.21 2.47 ±0.16 2.58 ±0.15 2.68 ±0.17 2.68 ±0.11 2.57 ±0.14 Main effect of season Season 1 (S1) 3.13b±0.09 3.10b±0.11 2.89±0.10 2.93a±0.05 2.83a ±0.05 2.93±0.08 Season 2 (S2) 2.34a±0.08 2.74a±0.13 3.03±0.16 3.13b±0.16 3.23b ±0.15 3.01±0.14 Means with different superscripts in a column differ significantly

269 Veterinary Practitioner Vol. 20 No. 2 December 2019

Table 4: Effect of different treatment groups on serum globulin (g/dl) at monthly intervals in two lambing seasons Period (months) Treatment groups 1 2 3 4 5 6 Interaction (Treatment x Season) Treatment Season a a c T1 1 4.07±0.03 4.00±0.10 3.87±0.32 3.23 ±0.09 3.07 ±0.03 4.03 ±0.03 cde b c T2 1 3.77±0.19 3.53±0.26 3.83±0.13 3.70 ±0.06 3.57 ±0.15 3.93 ±0.09 ab a bc T3 1 3.60±0.12 3.57±0.22 3.47±0.27 3.33 ±0.12 3.20 ±0.10 3.80 ±0.12 ab a bc T4 1 3.53±0.34 3.43±0.12 3.40±0.10 3.37 ±0.07 3.30 ±0.06 3.90 ±0.12 e d c T1 2 3.60±0.12 3.63±0.15 3.90±0.06 3.93 ±0.09 4.00 ±0.06 3.97 ±0.07 de c b T2 2 3.47±0.23 3.60±0.06 3.73±0.03 3.87 ±0.07 3.90 ±0.12 3.67 ±0.07 bc b a T3 2 2.97±0.09 3.30±0.06 3.43±0.23 3.53 ±0.15 3.57 ±0.03 3.17 ±0.03 cd c a T4 2 2.90±0.06 3.50±0.06 3.73±0.23 3.80 ±0.08 3.83 ±0.03 3.03 ±0.07 Main effect of treatment b a ab c T1 3.83 ±0.12 3.82±0.11 3.88±0.14 3.58 ±0.17 3.53 ±0.21 4.00 ±0.04 b b c b T2 3.62 ±0.15 3.57±0.12 3.78±0.07 3.78 ±0.05 3.73 ±0.11 3.80 ±0.08 a a a a T3 3.28 ±0.16 3.43±0.12 3.45±0.16 3.43 ±0.10 3.38 ±0.09 3.48 ±0.15 a a b a T4 3.22 ±0.21 3.47±0.06 3.57±0.14 3.58 ±0.10 3.57 ±0.12 3.47 ±0.20 Main effect of season Season 1 (S1) 3.74b±0.11 3.63±0.10 3.64±0.11 3.41a±0.06 3.28a±0.07 3.92b±0.05 Season 2 (S2) 3.23a±0.11 3.51±0.05 3.70±0.09 3.78b±0.06 3.83b±0.06 3.46a±0.12 Means with different superscripts in a column differ significantly

Dubrovnik sheep lambs. In: Proc. 1 Conference on native Kramer CY (1956) Extension of multiple range tests to group means breeds and varieties as part of natural and cultural heritage with unequal numbers of replications. Biometrics. 12(3): Sibenik, Croatia, pp. 6-8. 307-310. Bach A (2012) Nourishing and managing the dam and postnatal calf Marai IFM, El- Darawany AA, Abou-Fandoud EI, Abdel-Hafez MAM for optimal lactation, reproduction, and immunity. In: Ruminant (2006) Serum blood components during pre-oestrus, nutrition symposium: Optimizing performance of the oestrus and pregnancy phases in Egyptian Suffolk as offspring. J. Anim. Sci. 90:1835-1845. affected by heat stress, under the conditions of Egypt. Ben Salem H and Smith T (2008) Feeding strategies to increase small Egyptian J. Sheep, Goat Desert Anim. Sci. 1: 47-62. ruminant production in dry environments. Small Rumin. Res. Maurya VP, Naqvi SMK and Mittal JP (2004) Effect of dietary energy 77: 174-194. level on physiological responses and reproductive Burrin D G, Ferrel CL and Britton RA (1989) Effect of feed intake of performance of Malpura sheep in the hot semi-arid region lambs on visceral organ growth and metabolism. In: of India. Small Rumi. Res. 55: 117-22. Proceedings of the 11th Symposium on Energy Metabolism. Okoruwa MI (2014) Effect of heat stress on thermoregulatory, live Collier RJ, Coppola C and Wolfgram A (2003) Novel approaches for the body weight and physiological responses of dwarf Goats alleviation of climatic stress in farm animals, interactions in southern Nigeria. European Scient. J. 10(27): 255-264. between climate and animal production. EAAP Tech Ser No Salam S, Khan HM, Shah AA, Mir MS and Dar PA (2016) Effect of cold 7, Wageningen Acad. Publ., Wageningen, pp. 61-71. and nutritional stress on blood metabolites of corridale Dangi SS, Gupta M, Maurya D, Yadav VP, Panda RP, Singh G, Mohan sheep in Jammu and Kashmir. Indian J Small Rumin. 22(2): NH, Bhure SK, Das BC, Bag S, Mahapatra RK and Sarkar M 36-39. (2012) Expression profile of HSP genes during different Sejian V, Maurya VP and Naqvi SMK (2010) Adaptive capability as seasons in goats (Capra hircus). Trop. Anim. Health and indicated by endocrine and biochemical responses of Prod. 44: 1905-1912. Malpura ewes subjected to combined stresses (thermal Everett-Hincks JM, Mathias-Davis HC, Greer GJ, Auvray BA, Dodds and nutritional) under semi-arid tropical environment. Int. J. KG (2014) Genetic parameters for lamb birth weight, survival Biometeorol. 54: 653-61. and death risk traits. J. Anim. Sci. 92: 2885-2895. Singh SV and Upadhyay RC (2009) Thermal stress on physiological Hooda OK and Naqvi SMK (1990) Effect of thermal load and feed functions, thermal balance and milk production in Karan Fries restriction on the relative adaptability of Malpura and Avikalin and Sahiwal cows. Indian Vet. J. 86: 141-144. sheep in semi-arid region. Indian J. Anim. Sci. 60: 608-611. Snedecor GW and Cochran WG (2004) Statistical Methods. 8th edn., Hooda OK and Upadhyay RC (2014) Physiological responses, growth Oxford and IBH Publishing company, Kolkata. rate and blood metabolites under feed restriction and thermal exposure in kids. J. Stress Physiol. Biochem. 10(2): 214- 227.

270 Veterinary Practitioner Vol. 20 No. 2 December 2019

EFFECT OF DIETARY SUPPLEMENTATION OF CHROMIUM FROM DIFFERENT SOURCES ON HAEMATO-BIOCHEMICAL PARAMETERS IN BROILERS#

S.S. Siyag1, Dinesh Jain, R.K. Dhuria, T. Sharma, Tara Bothra2, R. Nehra, S. Kumar, U.K. Prajapat and M. Kumar Department of Animal Nutrition, College of Veterinary and Animal Science Rajasthan University of Veterinary and Animal Sciences, Bikaner-334 001, Rajasthan, India

Received revised on: 12.05.2019 ABSTRACT Accepted on: 23.17.2019

An experiment was conducted to assess the effect of incorporation of chromium from different sources as feed supplement on haemato-biochemical parameters in broilers. A total of 150 one day-old broiler chicks were divided into five treatment groups with two replicates of 15 chicks in each replicate using completely randomized design. The experimental starter and finisher rations contained

21.79 and 19.22% C.P., respectively. The five treatments were designated as C i.e. control group fed on unsupplemented diet and T1 and T2 treatment groups supplemented with 200 ppb feed and 400 ppb feed level of chromium picolinate and likewise T3 and T4 treatment group were supplemented with 200 ppb feed and 400 ppb feed level of chromium chloride in the experimental broiler starter and finisher ration, respectively. In respect with haemato-biochemical parameters, the statistical analysis of means in terms of Hb, PCV, serum protein, serum glucose, serum cholesterol and serum triglyceride revealed non-significant effect of supplementation of chromium in all treatments. All haemato-biochemical parameters studied in text were well within the normal range.

Key words: Broiler, chromium picolinate, chromium chloride, haemato-biochemical, serum protein

Introduction healthy broiler chicks procured from commercial hatchery were India has 1.30 billion people and the number is growing used in the present experiment. The various feed ingredients every year. The focus is on “Development” meaning good food, used for formulating different experimental ration were better health & better living conditions to everyone. Healthy purchased from the local market in one lot before starting the food at attractive price will be the issue in focus. Within a span experiment and were analyzed for proximate composition of 25 years, the egg production has gone up to 70 billion from according to AOAC (1995). Five dietary treatment groups few millions and the broiler production has gone to 3.8 million designated at C, T1, T2, T3 and T4 were formulated by tons. As per the Annonymas (2012) 19th Livestock census 2012, incorporating basal diet with no chromium supplement, poultry population of India is 729.2 million and out of which Chromium picolinate @ 200 ppb, 400 ppb and Chromium Rajasthan has 8.024 million. Poultry meat production chloride @ 200 ppb, 400 ppb, respectively. increased from 0.069 million tons in 1961 to 3.725 million The proximate composition of basal feed for starter and tons in 2014. The per capita availability of poultry meat is 2.8 finisher phase of experimental birds is presented in Table 1. kg; against ICMR recommended level of 11 kg (Prabakaran, The experimental feed was analyzed by method of AOAC, 1995. 2014; Rajendran et al., 2014). The chicks were weighed individually at the start of the Chromium (Cr) is a trace element that appears to be an experiment and subsequently at weekly intervals for 6 weeks. essential micronutrient for animals and humans. Trivalent Various haemato-biochemical parameters were investigated (Cr3+) and hexavalent (Cr6+) states are biologically active, but at the end of experiment to judge the physiological status of some differences in their metabolism are known. Cr6+ is more health of broiler chicks. Blood was collected from wing vein readily absorbed than Cr3+ but its toxicity is higher. The primary with all aseptic precaution. role of Chromium in metabolism is to potentiate the action of For haematological examination blood was collected in insulin through its presence in an organometallic molecule, sterile tubes having disodium salt of ethylene-diamine-tetra- called the glucose tolerance factor (GTF) (Anderson, 1984 and acetic acid (EDTA) as an anticoagulant. Haemoglobin and PCV 1987; Sahin et al., 2001 and 2003; Pechova et al., 2002). were determined by Sahli-Hellige haemoglobinometer and Chromium (Cr) was recognized as an essential element of microhaematocrit method, respectively. For bio-chemical diet in mammals by Schwarz and Mertz in 1957. There is no studies blood was collected in another sterile tubes having no specification for chromium requirements in poultry diets (NRC, anticoagulant and kept in slant position in incubator at 370C for 1994), and most poultry diets are composed of plant-origin one hour. Blood clots were broken and tubes were centrifuged ingredients, usually low in chromium (Giri et al., 1990). The at 2500 rpm for 30 minutes. Serum was separated for analysis present study was conducted to evaluate the effect of chromium of serum protein, glucose, cholesterol and triglyceride. Serum from different sources on health status of broilers. protein, glucose, cholesterol and triglyceride were determined by the Vet test chemistry analyzer by using kit supplied by Materials and Methods IDEXX laboratories, as per the manufacturer’s standard One hundred and fifty one-day-old, unsexed, apparently procedure.

#1Part of M.V.Sc. Thesis and corresponding author present address: Ph.D. Scholar, Dept. of Animal Nutrition, CVAS, RAJUVAS, Bikaner, Email: [email protected]; 2Asst. Prof. Dept. of Livestock Production Management, Phone: 9829960827

271 Veterinary Practitioner Vol. 20 No. 2 December 2019

Table 1: Proximate composition of broiler starter and finisher ration groups. The results obtained in study in text corroborate well Type of Dry Crude Crude Ether Nitrogen Total with the finding of Toghyani et al. (2012) who reported no ration matter protein fiber extract free extract ash significant effect on serum cholesterol. Starter 90.56 21.79 5.37 2.68 63.92 6.58 ration Serum triglyceride Finisher The overall mean value of triglyceride in C, T , T , T and T 90.82 19.22 4.96 3.83 64.99 7.15 1 2 3 4 ration groups were found to be 107, 100.5, 107.5, 118.5 and 96.5 Table 2: Effect of chromium supplementation on Hb and PCV in broiler (mg/dl), respectively. The result corroborate well with the finding chicks of Toghyani et al. (2012) and Kim et al. (1996a) who reported Main effects Hb % PCV % no significant effect of supplementation of Chromium in different C 7.65 22.95 treatment group on triglyceride. T1 7.8 23.4 T2 8.05 24.15 References T3 7.7 23.1 Annonymas (2012) All India 19th Livestock Census, (2012). Ministry T4 7.6 22.8 of Agriculture, Department of Animal Husbandry, Fisheries SEM 0.10368 0.41472 and Dairying, India. th Table 3: Effect of chromium supplementation on serum parameter in AOAC (1990) Official Methods of Analysis, 15 edn. Association of broiler chicks Official Analytical Chemists, Washington D.C. Anderson LD, Kent DB and Devis JA (1984) Batch experiments Main Serum Serum Serum Serum characterizing the reduction of Chromium (VI) using suboxic effects Total Protein glucose cholesterol Triglyceride material from a mildly reducing sand and gravel aquifer. C 3.45 185.5 129 107 Environ. Sci. Technol. 28(1): 178-185. T1 3.7 227 138 100.5 Anderson RA (1987) Chromium: In Mertz W, editor ed. Trace elements T2 3.15 154 139 107.5 in human and animal nutrition. Vol. 1 San Diego: Academic T3 4.1 123.5 148.5 118.5 Press. pp. 225-244. T4 3.8 170.5 142 96.5 Giri J, Usha KA and Sunita T (1990) Evaluation of the selenium and SEM 0.3453 64.063 14.3509 19.8305 Chromium content of plant foods. Plant foods for Human Nutrition. 40(1):49-59. Results and Discussion Kim YH, Han IK, Choi YJ, Shin IS, Chae BJ and Kang TH (1996a) Effects of dietary levels of Chromium picolinate on growth Haemoglobin and packed cell volume performance, carcass quality and serum traits in broiler The means of per cent haemoglobin for various treatment chicks. Asian-Aust. J. Anim. Sci. 9: 341-348. groups were recorded to be 7.65, 7.8, 8.05, 7.7 and 7.6 g/dl in NRC (1994) Nutrient requirements of poultry. 9th Rev. ed. Natl. Acad.

C, T1, T2, T3 and T4, respectively, which were statistically similar Press, Washington, DC. among different groups. The average value of packed cell Pechova A, Illek J, Indela M and Pavlata L (2002) Effects of Chromium supplementation on growth rate and metabolism in fattening volume for C, T1, T2, T3 and T4 treatment groups were observed to be 22.95, 23.4, 24.15, 23.1 and 22.8, respectively. bulls. Acta Vet Brno. 71: 535-541. The result of haemoglobin and packed cell volume in Prabakaran R (2014) Indian Poultry Industry - Current Status, Practical Challenges and Opportunities. Proceedings of the 31st Annual present study collaborates well with findings of Toghyani et al. Conference and National Symposium of Indian Poultry (2012) who reported no significant effect of chromium Science Association (IPSACON 2014): Dec. 18-20, supplementation on haematological parameters in broiler Namakkal, India. pp. 1-4. chicks. Rajendran K, Mani K, Shamsudeen P and Vasanthakumar T (2014) Broiler Industry - Understanding the Integration and Role of Serum protein Private Industries. Proceedings of the 31st Annual Conference

The average mean values of total serum protein for C, T1, and National Symposium of Indian Poultry Science

T2, T3 and T4 treatment groups were observed to be 3.45, 3.7, Association (IPSACON 2014), Dec. 18-20, Namakkal, India. 3.15, 4.1 and 3.8 (g/dl), respectively. pp. 103-105. The results obtained in study is corroborated well with Sahin K, Sahin N and Kucuk O (2003) Effects of Chromium, and the finding of Toghyani et al. (2012) who reported no significant ascorbic acid supplementation on growth, carcass traits, serum metabolites, and antioxidant status of broiler chickens effect of supplementation of chromium in different treatment reared at a high ambient temperature (32°C). Nutr. Res. 23: group on total serum protein. 225-238. Sahin K, Kucuk O, Sahin N and Ozbey O (2001) Effects of dietary Serum glucose Chromium picolinate supplementation on egg production, egg The overall mean value of serum glucose in C, T , T , T 1 2 3 quality and serum concentrations of insulin, corticosterone, and T4 groups were found to be 185.5, 227, 154, 123.5 and and some metabolites of Japanese quails. Nutr. Res.21: 170.5 (mg/dl), respectively. The result corroborate favourably 1315-1321. with the finding of Toghyani et al. (2012) and Kim et al. (1996a) Schwarz K and Mertz K (1957) A glucose tolerance factor and its who reported no significant effect of supplementation of differentiation from factor 3. Archives of Biochemistry and chromium in different treatment group on serum glucose. Biophysics. Academic Press. Tezeuka M, Momiyama K, Edano T and Okada S (1991) Protective Serum cholesterol effect of Chromium (III) on acute lethal toxicity of carbon tetrachloride in rats and mice. J. Inorg. Biochem. 42: 1-8. The overall mean value of serum cholesterol in C, T1, T2, T and T groups were found to be 129, 138, 139, 148.5 and Toghyani M and Shivazad M (2012) Chromium supplementation can 3 4 alleviate the negative effects of heat stress on growth 142 (mg/dl), respectively, were statistically similar among performance, carcass traits, and meat lipid oxidation of broiler chicks without any adverse impacts on blood272 constituents. Biol. Trace Elem. Res.146: 171. Veterinary Practitioner Vol. 20 No. 2 December 2019

A CLOSED FLUX CHAMBER EXPERIMENT: TAPPING THE METHANE PRODUCING POTENTIAL OF EQUINE MANURE IN INDIAN CONDITION#

P.A. Bala*, S.S. Kundu1, R.R. Rani3 and R.K. Dedar4 ICAR-Central Island Agricultural Research Institute, Port Blair, Andman and Nicobar Islands, India

Received on: 28.05.2019 ABSTRACT Accepted on: 27.07.2019

The present project was undertaken to study the methane producing potential of horse manure under indigenous condition. For this, 60 days of feeding trial was conducted on six thoroughbred horses of average 450 kg weight and fed with gram-oats-wheat based ration with ad lib access to local grass and water. The faeces was collected and heaped in closed flux chamber in 10 and 20 kg treatment groups for collection of methane gas. The gas was collected from the air tight gasket fitted to the chamber and analyzed in GLC. The average methane produced from both the groups of manure heaps was high in the first week which reduced drastically in the second week, thereafter the average methane production reduced gradually till 7th week. The methane production in the

experiment was at par with the IPCC (1997) default value of 2 tier of horse (10 gCH4/day), with 20 kg manure, while 10 kg manure produced lower average methane.

Key words: Methane, manure, equine

Introduction the default value for IPCC tier I and tier II may not be applicable Livestock sector is one of the most dynamic segments of in this situation. However, so far very less or no attempt has India and due to economic growth and urbanization demands been made to study the release of methane from these for livestock products (mainly protein) is expected to continue indigenous animal’s manure. Thus, an attempt was made to growing. Livestock rearing causes for emission of major study the methane production potential of equine manure in greenhouse gas like methane (CH4) from enteric fermentation Indian condition, where liquid manure is seldom stored and and manure management. The methane gas production by are thrown as heaps for months together and then applied to horses is 3-4% of the digestible energy intake. There major the fields as dung manure. factors which influences the methane production by an animal are body weight, feed intake, class of animal (physiology/work), Materials and Methods type of feed given, manure management, ambient temperature Feeding and management of the animals etc. These mentioned factors totally differ in India from west. Six horses (Thoroughbred, 3 female and 3 male), average The average body weight of the indigenous horses is 350 kg, BW 450 kg, were used for faeces collection from Police Training Indian donkeys 120 kg and 220 kg for Indian wild asses. Centre, Madhuban, Karnal, Haryana for studying the methane Indigenous equine breeds are smaller than their western emission from the manure of equines. The horses were relatives, thus consumes less dry matter and so anticipated to housed in well ventilated stables having facilities for individual release less methane. feeding and watering. In the night time the animals were shifted In India, feed intake is higher as the quality of feed offered to special stables having extra pen area. Animals were de- is low which render animals to consume more dry matter to wormed using Albendazole @ 10 mg/kg b.wt one week before satiate their need for nutrients. Moreover, low quality feeds are the commencement of the trial. They were allowed ad libitum known to produce more methane per unit of feed consumed. access to local grass hay (Eulaliopsis binata) in addition to 5 The manure disposal practices are very different in India. If we kg concentrate mix (2 kg gram, 1 kg maize, 1 kg oat and 1kg consider only equines, there is very less possibility that wheat bran), and 10 kg green maize fodder on dry matter basis. methane is produced from manure to the magnitude prescribed The feed intake was in ratio of 60: 40 for roughage to by IPCC as default value. About 97-98 % of equines are with concentrate. The concentrate mixture was fed to the animals the unorganized sector or with poor or marginal farmers in in two divided fractions after soaking in water. Green roughage India, moreover the farmer’s posses less number of animals was offered to the animals just after feeding the concentrate. individually. Due to this reason there are less chances that the However, dry local grass was given to the animals around the manure produced by their animals are get piled up rather to be clock in small portions and water was provided throughout the included in daily spread category. Rarely any manure is stored day. The animals were initially adapted to the rations for a in liquid form in India and due to high ambient temperature the month in stables. manure kept in pile get dried up very fast which makes less Fresh faeces samples were collected just after liable to produce methane. Manure managed by daily spread, defaecation and transported to the cattle yard, NDRI into the and pasture/range/paddock system are to be reported under closed flux chamber after weighing. direct soil emissions from animal production. The methane Estimation of methane from manure emission associated with the use of manure as fuel is also to Methane emission estimation from faeces of the equine be reported under the IPCC category fuel combustion. Thus, was estimated by closed flux chamber method (Hettiaratchi #*Part of Ph.D. Thesis of first author and corresponding author mail: [email protected]; 2Ex. Head & PS, DCN Division, NDRI, Karnal; 3Scientist, KVK, Dahod; 4Senior Scientist, EPC, Bikaner 273 Veterinary Practitioner Vol. 20 No. 2 December 2019 and Hansen, 1996). The base of the chamber was made of The average methane production was 1.4 and 9.31 g/day from metal body of 17.7 cm in height and 34 cm diameter, on which 10 and 20 kg manure, respectively. During the trial the average a plastic bucket (80 lit. capacity) was inverted and made air temperature was 30.7oC and average relative humidity recorded tight by filling water between the chamber jacket and inverted was 64%. bucket (Fig.1). A gas collection nozzle was put (motor-cycle The aim of this study was not to calculate the maximum tube’s valve) and sealed properly for drawing air having Table 1: Average methane production from horse dung in methane inside the chamber. At the morning 9.00 h of the 0 day fermentation chamber collection 20 and 10 kg of equine (horse) faeces was put into the chambers with 4 and 5 replicates, respectively. Then 4 Avg. Temp. CH4 (g/day) CH4 (g/day) (0C) (10 kg manure) (20 kg manure) samples of gas were collected for each day to estimate the Days methane production from the faeces every day at stipulated 1 34.0 5.56a0.3 18.21a0.1 time. Gas sampling was done by gas tight-syringe (100 ml) to 2 34.2 4.49b0.3 17.20b0.1 withdraw gas from the chamber and injected into a sealed-vial 3 33.0 3.27c0.3 16.09c0.1 (100 ml). 4 33.0 2.32d0.2 13.96d0.1 Collected gas samples were analyzed for methane 5 33.4 1.71e0.2 13.06e0.1 concentration by GLC (Gas-liquid chromatograph). Collection 6 34.2 1.19f0.2 12.12f0.2 was done for 49 days (seven weeks). 7 34.2 0.91g0.2 11.09g0.2 A close flux chamber or static chamber was used for 8 35.5 0.83h0.02 9.95h0.2 determination of gas emission by measuring the changes of 9 34.2 0.77hi0.05 9.13i0.2 gas concentration with time inside the closed chamber. When 10 30.4 0.71hij0.1 7.55j0.1 a close flux chamber is employed in measurement gas 11 31.1 0.69hijk0.05 6.65k0.1 emission, 12 31.5 0.66hijkl0.03 6.19kl0.1 13 30.0 0.63hijklm0.01 5.96l0.07 14 27.8 0.61ijklmn0.03 5.66l0.06 Methane reading from collected 15 30.5 0.58ijklmno0.05 5.35m0.05 gas (ppm) 16 29.4 0.55jklmno0.06 5.05mn0.05 1. CH4 (ppm/min) = G x (273+ToC)K 17 31.1 0.54jklmnop0.07 4.74no0.07 30.0 jklmnop nop CH (ppm/min) 18 0.52 0.1 4.45 0.08 4 klmnopq opq 2. CH µmol/L.min = 19 29.5 0.50 0.1 4.18 0.08 4 G (273+ToC) K 20 31.2 0.48lmnopqr0.1 3.91pqr0.08 21 29.2 0.46lmnopqr0.1 3.64qrs0.1 CH µl x (MW) mnopqrs rst 3. CH µl/µmole= 4 22 30.7 0.44 0.1 3.37 0.1 4 µmole 23 31.3 0.41nopqrst0.1 3.10stu0.1 24 32.1 0.39opqrstu0.1 2.83tuv0.1 µmole x µg x chamber area (L) 25 33.4 0.37pqrstuv0.1 2.56uvw0.1 4. CH4 (µg/min) = L.min x µ mole 26 31.0 0.35pqrrstuvw0.06 2.29vwy0.1 27 28.9 0.32qrstuvwx0.06 2.02wyz0.1 Where, MW = molecular weight of methane (24.97) 28 30.2 0.30rstuvwx0.05 1.75yzα0.1 G = gas constant (0.08206) 29 32.0 0.28stuvwxy0.05 1.52zα0.1 stuvwxyz zα Results and Discussion 30 31.0 0.26 0.05 1.42 0.1 tuvwxyz α The average methane production from the horse manure 31 31.0 0.23 0.05 1.40 0.1 28.3 uvwxyz α in two sets showed different patterns of methane release (Table 32 0.21 0.05 1.38 0.1 29.1 0vwxyz α 1 and 2). There was drastic decrease in the methane release 33 0.2 0.05 1.36 0.1 34 31.5 0.18vwxyz0.06 1.34α0.09 from the 10 kg replicate chambers on weekly basis. The 35 28.7 0.16wxyz0.07 1.31α0.09 average methane produced by 10 kg manure was 5.56 g/day 36 29.3 0.14xyz0.1 1.29α0.08 in the first week, and then was reduced to 0.83 g/day in the 37 29.1 0.14xyz0.07 1.27α0.08 second week. Thereafter, the reduction in methane release 28.5 0.14xyz0.05 1.41α0.1 rd th 38 was slow and was 0.58 g/day in 3 week, 0.44 g/day in 4 39 28.3 0.14xyz0.05 1.21α0.08 th th th week, 0.28 g/day in 5 week, 0.14 in 6 week, 0.10 in 7 week 40 31.5 0.20uvwxyz0.04 1.20α0.07 and 0.05 g was the final reading taken at the last day of the trial 41 29.8 0.20uvwxyz0.1 1.18α0.06 th (7 week). 42 26.2 0.16wxyz0.03 1.16α0.06 The methane production by 20 kg manure too followed 43 29.7 0.10yz0.03 1.13α0.06 th similar pattern of release. Up to 5 week there was 44 29.1 0.09yz0.03 1.1α0.05 approximately 50% decrease in methane release per week. 45 29.2 0.08z0.03 1.09α0.05 The methane release was 18.21 g/day in the first week, 9.95 g/ 46 29.9 0.08z0.02 1.07α0.05 day in the second week, 5.35 g/day in 3rd week, 3.37 g/day in 4th 47 28.4 0.07z0.02 1.05α0.04 week and 1.57 g/day in 5th week. 48 28.4 0.06z0.02 1.02α0.04 There after the reduction in methane release was slow 49 28.6 0.05z0.02 1.00α0.04 th th and was 1.29 in 6 week, 1.13 in 7 week and 1.00 g/day was *Means bearing different superscript in a column differ significantly the final reading taken at the last day of the trial on 7th week. (P<0.05).

274 Veterinary Practitioner Vol. 20 No. 2 December 2019

Fig.1: Fermentation chamber (closed flux) for Horse manure methane estimation methane potential of the dung for estimating the degradation efficiency of the dung, rather to tap the maximum potential of methane production. Manure production varies by animal type the dung to produce methane at the natural condition. The and is proportional to the animal’s weight. A typical 450 kg methane producing ability is an individual character of the feed horse produces about 17 kg of manure per day. Methane ingredients (Bala et al., 2015b). The methane production generation takes place in the volatile solids portion (VS) of the potential of manure depends on the specific composition of manure, which depends on diet. The average dry matter content the manure, which in turn depends on the composition and of horse manure is 23% and the volatile solids is 90% (DM digestibility of the animal diet (Bala et al., 2015a). There are basis). Majority of horses are with the poor farmers in India several factors which can influence the methane production and the management practices in our country rarely favour by an animal, viz. body weight, feed intake, class of animal higher production of methane from the horse manure. (physiology/work), type of feed given, manure management, In the present investigation the methane production was ambient temperature etc. These mentioned factors totally differ at par with the IPCC, (1997) default value of 2 tier of horse (10 in India from west. The amount of methane produced during gCH4/day), with 20 kg manure. However, 10 kg manure decomposition, is also influenced by the climate and the produced very lower average methane, may be due to the fact manner in which the manure is managed to dispose. Manure that the manure got dried fast due to less quantity and higher decomposes more rapidly when climate conditions encourage surface area. Horse manure has higher C: N ratio (22-50) bacterial growth and hot and humid climate increase methane than cattle (10-30), pig (10-20) and poultry (5-15), thus has generation. Methane production also depends on the type of higher methane production potential (AFRD, 2005). This manure management system used. In India dry manure resource can be used for biogas production or electricity management is generally practiced, thus reduces the production at farm level. possibility of higher methane production. References The average body weight of the indigenous horses is AFRD (2005) Manure Composting Manual. Agriculture Food and Rural about 350 kg and near 120 kg for Indian donkeys and 220 kg Development, Alberta. release less methane. Both quality and quantity of the feed, Bala PA, Kundu SS, Dutt C, Rani RR and Prusty S (2015a) Comparative together with the individual performance of the animals, have digestibility of forages by cattle and horses. Vet. Pract. 16: been found to determine the amount of energy that is lost by 4-6. Bala PA, Kundu SS, Dutt C, Rani RR and Prusty S (2015b) In vitro nutrient evaluation of energy supplements in Horses. Vet. Table 2: Total methane produced from per kg horse dung in fermentation Pract. 18: 180-185. chamber Hettiaratchi JPA and Hansen C (1996) Evaluation of a closed flux Avg. Relative CH4 CH4 chamber method to measure hand fill gas, Calgery, Canada. temp. humidity (g/day) (g/day) Intergovernmental Panel on Climate Change (IPCC) (1997) IPCC (0C) (%) (10kg (20kg Guidelines for National Greenhouse Gas inventories. manure) manure) intergovernmental panel on climate change, organization 30.7 65% 1.4 9.31 for economic co-operation and development. Paris, France.

275 Veterinary Practitioner Vol. 20 No. 2 December 2019

EFFECT OF FEEDING HYDROPONICS MAIZE FODDER ON MILK YIELD AND MILK CONSTITUENTS IN GIR COWS#

Abhishek Sharma1, Monika Joshi2 and S.K. Sharma3 Department of Animal Nutrition College of Veterinary and Animal Science, Navania, Vallabhnagar, Udaipur-313 601 Rajasthan University of Veterinary and Animal Sciences, Bikaner-334 001, Rajasthan, India

Received revised on: 26.06.2019 ABSTRACT Accepted on: 23.08.2019

A feeding trial of 120 days was conducted on 16 Gir cows distributed equally in four groups and fed different levels of hydroponics maize fodder. Significant (P<0.01) effect of feeding hydroponics maize fodder was observed on milk yield, milk fat percentage and milk total solids, whereas, the effect of feeding hydroponics maize fodder was non significant on milk SNF (solid not fat) and milk protein percentage. It was concluded from the feeding trial that hydroponics maize fodder had beneficial effect on milk production efficiency in Gir cows and can be fed as replacement up to 75 per cent level of CP of concentrate mixture.

Key words: Hydroponics maize fodder, Gir cows, milk yield

Introduction green fodder. Feeding of quality green fodder to dairy animals plays an The animals were completely milked twice in a day important role in sustainable and economical dairy farming. throughout the experimental period and the milk yield and milk However, various constraints are faced by the dairy farmers for constituents (fat, SNF, total solids and milk protein) were production of green fodder like small land holdings, recorded at fortnightly interval. The data obtained were unavailability of land for fodder cultivation, scarcity of water or statistically analysed as per Snedecor and Cochran (1994). saline water, non-availability of good quality fodder seeds, more labour requirement, requirement of manure and fertilizer, longer Results and Discussion growth period (45-60 days), fencing to prevent fodder crop from The per cent chemical composition of hydroponics maize wild animals, natural calamities etc. Furthermore, the non- fodder, concentrate mixture and basal roughage were availability of constant quality of fodder round the year estimated as per AOAC (2000) and presented in Table 1. aggravates the limitations of the sustainable dairy farming. The data of average fortnightly milk yield in different For sustainable dairy farming, quality green fodder should be treatment groups is presented in Table 2. The statistical fed regularly to dairy animals (Naik et al., 2012a). Due to the analysis of data revealed significant difference (P<0.01) in milk above constraints and the problems faced in the conventional yield of Gir cows from different treatment groups. The milk yield was 4.5, 12.04 and 13.78 per cent higher in T , T and T method of fodder cultivation, hydroponics is now emerging as 2 3 4 treatment groups, respectively than T group. Similar findings an alternative technology to grow green fodder for farm animals 1 (Naik et al., 2014 and Naik et al., 2015). Hydroponics fodder have also been reported by Grigor’ev et al. (1986), Reddy et al. has high feed quality, rich with proteins, fibres, vitamins and (1988) and Naik et al. (2014). Increase in milk yield might be minerals (Bhise et al., 1988; Chung et al., 1989). It has high due to higher DCP and TDN content of hydroponics maize metabolizable energy, crude protein and digestibility (El-Morsy fodder. et al., 2013). Hydroponics fodder may replace feed ingredients Average fat percentage in milk in different treatment groups in the diets and improve performance (Rodriguez et al., 2004). has been presented in Table 3. The fat percentage in milk was 14 and 18 per cent lower in T3 and T4 groups, respectively than

Materials and Methods T1 group. The statistical analysis of data revealed significantly

In present investigation, a feeding trial for 120 days was higher (P<0.01) fat percentage of milk in T1 group followed by conducted on 16 Gir cows, distributed equally in four groups T2, T3 and T4 groups. However, there was no significant and subjected to different treatments as described below: difference among average values of T2, T3 and T4 groups.

T1 -Basal Roughage + Concentrate mixture (Control). Findings of present investigation are in agreement with that of

T2 - Basal Roughage + Concentrate mixture + 25% CP of Grigor’ev et al. (1986) and Adjlane et al. (2016). concentrate mixture was supplied through Hydroponics maize Average SNF percentage in milk of different treatment green fodder. groups is presented in Table 4. There was non-significant

T3 -Basal Roughage + Concentrate mixture + 50% CP of effect of feeding of hydroponics maize fodder on SNF concentrate mixture was supplied through Hydroponics maize percentage in milk of Gir cows. Similar finding were also green fodder. observed by Raddy et al. (1991), Maity et al. (1996) and Misra et

T4 -Basal Roughage + Concentrate mixture + 75% CP of al. (1996). concentrate mixture was supplied through Hydroponics maize Average protein percentage in milk of Gir cows in different

#1Part of M.V.Sc. Thesis submitted by first author and present address: Teaching Associate, email: [email protected]; 2Assistant Professor, Deptt. of Animal Nutrition; 3Associate Professor & Head, Dept. of Vety. Medicine 276 Veterinary Practitioner Vol. 20 No. 2 December 2019

Table 1: Chemical composition of experimental feed (% DM basis) Table 5: Average protein percentage in milk of Gir cows in different treatment groups Parameter Hydroponics Concentrate Wheat maize fodder mixture straw Treatment groups Fortnights Mean DM 17.09 89.2 92.01 T1 T2 T3 T4 OM 97.25 89.31 88.63 I 3.00 2.75 2.75 3.25 2.93 CP 18.38 20.00 3.34 II 3.25 3.00 3.25 3.25 3.18 EE 3.53 4.1 1.45 III 3.50 3.25 3.25 3.00 3.25 CF 7.32 10.0 36.69 IV 3.50 3.25 3.00 3.00 3.18 NFE 68.03 55.32 47.17 V 3.50 3.25 2.75 3.00 3.12 VI 3.75 3.50 3.00 3.25 3.37 Table 2: Average milk yield (kg/cow) in different treatment groups VII 3.00 3.50 3.25 2.75 3.12 Treatment groups VIII 3.50 3.25 5.00 3.25 3.75 Fortnights Mean T1 T2 T3 T4 Mean 3.37 3.21 3.28 3.09 3.24 I 6.75 6.71 6.85 6.96 6.82 SEM: Treatment = 0.074014, Period = 0.097911 II 6.50 6.50 7.00 7.25 6.81 III 6.50 6.75 7.25 7.25 6.93 Table 6: Average milk total solid percentage in different treatment groups IV 6.50 6.25 7.00 7.25 6.75 V 6.50 6.25 7.00 7.25 6.62 Treatment groups VI 6.00 6.75 7.25 7.00 6.75 Fortnights Mean T1 T2 T3 T4 VII 6.00 7.00 7.25 7.00 6.81 I 12.75 12.75 13.00 13.75 13.06 VIII 6.25 6.75 7.00 7.50 6.87 Mean 6.31a 6.60b 7.07c 7.18c 6.79 II 12.75 13.25 14.00 13.75 13.43 III 13.00 13.00 13.25 13.50 13.18 SEM: Treatment = 0.063821, Period = 0.084427; Means bearing IV 13.00 13.50 13.50 14.00 13.50 different superscripts within a row and column differ V 13.00 12.50 13.50 14.00 13.25 significantly (P<0.01) VI 13.00 12.75 13.75 14.00 13.37 VII 13.00 13.00 13.50 14.00 13.37 Table 3: Mean milk fat percentage in different treatment groups VIII 13.00 13.25 14.00 14.00 13.56 Mean 12.93a 13.00a 13.56b 13.87c 13.34 Treatment groups Fortnights Mean SEM: Treatment = 0.077551, Period = 0.102591; Note: means bearing T1 T2 T3 T4 I 4.75 4.25 4.00 4.00 4.25 different superscripts within a row and column differ significantly II 4.75 4.00 4.00 3.75 4.12 (P<0.01) III 4.50 4.00 4.25 3.75 4.12

IV 4.50 4.00 3.75 3.50 3.93 total solid percentage in T4 group than T1, T2 and T3 groups. V 4.50 4.00 4.00 3.75 4.06 The results of present investigation are in agreement with VI 4.50 4.00 4.00 3.75 4.06 that of Naik et al. (2014). VII 4.50 4.00 3.50 3.75 3.93 It could be concluded from study that feeding of VIII 4.50 3.75 3.75 3.50 3.87 b a a a hydroponics maize fodder so as to replace concentrate Mean 4.56 4.00 3.90 3.71 4.04 mixture up to 75 per cent level on CP basis increase the SEM: Treatment = 0.106928, Period = 0.141453; means bearing milk yield in Gir cows with decreased in the fat percentage different superscripts within a row and column differ and increase in milk total solids. Thus, hydroponics maize significantly (P<0.01) fodder may be included at the level of 75 per cent CP of Table 4: Mean solid not fat percentage in different treatment concentrate mixture in diet and may be fed to cows to groups improve milk production.

Treatment groups References Fortnights Mean T1 T2 T3 T4 Adjlane S, Ahmed A, Bafdel M and Benhacine R (2016) Techno- I 8.75 8.75 8.25 8.75 8.62 Economic Approach to Hydroponic Forage Crops: Use II 8.75 8.75 8.50 8.75 8.68 for Feeding Dairy Cattle Herd. J. Appl. Environ. Biol. III 8.75 8.75 8.50 8.75 8.68 Sci. 6(3)83-88. IV 9.00 8.75 8.50 8.75 8.75 AOAC (2000) Official methods of analysis, 17th edn., Association V 8.75 9.00 8.75 8.50 8.75 of Official Analytical Chemists, Washington, D.C. VI 8.75 8.75 8.75 8.25 8.62 Bhise V, Chavan J and Kadam SS (1988) Effects of malting on VII 8.00 9.00 8.25 8.50 8.43 proximate composition and in vitro protein and starch VIII 8.25 8.50 8.50 8.00 8.31 digestibilities of grain sorghum. J. Food Sci. Technol. Mean 8.62 8.78 8.50 8.53 8.60 25: 327-329. Chavan J and Kadam SS (1989) Nutritional improvement of SEM: Treatment = 0.073133, Period = 0.096746 cereals by sprouting. Food Sci. Nutr. 28: 401-437. treatment groups presented in Table 5. Statistically, non- Chung T, Nwokolo EN and Sim JS (1989) Compositional and digestibility changes in sprouted barley and canola significant effect of feeding of hydroponics maize fodder was seeds. Plant Foods Human Nutr. 39: 267-278. observed on milk protein percentage. It was in agreement with EI-Morsy AT, Abul-Soud M and Eman MSA (2013) Localized the findings of Maity et al. (1996) and Misra et al. (1996). hydroponic green forage technology as a climate Average total solid percentage in milk of Gir cows in change adaptation under Egyptian conditions. Research different groups is presented in Table 6. The statistical J. Agr. Biol. Sci. 9 (6): 341-350. analysis of data revealed significantly (P<0.01) higher Grigor’ev NG, Fitsev AI and Lesnitskaya TI (1986) Nutritive value

277 Veterinary Practitioner Vol. 20 No. 2 December 2019

of hydroponic feed and its use for feeding high-yielding Naik PK, Dhuri RB, Swain BK and Singh NP (2012) Nutrient cows. Sel’skokhozyaistvennaya Biologiya. 7: 47-50. changes with the growth of hydroponics fodder maize. ICAR (1985) Nutrient requirements of livestock and poultry. 1st Indian J. Anim. Nutr. 29(2): 161-163. edn. ICAR Publication and Information Divisions, New Naik PK, Swain BK and Singh NP (2015) Review- production and Delhi. utilization of hydroponics fodder. Indian J. Anim. Nutr. Kramer CY (1957) Extension of multiple range tests to group 32(1): 1-9. correlation adjusted means. Biometrics. 13: 13. Reddy MR, Reddy DN and Reddy GVK (1991) Supplementation Lorenz K (1980) Cereal sprouts: composition, nutritive value, of barley fodder to paddy straw based rations of food applications. Crit. Rev. Food Sci. Nutr. 13(4): 353- lactating crossbred cows. Indian J. Anim. Nutr. 8(4): 385. 174-277. Maity SB, Singh NP and Misra AK (1996) Effect of replacement Rodriguez-Muela C, Rodriguez HE, Ruiz O, Flores A, Grado JA of concentrate mixture by artificially grown barley and Arzola C (2004) Use of green fodder produced in fodder on energy utilization and milk production in hydroponic system as supplement for lactating cows crossbred cows. Indian J. Anim. Nutr. 13(4): 231-233. during dry season. In: Proc. Am. Soc. Anim. Science Misra AK, Maity SB and Upadhyay VS (1996) Nutritional pp. 271-274. evaluation of barley fodder grown under artificial Sneath R and Mclntosh F (2003) Review of hydroponic fodder conditions. Indian J. Anim. Sci. 66(8): 958-960. production for beef cattle. Queensland Government, Naik PK, Dhuri RB, Karunakaran M, Swain BK and Singh NP Department of Primary Industries. Dalby, Queensland. (2014) Effect of feeding hydroponics maize fodder on Snedecor CW and Cochran WG (1994) Statistical Method. 8thedn., digestibility of nutrients and milk production in lactating Lowa state University Press, Ames, USA. cows. Indian J. Anim. Sci. 84(8): 880-883.

278 Veterinary Practitioner Vol. 20 No. 2 December 2019

EFFECT OF NUTRITIONAL STATUS AND MANAGEMENT SYSTEMS ON HAEMATOLOGICAL AND BIOCHEMICAL PARAMETERS OF SAHIWAL CALVES#

V. Kumar1, V. K. Chaudhary2, M. L. Chaudhary3 and S.R. Gupta4 Centre for Organic Animal Products Technology, College of Veterinary and Animal Science Rajasthan University of Veterinary and Animal Sciences, Bikaner-334 001, Rajasthan, India

Received on: 22.08.2019 ABSTRACT Accepted on: 23.11.2019

In the present study the average values of haemoglobin, packed cell volume and N: L ratio were 11.05±0.060, 11.10±0.054, 11.08±0.050 and 11.06±0.064 gm/dl and 30.61±0.0149, 30.55±0.171, 30.82±0.151 and 30.35±0.085 and 0.900±0.001, 0.901±0.001, 0.902±0.001and 0.900±0.001, in 100 per cent ICAR feeding, 120 per cent ICAR feeding, routine management and improved management systems, respectively. The packed cell volumes was significantly (P<0.05) influenced by management systems. The average values of serum glucose and total serum protein were 41.64±1.45, 42.21±1.30, 41.54±1.40 and 42.30±1.36 mg/dl and 6.78±0.039, 6.83±0.048, 6.72±0.026 and 6.89±0.028 gm/dl in 100 per cent ICAR feeding, 120 per cent ICAR feeding, routine management and improved management systems, respectively. Total serum protein was highly significant influenced (P<0.01) by management systems. The average values of serum albumin and serum cholesterol were 2.84±0.015, 2.86±0.017, 2.82±0.011 and 2.88±0.012 mg/dl and 133.59±1.819, 138.23±1.505, 134.85±1.987 and 136.97±1.826 mg/dl in 100 per cent ICAR feeding, 120 per cent ICAR feeding, routine management and improved management systems, respectively. The serum Albumin was highly significant influenced (P<0.01) by management systems. The average values of serum creatinine and serum triglycerides were 1.01±0.010, 1.04±0.011, 1.02±0.009 and 1.03±0.014 mg/dl and 5.28±0.328, 5.33±0.295, 5.28±0.303 and 5.33±0.321 gm/dl in 100 per cent ICAR feeding, 120 per cent ICAR feeding, routine management and improved management systems, respectively. Total serum protein was highly significant influenced (P<0.01) by management systems. The average values of SGPT and SGOT were 29.69±0.149, 29.85±0.160, 30.00±0.063 and 29.54±0.162 IU/L and 83.59±0.847, 83.66±0.805, 84.64±0.641 and 82.61±0.738 in 100 per cent ICAR feeding, 120 per cent ICAR feeding, routine management and improved management systems, respectively. The SGPT was significantly influenced (P<0.05) by management systems.

Key words: Sahiwal calves, haematological parameters, biochemical parameters, ICAR feeding, improved management

Introduction which can exceed their ability to dissipate body heat. The Dairy sector is economically and socially very significant ensuing heat stress has important implications for cattle in India due to the multifunctionality of dairy animals performing welfare as well as a negative impact on health and production; output, input, asset and socio cultural function. Farmers are in extreme cases resulting in death. It has been observed that always aiming at achievement of higher productive radiation energy flow on animal is 685 kcal/m²h, but actually performance along with lower feed consumption i.e., best only 340 kcal/m²h is from the direct solar radiation and rest is utilization. In order to achieve the best performance of growing by reflected by floor, dust, wall etc (Thomas and Sastry, 2007). fattening animals, farmer should select the basal carbohydrate Every year, loss in milk production due to heat stress causes (concentrate) resource according to availability, potential huge financial loss in our country. Though indigenous breeds ferment ability and price. Now a days the price of animal feed of cattle are more thermo-tolerant, crossbred and exotic breeds stuffs, especially concentrate is going up leading to higher of cattle are highly sensitive to heat stress. Buffaloes are more prices of the animal products (milk, meat etc). To produce low prone to this owing to their black skin that absorbs more solar price meat, feed intake should be programmed in order to radiations and fewer sweat glands compromising heat lower the concentrate ratio in the diet. This could be achieved dissipation through evaporative heat loss. Heat stress can be by restriction of concentrates with ad libitum feeding of alleviated through housing management, making provision of roughages. cooling devices and nutritional management. Considering the tropical climate of Indian subcontinent, the summer stress is a major problem in managing dairy Materials and Methods animals in India. During the extreme hot humid or hot dry Twenty four female Sahiwal calves between 4 to 8 months weather, thermoregulatory capability of animals to dissipate of age were selected from the herd of Sahiwal cattle breeding heat by sweating and panting is compromised and summer/ farm, Livestock Research Station Kodamdesar, Rajasthan heat stress occurs. Continued exposure to the direct sun University of Veterinary and Animal Sciences, Bikaner. These results in loss of body water through evaporation resulting in calves were divided into four groups of six calves each on the dryness of skin, increased rectal temperature, respiration and basis of nearness in their body weight and age. The pulse rates, off-feed and cessation of rumination leading to experimental groups were randomly allocated to one of the higher calf mortality, poor growth rate during summer following treatments Table 1. (Hemsworth et al., 1995). Generally calves are housed in Managemental systems groups in confined outdoor yards during day that leave them Routine management exposed to episodes of high environmental temperatures, House having covered area with coated tin shed roofing #1Part of Ph. D Thesis, submitted by first author and corresponding author present address: Assistant Professor and Principal Investigator, Centre for Organic Animal Products Technology, RAJUVAS.; Email:[email protected]; 2Professor; and Head; 3,4Assistant Professor 279 Veterinary Practitioner Vol. 20 No. 2 December 2019 and concrete floor and open area with kachha floor having free 5 minutes at 12,000 rpm in microhaematocrit centrifuge access of feeding and water trough. Surrounded by four feet machine. After centrifugation, packed cell volume was fencing with galvanized iron pipes. determined with the help of a special microhaematocrit reader scale. The bottom of the red column of capillary tube was Improved management adjusted with the zero line and the plasma level was matched Improved management in summer months having with the hundred lines and top of red column excluding buffy additional facilities of white painting over roof of tin sheds, layer was read in per cent. feeding dry fodder in cool hour (i.e. 7:00 PM to 6:00 AM), prevention of calves from hot wind (Loo) and water splashing Neutrophil-lymphocyte ratio twice daily than routine managements. Thin smears of blood were prepared on dust, lint and grease free clean microscopic slides, immediately after the Feed and feedings collection of blood and were air dried. These were then fixed All the experimental calves in each group were fed as per for five minutes with methyl alcohol (methanol). The slides ICAR recommendations (ICAR 1985). The calves were fed were dried and placed on a staining rack and flooded with groundnut fodder and wheat straw during the experimental Giemsa’s stain (BDH) freshly diluted in the ratio of 1:10 and period. A concentrate mixture containing crushed wheat, allowed to act for 30 minutes. The slides were washed with groundnut cake and wheat bran was prepared. The neutral distilled water; air dried and examined under oil concentrate mixture contained 21.50 per cent crude protein immersion lens of the microscope for differential leucocytes and 77.10 per cent total digestible nutrients. The allowance of counts. One hundred cells were counted. Neutrophils, concentrate mixture was fixed in such a way that calves of T3 lymphocytes, monocytes, eosinophils and basophils were and T4 got 20 per cent higher than calves of T1 and T2 at differentiated and expressed in per cent and neutrophil- normal ICAR recommended levels of protein per head per lymphocyte ratio was calculated. day. A weighed amount of groundnut fodder was fed to all the calves daily and its protein content was taken into consideration Serum biochemical parameters while fixing the allowance of concentrate mixture for each group. Serum samples were analyzed for biochemical The quantity of different feeds fed to each calf was adjusted at parameters like serum glucose, total serum protein, serum fortnightly intervals in order to meet the requirements of the albumin, serum triglycerides, serum cholesterol, serum calves with the change in their body weight. creatinine, serum alanine transaminase (ALT, SGOT), and Blood samples of experimental Sahiwal calves (three serum aspartate transaminase (AST, SGPT) by Vet Test calves selected from each treatment group) were collected at Chemistry Analyzer using kit supplied by IDEXX laboratories, monthly interval by puncturing jugular vein following aseptic as per the manufacturers subscribed procedure. measures. Blood samples were collected into 15 ml centrifuge tubes and allowed to clot. Serum was separated from the Statistical analysis blood sample after centrifuge at 3000 rpm for 7 min. Separated The experiment was planned and analyzed as 2 x 2 serum samples were stored in deep freez (-20ºC). Serum Factorial Randomized Block Design (Snedecor and Cochran, samples were utilized for estimation of biochemical 1994). The differences among treatment means were tested parameters like serum glucose, total serum protein, serum for significance by performing Duncan´s Multiple Range Test. albumin, serum triglycerides, serum cholesterol, serum Results and Discussion creatinine, serum alanine transaminase (ALT, SGOT), and Haematological parameters serum aspartate transaminase (AST, SGPT). Fresh blood The mean values of haemoglobin, packed cell volumes samples were utilized for haematological observations like and lymphocyte: neutrophil ratio of different treatment groups haemoglobin percent, packed cell volume, neutrophil- and corresponding values under two levels of feeding and lymphocyte ratio. All fresh blood and serum samples were management systems have been presented in Table 2 and analyzed in TVCC, laboratory in Department of Veterinary their analysis of varience in Table 3. Medicine, College of Veterinary and Animal Science, Rajasthan University of Veterinary and Animal Sciences, Bikaner. Haemoglobin The mean values of haemoglobin in treatment groups Haematological parameters T1, T2, T3 and T4 were 11.06±0.076, 11.03±0.109, 11.10±0.080 Haemoglobin and 11.09±0.090 gm/dl, respectively. The corresponding Haemoglobin in g/dl was determined by Sahli-Hellige values of haemoglobin in 100 per cent, 120 per cent ICAR haemoglobinometer. feeding, routine and improved management systems were Packed cell volume 11.05±0.060, 11.10±0.054, 11.08±0.050 and 11.06±0.064 gm/ For determination of packed cell volume, microhaematocrit dl. The haemoglobin values were almost similar in all the method was adopted. Non-heparinized capillary tubes were treatment groups. The lower haemoglobin values may be due filled with blood up to three- fourth of total length. The blood to haemodilution, by which more water is transported in the adhered over the end of capillary tubes was wiped off with the circulatory system for evaporative cooling (Banerjee and help of a moist filter paper. The opposite ends of tubes were Asutosh, 2010). High haemoglobin values are associated with sealed over the spirit lamp by rotating between the thumb and high adaptability to extreme conditions of temperature and it the index finger for 2-3 seconds over the flame near its base. has been suggested that this character might be an index of After perfect sealing of the end, the tubes were centrifuged for their superior heat tolerance (Bianca, 1965).

280 Veterinary Practitioner Vol. 20 No. 2 December 2019

Analysis of variance showed that the levels of feeding and The results of the present study are in agreement with management systems did not affect the Haemoglobin Soni et al. (1982); Kumar and Gupta (1991); Singh (1996 and concentration significantly in calves of different treatment 2000). They observed increased blood glucose in buffalo groups. heifers subjected to variables like wetting and cool hours Present findings are similar with Lohakare et al. (2006) feeding, thatch, etc. reported in cross bred calves that no significant influence of The level of glucose in the blood is important parameters the dietary treatments on haemoglobin. to determine the glucose concentration in the interstitial fluid, which in turn has an influence on the rate of transportation of Packed cell volume blood glucose to the individual cells. The high environmental The average values of packed cell volumes in treatment temperature increase secretion of adrenaline causing increase groups T1, T2, T3 and T4 were 30.85±0.218, 30.38±0.085, glycolysis, which may probably be the reason for low glucose 30.78±0.257 and 30.33±0.171 per cent, respectively, the level at high temperature. corresponding values of Haemoglobin in 100 per cent, 120 Analysis of variance showed that the serum glucose level per cent ICAR feeding, routine and improved management did not influence significantly by levels of feeding and systems were 30.61±0.149, 30.55±0.171, 30.82±0.151 and management systems. The interaction between the levels of 30.35±0.086, respectively. The mean values of PCV was feeding and management systems was also found non significantly (P<0.05) higher in routine management systems significant. in comparison to improved management systems. Similar results were found by Nagpal (2011) reported that Analysis of variance showed the Packed cell value was dietary protein levels on glucose levels did not vary among the significantly (P<0.05) influenced by management systems groups. Bahga et al. (2009) and Singh et al. (2008) found non- while levels of feeding did not affect significantly. The interaction significant difference in glucose level in crossbred calves during between the levels of feeding and management systems was summer stress. non significant. Similar finding were obtained by Lohakare et al. (2006) Total serum protein reported in cross bred calves that no significant influence of The mean values of total serum protein in treatment groups the dietary treatments on packed cell volume. Results obtained T1, T2, T3 and T4 were 6.70±0.038, 6.86±0.017, 6.74±0.038 by Okab et al. (2008) reported that packed cell volumes (PCV) and 6.91±0.053 gm/dl, respectively. The corresponding values was decreased, during summer compared with spring. of total serum protein in 100 per cent, 120 per cent ICAR feeding, routine and improved management systems were 6.78±0.039, Neutrophil : lymphocyte ratio 6.83±0.048, 6.72±0.026 and 6.89±0.028 gm/dl, respectively. The average values of N: L ratio in treatments T1, T2, T3 Total serum protein was significantly higher (P<0.01) in calves and T4 were 0.903±0.000, 0.898±0.002, 0.900±0.002 and kept under improved managements systems in comparison 0.902±0.001, respectively. The corresponding values of N: L to calves reared under routine management systems. The ratio in 100 per cent, 120 per cent ICAR feeding, routine and results are in general agreement with the findings of Nagpal improved management systems were 0.900±0.001, (2011) reported that dietary protein levels on total protein, levels 0.901±0.001, 0.902±0.001 and 0.900±0.001, respectively. The did not vary among the groups. Singh (1982); Kumar and Gupta average values of N: L ratio in all treatments was almost similar. (1991); Yazdani (1996) and Singh (2000) found higher blood Analysis of variance showed that the N : L ratio did not protein level in animals protected against thermal stress. influence significantly by levels of feedings and management Analysis of variance showed that total serum protein was systems. The interaction between the levels of feeding and significantly (P<0.01) influenced by management systems management systems was non significant. while feeding level did not significantly influenced. The Serum biochemical parameters interaction between the levels of feeding and management The average value of serum glucose, total serum protein, systems was non significant. serum albumin, serum cholesterol, serum creatinine, serum Similar results were found by Wadhwa and Bakshi (2006) alkaline transaminase (ALT), serum aspartate transaminase reported that feeding system did not affected significantly on (AST) and serum triglycerides of different treatment groups total serum protein. Lohakare et al. (2006) reported in cross and corresponding values for under two levels of feeding and bred calves that no significant influence of the dietary management systems have been presented in Table 4 and treatments on total protein were found in normal physiological their analysis of variance in Table 5. range. Vijayakumar (2005) reported significantly higher (P<0.01) total serum protein in buffalo heifers treated with heat Serum glucose ameliorative measures as compared to control group during The average values of serum glucose in treatment groups summer. Shrikhande et al. (2008); Scharf et al. (2010); Podar T1, T2, T3 and T4 were 41.33±2.277, 41.95±2.368, 41.76±2.152 and Orion (2003) and Rasooli et al. (2004) reported that high and 42.66±1.910 mg/dl, respectively. The corresponding environmental temperature causes increase in total plasma values of serum glucose in 100 per cent, 120 per cent ICAR protein of milking cattle. feeding, routine and improved management systems were 41.64±1.475, 42.21±1.302, 41.54±1.404 and 42.30±1.369 mg/ Serum albumin dl, respectively. The mean values of serum glucose were slightly The mean values of serum albumin in treatment groups higher in calves fed higher plane of nutrition and kept under T1, T2, T3 and T4 were 2.81±0.150, 2.87±0.017, 2.84±0.021 improved management systems. and 2.89±0.019 gm/dl, respectively. The corresponding values

281 Veterinary Practitioner Vol. 20 No. 2 December 2019 of serum albumin in 100 per cent, 120 per cent ICAR feeding, were 5.28±0.328, 5.33±0.295, 5.28±0.303 and 5.33±0.321 mg/ routine and improved management systems were 2.84±0.015, dl, respectively. The serum triglycerides were found slightly 2.86±0.017, 2.82±0.011 and 2.88±0.012 gm/dl, respectively. higher in calves fed higher plane of nutrition and kept under The average values of serum albumin was significantly high improved management systems. (P<0.01) in calves reared under improved management Analysis of variance showed the serum triglycerides level systems in comparison to routinely managed calves. did not significantly affected by levels of feedings and Analysis of variance showed that serum albumin was management systems. The interaction between the levels of highly (P<0.01) influenced by management systems while feeding and management systems was non significant. feeding level did not significantly influenced the serum albumin Similar results were found by Nagpal (2011) reported that level. The interaction between the levels of feeding and dietary protein levels on total glycerides, did not vary among management systems was found non significant. the groups. Wadhwa and Bakshi (2006) reported that feeding Similar results were obtained by Nagpal (2011) reported system did not affect significantly serum triglyceride of buffalo that dietary protein levels on albumin levels did not vary among calves and was found in normal physiological range. the groups. Wadhwa and Bakshi (2006) reported that feeding system did not affected significantly on albumin. Lohakare et Serum alkaline transaminase al. (2006) reported in cross bred calves that no significant The mean values of serum alkaline transaminase (ALT, influence of the dietary treatments on serum albumin and found SGPT) were 29.90±0.047, 29.47±0.251, 30.09±0.095 and in normal physiological range. Shrikhande et al. (2008) 29.61±0.251 IU/L in treatment groups T1, T2, T3 and T4, reported higher serum albumin (3.30 g/dl) in cattle during respectively. The corresponding values of serum alkaline summer. transaminase in 100 per cent, 120 per cent ICAR feeding, routine management and improved management systems Serum cholesterol were 29.69±0.149, 29.85±0.160, 30.00±0.063 and 29.54±0.162 The mean values of serum cholesterol in treatment IU/L, respectively. The serum alkaline transaminase level found groups T1, T2, T3 and T4 were 132.61±3.305, 134.57±02.163, significantly lower (P<0.05) in calves reared under improved 137.09±01.952 and 139.38±2.493 mg/dl, respectively. The management systems in comparison to routinely managed corresponding values of serum cholesterol in 100 per cent, calves. 120 per cent ICAR feeding, routine and improved management Analysis of variance showed that serum alkaline systems were 133.59±1.819, 138.23±1.505, 134.85±1.987 and transaminase was significantly (P<0.05) influenced by 136.97±1.826 mg/dl, respectively. management systems while feeding level did not significantly Analysis of variance showed the serum cholesterol level influenced the serum alkaline transaminase level. The did not significantly affected by levels of feedings and interaction between the levels of feeding and management management systems. The interaction between the levels of systems was found non significant. feeding and management systems was non significant. Similar In present experiment serum alkaline transaminase level results were found by Nagpal (2011) reported that dietary protein falls under normal range (11-40 IU/L) (Radostits et al. 2007). levels on cholesterol levels did not vary among the groups. Similar findings were obtained by Nagpal (2011) reported that Wadhwa and Bakshi (2006) reported that feeding system did dietary protein levels on serum alkaline transaminase, levels not affect significantly Cholesterol of buffalo calves and was did not vary among the groups. Nazifi et al. (2003) also found in normal physiological range. supported the finding and reported increased serum alkaline transaminase activity at hot temperature as compared to cooler Serum creatinine temperatures. Brijesh (2012) observed significantly higher The mean values of serum creatinine were 1.02±0.112, (P<0.05) level of SGPT in heat stress cattle. Marai et al. (1997) 1.00±0.019, 1.03±0.017 and 1.05±0.017 mg/dl in treatment also reported an increase in serum SGPT activity (179 vs 228 groups T1, T2, T3 and T4, respectively. The corresponding IU/L) in summer as compared to winter in the calves. Kumar et values of serum creatinine in 100 per cent, 120 per cent ICAR al. (2016) reported that different protein levels plasma enzymes feeding, routine and improved management systems were alanine amiontransferase (ALT) were comparable among all 1.01±0.010, 1.04±0.011, 1.02±0.009 and 1.03±0.014 mg/dl, groups and were within normal physiological range in Sahiwal respectively. Analysis of variance showed the serum creatinine calves. level did not significantly affected by levels of feedings and management systems. The interaction between the levels of Serum aspartate transaminase feeding and management systems was non significant. The mean values of serum aspartate transaminase (AST, Present results are in line with Wadhwa and Bakshi (2006) SGOT) were 85.23±0.497, 81.95±0.801, 84.04±1.207 and reported that feeding system did not affect significantly 83.28±1.280 IU in treatment groups T1, T2, T3 and T4, creatinine of buffalo calves and was found in normal respectively. The corresponding values of serum aspartate physiological range. transaminase in 100 per cent , 120 per cent ICAR feeding, routine and improved management systems were Serum triglycerides 83.59±0.847, 83.66±0.0805, 84.64±0.641 and 82.61±0.738 The mean values of serum triglycerides were 5.25±0.509, IU/L, respectively. The mean values of serum aspartate 5.30±0.529, 5.31±0.445 and 5.35±0.486 mg/dl in treatment transaminase were slightly higher in calves fed higher plane groups T1, T2, T3 and T4, respectively. The corresponding of nutrition and kept under routine management systems. values of serum triglycerides in 100 per cent, 120 per cent Analysis of variance showed that the serum aspartate ICAR feeding, routine and improved management systems 282 Veterinary Practitioner Vol. 20 No. 2 December 2019

Table 1: Feedings and managements of calves transaminase level did not significantly affected by levels of feeding and management systems while serum aspartate Sr. Treatment Treatments transaminase activity increases in the calves kept under routine No. Group management systems due to heat stress. The interaction 1 T1 100 per cent ICAR feeding and routine management 2 T2 100 per cent ICAR feeding and improved management between the levels of feeding and management systems was 3 T3 120 per cent ICAR feeding and routine management found non significant. 4 T4 120 per cent ICAR feeding and improved management The present findings are also supported by Marai et al. (1997); Srinandkumar et al. (2003); Calmari et al. (2011); Nazifi Table 2: Mean ± SE values and effect of feeding levels and management et al. (2003) and Brijesh (2012) as they reported an increase in systems on haematological parameters serum SGOT activity during thermal stress under different Variable Haemoglobin Packed cell Neutrophil– (gm/dl) volume lymphocyte situation. Nagpal (2011) reported that dietary protein levels on (%) ratio SGOT, levels did not vary among the groups. Okab et al. (2008) Feeding Level NS NS NS reported the AST activity was not significantly affected by the 100% ICAR (F1) 11.05±0.060 30.61±0.149 0.900±0.001 season. 120% ICAR (F2) 11.10±0.054 30.55±0.171 0.901±0.001 Management systems NS S* NS References Routine Management (M1) 11.08±0.050 30.82±0.151b 0.902±0.001 AOAC (1990) Official Method of Analysis (15th Ed.). Association of Improved Management (M2) 11.06±0.064 30.35±0.086a 0.900±0.001 Official Analytical Chemists, Washington, D.C. Interaction (FLXMS) NS NS NS AOAC (1995) Official Methods of Analysis. 15th edn. Association of T1 (F1M1) 11.06±0.076 30.85±0.218 0.903±0.000 Official Analytical Chemists, Washington, DC. T2(F1M2) 11.03±0.109 30.38±0.085 0.898±0.002 Bahga CS, Sikka SS and Saijpal S (2009) Effect of seasonal stress on T3 (F2M1) 11.10±0.080 30.78±0.257 0.900±0.002 growth rate and serum enzyme levels in young crossbred T4 (F2M2) 11.09±0.090 30.33±0.171 0.902±0.001 calves. Indian J. Anim. Res. 43(4): 288-290. Banerjee D and Ashutosh (2011) Effect of thermal exposure on diurnal Means with different superscripts differ significantly at (P<0.05), highly rhythms of physiological parameters and feed, water intake significant at (P<0.01) in Tharparkar and Karan Fries heifers. Bio. Rhy. Res. Table 3: Analysis of variance of data on haematological parameters 42(1):39-51. Bianca W (1965) Reviews of the progress of dairy science. Section Mean Sum of Square A. Physiology: Cattle in a hot environment. J. Dairy Res. 32: d. f. Haemoglobin Packed Neutrophil : 291-345. Source (gm/dl) cell lymphocyte volume (%) ratio Brijesh Y (2012) Physio-biochemical responses and methane emission Feeding 1 0.0075 0.010629 0.0000000908 during thermal stress in cattle. Ph.D. Thesis submitted to levels (FL) Deemed University, Indian Veterinary Research Institute, Management 1 0.001365 0.6466* 0.00000099 Izatnagar, Bareilly, Uttar Pradesh. systems (MS) FL x MS 1 0.0000012 0.000425 0.0000046 Calamari L, Petrera F, Abeni F and Bertin G (2011) Metabolic and Error 8 0.024458 0.113095 0.000000956 haematological profiles in heat stressed lactating dairy cows fed diets supplemented with different selenium sources *Significantly at (P<0.05), **highly significant (P<0.01)

Table 4: Mean ± SE values and effect of feeding levels and management systems on serum biochemical parameters

Variable Serum Total serum Serum Serum Serum Serum Serum alanine Serum glucose protein albumin cholesterol creatinine triglycerides transaminase aspartate (mg/dl) (gm/dl) (gm/dl) (mg/dl) (mg/dl) (mg/dl) (ALT) IU/L transaminase (AST) IU/L Feeding Level NS NS NS NS NS NS NS NS 100% ICAR 41.64 6.78 2.84 133.59 1.01 5.28 29.69 83.59 (F1) ±1.475 ±0.039 ±0.015 ±1.819 ±0.010 ±0.328 ±0.149 ±0.847 120% ICAR 42.21 6.83 2.86 138.23 1.04 5.33 29.85 83.66 (F2) ±1.302 ±0.048 ±0.017 ±1.505 ±0.011 ±0.295 ±0.160 ±0.805 Management NS S** S** NS NS NS S** NS systems Routine 41.54 6.72 2.82 134.85 1.02 5.28 30.00 84.64 Management ±1.404 ±0.026a ±0.011b ±1.987 ±0.009 ±0.303 ±0.063b ±0.641 (M1) Improved 42.30 6.89 2.88 136.97 1.03 5.33 29.54 82.61 Management ±1.369 ±0.028b ±0.012a ±1.826 ±0.014 ±0.321 ±0.162a ±0.738 (M2) Interaction NS NS NS NS NS NS NS NS (FLXMS) T1 (F1M1) 41.33 6.70 2.81 132.61 1.02 5.25 29.90 85.23 ±2.277 ±0.038 ±0.150 ±3.305 ±0.012 ±0.509 ±0.047 ±0.497 T2(F1M2) 41.95 6.86 2.87 134.57 1.00 5.30 29.47 81.95 ±2.368 ±0.017 ±0.017 ±2.163 ±0.019 ±0.529 ±0.251 ±0.801 T3 (F2M1) 41.76 6.74 2.84 137.09 1.03 5.31 30.09 84.04 ±2.152 ±0.038 ±0.021 ±1.952 ±0.017 ±0.445 ±0.095 ±1.207 T4 (F2M2) 42.66 6.91 2.89 139.38 1.05 5.35 29.61 83.28 ±1.910 ±0.053 ±0.019 ±2.493 ±0.017 ±0.486 ±0.251 ±1.280 Means with different superscripts differ *significantly at (P<0.05), **highly significant at (P<0.01)

283 Veterinary Practitioner Vol. 20 No. 2 December 2019

Table 5: Analysis of variance of data on serum biochemical parameters Mean sum of square Source d. f Serum Total Serum Serum Serum Serum Serum Serum glucose serum albumin cholesterol creatinine triglycerides alanine aspartate (g/dl) protein (g/dl) (mg) (mg/dl) (mg/dl) transaminase transaminase (g/dl) (ALT) IU/L (AST) U/L Feeding levels 1 0.979592 0.0075 0.001701 64.66863 0.002058 0.0075 0.083335 0.015306 (FL) Management 1 1.741497 0.0809** 0.0097** 13.47091 0.0000017 0.006139 0.61393* 12.28744 systems (MS) FL x MS 1 0.061224 0.000154 0.000067 0.083333 0.000833 0.000153 0.001701 4.777213 Error 8 14.30782 0.004659 0.00085 19.2297 0.000833 0.731871 0.103741 2.989793 *Significantly at (P<0.05), **highly significant (P<0.01)

and doses. Livest. Sci. 142: 128-137. Weaber RL and Spiers DE (2010) Evaluation of physiological Hemsworth PH, Banetta JL, Beveridge L, Matthews LR (1995) The and blood serum differences in heat-tolerant (Romosinuano) welfare of extensively managed dairy cattle: a review, Appl. and heat-susceptible (Angus) Bos taurus cattle during Anim. Behav. Sci. 42: 161- 182. controlled heat challenge. J. Anim. Sci. 88(7): 2321-36. ICAR (1985). Nutrient requirements of livestock and poultry. Indian Shrikhande GB, Rode AM, Pradhan MS and Ashiesha K (2008) Council of Agricultural Research, New Delhi. Seasonal effect on the composition of blood in cattle. Vet. Kumar D and Gupta LR (1991) Effect of some summer managemental Word. 11(1): 341-342. practices on the growth, physiological and biochemical Singh DN, Wadhmani KS, Arya JS, Sarvaiya NP and Patel AM (2008) responses of buffalo calves. Indian J. Ani. Prod. Manag. Effect of blood constitute of ewes during summer in a 7: 98-101. subtropical climate. Indian J. Small Rumi. 14(1): 252-254. Lohakare JD, Pattanaik AK and Khan SA (2006) Effect of Dietary Singh MP (1982) Effect of different housing conditions during summer Protein Levels on the Performance, Nutrient Balances, and winter season on feed utilization and water intake by Metabolic Profile and Thyroid Hormones of Crossbred growing buffalo calves. Ph D. Thesis, submitted to Haryana Calves. Asian-Aust. J. Anim. Sci. 19(11): 1588-1596. Agricultural University, Hisar. Marai IFM, Habeeb AA M and Farghaly HM (1999) Productive, Singh Y (1996) Studies of certain summer managemental practices on physiological and biochemical changes in imported and locally performance of growing buffalo calves. M. V. Sc. Thesis, born Friesian and Holstein lactating cows under hot summer submitted to CCS Haryana Agricultural University, Hisar. conditions of Egypt. J. Tropical Anim. Heal. Prod. 31: 233- Singh Y (2000) Studies on certain summer managemental practices 243. on performance of buffalo heifers. M. V. Sc. Thesis, submitted Marai IFM, Habeeb AAM, Daader AH and Yousef HM (1997) Effects of to CCS Haryana Agricultural University, Hisar. diet supplementation and body cooling on Friesian calves Snedecor FW and Cochran WG (1994) Statistical Methods. 8th ed. reared in high ambient temperature in the Eastern Desert of Oxford and IBH Publishing Co., Calcutta. Egypt. J. Trop. Anim. Health Prod. 4: 201-208. Soni PL, Gangwar, PC, Bagha CS, Srivastava RK and Dhingra DP Nagpal AK, Roy AK, Chirania BL and Patil NV (2011) Growth, Nutrient (1982) Effect of cooling on certain blood metabolites and Utilization and Serum Profile in Camel Calves as Affected by minerals in buffaloes. Indian J. Anim. Sci. 52: 222-227. Dietary Protein Levels . Indian J. Anim. Nutr. 28(2): 166- Srikandakumar A, Johnson EH and Mahgoub O (2003) Effect of heat 171. stress on respiratory rate, rectal temperature and blood Nazifi S, Saeb M, Rowghani E and Kaveh K (2003) The influences of chemistry in Omani and Australian Merino sheep. Small thermal stress on serum biochemical parameters of Iranian Rum. Res. 49(2): 193-198. fat-tailed sheep and their correlation with triiodothyronine Thomas CK and Sastry NSR (2007) Problems of Dairy production in (T3), thyroxine (T4) and cortisol concentrations. Comp. Clin. Hot Regions. Dairy Bovine Production. 1st edn., Kalyani Pathol. 12(3): 135-139. Publisher, Ludhiana. P. 111. Okab AB, El-Banna SG and Koriem AA (2008) Influence of environmental Vijayakumar P (2005) Effect of thermal stress management on temperatures on some Physiological and Biochemical nutritional, physiological and behavioural responses of Parameters of New Zealand Rabbit Males Slovak. J. Anim. buffalo heifers. Ph.D. Thesis submitted to Deemed Sci. 41(1): 12-19. University, IVRI, Izatnagar, Bareilly (U.P.) India Podar C and Orion I (2003) The influence of high temperature on milk Wadhwa M and Bakshi M. P. S. (2006) Effect of feeding total mixed cows. Buletinualduniversitatii-de-Stiinte-Agricole-si- ration on performance of buffalo calves . Indian J. Anim. Medician-veterinara-cluj mapoca seriazootehnie-si- Nutr. 23(3): 159-164. biotecnologiii. 59: 130-133. Yazdani AR (1996) Effect of the different source of proteins and type Radostits OM, Gay C, Hinchcliff KW, Constable PD (2007) Veterinary of housing on the growth performance of cross-bred calves. Medicine. A textbook of the diseases of cattle, horses, Ph.D Thesis, submitted to CCS, Haryana Agricultural sheep, pig and goats. 10th edn. Elsevier, Edinburgh London, University, Hisar. New York. P 2049 Rasooli A, Nouri M, Khadjeh GH and Rasekh A (2004) The influence of seasonal variations on thyroid activity and some biochemical parameters of cattle. Iranian J. Vet. Res. 5(2): 1383-1391. Scharf B, Carroll JA, Riley DG, Chase CC Jr, Coleman SW, Keisler DH,

284 Veterinary Practitioner Vol. 20 No. 2 December 2019

EFFECT OF DIETARY SUPPLEMENTATION OF TULSI (OCIMUM SANCTUM) LEAF POWDER AND FENUGREEK (TRIGONELLA FOENUM-GRACEUM L.) SEED POWDER ON PERFORMANCE INDEX, DRY MATTER DIGESTIBILITY AND N-BALANCE OF HEAT STRESSED BROILERS IN ARID ZONE#

Umesh Kumar Prajapat1, D. Jain, T. Sharma, R.K. Dhuria, Tara Bothra2, R. Nehra, Mangesh Kumar, Subhash Kumar and S.S. Siyag Department of Animal Nutrition, College of Veterinary and Animal Science, Bikaner, Rajasthan University of Veterinary and Animal Sciences, Bikaner-334 001 Rajasthan, India Received on: 11.05.2019 ABSTRACT Accepted on: 03.10.2019

An experimental trial was conducted to assess the effect of dietary supplementation of Tulsi (Ocimum sanctum) leaf powder and Fenugreek (Trigonella foenum-graecum L.) seed powder as herbal feed additives on performance index, dry matter digestibility and N-balance of heat stressed broilers in arid zone of Rajasthan. A total of 210 one day old broiler chicks of Cobb-400 strain were divided into seven treatment groups with three replicates of 10 chicks in each replicate using completely randomized design. The control group (C) was fed on basal diet without any supplementation and other six treatment groups were supplemented with 0.5% Tulsi leaf powder, 1% Tulsi leaf powder, 0.5% Fenugreek seed powder, 1% Fenugreek seed powder, 0.25% Tulsi leaf powder + 0.25%

Fenugreek seed powder and 0.5% Tulsi leaf powder + 0.5% Fenugreek seed powder in T1, T2, F1, F2, T1F1 and T2F2 groups, respectively. Statistical analysis of data revealed highly significant (P<0.01) effect of Tulsi and Fenugreek supplementation alone or in combination on overall performance index, dry matter digestibility, nitrogen intake and nitrogen voided. Overall nitrogen balance was significantly (P<0.05) higher in the Tulsi and Fenugreek supplemented groups compared to control group. On the basis of results obtained in the study, it could be concluded that in high ambient temperature in heat stressed broilers, inclusion of Tulsi leaf powder alone at 0.5% level, Fenugreek seed powder alone at 0.5% level and combination of both i.e. Tulsi leaf powder and Fenugreek seed powder at 0.5% level is quite effective for overall well being of the birds.

Key words: Tulsi, Fenugreek, broiler, performance index

Introduction and anticancer properties. Poultry meat is the rapidly growing sector of global meat Fenugreek (Trigonella foenum-graecum L.) is a well production, consumption, and business with developing known medicinal plant and locally known as Methi, and mainly economy playing a key role in its growth due to its great potential cultivated in India, Pakistan and China (Alloui et al., 2012). to bring fast economic growth with low input (Najeeb et al., Fenugreek seeds and leaves are used to prepare extracts 2014). Now the Broiler industry throughout the world has been and powders for medicinal uses (Basch et al., 2003). Many evolved itself from a mere backyard proposition into an researchers reported that fenugreek have hypoglycemic, agribusiness states (Singh et al., 2015). The conventional anthelmintic, antibacterial, anti-inflammatory, antipyretic feeds are not enough to meet the growing demand of the properties (Ahmadiani et al., 2001; Basch et al., 2003), and poultry; therefore, nutritional manipulation are must like anti-diabetic, anti-fertility, anti-cancer anti-microbial, hypo- supplementation of probiotics, enzymes, acidifiers, herbs in cholesterolaemic, antiparasitic effects (Al-Habori and Roman, poultry ration. Use of antibiotic as growth promoters in feed of 2002). animal are seriously criticized by human welfare authorities and also by consumers, so use of herbal formulations in feed Materials and Methods is need of time. Herbs can be utilized as feed additives because A total of two hundred and ten, day old broiler chicks of of their suitability in feed, lower production price, reduced risk Cobb-400 strain were divided into seven treatment groups of toxicity, minimum health hazards and lower hazardous impact with 3 replicates of 10 chicks in each replication using on environment (Devegowda, 1996). Latest research works completely randomized design. Experiment was conducted in on implications of herbs as feed additives in animal feeds extreme environmental heat condition in month of May and have shown encouraging results on feed efficiency, body weight June in arid zone of Rajasthan. Environmental stress was gain and decreased mortality in poultry birds (Deepak et al., noticed as ambient temperature and Temperature Humadity 2002; Jahan et al., 2008). Index (THI) were recorded to be higher than the threshold. All The whole plant of Tulsi is used in medicine. Many the treatments were fed according to BIS (1992) feeding studies have been conducted using Ocimum sanctum (Tulsi) standards. The control group (C) was fed with basal diet without any supplementation diet and treatment groups T and T for its anti-inflammatory, antioxidant, antibacterial, antiulceric, 1 2 antimalarial, antidiabetic, antilipidemic, immunomodulatory supplemented with 0.5% and 1% level of Tulsi in the experimental broiler starter and finisher ration, respectively. #Part of M.V.Sc. Thesis submitted by first author and corresponding author present address Ph.D. scholar. Deptt. of Animal Nutrition, CVAS, Bikaner (RAJUVAS), M. 8561823663, email: [email protected]; 2Astt. Prof. Deptt. of Livestock Production Management.

285 Veterinary Practitioner Vol. 20 No. 2 December 2019

Table 1: Performance index, Dry matter digestibility and N-balance of broilers birds in different dietary treatments

Parameter C T1 T2 F1 F2 T1 F1 T2 F2 SEM PI 559.89a 788.09d 673.98b 753.51c 684.81b 730.03c 677.52b 5.6717 Dry matter Digestibility 58.51a 74.39b 74.31b 75.93b 75.65b 65.11a 73.89b 2.0447 (%) N-intake a b b b b ab ab 1.78 2.30 2.28 2.37 2.35 2.07 2.09 0.0891 (g/d/bird) N-voided 0.72b 0.75b 0.85bc 0.99cd 1.10d 0.67b 0.72b 0.0543 (g/d/bird) N-balance A C BC BC B BC BC 1.06 1.55 1.44 1.38 1.25 1.40 1.37 0.0754 (g/d/bird) Means bearing different superscripts (a, b, c, d) in a row differ significantly (P<0.01) Means bearing different superscripts (A, B, C) in a row differ significantly (P<0.05)

Likewise F1 and F2 treatment group were supplemented with herbal plant in the ration of broilers and also with findings of 0.5% and 1% level of Fenugreek in the experimental broiler Meena (2015) who recorded improvement in digestibility due starter and finisher ration, respectively. T1F1 and T2F2 treatment to incorporation of Fenugreek seed powder in diet of broilers. groups were supplemented with 0.5% and 1% level of both The overall intake and balance of nitrogen, which could Tulsi and Fenugreek in combination, respectively. Considering be considered as the indices of overall well-being of the animal the feed efficiency as well as the growth rate, a performance were estimated in all the treatment groups as g/d and the index was obtained for each treatment by dividing the average mean values have been depicted in Table 1. The overall mean weight gained by the feed conversion ratio. values for nitrogen intake, voided and balance were found to Dry matter digestibility and nitrogen balance studies were be 1.78, 0.72 and 1.06 (g/d/ chick) in C, 2.30, 0.75 and 1.55(g/ conducted using 6 chicks from each group for 5 days at the d/ chick) in T1, 2.28, 0.85 and 1.44 (g/d/chick) in T2,2.37, 0.99 end of feeding trial using metabolic cages. and 1.38 (g/d/chick) in F1, 2.35, 1.10 and 1.25 (g/d/chick) in F2, 2.07, 0.67 and 1.40 (g/d/ chick) in T F , 2.09, 0.72 and 1.37 (g/ Results and Discussion 1 1 d/ chick) in T F , respectively. All broilers in various treatment The overall mean performance index (PI) calculated in 2 2 groups were found to have positive nitrogen balance. terms of weight gain per unit of feed conversion ratio for C, T , 1 The statistical analysis of variance revealed highly T , F , F , T F and T F groups were found to be 559.89, 788.09, 2 1 2 1 1 2 2 significant (P<0.01) effect of supplementation of Ocimum 673.98, 753.51, 684.81, 730.03 and 677.52, respectively. The sanctum (Tulsi) andTrigonella foenum-graecum L. (Fenugreek) statistical analysis of variance revealed highly significant in terms of nitrogen intake and nitrogen voided but significant (P<0.01) effect of supplementation of Ocimum sanctum (Tulsi) (P<0.05) in nitrogen balance. Further, on comparison of means leaf powder and Trigonella foenum-graecum L. (Fenugreek) differences were recorded among treatment groups with seed powder on performance index in broiler ration. The maximum intake in F followed by F ,T , T ,T F , T F and C. performance index was significantly highest for T from rest of 1 2 1 2 2 2 1 1 1 Regarding excretion of nitrogen in droppings, maximum the groups and lowest for control group. The PI for T , F and 2 2 excretion was noticed in F followed by F , T , T , C, T F , and T F were intermediate and comparable with each other. The 2 1 2 1 2 2 2 2 T F . results obtained from study in text are in line with the findings 1 1 In respect of nitrogen balance, which is important for overall of Patel et al. (2014) recorded similar effects on performance well being of broilers, the statistical analysis results and index due to supplementation of Garlic in the poultry ration. comparison of means revealed highest retention in T followed The digestibility of dry matter was determined in different 1 by T , T F , F , T F , F and C, respectively. These results of dietary groups to determine the effect of supplementation of 2 1 1 1 2 2 2 study in text in terms of nitrogen balance suggested that Ocimum sanctum (Tulsi) leaf powder and Trigonella foenum- supplementation of Tulsi leaves powder and Fenugreek seed graecum L. (Fenugreek) seed powder alone and in powder improved the retention of nitrogen and the findings combination in ration of broilers on digestibility of feed. The corroborate well with the findings of Meena (2015). mean values of digestibility coefficient of dry matter for various treatment groups have been presented in Table 1. The overall References mean values of dry matter digestibility (per cent) were found to Ahmadiani A, Javan M, Semnanian MA, Barat E and Kamalinejad M (2001) Anti-inflammatory and antipyretic effects of Trigonella be 58.51 in C, 74.39 in T1, 74.31 in T2, 75.93 in F1, 75.65 in F2, foenum-graecum leaves extracts in rats. J. 65.11 in T1F1 and 73.89 in T2F2. The results showed highly significant (P<0.01) effect of supplementation of Ocimum Ethnopharma.75: 283-286. sanctum (Tulsi) leaves powder and Trigonella foenum- Alloui N, Ben Aksa S, Alloui MN and Ibrir F (2012) Utilization of Fenugreek (Trigonella foenum-graecum) as growth promoter for broiler graecum L. (Fenugreek) seed powder alone and in chickens. J. World’s Poult. 2(2): 25-27. combination. The digestibility was recorded to be highest in Al-Habori M and Roman A (2002) Pharmacological properties in st F1followed by F2, T1, T2, T2F2, T1F1 and C. The lowest digestibility Fenugreek- The genus Trigonella. 1 Edn. by G. A. was recorded in control. These results obtained in study in text Petropoulos (Ed), Taylor and Francis, London and New corroborate well with the findings of Hernandez et al. (2004) York, 10: 163-182. on dry matter digestibility due to incorporation of extract from Basch E, Ulbricht C, Kuo G, Szapary P and Smith M (2003) Therapeutic

286 Veterinary Practitioner Vol. 20 No. 2 December 2019

applications of Fenugreek. Alt. Med. Rev. 8: 20-27. Najeeb AP, Mandal PK and Pal UK (2014) Efficacy of fruits (red BIS (1992) Indian Standard: Poultry feed specifications, 4th revision, grapes, gooseberry and tomato) powder as natural Bureau ofIndian Standards, New Delhi. preservatives in restructured chicken slices. Int. Food Deepak G, Jogi S, Kumar A, Bais R and Vikas KS (2002) Effect of Res. J. 21(6): 2431-2436. herbal liver stimulants on efficacy of feed utilization in Patel RM, Garg DD, Patel VR, Vahora SG, Katariya MA and commercial broiler chicken. Ind. J. Anim. Res. 36(1): 43-45. Choubey M (2014) Effect of dietary supplementation of Devegowda G (1996) Herbal medicines, an untapped treasure garlic (Allium sativum) and fenugreek (Trigonella in poultry production. In Proc. 20 th World Poultry foenum- graecum L.) seed powder on growth Congress New Delhi, India. performance and blood biochemical parameters in Hernandez F, Madrid J, García V, Orengo J and Megías MD (2004) broilers. Indian J. Poult. Sci. 49(1): 17-20. Influence of two plant extracts on broilers Singh N, Santra AK, Dutta GK, Gendley MK, Chaurasia D and performance, digestibility and digestive organ size. Deshmukh S (2015) Studies on the welfare indicators Poult. Sci. 83: 169-174. like haematological and and biochemical parameters of Jahan ZA, Ahsan UH, Muhammad Y, Tanveer A and Sarzamin K commercial broiler chicks raised in different stocking (2008) Evaluation of different medicinal plants as densities. Vet. Pract. 16(2): 219-221. growth promoters for broiler chicks. Sarhad J.Agric. 24(2): 323-329. Meena MK (2015) Effect of feeding Rosmarinus officinalis and Trigonella foenum- graceum L. alone and in combination on performance of broiler chicks. M.V.Sc. Thesis submitted, RAJUVAS, Bikaner.

287 Veterinary Practitioner Vol. 20 No. 2 December 2019

IN VITRO ANTIBACTERIAL POTENTIALS OF VARIOUS EXTRACTS OF GINGER ROOT POWDER AND BLACK CUMIN SEED POWDER#

Mangesh Kumar1, R.S. Arya2, R.K. Dhuria, Dinesh Jain, Rajesh Nehra and T. Sharma3 Department of Animal Nutrition,College of Veterinary and Animal Science, Bikaner Rajasthan University of Veterinary and Animal Sciences, Bikaner-334 001, Rajasthan, India

ABSTRACT

The present investigation was undertaken for in vitro screening of antibacterial activities of benzene, ethyl acetate and methanol extract of ginger root powder and black cumin seed powder. In vitro antibacterial efficacy of selected plants was assessed by well diffusion method against Salmonella typhi, Staphylococcus aureus and Pseudomonas aeruginosa. The results showed that ben- zene and ethyl acetate extract of black cumin seed powder were most effective against the Salmonella typhi, while the ethyl acetate extracts of black cumin seed powder was most effective against the Staphylococcus aureus, whereas benzene extract of black cumin seed powder and the all three extracts of both the herbs remained ineffective against Staphylococcus aureus and Pseudomo- nas aeruoginosa, respectively. Results of the current study showed that these plants possess compounds with antibacterial activity.

Key words: Ginger root powder, black cumin seed powder, antibacterial

Introduction Materials and Methods In India infectious diseases are still persisting as major Collection of plant material health problems along with re-emerging infectious diseases Ginger root powder and black cumin seed powder were and increasing prevalence of non-communicable diseases. purchased from the shop of herbal medicine.Crude plant The root cause for spreading and re-emerging of diseases is extract was prepared by Soxhlet extraction method. Five grams bacterial resistant (Nongkynrih et al., 2004). Bacterial species of powdered ginger root powder and black cumin seed powder showed resistance against available antibiotics due to filled in thimble directly were placed in soxhlet apparatus, and indiscriminate use of synthetic antibiotics; similarly increase extracted separately using benzene, ethyl acetate and in prevalence of non-communicable diseases is due to lifestyle methanol extract for 24 hrs or until the solvent in siphon tube of changes and urbanization. Thus researchers are in need to an extractor become colorless. The extracts were than search for alternatives with no side effects.Herbalplants are concentrated in pre-weighted vials on a rotary evaporator below capable of synthesizing variety of low molecular weight organic 50°C. Dried extract was weighted and reconstituted with known compounds called secondary metabolites. Plant secondary volume of solvent and were stored in vials at 4°C for further metabolites have incredible pharmacological value for experimental studies.Antibacterial activities of different extracts scientific and clinical research (Shraddha et al., 2017; Meena, were studied by the well diffusion method.The pure cultures of 2017). Identification of their activity against various pathogenic bacteria maintained in the nutrient broth medium. The test microorganisms results in treatment of various systemic organisms used are Salmonella typhi, Staphylococcus aureus diseases (Gupta et al., 2017; Sharma, 2017; Marwaha, 2018). and Pseudomonas aeruginosa.Stock cultures were maintained There were also beneficial effects of one or combination of at 4°C in nutrient broth. Active cultures for experiments were various herbal medicines on the survival, immune modulation prepared by transferring a loopful of cells from the stock cultures and quality of life of cancer patients (Yin et al., 2013). Ginger to test tubes of nutrient broth for bacteria that were incubated (Zingiber officinale) has been used for analgesic, antipyretic, without agitation for 24 h at 37°C. Media was prepared by sedative and antibacterial effects (Khan et al., 2012). Black dissolving 0.5% Peptone, 0.3% beef extract/yeast extract, 1.5% cumin (Nigella sativa L.) is regarded as a valuable remedy for agar, 0.5% NaCl and dissolved in 100 ml distilled water and treat ailments including asthma, bronchitis,rheumatism and autoclaved at 121°C for 15 min. Standard well diffusion method related inflammatory diseases and hyperglycemia as well as was carried out to screen the antibacterial activity. In vitro promote digestion and to fight parasitic infections. They reported antibacterial activity was screened by using nutrient agar media. to exhibit immunopotentiating (Hailat et al., 1995), The nutrient agar plates were prepared by pouring 10 ml to 15 immunomodulating and interferon-like activities.Keeping in ml of molten liquid media into sterile petri plates. The plates mind the infectious diseases, non-communicable diseases, were allowed to solidify for a few minutes and 0.1% inoculum resistant pathogenic organism and side effect of antibiotics suspension was swabbed uniformly and the inoculum was an attempt was needed to determine the antimicrobial activity allowed to dry for 10 min. Wells were prepared on agar plates of plant based medicinal agents. Therefore, the current and 100 μl extract and solvent in control well was inoculated research was focused to investigate the effects of benzene, and the plates were kept for incubation at 37°C for 24 h. At the ethyl acetate and methanol extract of ginger root powder and end of incubation, inhibition zones formed around the wells black cumin seed powder against growth of Salmonella typhi, were measured with transparent ruler in millimeter. Staphylococcus aureus and Pseudomonas aeruginosa. #1Part of Ph.D. Thesis submitted by First author and corresponding author email:[email protected]. Mob: 9782734844, 9887803664; 2Retired Professor; 3Dean, CVAS, Navania, Vallabhnagar, Udaipur

288 Veterinary Practitioner Vol. 20 No. 2 December 2019

Results and Discussion Table 1: Mean inhibitory zone (mm) induced by the various crude extracts In the present investigation, in vitro antibacterial activity of of ginger root powder and black cumin seed powder against tested the various crude extracts of ginger root powder and black microorganism cumin seed powder was qualitatively assessed based on the zone of inhibition. The zones of inhibition in diameter (mm) Microorganisms S. typhi S. aureus P. aeruginosa recorded for benzene, ethyl acetate and methanol extract and Benzene 12 11 - have been presented in Table 1. Ginger Ethyl acetate 10 12 - Against Salmonella typhi highest zone of inhibition (14 Methanol 13 10 - Benzene 14 - - mm) was observed in benzene and ethyl acetate extract of Black Ethyl acetate 14 15 - black cumin seed powder followed by methanol extract (13 cumin mm) and benzene extract (12 mm) of ginger root powder, while Methanol 11 10 - the zone of inhibition was (11 mm) in methanol extract of black also reported antibacterial activity of ethyl acetate extract (8 cumin seed powder. The lowest zone of inhibition (10 mm) mm), methanol extract (8 mm) and hexane extract (11 mm) of was observed in ethyl acetate extract of ginger root powder. black cumin seed against Staphylococcus aureus, whereas The highest (15 mm) zone of inhibition against Staphylococcus the antibacterial activity against Pseudomonas aeruginosa was aureus was observed in ethyl acetate extract of black cumin 7 mm in ethyl acetate and hexane extract of black cumin, seed powder followed by 12 mm in ethyl acetate and 11 mm however the methanol extract of black cumin seed have no in benzene extract of ginger root powder. Against zone of inhibition against Pseudomonas aeruginosa, whereas Staphylococcus aureus lowest zone of inhibition (10 mm) was against Salmonella typhimurium the zone of inhibition was 7 recorded in methanol extract of both ginger root powder and mm in methanol and hexane extracts of black cumin but no black cumin seed powder, while no zone of inhibition was zone of inhibition was observed in ethyl acetate extracts of observed in benzene extract of black cumin seed powder. black cumin. Further, Abdalla and Abdallah (2018) reported Against Pseudomonas aeruoginosa, no zone of inhibition was significant antibacterial activity against Salmonella typhi by observed in benzene, ethyl acetate and methanol extract of methanol extract (11.7 mm) and against Staphylococcus both ginger root powder and black cumin seed powder. aureus by methanol extract (14.4 mm) and hexane extract (16.5) The results of antimicrobial study of various extracts of of ginger rhizome. ginger root powder and black cumin seed powder showed Phytochemicals in herbs alter fatty acid composition, which that benzene and ethyl acetate extract of black cumin seed can influence surviving ability of microbes by increasing powder were most effective against the Salmonell typhi, while hydrophobicity. The antibacterial activity against the ethyl acetate extracts of it was most effective against the microorganisms obtained in present investigation might be Staphylococcus aureus, whereas benzene extract of black due to any one or more phytochemicals present in ginger root cumin seed powder and the all three extracts of both the herbs powder and black cumin seed powder. remained ineffective against Staphylococcus aureus and Pseudomonas aeruoginosa, respectively. References Several workers have reported the anti-bacterial activity of Abdalla WE and Abdallah EM (2018) Antibacterial activity of ginger (Zingiber various extracts of ginger and black cumin against Salmonella Officinale Rosc.) rhizome: a mini review. Int. J. Pharmacogn typhi, Staphylococcus aureus and Pseudomonas aeruginosa Chinese Med. 2(4): 1-8. such as Erdogrul et al. (2009), Kaushik and Goyal (2011), Gull Abdel-Raouf M, Nabil M and ElSayad M (2014) Antimicrobial activities of et al. (2012), Igwo-Ezikpe et al. (2013), Abdel-Raouf et al. (2014) some herbs extracts on food borne bacteria. J. Am. Sci. 10(11):76-85. and Arshad and Shadab (2017) which support the present Arshad M and Shadab M (2017) Zingiber officinale extract: antimicrobial findings against various microbes. properties phytochemical screening, drug likeness and Further, the results are in line with the results of Abdel- physicochemical studies. Eur. J. Pharm. Med. 4(3):364-368. Raouf et al. (2014) who reported that the etanolic extracts of Erdogrul Z, Ciftci E, Bozdogan H and Toroglu S (2009) Antimicrobial activity both ginger and black cumin are moderately effective against of black cumin seeds (Nigella sativa L.). Asian J. Chem. Salmonella typhi and Staphylococcus aureus, whereas, no 21(1):467-470. inhibition zone was reported against Pseudomonas Gull I, Saeed M, Shaukat H, Aslam SM, Samra ZQ and Athar AM (2012) aeruginosa. Gull et al. (2012) find out antibacterial activity Inhibitory effect of Allium sativum and Zingiber officinale extracts on clinically important drug resistant pathogenic bacteria. against Salmonella typhi (11.7 mm) and Pseudomonas Ann.Clin.Microbiol. Antimicrobiol.11(8):1-6. aeruginosa (13.6 mm) by methanolic extract of ginger, however Gupta KK, Singh A, Shah HK, Upadhaya A, Parashar A and Kumar S Kaushik and Goyal (2011) and Jain et al. (2016) reported no (2017) Management of thrombocytopenia in canine Ehrlichiosis zone of inhibition against Salmonella typhi by methanol, ethyl by herbal therapy. Vet. Pract. 18(1):31. acetate and hexane extract of ginger rhizome. Hailat N, Bataineh Z, Lafi S, Raweily E, Aqel M, Al-Katib M and Hanash S Jain et al. (2016) also reported antibacterial activity of (1995) Effect of Nigella sativa volatile oil on Jurkal T cell leukemia ethanolic extract (6 mm) and ethyl acetate extract (3 mm) of polypeptides. Int. J. Pharmaco. 33:16-20. ginger rhizome against Pseudomonas aerunginosa. Igwo- Igwo-Ezikpe MN, Imaga NOA, Ogbunogafor HA, Osuntoki AA, Adeleye S and Ipadeola AO (2013). Antimicrobial effects of Zingiber Ezikpe et al. (2013) reported that ethyl acetate extract of ginger officinale rhizomes extract on selected pathogens clinical rhizome exhibited its antibacterial potency against isolates. The Bioscientist. 6: 73-79. Staphylococcus aureus. Arshad and Shadab (2017) portrayed Jain A, Kad V, Labade D and Wani M (2016) In vitro antibacterial that the methanol extract of ginger has significant antimicrobial activity of solvent extracts of Zingeber officinale Rosc. activity against Staphylococcus aureus. Erdogrul et al. (2009) rhizome on different micro-organisms. Int. J. Adv.Res.Sci. 289 Veterinary Practitioner Vol. 20 No. 2 December 2019

Eng. 5(12): 283-289. Parthasarathy VA, Chempakam B and Zachariah TJ (Eds.) (2008) Kaushik P and Goyal P (2011) Evaluation of various crude extracts of Chemistry of spices. CABI, pp. 242-259. Zingiber officinale rhizome for potential antibacterial activity: Sharma D (2017) Studies on therapeutic potential of Ocimum sanctum A study in vitro. Adv. Microbiol. 1(1):7-12. on subclinical mastitis in goats (Capra hircus), M.V.Sc. Khan RU, Naz S, Tufarelli V and Laudadio V (2012) Potential applications Thesis submitted to Rajasthan University of Veterinary and of ginger (Zingiber officinale) in poultry diet. Worlds Poult. Animal Sciences, Bikaner. Sci. J. 68: 245-252. Shraddha N, Koley KM, Choudhary M, Durga C and Kumar V (2017) Marwaha S (2018) Therapeutic studies of Piper nigrum in subclinical Comparative study of immunomodulatory effect of Tinospora mastitis in cattle, M.V.Sc. Thesis submitted to Rajasthan cordifolia stem and Azadirachta indica leaf extract in broiler University of Veterinary and Animal Sciences, Bikaner. chicks. Vet. Pract. 18(2):286-288. Meena N (2017) Studies on therapeutic potential of Withania somnifera Yin SY, Wei WC, Jian FY and Yang NS (2013) Therapeutic applications on subclinical mastitis in goats (Capra hircus), M.V.Sc. of herbal medicines for cancer patients. J. Evid. Based Thesis, Rajasthan University of Veterinary and Animal Complementary Altern. Med. 302426. Sciences, Bikaner. Nongkynrih B, Patro BK, and Pandav CS (2004) Current status of communicable and noncommunicable diseases in India. Japi. 52:118-23.

290 Veterinary Practitioner Vol. 20 No. 2 December 2019

EFFECT OF FEEDING OF HYDROPONICS MAIZE FODDER ON NUTRIENT UTILISATION EFFICIENCY IN RATHI CALVES

Rupal Dadhich*, R.K. Dhuria, Dinesh Jain, Rajesh Nehra and T. Sharma Department of Animal Nutrition, College of Veterinary and Animal Science Rajasthan University of Veterinary and Animal Sciences, Bikaner-334 001, Rajasthan, India

Received on: 02.06.2019 ABSTRACT Accepted on: 23.09.2019

Twenty male Rathi calves of similar age (6 - 12 month) and average body weight (96 kg) were distributed in five groups of four each in order to study the effect of feeding hydroponics maize fodder on intake, nutrient digestibility, digestible nutrient component and

weight gain. The feeding trial was conducted for 30 days followed by 7 days of digestibility trial. The animals in group T1 (control) were fed 1.5 kg concentrate mixture (CP 20%). In group T2, 75% of CP requirement was met through concentrate mixture (1.125 kg) and rest through hydroponic maize fodder (2.63 kg). Whereas, in group T3, 50% of CP was met through 0.75 kg concentrate mixture and rest through 5.27 kg hydroponic maize fodder, while in group T4, 25% of CP was met through concentrate mixture (0.375 kg) and remaining by hydroponic maize fodder (7.9 kg). In T5 group CP requirement was met through 10.54 kg hydroponic maize fodder. In addition, all the animals were offered ad lib. wheat straw along with 2.5 kg groundnut straw. The dry matter Intake (kg/100 kg b. wt.)

was found to decrease significantly (P<0.05) in groups T2, T3, T4, T5 in comparison to control T1 (3.27). Digestibility of DM, OM, CP, CF, NFE and ADF increased significantly (P<0.05) for calves fed with hydroponics maize fodder whereas no significant effect was observed in digestibility of EE, NDF and HC. The DCP and TDN content were found to be increased significantly (P<0.05) in groups fed with hydroponics maize fodder. The digestible dry matter intake (kg/100kg b.wt) was found to be similar in all the groups whereas digestible organic matter intake (kg/100 kg b.wt) was found to be increased significantly (P<0.01) in groups fed with hydroponics maize fodder. The digestible crude protein intake (kg/100 kg b.wt) and total digestible nutrient intake (kg/100 kg b.wt) were found to be increased significantly (P<0.01) in calves fed with hydroponics maize fodder. It can be thus inferred that feeding of hydroponics maize fodder in Rathi calves increased the digestibility of nutrients.

Key words: Rathi calves, hydroponics maize fodder, digestibility, digestible crude protein, total digestible nutrient

Introduction Materials and Methods The quality green fodder is essential for production and The production of hydroponics maize was done in a reproductive performances in animals but its unavailability is hydroponics chamber of Ayurvet Progreen machine equipped leading to the issue of major concern. For sustainable dairy with automatic irrigation having the potential of producing 480 farming, quality green fodder should be fed regularly to dairy kg fresh hydroponics maize fodder on daily basis. Clean maize animals (Naik et al., 2012b). Faster urbanisation/ seeds were soaked for overnight in tap water and thereafter industrialisation have squeezed area under pasture land distributed in trays. On first day, trays were placed in the top affecting the grazing based production systems resulting in most row of growth chamber and then everyday were shifted failure to meet the green fodder requirements of the animal. to the respective lower rows. Inside the growth chamber the Furthermore, small size land holdings, water scarcity, salinity, plants were allowed to grow for the duration of 7 days and then high evapotranspiration rate, less soil water holding capacity, on eight day, these were harvested and fed to the animals. more labour requirement, more growth time (50-65 days), Twenty male Rathi calves of age group 6-12 month of unavailability of same quality throughout the year, need of average body weight 96 kg were divided into five equal groups fertilisers, climate variations are the major obstacles in green on the basis of their body weight (mean body weight 95.00, fodder production. In order to surmount all the constrain 95.24, 96.41, 96.54 and 96.98 kg in T1, T2, T3, T4 and T5, hydroponics technology is the most suitable up coming respectively). Animals were housed in well ventilated, hygienic alternate (Sneath and McIntosh 2003, Naik et al., 2011; Naik et and protected sheds and were allotted to acclimatize for a al., 2012; Naik et al., 2013a). It has been reported that hydroponic period of 10 days prior to experimental feeding. The animals fodder production requires only about 2-3% of water used under were given prophylactic doses of panacure vet tablet as field conditions to produce the same amount of fodder (Al- anthelmintic. Faecal and blood smears were examined Karaki and Al-Momani, 2011). All these special features of periodically for parasitic infestation. The animals in group T1 hydroponics culture, in addition to others make it one of the (control) were fed 1.5 kg concentrate mixture (CP 20%), 2.5 kg most important agricultural techniques currently in use of green groundnut straw and wheat straw ad lib. In group T2, 75% of forage production in many countries especially in arid and CP was met through concentrate mixture(1.125 kg) and rest semi arid regions (Al-Karaki, 2011). Therefore, the experiment through hydroponic maize fodder (2.63 kg) along with 2.5 kg was conducted to find out the effect of feeding hydroponics groundnut straw and ad lib. wheat straw was given. Whereas, maize fodder on nutrient utilisation efficiency in Rathi calves in in group T3, 50% of CP was met through concentrate mixture the arid region of Rajasthan (India). (0.75 kg) and rest through hydroponic maize fodder (5.27 kg) and 2.5 kg of groundnut straw was given along with ad lib

*Corresponding author : Email:[email protected] 291 Veterinary Practitioner Vol. 20 No. 2 December 2019

wheat straw. In group T 4, 25% of CP was met through artificially grown barley fodder which was due to change in concentrate mixture (0.375 kg) and remaining by hydroponic roughage to concentrate ratio. Fazaeli et al. (2011) reported maize fodder (7.9 kg) and 2.5 kg groundnut straw with ad lib that the decreased dry matter intake of hydroponics fodder wheat straw was offered. In T5 group CP requirement was met which could possibly be due to high water content that have through 10.54 kg hydroponic maize fodder and 2.5 kg groundnut made bulky leading to limited dry matter intake by the straw along with wheat straw was given ad lib. Daily allowance experimental animals. of concentrate and roughage were offered to meet their nutrient Similarly, Reddy and Reddy (1988) reported dry matter requirements ICAR (1985). A feeding trial of 30 days was intake of artificially grown barley fodder was significantly lower. conducted followed by digestion trial of 7 days. During the Verma et al. (2015) reported the dry matter intake (% of b.wt) entire period of experiment measured quantity of respective were higher in groups where 50 % of crude protein and energy experimental complete feed was provided to each animal every requirements were met through concentrate mixture,T2 and morning and the left over was weighed next morning to assess 100% of crude protein and energy requirements were met daily consumption. through hydroponics barley fodder, T3 (3.38 kg and 3.35 kg,

Samples of feed offered and their residues left and faeces respectively) in comparison to control T1 (2.93 kg). Whereas, were analysed for proximate constituents as per AOAC (2000). Naik et al. (2014) reported the dry matter intake was similar in For determination of dry matter, crude fibre, and total ash, both the groups, in which one was fed with hydroponics maize standard conventional procedures were followed. The fodder and other with conventional green fodder. conventional Weende’s method was followed for calculation The perusal of results indicated that digestibility coefficient of nitrogen free extract. of dry matter (DM), organic matter (OM), crude protein (CP), The method of Goering and Van Soest (1970) was adopted nitrogen free extract (NFE), crude fibre (CF) and acid detergent to evaluate the cell wall constituents. The data obtained in the fibre (ADF) were significantly (P<0.01) higher in comparison experiment were analyzed using statistical procedures as to control group (Table 3). However, there was non significant suggested by Snedecor and Cochran (1994). Significance of difference in digestibility for ether extract (EE), neutral detergent mean differences was tested by Duncan’s New Multiple Range fibre (NDF) and hemicellulose (HC). The improvement in Test (DNMRT) as modified by Kramer (1957). digestibility coefficients of different nutrients is probably due to improved gross activity of rumen microflora, alteration in Results and Discussion number and species of micro organism in rumen, increased The concentrate mixture nutrient content is as per the BIS total volatile fatty acid concentration by replacing 25%, 50%, specification of the compound cattle feed (Table 1). The basal 75% and 100% CP of concentrate mixture through hydroponics roughage i.e. wheat straw and groundnut straw were within maize green fodder. the normal range and these values corroborates with the The results of digestibility of nutrients in different treatment reports of earlier workers Banerjee (1988) and Verma et al. groups recorded in present study are in agreement with the (2015). The dry matter content of hydroponics fodder ranges findings of Reddy and Reddy (1988), they reported the between 6.4-20% Sneath and Mclntosh (2003). In the present digestibility of DM, OM, CP, EE and NFE; nitrogen balance were study 16.53 % DM was observed. The crude protein value was higher in the group fed with artificially grown barley fodder. higher in the present study but the remaining chemical Reddy et al. (1988) observed the digestibility of DM, OM, NFE composition was similar to Naik et al. (2014). The crude protein, (P<0.05) and CF (P<0.01) were significantly higher in animals ether extract and nitrogen free extract were higher but the crude fed with artificially grown fodder and found that increase in fibre, total ash and acid insoluble ash were lower in hydroponics digestibility of nutrients may be due to tenderness of the fodder maize fodder than the conventional maize fodder as reported because of its lower age. by Naik et al. (2012). Misra et al. (1996) reported the digestibility coefficients of Naik et al. (2014) found that hydroponics maize fodders DM, OM, CP, EE, NFE, and NDF were significantly higher in crude protein 13.30 %, ether extract 3.27 %, nitrogen free extract cows fed on artificially grown barley fodder. Further, Naik et al. 75.32 % and lower crude fibre 6.37 %, total ash (1.75 %) and (2014) observed significant increase in digestibility of CP and acid insoluble ash (0.57 %). Similarly, Rajendra et al. (1998) CF and non significant increase in the digestibility of DM, OM, reported that artificially grown barley fodder (fometa) contained, EE and NFE in cows fed with hydroponics maize fodder. Verma 15.74% crude protein, 9.37% crude fibre, 1.97% ether extract et al. (2015) reported the significant increase in digestibility of and 70.27% nitrogen free extract. organic matter and crude protein in calves fed on hydroponics The intake of dry matter from all the treatment groups barley. revealed highly significant (P<0.01) effect of hydroponics maize The feeding of hydroponics maize fodder showed 0.75 fodder in terms of in terms of g/d, kg/100 kg b.wt, g/kgW significant effect (P<0.01) of feeding of hydroponics maize (Table 2). These results of study stated that significantly high fodder on % DCP, % TDN and NR (Table 4). Moreover, on intake in T1 and lowest intake in T5 group. Whereas, non comparison of means of DCP%, TDN% T4 recorded the highest significant effect was observed in terms of g/d, kg/100 kg b.wt, value followed by T , T , T and T . However, for the values of 0.75 5 3 2 1 g/kgW . The findings of present investigation indicated NR, T recorded the highest followed by T , T , T and T but the significant decrease in dry matter intake and non significant 1 2 3 4 5 values of T3, T4 and T5 were comparable. effect of organic matter intake on account of feeding of Verma et al. (2015) recorded significant increase in hydroponics maize fodder. The results of dry matter intake DCP% and TDN % at P<0.05 and P<0.01 levels, respectively corraborates with the findings of Maity et al. (1996) and Misra in Hariana calves fed with hydroponics barley fodder. Misra et et al. (1996). They reported the decrease in dry matter intake of al. (1996) also observed significant increase in DCP and TDN 292 Veterinary Practitioner Vol. 20 No. 2 December 2019

Table 1: Chemical composition of experimental feed (% DM basis) Attribute DM OM CP EE CF NFE TA NDF ADF HC Concentrate mixture 89.00 89.23 20.00 4.00 10.00 55.23 10.77 37.22 21.17 16.05 Hydroponics maize fodder 16.53 96.90 18.21 3.65 7.74 67.30 3.10 35.81 16.38 19.43 Groundnut straw 91.10 89.46 8.27 1.27 41.89 38.03 10.54 52.40 44.20 8.20 Wheat straw 91.80 88.13 3.26 1.39 38.40 45.08 11.87 74.64 52.21 22.43

Table 2: Average values of dry matter intake and organic matter intake in terms of g/d, kg/100 kg b.wt. and g/kg W 0.75 in Rathi calves Attribute Treatment groups SEM T1 T2 T3 T4 T5 Dry matter intake g/d 3091.79c 3022.44bc 2987.33ab 2956.81ab 2919.31a 1304.73 kg/100 kg 3.27c 3.19bc 3.12ab 3.08ab 3.03a 0.0028 b.wt g/kgW 0.75 101.89c 99.41bc 97.53ab 96.40ab 94.73a 1.93 Organic matter intake g/d 2762.12a 2728.57a 2728.28a 2727.70a 2726.30a 1072.25 kg/100 kg 2.92a 2.88a 2.85a 2.84a 2.82a 0.0023 b.wt g/kgW 0.75 91.023a 89.75a 89.07a 88.93a 88.47a 1.67 Note: Means with different superscripts in a row differ significantly from each other

Table 3: Average digestibility coefficient of dry matter, gross nutrients Table 5: Effect of hydroponics maize fodder on intake of digestible and fibre fractions in different treatment groups nutrients in Rathi calves Attribute Treatment groups SEM Attribute Treatment groups SEM T T T T T 1 2 3 4 5 T T T T T a b c e d 1 2 3 4 5 DM 60.66 62.49 64.12 67.12 66.26 0.056 DDMI a b c e d OM 62.73 64.29 66.63 68.65 67.14 0.026 1929.83 a b c d c g/d 1875.30a 1888.78a 1915.55a 1984.53b 680.09 CP 62.67 64.72 66.69 69.02 66.70 0.047 ab a a a a a EE 71.23 71.23 71.24 71.26 71.24 0.139 kg/100 kg 1.98a 1.99a 2.00a 2.07a 2.01a 0.00134 a b c e d CF 48.69 49.75 50.66 52.69 51.72 0.002 b.wt a b c d c NFE 63.48 65.57 67.42 70.49 67.83 0.245 g/kgW 0.75 61.77a 62.09a 62.51ab 64.68b 62.62ab 1.0014 a a a a a NDF 53.95 54.07 54.37 55.08 55.43 2.836 DOMI a ab bc c c ADF 43.79 44.36 45.41 46.52 46.88 0.385 a ab b c 1830.44 g/d 1732.57 1755.42 1782.43 1872.59 c 367.69 HC 72.47a 73.10a 73.31a 73.69a 73.83a 1.399 a a a b ab Note: Means with different superscripts in a row differ significantly kg/100 kg 1.83 1.85 1.86 1.95 1.90 0.00099 b.wt from each other g/kgW 0.75 57.08a 57.72ab 58.24ab 61.03c 59.39bc 0.669 DCPI Table 4: Effect of hydroponics maize fodder on practical nutritional a b c d cd worth in Rathi calves g/d 256.99 289.45 319.34 335.12 327.54 13.64 kg/100 kg 0.27a 0.30b 0.33c 0.35d 0.34cd 0.000037 Attribute Treatment groups SEM b.wt 0.75 a b c d cd T1 T2 T3 T4 T5 g/kgW 8.47 9.52 10.43 10.92 10.63 0.0257 a b c e d DCP % 8.32 9.58 10.69 11.34 11.22 0.0024 TDNI a b c e d TDN % 54.78 59.75 63.66 67.21 65.88 0.083 a b c d 1923.04 g/d 1703.51 1806.02 1901.24 1986.92 c 514.84 NR 5.59c 5.24b 4.95a 4.93a 4.87a 0.0015 kg/100 kg 1.79a 1.90b 1.98c 2.07d 1.99c 0.00114 Note: Means with different superscripts in a row differ significantly b.wt from each other g/kgW 0.75 55.80a 59.38b 62.05c 64.76d 62.39c 0.792 values of cows fed on artificially grown barley fodder. Similarly, Note: Means with different superscripts in a row differ significantly Reddy et al. (1988) reported significant (P<0.05) increase in from each other DCP% and TDN% values in cows fed with artificially grown concentrate mixture was met through hydroponics maize barley fodder. However, Naik et al. (2014) recorded significant fodder and the lowest was observed in T1, control group. increase in DCP values and non significant increase in CP Reddy et al. (1988) reported that the intake of DCP and and TDN values in cows fed with hydroponics maize fodder. TDN were higher in both groups of milch cows fed on artificially In DDMI significant increase (P<0.05) was observed in grown barley fodder and NB-21. Pandey and Pathak (1991) terms of g/d but non significant increase was recorded for kg/ observed that the mean daily intake of CP, DCP and TDN were 0.75 100 kg b.wt, g/kgW when groups were fed with hydroponics higher than the maintenance requirement but lower than the maize fodder (Table 5). In DOMI significant (P<0.01) increase total requirement for maintenance and milk production in cows 0.75 was observed in terms of g/d, g/kgW and significant increase fed on artificially grown barley fodder.Whereas, Maity et al. (P<0.05) was recorded in terms of kg/100 kg b.wt in groups (1996) recorded that there was no significant change in DCP fed with hydroponics maize fodder. The hydroponics maize and TDN intake in cows fed on artificially grown barley fodder. fodder significantly (P<0.01) increased the DCPI and TDNI in Similarly, Maity et al. (1996) reported that there was no significant 0.75 terms of g/d, kg/100 kg b.wt, g/kgW . The highest value was change in DCP intake in cows fed on artificially grown barley observed in T4 where 75% of crude protein requirement of fodder. On the basis of the performance of animals subjected 293 Veterinary Practitioner Vol. 20 No. 2 December 2019

to the feeding of basal roughage along with hydroponics maize Naik PK, Dhuri RB, Karunakaran M, Swain BK and Singh NP (2013a) fodder at different levels in order to replace the concentrate Hydroponics technology for green fodder production. Indian mixture, it can be thus concluded that hydroponics maize fodder Dairyman, March Issue, pp. 54-58. has beneficial effect on nutrient utilization efficiency in Rathi Naik PK, Dhuri RB, Karunakaran M, Swain BK and Singh NP (2014) Effect of feeding hydroponics maize fodder on digestibility calves. of nutrients and milk production in lactating cows. Indian J. References Anim. Sci. 84(8): 880-883. Naik PK, Dhuri RB, Swain BK and Singh NP (2012) Nutrient changes A.O.A.C (2000) Official methods of analysis. 17th ed. Association of with the growth of hydroponics fodder maize. Indian J. Official Analytical Chemists, Washington, D.C. Anim. Nutr. 29(2): 161-163. Al-Karaki GN (2011) Utilization of treated wastewater for green forage Naik PK, Swain BK, Chakurkar EB and Singh NP (2012b) Performance production in a hydroponic system. Emirates J. Food Agri. of dairy cows on green fodder maize based ration in coastal 23: 80–94. hot and humid climate. Anim. Nutr. Feed Tech. 12: 265-70. Al-Karaki GN and Al-Momani N (2011) Evaluation of some barley Rajendra P, Seghal JP, Patnayak BC and Beniwal RK (1998) Utilization cultivars for green fodder production and water use of artificially grown barley fodder by sheep. Indian J. Small efficiency under hydroponic conditions. Jordan J. Agri Sci. Rumi. 4(2): 63-68. 7: 448-456. Reddy GVN. and Reddy MR (1988) Comparative Nutrient Utilization Banerjee GC (1988) Feeds and Principles of Animal Nutrition. Oxford from Rations Containing NB-21 and Artificially Grown Green and IBH publishing company. Fodder by Sheep. Indian J. Anim. Nutri. 5(3): 252-255. Fazaeli H, Golmohammadi HA, Shoayee AA, Montajebi N and Mosharraf Reddy GVN, Reddy MR and Reddy KK (1988) Nutrient utilisation by Sh ( 2011) Performance of feedlot calves fed hydroponics milch cattle fed on rations containing artificially grown fodder. fodder barley. J. Agri. Sci. Tech. 13: 367-375. Indian J. Anim. Nutr. 5(1): 19-22. Goering HK and Van Soest PJ (1970) Forage Fibre analyses Sneath R and Mclntosh F (2003) Review of hydroponic fodder (Apparatus, Reagents, Procedures and Some Applications). production for beef cattle. Queensland Government, Agriculture Handbook No. 379. ARSUSDA, Washington, Department of Primary Industries, Dalby, Queensland. DC., USA. Snedecor GW and Cochran WG (1994) Statistical Methods, 8th ed. ICAR (1985) Nutrient requirements of livestock and poultry. I st ed. ICAR Oxford and IBH Publishing Co. New Delhi, India. Publication and Information Divisions, New Delhi. VanSoest PJ, Robertson JB and Lewis BA (1991) Methods of dietary Kramer CY (1957) Extension of multiple range tests to group correlation fiber, neutral detergent fiber and non starch polysaccharides adjusted means. Biometrics. 13:13. in relation to animal nutrition. J. Dairy Sci. 74: 3583-3597. Maity SB, Singh NP and Misra AK (1996) Effect of replacement of Verma Swati, Singh Anand, Kalra Anup and Saxena Mohan ji (2015) concentrate mixture by artificially grown barley fodder on Effect of Feeding Hydroponics Barley (Hordeum vulgare) energy utilization and milk production in crossbred cows. Fodder on Nutrient Utilization, Grown, Blood Metabolites and Indian J. Anim. Nutri. 13(4): 231-233. Cost Effectiveness in Hariana Male Calves. Indian J. Anim. Misra AK, Maity SB and Upadhyay VS (1996) Nutritional evaluation of Nutr. 32(1): 10-14. barley fodder grown under artificial conditions. Indian J. Anim. Sci. 66(8): 958-960. Naik PK, Dhuri RB and Singh NP (2011) Technology for production and feeding of hydroponics green fodder. Extension Folder No. 45/2011, ICAR Research Complex for Goa, Goa.

294 Veterinary Practitioner Vol. 20 No. 2 December 2019

STUDY ON EFFECT OF IMPROVED SHELTER MANAGEMENT PRACTICES ON THE BEHAVIOUR PERFORMANCE OF SAHIWAL CATTLE IN ARID REGION OF RAJASTHAN

R. Arora, S.C. Goswami and V.K. Chaudhary Department of Livestock Production and Management, College of Veterinary and Animal Sciences Rajasthan University of Veterinary and Animal Sciences, Bikaneri-334 001, Rajasthan, India

ABSTRACT Received on: 07.09.2019 Accepted on: 18.11.2019

The present study was conducted on 24 lactating Sahiwal cows by dividing them into four homogeneous groups randomly. The cows of control were kept on cement concrete floor. The cows of treatment group (G-2) were kept in shed having rubber mat flooring, whereas G-3 group animals were reared on cement concrete floor with physical modification, in G-4 group providing rubber mat flooring with physical modification. The objective was to study the effect of improved shelter management on behaviours (lying time, standing time) of cattle. In hot-humid season (June to august), the overall mean values of standing time of cows housed under different shed were 776.69±1.45, 619.94±1.06, 728.06±1.01 and 545.24±1.34 minutes, in G-1, G-2, G-3 and G-4 group, respectively whereas in hot-humid season, the overall mean values of lying time of cows housed under different shed were 513.26 ±0.62, 662.04±1.4, 555.75±2.67 and 714.08±3.26 minutes, respectively. There was significant difference in animal behavior such as in standing time, lying time. Overall standing time (minute) in cows was significantly higher in G-1 group (776.69±1.45). All groups were significantly differ (P<0.05) in standing time as well as in lying time. Lying time was significantly higher (P<0.05) in G-4 group (714.08±3.26.).

Key words: Behaviour, lactating cow, rubber mat, cement concrete floor, improved shelter

Introdution by use of fogger, mister or sprinker and splashing of water Livestock sector is an integral part of agriculture of India with fan or without fan (Atrian and Shahryar, 2012). and an important part of the whole economy with reference to Flooring is also one of the most important components of employment, income and earning of foreign exchange for the animal housing as far as animal health, growth and welfare country. Cattle are economically explored for dairy purposes. are concerned.In dairy animals the most common flooring The total cattle contributes around 37.28% of the total livestock material used is cement concrete. Though concrete flooring population. Rajasthan is the largest state of India endowed has advantages like durability, and strength, there are some with huge livestock production which is at present 57.73 million obvious disadvantages like slippery nature and hardness (Livestock Census, 2012). As per the 19th livestock census which reduces the animal comfort. However, concrete cannot (2012) India possesses 190.90 million cattle population out of provide comfort necessities for standing, walking and lying. which Rajasthan possess 13.32 million. Now a days provision of cushioned flooring particularly rubber Sahiwal is one of the heaviest milker of all Zebu breeds mat in the animal house is gaining popularity. Cows provided and display a well-developed udder. Due to their heat tolerance, with a softer bed are known to stand up and lie down twice as disease resistance and high milk production potential and often as cows on concrete (Chapinal et al., 2009). Still the low maintenance cost, this breed has higher demand among usefulness of improved shelter management is not well studied the Indigenous breeds. with respect to indigenous cow’s behaviour. Therefore, present During the year 2015-16 the country had nearly 22.50 study was conducted to study effects of improved shelter million crossbred cows and 30.45 million indigenous cows in management on sitting, standing behaviors in lactating Sahiwal milk production. The average milk production of the respective cows. categories was 8.44 kg/day and 3.97 kg/day (Reddy, 2016). Despite large genetic resources, productivity per animal is low Materials and Methods in our country. Thus, there is a need for agents to alleviate The present study was conducted at Livestock Research environmental stressors for improving productivity in this breed Station, Kodamdesar. Twenty four Sahiwal milch cattle were of cattle. selected in early lactation (1-3 months) from L.R.S., One of the greatest challenges being faced by producers Kodamdesar. They were randomly divided into 4 homogenous and livestock due to high ambient temperature is thermal groups of six each. Group-I without any shelter management stress. The effect of thermal stress is aggravated when reared on pucca floor made up of cement concrete blocks in accompanied with high humidity (Marai and Habeeb, 2010). covered area were act as control (G1). The experimental cows An ideal housing enables in moderating the range of in group-II were reared on rubber mat bedding over pucca floor microclimate to which the animals are exposed and the degree in covered area (G2). In group-III were reared on pucca floor of comfort depends upon the shelter management and type of (made up of cement concrete blocks) in covered area with floor which can be used. The most common approach to physical modification in shelter (G3). In group-IV were reared ameliorate heat stress is to modify environment near to cow on rubber mat (width-4 foot, length-7 foot, thickness-25 mm, way through provision of shade, evaporative cooling system from Sumanglam Dairy Farm Solution Pvt. Ltd.,Ghaizabad) 295 Veterinary Practitioner Vol. 20 No. 2 December 2019 floor in covered area with physical modification in shelter (G4). Table 1(a) Mean± SE of standing time in different groups (hot The data for various observations were recorded for 150 days humid) from June to November-2018. In physical modification Days standing G-I G-II G-III G-IV (provided with fan and splashing of water on body surfaces for Time- hh two times a day 11.00 AM and 3.00 PM daily). Feed offered in 1 770±2.54 620.5±1.57 727± 1.75 524±1.63 all treatment groups were similar throughout the experiment. 2 784.5±2.91 618±1.63 724.84±1.58 524.5±1.73 Individual cow were offered green fodder and dry fodder ad 3 759.67±3.22 621.67±2.2 729.17±1.56 534.84±3.15 libitium and 2.5 kg concentrate mixture daily. After calving 1 kg extra concentrate mixture was given for every 2.5 kg milk 4 784±3.83 619.67±2.49 735±2.22 540±0.73 production. All cows were receive the basal diet. Milking of 5 783.5±1.52 621.34±2.89 730.34±2.17 548±3.96 cows was mainly done by hand milking by milkers twice a day 6 765.34±4.05 628.84±2.77 724.84±1.72 547±3.9 at 5.00 AM and 4.00 PM at milking parlour. In the present study, 7 785.34±2.63 617.67±1.89 726±2.08 543±1.77 behavioral activity in all the groups of cattle was recorded by 8 787.17±3.1 614.17±2.75 732.17±2.14 540.17±3.13 constant personal observation and CCTV for 24 hours from 9 796±2.68 615.84±3.53 730±1.65 550.67±2.93 60th day to 75th day in hot humid season (June to August) in covered area during the experimental period (150 days). The 10 774.5±3.08 625.17±3.04 733.17±2.61 546.67±2.14 data collected, scored, compiled and tabulated were subjected 11 779.67±1.73 621.5±0.76 728.17±2.73 556.84±2.49 to statistical analysis by appropriate method of analysis as 12 769.67±3.69 619.5±2.63 727.5±2.36 561.17±3.46 per Snedecor and Cochran (1994) for analysis of variance and 13 749.5±3.3 617.84±1.8 723.34±3.34 546.5±3.7 Duncan’s multiple range tests was conducted to test the 14 782.84±4.73 621±3.02 723.67±2.87 559±5.73 significance of difference between means (P<0.05). 15 778.67±4.16 616.34±2.5 725.67±2.96 556.17±5.11 Overall Mean d b c a Results and Discussion 776.69 ± 1.45 619.94 ± 1.06 728.06 ± 1.01 545.24 ± 1.34 Behavior is one of the most commonly used and sensitive Mean bearing different superscripts in a raw differ significantly (p<0.05) indicators of animal welfare (Haley et al., 2001). The animal behavior viz., standing and lying time in different groups of Table 1(b) ANOVA for standing time in Sahiwal cattle in different shed sahiwal cattle due to microclimate alteration were represented in Tables 1 and 2. d.f. Sum sqr Mean sqr F (calculat) Group 3 196805.5 65601.82** 7251.551 Standing time Error 20 180.9319 9.046593 The overall mean values of standing time are presented Total 23 in Table 1. In hot-humid season, the overall mean values of Significant at 5% level of significance (P<0.05) standing time of cows housed under different shed were 776.69±1.45, 619.94±1.06, 728.06±1.01 and 545.24±1.34 minutes, in G-1, G-2, G-3 and G-4 group, respectively.

Lying time The overall mean values of daily lying time are presented in Table 2. In hot-humid season, the overall mean values of lying time of cows housed under different shed were 513.26±0.62, 662.04±1.4, 555.75±2.67 and 714.08±3.26 minutes, respectively. The reason behind this was the environmental condition were more comfortable in G-4 groups as compared to other groups. The animals reared on rubber mat spend more time in lying condition rather than standing. Animals on concrete floor spent more time standing without eating in G-1 group results in low feed intake and reduce rumination time. The results are similar to the findings of Madke et al. (2010) who reported that the increased standing time in animals kept on concrete flooring than the animals kept on sand bedding. Rushen et al. (2007) also reported higher standing time of cows housed on concrete flooring as compared to those housed on rubber mattress. The results were in accordance with Herlin (1997) and whereas inconsistent with Chaplin et al. (2000), Hultgren (2001), Fregonesi et al. (2004), Haufe et al. (2012), Calamari et al. (2009), Mitev et al. (2012) and Cozzi et al. (2013). Similar finding was observed in time budget reported by Grant (2007) in which he reported 12 to 14 hours of sitting time

296 Veterinary Practitioner Vol. 20 No. 2 December 2019

Table 2(a): Mean± SE of lying time in different groups (hot humid) Chaplin SJ, Tierney G, Stockwell C, Logue DN and Kelly M (2000).An evaluation of mattresses and mats in two dairy units. Appl. days G-I G-II G-III G-IV Anim. Behaviour Sci. 66(4): 263-272. 1 476.5 ± 1.02 653.84± 1.11 596.5± 2.29 704.84± 3.85 Cook NB, Bennett TB and Nordlund KV (2004) Effect of free stall 2 484.34± 1.28 661.67± 1.73 592.67± 2.62 709.17±3.32 surface on daily activity patterns in dairy cows with relevance to lameness prevalence. J. Dairy Sci. 87(9): 2912 3 497.67± 2.43 684.5±3.02 584± 3.02 710.5± 4.43 2922. 4 498±1.29 673± 1.9 578.17± 2.52 711.5±3.06 Cozzi G, Tessitore E, Contiero B, Ricci R, Gottardo F and Brscic M 5 509.67± 3.86 697± 5.11 568.67± 5.48 717± 2.82 (2013) Alternative solutions to the concrete fully-slatted floor 6 520.34±2.89 677.5± 3.77 550.84± 3.06 721.17± 3.72 for the housing of finishing beef cattle: effects on growth 7 527.67± 1.17 668.5± 3.39 547± 4.36 724.67± 3.29 performance, health of the locomotor system and behaviour. 8 520.5± 1.67 663±3.83 539.5± 5.3 715.34± 5.29 Vet. J. 197(2): 211-215. Fregonesi JA, Tucker CB, Weary DM, Flower FC and Vittie T (2004) 9 529.17± 1.54 642.34± 3.59 528.17± 4.89 715.34± 2.87 Effect of rubber flooring in front of the feed bunk on the time 10 539± 1.53 642.5± 3.93 547.34± 2.07 719.67± 2.44 budgets of dairy cattle. J. Dairy Sci. 87(5): 1203-1207. 11 528.67± 1.86 650.34± 4.5 549.67± 4.2 712.17± 4.21 Grant R (2007) Taking advantage of natural behaviour improves dairy 12 524.5± 2.32 656.84± 2.91 542.84± 2.91 712.67± 6.6 cow performance. Proceeding Western Dairy Management 13 516.84± 1.62 649.5± 2.99 543.5± 5.99 721± 3.39 Conference, Reno, NV. 225-236. Haley DB, De Passille AM and Rushen J (2001) Assessing cow 14 517.17± 2.3 650.34± 3.59 535± 3.47 712.5± 2.77 comfort: Effects of two floor types and two tie stall designs 15 508.84± 1.25 659.67± 3.16 532.34± 4.46 703.67± 4.3 on the behaviour of lactating dairy cows. Appl. Anim. d Overall a c b 714.08 Behaviour Sci. 71(2): 105-117. 513.26 ± 0.62 662.04 ± 1.4 555.75 ±2.67 Mean ±3.26 Haufe HC, Gygax L, Wechsler B, Stauffacher M and Friedli K (2012) Influence of floor surface and access to pasture on claw Mean bearing different superscripts in a row differ significantly (p<0.05) health in dairy cows kept in cubicle housing systems. Prev. Vet. Med. 105(1-2): 85-92. Table 2(b): ANOVA for lying time in Sahiwal cattle in different shed Herlin AH (1997) Comparison of lying area surfaces for dairy cows by d.f. Sum sqr Mean sqr F (calculat) preference, hygiene and lying down behaviour. Swedish J Group 3 155017.6 51672.55** 1713.508 Agric. Res. 27:189-196 Error 20 603.12 30.156 Hultgren J and Bergsten C (2001) Effects of a rubber-slatted flooring Total 23 system on cleanliness and foot health in tied dairy cows. Significant at 5% level of significance (P<0.05) Prev. Vet. Med. 52(1): 75-89. Madke PK, Lathwal SS, Kumar Y and Kaushik V (2010) The effect of on 24 hours basis. These results are also in agreement with floor system on the performance, cleanliness, carcass the observations of Tucker et al. (2003), Cook et al. (2004) who composition and meat quality of housed finishing beef cattle. Livest. Prod. Sci. 69(1): 33-42. found that the cows in comfortable surroundings typically lie Marai IFM and Habeeb AAM (2010) Buffalo’s biological functions as down between 9 and 13 hours per day. This is also in affected by heat stress-a review. Livest. Sci. 127: 89-109. agreement with Vijayakumar et al. (2011) who concluded that Mitev J, Penev T, Gergovska Z, Miteva C, Vassilev N and Uzunova K the provision of sprinklers and fans for reduction of summer (2012) Comparative investigation on some welfare indicators stress helps the comfort of the buffalo heifer, which was of cattle under different housing systems. Agr. Sci. Technol. indicated by more time lying down. 4(1): 27-32. Reddy SA and Padmathi M (2016) The Growth and development of References Dairy industry in India. Int. J. Scientific Res. 5(6): 246-249. 19th Livestock Census (2012) Department of Animal Husbandry, Rushen J, Haley D and De Passille AM (2007) Effect of softer flooring Dairying and Fisheries, Ministry of Agriculture. Government in tie stalls on resting behaviour and leg injuries of lactating of India. cows. J. Dairy Sci. 90: 3647-3651. Atrian P and Shahryar HA (2012) Heat stress in dairy cows. Res. Snedecor, G. W. and W. G. Cochran (1994) Statistical Methods. 8th Zool. 2(4): 31-37. edn.Affiliated East. West Press, New Delhi. 13:1467-1473. Calamari L, Calegari F and Stefanini L (2009) Effect of different free Tucker CB, Weary DM and Fraser D (2003) Effect of three types of stall surfaces on behavioural, productive and metabolic free-stall surfaces on preferences and stall usage by dairy parameters in dairy cows. Appl. Anim. Behaviour Sci. 120(1- cows. J. Dairy Sci. 86: 521-529. 2): 9-17. Vijayakumar P, Dutt T, Singh M and Pandey HN (2011) Effect of heat Chapinal N, de Passillé AM, Weary DM, von Keyserlingk MAG and ameliorative measures on the biochemical and hormonal Rushen J (2009) Using gait score, walking speed and lying responses of buffalo Heifers. J. Appl. Anim. Res. 39(3):181- behavior to detect hoof lesions in dairy cows. J. Dairy Sci. 184. 92(9): 4365-4374.doi:

297 Veterinary Practitioner Vol. 20 No. 2 December 2019

ADOPTION LEVEL OF LIVESTOCK OWNERS OF RAJASTHAN IN TERMS OF TOLL FREE (1800-180-6224) EXPERT ADVISORY SERVICE (RTHS)#

Siddharth Singh Rathore1*, Devi Singh Rajput, Prerna Nathawat2, Neeraj Kumar Sharma, Ashok Dangi3, Shyamlal Garg4 and Pramod Kumar Godara5 Department of Veterinary and Animal Husbandry Extension Education, College of Veterinary and Animal Science Rajasthan University of Veterinary and Animal Sciences, Bikaner- 334 001, Rajasthan, India

Received revised on: 22.04.2019 ABSTRACT Accepted on: 03.09.2019

Present paper highlighted the adoption level of livestock owners for the RAJUVAS toll free expert advisory services (1800-180- 6224). Respondents were selected from two districts Bikaner and Jaipur of Rajasthan state on the basis of received maximum telephonic calls during a period of six months (1 Jan to 30 June, 2017). A total 75 respondents were selected randomly from each district and constitute total 150 respondents as sample for the study. Primary data were generated by contacting the respondents via telephonic interview schedule. The results shown that majority of respondents (56.67%) fully adopted the advices whereas, 33.33 per cent respondents did not, and remaining 10 per cent respondents adopted the advices partially. Results pertaining to query wise adoption level of advices revealed that medicinal problems based adoption level was maximum (65.34%) followed by animal produc- tion and management related practices (60%), gynaecological problems (58.82%), animal feeding and nutrition problems (50%), dairy entrepreneurial and dairy marketing related queries (44.44%) and surgical problems (33.33%).

Key words: Toll free, advisory services, adoption, RTHS, RAJUVAS

Introduction advisory services to the livestock owners throughout the country India is blessed with highest population of livestock, yet and with the help of this service, livestock farmers from any the poor net productivity is a serious concern. Livestock owners corner of India can reach the veterinary and animal husbandry actually face a diverse set of issues- be it about vaccination experts of RAJUVAS, twenty four hours. To assess the adoption schedule, control of infectious/contagious diseases, loss of level of this mobile advisory service of RAJUVAS among the production, management issues or changing market trends. livestock owners of district Bikaner and Jaipur, the present To ensure stable income for themselves, any progressive study was designed and carried out to generate primary data livestock farming system always seeks an actively promoting by contacting the respondents of this advisory service directly. information channel and advisory tailored to their local needs (IANS, 2008; Savithramma, 2011). Poor information Materials and Methods dissemination system only leads to a wider gap between Total recorded phone calls were collected from the record technologies developed and actually being adopted (NSSO, of IUMS (Integrate University Management System), RAJUVAS, Bikaner in form of respondent’s queries during six months (1 2005). In the era of e-communication, a variety of information th and communication technologies (ICT) available, of which, Jan. to 30 June, 2017) and treated as base of secondary data mobile phone has been emerged as one of the widely for further processing and analysis. From these collected accepted and adopted instruments increasing the contact phone calls, two districts were purposively identified based on intensity throughout the world (Anandaraja et al., 2011; Ansari the highest number of telephonic calls received by RTHS during and Pandey, 2013; Muthiah et al., 2013). It facilitates immediate the period of six months. From each district, total 75 access to up to-date information, faster and easy respondents were randomly selected to make a total sample communication between farmers and information provider size of 150 respondents for collection of primary data. (Ponnusamy, 2005). In Rajasthan state, the number of Respondents were personally contacted through telephonic telephone subscribers was 68.06 million at the end of March interview schedule to collect primary data and these data were 2017, out of which, 34.58 million were rural subscribers analyzed by percentage and frequency distribution. Extent of (Anonymous, 2017) and the number is increasing at a very adoption was measured by means of an adoption index faster rate because of the cost free services provided by the originally developed by Meena (1999) with suitable government agencies as well as by the network provider modifications. Adoption was calculated using adoption index companies. This impressive growth of mobile consumers in formula which is as follows: India attracted the government bodies to develop various Obtained score Adoption index = x 100 advisory services for example Kisan Call Centre, Kisan Mobile Maximum Obtainable score Advisory Service etc. (Bondale et al., 2005; Kumar et al., 2012; Kanavi, 2014). Rajasthan University of Veterinary and Animal Where: Sciences (RAJUVAS), Bikaner launched a TOLL FREE (1800- Obtained score = 2(X) +1(Y) +0(Z) 180-6224) HELPLINE SERVICE (RTHS) to provide expert Maximum obtainable score = 2(X+Y+Z)

*# Part of M.V.Sc. Thesis and corresponding author email: [email protected]; 1,2&5Veterinary Officer, Department of Animal Husbandry, Rajasthan, 3Incharge-IUMS, RAJUVAS, Bikaner, 4Project Associate, CVAS, RAJUVAS, Bikaner

298 Veterinary Practitioner Vol. 20 No. 2 December 2019

Table 1: Distribution of respondents according to extent of adoption of knowledge purpose about the dairy entrepreneurship, loan advice (N=150) and subsidiary schemes, about suitable breeds to start dairy S. Extent of Frequency Overall businesses for different locations etc. Such advices incorporate No. adoption of (per cent) percentage of a decision making process which takes a longer time for final advice adoption level 1 Fully 85 adoption. adopted (56.67) 2 Partially Query wise extent of adoption 15 (10) adopted 61.66% A query wise adoption level of advices by respondents 3 Not 50 adopted (33.33) received from RTHS are shown in perusal of Table 2 and it Total 150 (100) revealed that information about clinical problems has Table 2: Distribution of respondents according to query wise adoption maximum (65.34%) adoption level. Advices on livestock (N=150) production and management related problems stood second with 60 per cent of adoption level followed by gynecological S. Fully Partially Not Adoption Type of Query Frequency Rank problems (58.82%) and animal feeding and nutrition problems No. adopted adopted adopted level (50%), respectively. 1. Medicinal problems 101 65 2 34 65.34 I Least adoption was found for information of dairy Livestock production and 2. 15 7 4 4 60 II management problems entrepreneurship and dairy marketing related queries 3. Gynaecological problems 17 7 6 4 58.82 III (44.44%) and surgical problems (33.33%), respectively. Animal feeding and 4. 5 2 1 2 50 IV nutrition problems References Dairy entrepreneurial and Anandaraja N, Sriram N, Kathiresan C, Sebastian S and Vadivel E 5. 9 3 2 4 44.44 V marketing problems (2011) Linking the farmers with market through web and 6. Surgical problems 3 1 0 2 33.33 VI mobile. Information and Communication Technology for Total 150 85 15 50 61.66 Agriculture and Rural Development, New India Publishing Agency New Delhi. 38-49. Anonymous (2017) The Indian Telecom Services Performance Where: Indicator. Quarterly report (January-March, 2017), TRAI. X = Number of livestock owners who have fully adopted the New Delhi. India. advice, Ansari MA and Pandey N (2013) Assessing the potential and use of Y = Number of livestock owners who have partially adopted mobile phones in agriculture. Karnataka J. Agr. Sci. 26(3): the advice, 388-392. Z = Number of livestock owners who have not adopted the Bondale HP, Chavali AM, Tarde, VJ and Susane GK (2005) Role of Kisan Call Centre in dissemination of agricultural technology. advice, J. Agric. Ext. Manage. 6(2): 77-83. X+ Y + Z = Total number of livestock owners interviewed. IANS (2008) Farmers to get market rates on BSNL mobiles. http:// As far as query wise (subject area) adoption is concerned, www.the indian.com/news portal/business/farmers-to-get- queries of all respondents were tabulated and analyzed as market-rates-on-bsnl-mobiles100116668.html (Accessed on per case, the frequency number of livestock owners was 5th July, 2009). multiplied by the respective score allotted to each response Kanavi SR (2014) An analysis of Kisan Mobile Advisory Service (KMAS) and adoption level was calculated. of Krishi Vignyan Kendra. M.Sc. Thesis, University of Agricultural Sciences, Dharwad. Results and Discussion Koshy SM (2016) Agricultural Information Support Service vis-a-vis Extent of adoption Kisan Call Centre: A performance auditing. Ph.D. Thesis, Queries posed to RTHS were asked by conducting Kerala Agricultural University, Kerala. Kumar R, Mishra S, Kushwah RS, Jain DK and Chauhan S (2012) telephonic personnel interview method and information Assessment and refinement of KMA in Tikamgarh district collected on extent of adoption for the particular advice (Madhya Pradesh). Indian Res. J. Ext. Educ. (12): 35-38. recommended by RTHS. The results are shown in Table 1. Lavanya P (2006) Formative evaluation of Kisan Call Centre in Tamil According to the results obtained, about 57 per cent of Nadu. M.Sc. Thesis, Tamil Nadu Agr. University, Coimbatore. respondents adopted the particular advice in full agreement Meena HR (1999) Decision making pattern and adoption of Improved whereas, 33 per cent of respondents did not act to the advices Dairy Farming Practices (IDFPs) among Tribal in Rajasthan. and 10 per cent partially adopted the advices received from Ph.D. thesis, National Dairy Research Institute (NDRI), Karnal. RTHS. The overall extent of adoption level towards advices Muthiah G, Prashanth S, Umadikar J and Karthikeyan K (2013) An exploratory study of mobile multimedia agricultural advisory recommended by RTHS was 61.66 per cent. The above results system: Challenges and lessons from Tamil Nadu, India. have a positive impact towards the services rendered by RTHS, Electron. J. Inf. Syst. Developing Countries. 56(5): 1-14. as there were comparatively less adoption of the expert advices NSSO (2005) Access to modern technology for farming situation. by respondents to the most popular agro-farming advisory Report number-499, Ministry of Statistics and Programme services like Kisan Call Center (Lavanya, 2006; Koshy, 2016). Implementation, Government of India, New Delhi. The reason might be that it responds more timely and in a cost Ponnusamy K (2005) Mobile communication in rural development. Kisan effective manner to the queries rose in local language and World. 32(6): 29. there is no other animal husbandry related advisory services Savithramma M (2011) Farmer’s awareness of Kisan Call Centre and the symbolic adoption of advice in Karnataka- A study. available. The reason behind partial/no adoption might be the M.V.Sc. Thesis, University of Agr. Sciences, Bangalore. unavailability of the inputs or resources suggested, or it may be due to the information asked for general awareness or 299 Veterinary Practitioner Vol. 20 No. 2 December 2019

ETHNOVETERINARY PRACTICES OF SURGICAL AFFECTIONS WITH THEIR EXTENT OF USE FOLLOWED BY LIVESTOCK OWNERS IN WESTERN ZONE OF RAJASTHAN

S.L.Garg1, N. K. Sharma2, Devi Singh Rajput2 and S.S. Rathor3 Department of Veterinary and Animal Husbandry Extension Education, College of Veterinary and Animal Science Rajasthan University of Veterinary and Animal Sciences, Bikaner-334 001, Rajasthan, India

Received revised on: 06.05.2019 ABSTRACT Accepted on: 06.07.2019

The present study was conducted in Bikaner and Jodhpur districts of Rajasthan in order to document the ethnoveterinary practices followed by livestock owners. A total of 120 livestock owners were selected as respondent from 12 selected villages of 4 tehsils of the districts. Inventories of 8 ethnoveterinary practices were documented for treatment of fracture, 4 ethnoveterinary practices were documented for treatment wound, 6 ethnoveterinary practices were documented for treatment of burn, 5 ethnoveterinary practices were documented for treatment of affection of eye, one for dog bite and one for tail gangrene.

Key words: Ethnoveterinary, wound, Rajasthan

Introduction of the 13 tehsils from Jodhpur district on basis of good Alternative sources of medicines like herbal proportion of livestock population. With consideration of medicines may soon become key components in the availability of traditional healers, a comprehensive list of healthcare provision industry for both humans and all villages was prepared from respective tehsils after animals especially in developing countries. These herbal discussion with patwari, tehsildar, veterinary officer, medicines will fill a gap caused by a decrease in the villagers and traditional healers. Three villages were number of new modern medicines being developed in randomly selected from each tehsil and a total of twelve the last few decades (especially in the case with anti- villages were selected for the purpose of study. The 10 infective), increasing costs, drug resistance, and side livestock owners from each of the twelve selected villages effects of modern pharmaceuticals. Ethno-veterinary including the available traditional healers were identified medicine (EVM) is a scientific term for traditional animal randomly who have adopted animal husbandry health care that encompasses the knowledge, skills, occupation. Thus, the total sample size was constituted methods, practices, and beliefs about animal health care 120 livestock owners. found among community members (McCorkle, 1986). The The ethnoveterinary medicines (EVMs) used by the knowledge of ethno veterinary is orally transferred from livestock owners of a selected area in Rajasthan were generation to generation, hence with continuous identified and determined the extent to which the identified disruption of cultural set-ups and younger people showing EVMs were using by the them. Current study of extent of less interest in learning local languages, traditional use of Ethnoveterinary medicines was decide on the knowledge is on the verge of disappearance. The basis of EVMUI (Ethnoveterinary Medicine Use Indices) importance of this body of knowledge is best explained score. The following formula was used to calculate the by the African proverb, “When a knowledgeable old person EVMUI scores. The procedures for measuring the EVMUI dies, a whole library disappears” (Lalonde, 1993). were presented on a four-point continuum scale with the The rich and diversified flora of India provides valuable scoring order of 3, 2, 1 and 0 for ‘frequently used,’ storehouse of medicinal plants. The curative properties ‘occasionally used,’ ‘rarely used’ and ‘not at all used’ of herbs have long been known and are documented in respectively was employed (Islam and Kashem, 1999) ancient manuscripts such as in Rig Veda, Garuda Purana EVMUI = N1 × 3 + N2 × 2 + N3 × 1 + N4 × 0 and Agni Purana. These treatises focus on the potential Where, EVMUI = Ethnoveterinary Medicine Use Index of plants and herbs to cure human ailments and diseases N1 = Number of farmers who used the EVM frequently (Yadav et al., 2012) N2 = Number of farmers who used the EVM occasionally N3 = Number of farmers who used the EVM rarely Research Methodology N4 = Number of farmers who did not use the EVM The present study was conducted in purposively selected Bikaner and Jodhpur districts of Rajasthan. Two Results and Discussions tehsils Nokha and Lunkaransar were purposively Surgical affections/ailments selected out of the 8 tehsils from Bikaner district on basis 1. Fracture of good proportion of livestock population. Two tehsils I. Livestock owners fed 500 g haldi (Curcuma longa) after Phalodi and Bhopalgarh were purposively selected out mixed with 2 kg ghee. According to them haldi powder

1M.V.Sc Scholar and corresponding author, Email id: [email protected]; 2Assistant Professors and 3Veterinary Officer, Department of Animal Husbandry, Rajasthan 300 Veterinary Practitioner Vol. 20 No. 2 December 2019

and ghee provide strength to body. skin. II. Traditional healers burnt the ker wood (Capparis iii. Livestock owners applied mehndi (Lewsonia inermis) paste decidua) and prepared charcoal. They fed this charcoal 100 on the burn area. According to them topical application of g per day to suffering animal for 5 days. mehndi helps in reduction of irritation and inflammation of III. Livestock owners fed a mixture of 1 kg menda lakdi (Litsea skin. Medicinally, mehndi leaves also have astringent glutinosa), 500 g grinded haldi (Curcuma longa) with 2 kg til property. (Seasamum indicum) oil for 10 days. A paste prepared from iv. Livestock owners also reported that they apply paste of bajra menda lakdi also applied topically on fractured part. (Penisetum typhods) flour on burned skin of animal. Medicinally, menda lakdi has demulcent property. v. In another practice they applied paste prepared from bark IV. Traditional healer’s immobilised fractured limb through and leaves of sresh (Albezia lebbeck L.) on the burn area. plaster of multani mitti (Fuller earth) mixed with ladies hair. Medicinally, sresh plant has antiseptic and antibacterial V. Livestock owners fed 3 kg stone churi continuous for 15 properties which helps in early healing. days for quick healing of fractured part. vi. Ash of faeces of camel mixed with raw milk and apply topically VI. Livestock owners fed 1 kg guar (Cyamopsis tetragonoloba) in burn area. flour for continuous 20 days mixed with water for fracture healing in animals. 4. Tail gangrene VII. Traditional healers reported that they offered mixture of hen I. For treatment of tail gangrene in animals the affected portion eggs, haldi (Curcuma longa) with ghee to fractured animals. of tail dipped into boiled soya bean or mustard (Brassica VIII. Livestock owners fed 250 g sounth (Zinziber officinale) comprastis) oil for 10-15 seconds. Some livestock owners also mixed with 4 kg desi sugar for healing of fractured limb in mixed haldi powder (Curcuma longa) in oil. This practice was animals. repeated after 12 hours. Livestock owner stated that, this Galav et al. (2013) also reported that syrup was made by practice will check the further spreading of gangrene and it is mixture of 500 g shoots of Cissus quadrangular 500 g ash of very effective and economical also. Medicinally, antibacterial stem caparis decidua and roots of Zizipus jujube, 500 g jaggery and antifungal properties of oil check the further spread of and milk given to cattle once in a day for early healing of fractured infection in the affected part of the tail. bone. 5. Affection of eye 2. Wound I. Majority of livestock owners applied ash of bajra (Penisetum I. Livestock owners prepared a paste from flower of ker typhods) chapatti at lower eyelid of affected eye of animal. (Capparis decidua) plant and applied on the affected body They perceived that ash of bajra chappati helps in clear part of animal till healing. Medicinally, also ker flowers have visuality and reduce swelling in affected eye. anti-microbial activity thus help in early healing of wound. II. Some traditional healers also applied brick powder (stone) II. Livestock owners prepared a mixture of tobacco (Nicotiana after mixed with sugar in affected eye of animal on corneal tobacum) with water and applied topically on wound. opacity. According to them tobacco water act as fly repellent. III. In an another practice traditional healers washed eye of III. Livestock owners prepared a paste of haldi (Curcuma longa) animal with jaggery water if milk of aak (Calotropis gigantica) powder mixed with kapoor (Camphur) and apply topically on incidentlly fallen in animal eye. wound. Scientifically, haldi has antiseptic property which IV. Some traditional healers also wash affected eye of animal helps in early healing of wound. with dilute solution of tobacco powder with water. IV. For curing wound some livestock owners prepared a paste V. For treatment of corneal opacity livestock owners also applied of 50 g ajwain (Trachyspermum ammi), 50 g haldi (Curcuma a paste prepared with mixture of ground saunth (Zinziber longa) and 100 g ground onion (Alium cepa) mixed with 100 officinalis) powder with curd in affected animal. ml mustard oil. This paste was used for topically application 6. Horn cancer on wound. Medicinally, above ingredients have antibacterial, I. Livestock owners prepared paste with chomghas leaves anti-inflammatory, astringent properties which helps in fast (Corchorus depressus) and cow ghee and applied affected healing of wound. horn of animal. Result were in line with Niwas et al. (2013) who observed that haldi (Turmeric, Curcuma domestica) was ground and 7. Dog bite applied topically for wound healing in animal. I. In case of dog bite livestock owners applied red chilli (Capsicum annuam) on affected body part of animal. 3. Burn Scientifically, red chilli have irritant property which helps in i. In the case of burn livestock owners applied coconut (Cocos increase blood circulation at affected part. nucifera) oil on burnt body part. According to them coconut Thomas et al. (2011) found that an ointment prepared by oil help in reduction of pain and bacterial infection. Coconut mixing a pinch of red chilli powder in one spoon of honey oil have ability to accelerate re-epithelialization, improve applied to dog bite site is said to check hydrophobia. antioxidant enzyme activity, and stimulate higher collagen cross-linking within the tissue being repaired. Extent of use about EVMs of fracture with their EVMUIs and ii. Some livestock owners also applied til (Seasamum indicum) rank oil on the affected part of animal. Scientifically til oil has An inventory of 8 ethnoveterinary practices were emollient property thus helps in softening or soothing of documented for treatment of fracture. The data in the Table 1.1

301 Veterinary Practitioner Vol. 20 No. 2 December 2019

Table (1.1): Distribution of respondents according to extent of use (Fuller earth) and water with EVMUIs 84, 74 and rank II and III about EVMs of fracture with their EVMUIs and rank (N=120) respectively. Practices of using Guar (Cyamopsis EVM S.No. EVM practices F O R N Rank tetragonoloba) maida with water, churi stone flour with water - Uls 1. Ghee + haldi (Curcuma longa) 20 06 02 92 74 III and Saunth (Zinziber officinalis) with desi sugar were found Egg + haldi (Curcuma longa) + rarely utilized with EVMUIs 50, 28, 16 and ranked VI, VII and 2. 15 04 01 100 54 IV ghee VIII, respectively. Ladies hair + multani mitti 3. 12 06 04 98 52 V (Fuller earth) + water Extent of use about EVMs of wound with their EVMUIs and Coal powder of ker 4. 23 06 03 88 84 II (Capparis decidua) +water rank Menda lakdi (Litsea glutinosa) An inventory of 4 ethnoveterinary practices were 5. + curcuma longa + til 26 06 04 84 94 I documented for treatment of wound in animal. The data in the (Seasamum indicum) oil 6. Churi stone flour + water 00 12 04 104 28 VII Table 1.2 reflected that using camphor with haldi (Curcuma Guar (Cyamopsis tetragonoloba longa) was found most frequently using practices for treatment 7. 16 00 02 102 50 VI maida + water of wound in animal and having highest Ethnoveterinary Saunth (Zinziber officinalis) 8. 00 06 04 110 16 VIII + desi sugar Medicine Use Index 136 and ranked first. Another most **F-Frequently, O-Occasionally, R-Rarely, N-Never frequently utilized practice was ker (Capparis decidua) flower with water with EVMUI 95 and ranked second. Practice of using Table (1.2): Distribution of respondents according to extent of use tobacco (Nicotiana tobacum) with water was found rarely about EVMs of wound with their EVMUIs and rank (N=120) utilized with EVMUI 40 and ranked forth. S. EVM- EVM practices F O R N Rank No. Uls Extent of use about EVMs of burn with their EVMUIs and 1. Ker (Capparis decidua) flower 27 04 06 83 95 II rank 2. Camphor + haldi (Curcuma longa) 40 06 04 70 136 I An inventory of 6 ethnoveterinary practices were Tobacco (Nicotiana tobacum) + 3. 11 03 02 104 40 IV documented for treatment of burn in animal. The data in the water Table 1.3 revealed that using coconut oil (Cocos nucifera) was Ajwain (Trachyspermum ammi) + 4. haldi (Curcuma longa) + onions 23 04 02 91 79 III found most frequently used practice for treatment of burn having (Alium cepa) highest Ethnoveterinary Medicine Use Index 119 and ranked **F-Frequently, O-Occasionally, R-Rarely, N-Never first. Another most frequently utilized practice was mehndi (Lewsonia inermis) with water with EVMUI 71 and having ranked Table (1.3): Distribution of respondents according to extent of use second. Practice of using Ash of faeces of camels with raw about EVMs of burn with their EVMUIs and rank (N=120) milk was found rarely utilized with EVMUI 5 and ranked sixth. S. EVM- EVM practices F O R N Rank No. Uls Extent of use about EVMs of eye related affection with their 1. Coconut oil (Cocos nucifera) 32 10 03 88 119 I EVMUIs and rank 2. Sresh (Albezialebbek L.) + water 06 00 00 114 18 V An inventory of 5 ethnoveterinary practices were Bajra (Penisetum typhoidis) flour 3. 05 03 00 112 21 IV + water documented for treatment of affection of eye. The data in the Mehndi (Lewsonia inermis) + Table 1.4 reflected that using bajra (Penisetum typhoids) 4. 20 05 01 94 71 III water chapatti ash was found most frequently used practices for 5. Til (Seasamum indicum) oil 26 04 03 87 89 II treatment of affection of eye having highest Ethnoveterinary Ash of Faeces of camels + 6. 00 00 05 115 05 VI raw milk Medicine Use Index EVMUI 130 and ranked first. Another most frequently utilized practices was, bricks powder with sugar with **F-Frequently, O-Occasionally, R-Rarely, N-Never EVMUI 79 and ranked second. Practice of using tobacco Table (1.4) Distribution of respondents according to extent of use (Nicotiana tobacum) with water was found rarely utilized with about EVMs of eye related affection with their EVMUIs and rank (N=120) EVMUI 14 and ranked fifth. S. EVM- EVM practices F O R N Rank No. Uls References Bajra(Penisetum typhoids) Islam MM and Kashem MA (1999) Farmers’ use of ethno-veterinary 1. 40 05 00 75 130 I ki bati + namak medicine (EVM) in the rearing and management of livestock: 2. Bricks powder + sugar 15 12 10 83 79 II An empirical study in Bangladesh J. Sustainable Agri. 13(4): Tobacco (Nicotiana tobacum) + 39-56. 3. 3 2 1 114 14 V water Lalonde A (1993) African Indigenous Knowledge and Its Relevance to 4. Jaggery + water 7 2 3 108 28 IV Sustainable Development, In: Traditional Ecological Sounth (Zinziber officinalis) + Knowledge- Concepts and Cases. Ottawa: International 5. 13 1 2 104 43 III curd Program on TEK and the International Development Research **F-Frequently, O-Occasionally, R-Rarely, N-Never Centre. pp. 55-63 McCorkle CM (1986) An Introduction to Ethnoveterinary Research revealed that using menda lakdi (Litsea glutinosa) with Development and Extension for Studying and Applying Local curcuma longa and oil was found most frequently used practice Knowledge. J. Agr. Food Hum. Values Soc. 22: 52-80. for treatment of fracture in animal having highest Yadav M, Yadav A and Gupta E (2012) Ethnoveterinary practices Ethnoveterinary Medicine Use Index 94 and ranked first. Another in Rajasthan, India. Int. Res. J. Biol. Sci. 1(6): 80-82. most frequently utilized practices were coal powder of ker (Capparis decidua) with water, ladies hair with multani mitti

302 Veterinary Practitioner Vol. 20 No. 2 December 2019

CONTENTS Titles Page No. Effect of a novel antimicrobial peptide (KK-20) in combination with antibiotics on 147 - 149 Pseudomonas aeruginosa Rekha Panwar, Ram Kumar, Basant, Kritika Gahlot, Mukul Purva and Sunil Maherchandani

Isolation and identification of Salmonella in farm and backyard chicken samples 150 - 152 in and around Jaipur Madan Mohan Mali, D.S. Meena, Sandeep Kumar Sharma, Samita Saini, Sheela Choudhary, Sanjita Sharma and A.P. Singh

Sensitivity and specificity of Multiplex PCR assay for detection of Yersinia enterocolitica 153 - 158 in pigs and foods of porcine origin Rupa Boral, R.S. Rathore, A.K. Mishra and Ashok Kumar

Inflammatory cytokines, helping tool in veterinary diagnostics: from basics to advancement 159 - 162 Zul-I-Huma Syed, Neelesh Sharma, Amit Kumar Singh, Anand Kumar Pathak, Iva Bacic, Goran Bacic, Nino Macesic and Dong Kee Jeong

Histopathological study of skin of bird spontaneously infested by the red mite of poultry, 163 - 164 Dermanyssus gallinae S. Bora, Manoranjan Das, Saidul Islam, Shameem Ara Begum and Ranjeet Neog

Prevalence study and analysis of potential risk factors for Cryptosporidium spp. infection 165 - 169 in cattle calves of Jammu region Alveena Ganai, Anish Yadav, Rajesh Katoch and Rajesh Godara

Human parasitisation with nymphal Dermacentor auratus Supino, 1897 170 - 173 (Acari: Ixodoiidea: ixodidae) Saidul Islam, Prabhat Chandra Sarmah and Kanta Bhattacharjee

First report of Dicheilonema ciconiae (Schrank, 1788) of a free-ranged black stork 174 - 176 (Ciconia nigra) from India Saidul Islam, Sorang Tadap, Jahan Ahmed and Bandanpreet Kour Raisim

Urogenital myiasis in commercial broiler chicken due to Chrysomya bezziana in Assam 177 - 180 and its molecular characterization S. Bora, M. Das, S. Islam, L. Borkalita, R. Neog, S. Begum, P. Kakati and L. Hussain

Prevalence and cystic fertility study of Hydatidosis in meat animals of Kashmir valley 181 - 183 Sanku Borkataki, Pankaj Goswami, Basarat Ahmed Pandit and Rafiq Shahardar

Pathological findings of fibrosarcoma in dogs 184 - 185 Abhilasha Dadhich, Manisha Mathur, Manish Agrawal, Sakar Palecha and A.S. Arora

Occurrence and pathological observation of hydronephrosis in buffalo kidney 186 - 187 Brajesh Kumar, Manish Agrawal, Vikas Galav, S. K. Sharma, Rohitash Dadhich and A.S. Arora

Biochemical effect of induced sub acute toxicity of Parthenium hysterophorus L. and its 188 - 190 amelioration with Prosopis cineraria (L.) druce leaves in Wistar albino rats Anita Rathore, Rohitash Dadhich, Kamal Purohit, Shiv Kumar Sharma, Chandra Shekhar Vaishnava, Bincy Joseph and Anirudh Khatri

Evaluation of cardiac toxicity in dogs bitten by Viper snake 191 - 194 J.P. Varshney and H.D. Monapara

Study of dermal mycosis in camels (Camelus dromedaries) in and around Bikaner 195 - 198 Gaurav Kumar Jain, A.P. Singh, F.C. Tuteja, Sumnil Marwaha, Ankita Sharma and Jitendra Tanwer

303 Veterinary Practitioner Vol. 20 No. 2 December 2019

CONTENTS Titles Page No. Effect of subclinical mastitis on haematological and serum mineral profile in indigenous cattle 199 - 201 Sunita Choudhary, Anil Ahuja, A.P. Singh, Anju Chahar and Rajesh Nehra Effect of pregnancy stress on level of some serum enzymes in Kankrej cattle 202 - 203 Gajraj Singh, Anil Moolchandani, Meenaxi Sareen, Narendra Singh Rathore, Amit Pandey and Usha Chaudhary Perusal of varying environmental conditions versus physiological cadence in Pugal sheep 204 - 206 from arid tracts subsuming serum cortisol and glutathione status G.S. Gottam and N. Kataria Serum cholesterol profile and mineral concentrations in Toggenberg goat during lactation 207 - 209 I.H. Bhat, J. Devi and K. Sarma Pre-phacoemulsification electroretinography in cataractous dogs using HMsERG system 210 - 212 S.K. Jhirwal, R. Singh, P. Sanel, N.K. Kumawat, Anil Kumar, Munna Lal, P. Bishnoi and T.K. Gahlot Traumatic lateral elbow luxation in six dogs and its successful management by closed reduction 213 - 215 Mohammad Shafiuzamma, Shahid Hussain Dar, Shriram Ganesan, Sabrish Babu, S. Dinesh Kumar and Ravi Sundar George

Uroperitoneum in buffalo calf as a sequelae to bladder rupture owing to obstructive 216 - 217 uroloithiasis- a case report Manvi Chaudhary, Ashwani Kumar and N.K. Sood

Effect of cholesterol loaded cyclodextrin (CLC) on oxidative status during cryopreservation 218 - 222 of Poitou jack (Equusa sinus) spermatozoa Pramod Kumar, J. S. Mehta, S. K. Ravi, Talluri T Rao, G. N. Purohit, Ashok Kumar Chaudhary and Ramesh Kumar Dedar

Variation in blood glucose levels and insulin in leukocytosis in canine, undergoing 223 - 226 ovariohysterectomy Krittee Dejyong, Sareepah Manmoo and Saowakon Indoung Roentgenographic study on DCP LCP and IILN for femur fracture repair in dogs 227 - 232 Manjunath Patil and D. Dilipkumar

Maternal, foetal, managemental and seasonal factors predisposing to uterine torsion 233 - 237 in bovines: A review Ashutosh Tripathi, M.K. Shukla, Arbind Singh, R K Singh and Rajeshwar Dayal

Dystocia due to hydroallantois and Arthrogryposis condition and its therapeutic management 238 - 239 Arun Kumar, A.K. Rathore, Vikas Sachan, J.K. Agrawal and Atul Saxena

Molecular basis of attenuation in recently circulating PPRV in Rajasthan 240 - 243 Alka Galav, Sunil Maherchandani, Vikas Galav and Abhilasha Dadhich

Haemato-biochemical studies in renal affections in camel (Camelus dromedarius) 244 - 245 Manisha Mehra, O.P. Singh, M. Mathur, H. Dadhich, G. Singh, S. Rani, I. Vyas, S. Asopa, N. Sharma and H. Chouhan

In vitro assessment of antioxidant activity, antibacterial potentials and stability of 246 - 250 copper oxide nanoparticles Vijayta Gupta, Pinki Singh, Vinay Kant and Meena Sharma

Statistical investigation on stable lactation period of Jersey cross breed 251 - 252 Radhika Thakur, R.K. Gupta and Moneesh Thakur

Genetic parameters for wool production and quality traits in Magra sheep 253 - 255 H. Singh, G.C. Gahlot, H.K. Narula, U. Pannu and A. Chopra

304 Veterinary Practitioner Vol. 20 No. 2 December 2019

CONTENTS Titles Page No. Analyzing efficacy of milk adulteration testing kits and conventional biochemical methods 256 - 259 prevailing in India Vipin Kumar, R.S. Aulakh, J.P.S. Gill and J.S. Bedi

Study of therapeutic potential of aqueous and ethanolic extracts of Piper nigrum in 260 - 263 subclinical mastitis in cattle Sumnil Marwaha, A.P. Singh, J.P. Kachhawa, A. Gaur, Pratishta Sharma and Anju Chahar

Effect of supplementation of Tinospora cordifolia (at graded levels) and ascorbic acid 264 - 266 either alone or in combinations on haemoglobin and erythrogram of Broiler chickens D. Jain, R.K. Dhuria, T. Sharma, T. Bothra and Mangesh Kumar

Effect of improved nutrition and improved shelter on serum proteins of Magra lambs in 267 - 270 two lambing seasons under Arid zone T. Bothra, A.K. Patel, Vijay Kumar, S. C. Goswami, H.K. Narula, D. Jain and Mangesh Kumar

Effect of dietary supplementation of chromium from different sources on haemato- 271 - 272 biochemical parameters in Broilers S.S. Siyag, Dinesh Jain, R.K. Dhuria, T. Sharma, Tara Bothra, R. Nehra, S. Kumar, U.K. Prajapat and M. Kumar

A closed flux chamber experiment: tapping the methane producing potential of equine 273 - 275 manure in Indian condition P.A. Bala, S.S. Kundu, R.R. Rani and R.K. Dedar

Effect of feeding hydroponics maize fodder on milk yield and milk constituents in Gir cows 276 - 278 Abhishek Sharma, Monika Joshi and S.K. Sharma

Effect of nutritional status and management systems on haematological and biochemical 279 - 284 parameters of Sahiwal calves V. Kumar, V. K. Chaudhary, M.L. Chaudhary and S.R. Gupta

Effect of dietary supplementation of Tulsi (Ocimum sanctum) leaf powder and Fenugreek 285 - 287 (Trigonella foenum-graceum l.) seed powder on performance index, dry matter digestibility and N-balance of heat stressed broilers in arid zone Umesh Kumar Prajapat, D. Jain, T. Sharma, R.K. Dhuria, Tara Bothra, R. Nehra, Mangesh Kumar, Subhash Kumar and S.S. Siyag

In vitro antibacterial potentials of various extracts of ginger root powder and black 288 - 290 cumin seed powder Mangesh Kumar, R.S. Arya, R.K. Dhuria, Dinesh Jain, Rajesh Nehra and T. Sharma

Effect of feeding of hydroponics maize fodder on nutrient utilisation efficiency in 291 - 294 Rathi calves Rupal Dadhich, R.K. Dhuria, Dinesh Jain, Rajesh Nehra and T. Sharma

Study on effect of improved shelter management practices on the behaviour performance 295- 297 of Sahiwal cattle in arid region of Rajasthan R. Arora, S.C. Goswami and V.K. Chaudhary

Adoption level of livestock owners of Rajasthan in terms of toll free (1800-180-6224) 298 - 299 expert advisory service (RTHS) Siddharth Singh Rathore, Devi Singh Rajput, Prerna Nathawat, Neeraj Kumar Sharma, Ashok Dangi, Shyamlal Garg and Pramod Kumar Godara

Ethno-veterinary practices of surgical affections with their extent of use followed by 300 - 302 livestock owners in Western zone of Rajasthan S.L.Garg, N. K. Sharma, Devi Singh Rajput and S.S. Rathor

305 Veterinary Practitioner Vol. 20 No. 2 December 2019

RNI No. RAJ ENG/2000/3243 ISSN 0972-4036 VETERINARY PRACTITIONER

Volume 20 No. 2 December 2019 HALF YEARLY JOURNAL DEDICATED TO THE PRACTICING VETERINARIANS

CHIEF EDITOR ADVISORY MEMBERS Dr. S.N. Sharma Dr. J.S. Bhatia Ex-ADG (Edu), EXECUTIVE EDITORS ICAR, New Delhi Dr. A.K. Gahlot Dr. J.P. Vershney (Retd.), Principal Dr. R.K. Tanwar Scientist (Vet. Medicine), IVRI, Dr. Fakhruddin Izatnagar, Bareilly, UP Dr. A.P. Singh Dr. Ashok Kumar, Principal Scientist, ASSOCIATE EDITORS CIRG, Farah, Makhdoom, Mathura Dr. J.P. Kachhawa Dr. Sita Ram Gupta Dr. Kirti Dua, Professor (Vet. Medicine), GADVASU, Ludhiana

1ASSISTANT EDITORS 2 Dr. Ankita Sharma Dr. Rajendra Yadav

ALL COMUNICATIONS BE ADDRESSED TO

Chief Editor Veterinary Practitioner C/o Dr. A.K. Gahlot Gahlot Kuteer, B-30-A Karni Nagar, Nagneniji Road, BIKANER-334 003 (Raj.) Email : [email protected] DISCLAIMER The views, claims, suggestions and/or commitments in the articles are the sole and total responsibility of the author(s). Veterinary Practitioner’s editors need not necessarily agree/ disagree to these and will not be responsible for any liability/loss/injury/damage arising out of these.

Published and edited by Dr. S.N. Sharma and printed by Man Mohan Kalyani at Kalyani Printers, Kalyani Bhawan, 2nd Entrace of Railway Station, Alakh Sagar Road, Bikaner, published from Care of Gahlot Kuteer, B-3-A, Karni Nagar, Nagneniji Road, Bikaner

306 Veterinary Practitioner Vol. 20 No. 2 December 2019

307