Investigating Ichneumonidae: Insights Into Species Identification and Venom Composition

University of Kentucky UKnowledge

Theses and Dissertations--Entomology Entomology

2016

INVESTIGATING ICHNEUMONIDAE: INSIGHTS INTO SPECIES IDENTIFICATION AND VENOM COMPOSITION

Victoria G. Pook University of Kentucky, [email protected] Digital Object Identifier: http://dx.doi.org/10.13023/ETD.2016.110

Right click to open a feedback form in a new tab to let us know how this document benefits ou.y

Recommended Citation Pook, Victoria G., "INVESTIGATING ICHNEUMONIDAE: INSIGHTS INTO SPECIES IDENTIFICATION AND VENOM COMPOSITION" (2016). Theses and Dissertations--Entomology. 28. https://uknowledge.uky.edu/entomology_etds/28

This Doctoral Dissertation is brought to you for free and open access by the Entomology at UKnowledge. It has been accepted for inclusion in Theses and Dissertations--Entomology by an authorized administrator of UKnowledge. For more information, please contact [email protected]. STUDENT AGREEMENT:

I represent that my thesis or dissertation and abstract are my original work. Proper attribution has been given to all outside sources. I understand that I am solely responsible for obtaining any needed copyright permissions. I have obtained needed written permission statement(s) from the owner(s) of each third-party copyrighted matter to be included in my work, allowing electronic distribution (if such use is not permitted by the fair use doctrine) which will be submitted to UKnowledge as Additional File.

I hereby grant to The University of Kentucky and its agents the irrevocable, non-exclusive, and royalty-free license to archive and make accessible my work in whole or in part in all forms of media, now or hereafter known. I agree that the document mentioned above may be made available immediately for worldwide access unless an embargo applies.

I retain all other ownership rights to the copyright of my work. I also retain the right to use in future works (such as articles or books) all or part of my work. I understand that I am free to register the copyright to my work.

REVIEW, APPROVAL AND ACCEPTANCE

The document mentioned above has been reviewed and accepted by the student’s advisor, on behalf of the advisory committee, and by the Director of Graduate Studies (DGS), on behalf of the program; we verify that this is the final, approved version of the student’s thesis including all changes required by the advisory committee. The undersigned agree to abide by the statements above.

Victoria G. Pook, Student

Dr. Michael J. Sharkey, Major Professor

Dr. Charles W. Fox, Director of Graduate Studies

INVESTIGATING ICHNEUMONIDAE: INSIGHTS INTO SPECIES IDENTIFICATION AND VENOM COMPOSITION

DISSERTATION

A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the College of Agriculture at the University of Kentucky

Victoria Gillian Pook

Lexington, Kentucky

Director: Dr. Michael J. Sharkey, Professor of Entomology

Lexington, Kentucky

2016

ABSTRACT OF DISSERTATION

INVESTIGATING ICHNEUMONIDAE: INSIGHTS INTO SPECIES IDENTIFICATION AND VENOM COMPOSITION

Parasitoid wasps are hyperdiverse, with current estimates suggesting that they may account for up to 20% of all insect species. Though their ecological significance and their importance in integrated pest management cannot be denied, these taxa remain understudied and, due to their small size, are often overlooked. However, recent advances in molecular techniques are helping to reverse this trend by providing tools which scientists can use to better understand species limits and host interactions.

Parasitoid wasps are often morphologically cryptic and their accurate delimitation requires the analysis of DNA sequence data from fast-evolving genes in addition to morphological characters. The research presented here demonstrates the utility of a new molecular locus in species delimitation. Also, a morphological key to the species of a genus occurring in America, north of Mexico is presented.

The interactions between parasitoid wasps and their hosts are highly complex. On the wasp side, it involves the production venom, which likely contains bountiful natural resources. In this study, the venom proteins of wasps of the genus Megarhyssa (Hymenoptera: Ichneumonidae) are identified. Putative functions are assigned to these proteins and possible applications are discussed. One of the proteins identified is the enzyme, laccase, which is associated with the degradation and digestion of wood. The sequence of the gene coding for this laccase was analyzed and used to create recombinant proteins in a baculovirus-insect cell expression system. Future work investigating this enzyme is necessary to determine its activity against the plant cell wall.

The research presented here provides insight into the identification and venom composition of ichneumonid wasps. The results contribute to our knowledge of this understudied taxon and indicate that there is much to be gained from further research in this field which will become increasingly practicable as molecular techniques advance and become more affordable.

KEYWORDS: Parasitoid Wasp, Taxonomy, Identification, Venom, Proteomics Multimedia Elements Used: JPEG (.jpeg)

Victoria Gillian Pook

03 May 2016 Date

INVESTIGATING ICHNEUMONIDAE: INSIGHTS INTO SPECIES IDENTIFICATION AND VENOM COMPOSITION

Victoria Gillian Pook

Michael J. Sharkey Director of Dissertation

Charles W. Fox Director of Graduate Studies

03 May 2016 Date

The following dissertation is dedicated to my parents, Gillian and George Pook, who have supported me throughout my academic career and have always encouraged me to follow my heart.

ACKNOWLEDGEMENTS

The following dissertation, while an individual work, benefited greatly from the support and encouragement of numerous people. First and foremost, I would like to thank my major advisor, Dr Michael Sharkey, who has supported me through these five years. His „open door‟ policy of advising and willingness to discuss any problem, no matter how small, enabled me to efficiently complete the tasks set; and his constant encouragement helped me to reach my full academic potential. The sociable atmosphere he creates in his laboratory provides an environment in which everyone can flourish knowing that they are part of a team that cares and supports each of its members. I would also like to thank all the people I have had the pleasure of working alongside in the Sharkey Lab. The company of Stephanie Clutts-Stoelb, Dr. Erika Tucker, Dr. John Leavengood, Sarah Meierotto, Katie Morrison, Dr. Eric Chapman, Shelby Stedenfeld and Ilgoo Kang has made me look forward to coming to work every day, knowing that although we share a dedication to hard work, there is always time for fun and laughter! I am also indebted to my committee members, Dr Reddy Palli, Dr Bruce Webb and Dr Seth DeBolt for their advice and help with my research. Our committee meetings were always very constructive and encouraging. In addition, they all welcomed me into their own laboratories when particular experimental techniques required equipment and expertise outside of the Sharkey Lab. I would also like to thank Dr John Obrycki, Dr Reddy Palli and Dr Charles Fox for their leadership of the department and the graduate student program respectively. Together, they have created a nurturing environment for all students in the department and are always available to offer a helping hand when needed.

iii

TABLE OF CONTENTS

Acknowledgements ...... iii Table of Contents ...... iv List of Tables ...... vi List of Figures ...... vii Chapter 1: Introduction ...... 1 Chapter 2: Polydnavirus gene provides accurate identification of species in the genus Hyposoter (Hymenoptera: Ichneumonidae) ...... 5 Abstract ...... 6 Introduction ...... 6 Materials and Methods ...... 9 Results ...... 13 Discussion ...... 15 Chapter 3: Key to the species of Megarhyssa (Hymenoptera: Ichneumonidae: Rhyssinae) in America, north of Mexico ...... 26 Abstract ...... 27 Introduction ...... 27 Materials and Methods ...... 28 Key to Species ...... 30 Taxonomy ...... 32 Megarhyssa Ashmead, 1900 ...... 32 Megarhyssa atrata (Fabricius) ...... 32 Megarhyssa greenei Viereck, 1911 ...... 33 Megarhyssa macrurus (Linnaeus, 1771) ...... 34 Megarhyssa nortoni (Cresson, 1864) ...... 36 Phylogenetic Analysis ...... 37 Chapter 4: Insights into the venom of the parasitoid wasp, Megarhyssa (Hymenoptera: Ichneumonidae) ...... 44 Abstract ...... 44 Introduction ...... 44 Materials and Methods ...... 47 Results ...... 50 Discussion ...... 51 Summary ...... 54

Chapter 5: Examination of a putative laccase from the venom of parasitoid wasps of the genus Megarhyssa (Hymenoptera: Ichneumonidae) ...... 64 Abstract ...... 64 Introduction ...... 64 Materials and Methods ...... 66 Results ...... 69 Discussion ...... 71 Summary ...... 73 Chapter 6: Summary and Future Directions ...... 81 Appendices ...... 83 Appendix I. Specimen-associated information including host records and DNA sequence accession numbers...... 83 Appendix II. Pair-wise uncorrected p-distance tables ...... 94 Appendix III. Proteomics data associated with each putative Megarhyssa venom transcript. .. 96 References ...... 99 VITA ...... 113

LIST OF TABLES

Table 2.1. Details of primers including sequences and annealing temperatures ...... 19

Table 4.1. Transcriptome assembly statistics ...... 55

Table 4.2. Putative venom proteins and associated information ...... 56

LIST OF FIGURES

Figure 2.1. MAP tree from a Bayesian analysis of COI data ...... 20

Figure 2.2. MAP tree from a Bayesian analysis of the Cys-d9.2 exon ...... 22

Figure 2.3. The range of interspecific pair-wise distances for each of the species ...... 24

Figure 2.4. Alignment of all unique Cys-d9.2 protein sequences ...... 25

Figure 3.1. Megarhyssa atrata female ...... 39

Figure 3.2. Megarhyssa atrata male ...... 39

Figure 3.3. Megarhyssa greenei female ...... 40

Figure 3.4. Megarhyssa greenei male ...... 40

Figure 3.5. Megarhyssa macrurus female ...... 41

Figure 3.6. Megarhyssa macrurus male ...... 41

Figure 3.7. Megarhyssa nortoni female ...... 42

Figure 3.8. Megarhyssa nortoni male ...... 42

Figure 3.9. Maximum likelihood tree ...... 43

Figure 4.1. The terminal segment of the abdomen of M. greenei with venom apparatus ...... 63

Figure 4.2. Proportion of putative venom proteins corresponding to peptides identified by mass spectrometry of venom from each species for each database ...... 64

Figure 4.3. Venom proteins of one specimen of each species separated by SDS-PAGE ...... 65

Figure 4.4. Taxon distribution of top hits for Megarhyssa venom proteins on NCBI BLAST 66

Figure 5.1. cDNA sequence and amino acid translation of the open reading frame of the putative laccase identified in the venom of Megarhyssa ...... 78

Figure 5.2 Maximum a-posteriori tree resulting from a Bayesian analysis ...... 80

Figure 5.3 Analysis to show presence of purified protein ...... 81

Figure 5.4. Absorbance across the full spectrum for all treatments ...... 82

Figure 5.5. Ovipositor tips from M. macrurus (A), Orussus japonicus (B) and Tremex columba(C) ...... 83

vii

Chapter 1: Introduction

The developmental strategies of parasitoid wasps constitute some of nature‟s most remarkable examples of adaptive evolution and specialization, traits which may have led to the rapid radiation of these taxa into hundreds of thousands, or perhaps millions, of extant species. These wasps are a key component of terrestrial ecosystems (LaSalle &Gauld, 1991; 1993). Historically, research on parasitic Hymenoptera has been hindered by their small size and difficulty in sampling and rearing. However, recent advances in molecular techniques provide the tools necessary to investigate these fascinating organisms from new perspectives.

Parasitoid wasp diversity

Parasitoid wasps are free-living as adults but complete their immature life stages on

(ectoparasitoids) or inside (endoparasitoids) the body of an arthropod host, which will subsequently die as a result (Godfray, 1994; Quicke, 1997). Having radiated in parallel with flowering plants 65 million years ago (Rasnitsyn, 1988; Whitfield, 1998), it is estimated that 10-

20% of all extant insects may be parasitoid wasps (Godfray, 1994; Quicke, 1997; Whitfield,

2003). These species can be divided into two groups: (1) idiobionts, which halt the development of their hosts and (2) koinobionts, which allow their hosts to continue to develop after they are parasitized (Askew& Shaw, 1986). It is likely that all hymenopteran parasitoids share a single common ancestor that was probably an ectoparasitic idiobiont of wood-boring beetle larvae

(Pennacchio &Strand, 2006). This shift to parasitism was accompanied by modifications in ovipositor morphology resulting in circular ovipositors of variable length compared to the short, laterally compressed ovipositors of phytophagous hymenopterans (Quicke, 1997).

Parasitoid-host interactions

In order to successfully parasitize their hosts, parasitoids must locate and access their hosts; lay an egg(s) on or inside their host; and modify the host physiology. If the host is herbivorous,

1 parasitoids will often be attracted at long range to chemical compounds that are released by the plant being attacked (Turlings et al., 1991; Whitman & Eller, 1990; Geervliet et al., 1994;

Mattiacci & Dicke, 1995; Du et al., 1996; Powell et al., 1998; Guerrieri et al., 1999). Once in the appropriate habitat, the parasitoid will then exploit more specific cues to locate their hosts such as volatiles released from defecation, sex pheromones, feeding noises (Wäckers et al., 1998) and visual cues (e.g. feeding damage) (Vet, 1999). The ovipositor is then used to navigate or penetrate the substrate, assess and pierce the host, and finally to inject virulence factors and eggs into the host (Quicke, 2015). In order for the parasitic progeny to successfully develop inside their hosts, virulence factors injected by the female wasp, or factors produced by the parasitoid progeny, function to suppress the host‟s immune system and to redirect resources from host tissues to the parasitoid larvae (Pennacchio & Strand, 2006).

Superfamily: Ichneumonoidea

The hyperdiverse hymenopteran superfamily, Ichneumonoidea, comprises Ichneumonidae and

Braconidae with 24,000 and 17,000 described species respectively (Yu et al., 2012). These wasps display extraordinary phenotypes including mutualistic associations with symbiotic viruses

(polydnaviruses), complex venoms that alter host physiology to favor the developing wasp progeny and specialized egg-laying devices (ovipositors) capable of overcoming barriers between the wasp and its host. These remarkable adaptations are undoubtedly the result of arms races between the parasitoids and their hosts leading to increased specialization, resulting in the astounding diversity and species-richness observed in this superfamily today.

Identification: Though they are highly speciose and abundant, the majority of ichneumonoid parasitoids remain undescribed (LaSalle & Gauld, 1993). This is due in part to the lack of taxonomists in this field but is also due to the prevalence of morphologically cryptic species which are only revealed through the analysis of molecular and ecological data. Therefore, keys to

2 the species in this superfamily are either old and difficult to decipher or simply non-existent.

Much work is therefore required to both improve species concepts and produce identification keys that can be used by non-specialists.

Polydnaviruses: Found in particular subfamilies of Ichneumonidae and Braconidae, polydnaviruses (PDVs) constitute one of nature‟s most remarkable examples of mutualism. PDVs are integrated into the wasp genome as proviruses and replication only occurs in the nuclei of specialized cells in the reproductive tract of the female wasp, producing virions which are injected into the host at oviposition (Strand, 2010). The DNAs within these virions are then discharged into the host cell nuclei and the expression of virus coded genes takes place, resulting in the suppression of the host immune system and the alteration of host metabolism and development (Strand, 2012; Beckage, 2012).Though both families within Ichneumonoidea contain subfamilies that harbor these viruses, it appears they do not share a common ancestor and the two viral genera, Ichnoviruses (found in Ichneumonidae) and Bracoviruses (found in

Braconidae) (Strand & Drezen, 2012), are the result of convergent evolution (Burke & Strand,

2012).

Venom: Parasitoid wasp venom consists of a mélange of proteinacious and non-proteinacious compounds which is injected into the host at oviposition (Moreau & Asgari, 2015). These compounds may induce developmental arrest, immunosuppression, condition host physiology, and synergize the effects of polydnaviruses (Zhang et al., 2004; Strand& Noda, 1991; Strand &

Dover, 1991; Stoltz et al., 1988). The complexity of hymenopteran venoms is highly variable, ranging from 10-100 different proteins or peptides per species (Moreau & Asgari, 2015). These venoms represent a source of millions of bioactive molecules which could have myriad industrial applications.

Ovipositors: Ichneumonoid ovipositors are highly morphologically variable but they all comprise a pair of sheaths (which may be both protective and sensory) and the ovipositor itself, which has three parts - the upper valve and two lower valves which enclose the egg canal (Quicke,

2015).The hosts of many species of Ichneumonoidea develop deep inside the trunks of trees and therefore, the ovipositor must overcome this barrier before and egg can be laid. Some species will navigate through pre-existing cracks, fissures or borings while others will use their ovipositors to break wood fibers (Quicke, 2015). The rhyssine ichneumonid, Megarhyssa, has a remarkably long ovipositor which it uses to penetrate inches of solid wood in order to reach its host

(Heatwole & Davis, 1965) and Nénon et al. (1997) postulated that ovipositor secretions capable of lyzing wood facilitate this process.

Objectives

The general goals of my dissertation were to improve species identifications in two genera of the family Ichneumonidae (Order: Hymenoptera) and to provide insight in the functions and possible applications of the venom of the genus Megarhyssa (Hymenoptera: Ichneumonidae).

My specific objectives were to:

1. Determine to utility of polydnavirus genes in species delimitation in Hyposoter (Hymenoptera:

Ichneumonidae).

2. Create image-rich dichotomous and interactive keys to species of the genus Megarhyssa

(Hymenoptera: Ichneumonidae) in America, north of Mexico.

3. Identify the venom components of species in the genus Megarhyssa (Hymenoptera:

Ichneumonidae).

4. Characterize a putative laccase found in the venom of species in the genus Megarhyssa

(Hymenoptera: Ichneumonidae).

Chapter 2: Polydnavirus gene provides accurate identification of species in the genus

Hyposoter (Hymenoptera: Ichneumonidae)

Statement of Authorship

This chapter is a published research article:

Pook, V. G., Chapman, E. G., Janzen, D. H., Hallwachs, W., Smith, M. A., & Sharkey, M. J.

(2015). Polydnavirus gene provides accurate identification of species in the genus Hyposoter

(Hymenoptera: Ichneumonidae). Insect Conservation and Diversity, 8: 348-358.

John Wiley & Sons License Number: 3853080744350

This article has been modified in the following ways before incorporation into this dissertation:

- the caption for Table 2.1 contains additional information

- the legend for Figure 2.4 contains additional information

Abstract

Accurate identification of species of parasitoid Hymenoptera often requires the analysis of multiple genetic and non-genetic traits. Here we investigate the potential for nuclear polydnavirus

(PDV) gene loci to provide species-level discrimination in the parasitoid wasp genus Hyposoter

(Hymenoptera: Ichneumonidae). A region of one PDV gene, Cys-d9.2, was sequenced from nine species of wasps and an additional two PDV genes, Cys-d9.1and Rep-c18.2, were sequenced from multiple specimens of one species of wasp. A Bayesian phylogenetic analysis of the Cys-d9.2 sequences resulted in accurate identification of species and no intraspecific variation was observed in this gene, Cys-d9.1 or Rep-c18.2. Further statistical analyses showed that Cys-d9.2 has a high prevalence of non-synonymous nucleotide substitutions. Our results support the use of

Cys-d9.2 as an additional genetic locus for species delimitation in Hyposoter, highlighting the value of PDV gene information to taxonomists studying the ichneumonid subfamily,

Campopleginae.

Introduction

Parasitoid wasps, which kill their host in order to complete development, constitute the world‟s most species-rich parasitoid arthropod guild. However, the extent of the diversity of this group is unknown and a combination of ecological, morphological and molecular studies are uncovering numerous morphologically and ecologically cryptic species, steadily and dramatically increasing the number of species known to science (Kankare et al., 2005; Smith et al., 2008; Fernández-

Triana, 2010; Smith et al., 2011; Rodriguez et al., 2013; Fernández-Triana et al., 2014).

A standardized molecular marker for species-level identification, and frequently, for discovery of cryptic species, is a region of the mitochondrial gene, cytochrome c oxidase I (COI), the product of which is a key enzyme in the respiratory pathway. This region is an effective species-level discriminator and is dubbed a “DNA barcode” (Folmer et al., 1994; Hebert et al.,

2003; Janzen et al., 2009). Recent projects involved in barcoding parasitoid food webs using COI

6 have significantly increased estimates of parasitoid species numbers by exposing the prevalence of morphologically cryptic species. (Smith et al., 2008, 2011, 2013; Stahlhut et al., 2013;

Fernandez-Triana et al., 2014). Using molecular data to delimit species is rapid and becoming affordable for ecological and taxonomic applications.

COI barcode sequences can be combined with morphological, host and micro- geographical data collected by long term rearing studies such as those carried out at the Area de

Conservación Guanacaste (ACG) in northwestern Costa Rica (Janzen et al., 2009, 2011).

Concordance among these data results in accurate inference of species limits and provides insight into the tri-trophic interactions occurring in these ecosystems. The availability of these data also provides an excellent foundation for work investigating additional diagnostic traits that could be used in species delimitation in these organisms.

The genus Hyposoter (Hymenoptera: Ichneumonidae) has been extensively sampled in the ACG and due to the rate of discovery, many species including those examined in this study, remain undescribed. Intriguingly, all species of this genus display extreme specialization in both ecological traits as well as taxonomic entities. For example, Hyposoter INB-42DHJ04 has been reared 89 times from a set of 17 ecologically similar caterpillar species in the subfamily

Eudaminae (Lepidoptera: Hesperiidae) and never from any other of the many thousands of species of ACG caterpillars (600,000+ individuals) which have been reared to date and are all large enough to be a host for Hyposoter. Another species, Hyposoter INB-12, parasitizes only early instars of palm-eating brassoline Nymphalidae, and penultimate and ultimate instars of hesperiine Hesperiidae. Though these caterpillars are from different families, they are the same size and they feed on the same palm leaves in the same rain forest understory habitat. Like H.

INB-42DHJ04, H. INB-12 does not parasitize species in any other subfamily or family of caterpillars eating the same palm leaves, or the thousands of other species and taxa feeding on other species of plants in the same microhabitat. Total host records are available for these species at http://janzen.sas.upenn.edu, a dynamic database that increments annually.

Though COI provides accurate resolution of species in a wide range of arthropod taxa, it is generally acknowledged that combining several different molecular loci, ideally from both the mitochondrial and nuclear genomes, improves the confidence with which species delimitations can be made and phylogenies inferred (Caterino et al., 2000; Lin & Danforth, 2004; Whitfield &

Kjer, 2008). However, the most commonly used nuclear markers (e.g. elongation factor 1 alpha and 18S) evolve too slowly to resolve recent radiations (Caterino et al., 2000). The internal transcribed spacer 2 (ITS2) has been included in studies of a number of organisms which demonstrate its resolving power at the species level (e.g. fig wasps and lycaenid butterflies)

(Wiemer et al., 2009 & Darwell et al., 2014). However, this rapidly evolving nuclear DNA fragment is an intron and therefore does not code for an evolutionarily relevant protein. With our study we investigate sequence variation in nuclear protein coding genes that are involved in the success of parasitoidism in the genus Hyposoter.

Examples of genes that are critical to the survival of the wasp larvae include those present in polydnavirus (PDV) genomes integrated into the chromosomes of tens of thousands of species of Ichneumonoidea (Beckage & Drezen, 2012; Fleming & Summers, 1991; Webb &

Strand, 2005; Xu & Stoltz, 1991). PDVs are found in a range of subfamilies of Braconidae in the

“microgastroid complex” and two subfamilies of Ichneumonidae (Campopleginae and some species of Banchinae) and are named Bracoviruses (BV) and Ichnoviruses (IV) respectively

(Stoltz et al., 1984; Webb et al., 2000). These mutualistic viruses are produced in the calyx tissue in the reproductive tract of the female wasp and are injected into the host during oviposition

(Stoltz & Vinson, 1979). Inside the host they express products that alter host physiology preventing encapsulation of the parasite egg, thereby allowing the development of the larval parasite (Shelby & Webb, 1999). Genes from the IV cys-motif family are distinctive for containing a motif comprising conserved cysteine residues and highly variable non-cysteine amino acids (Dib-Hajj et al., 1993). Li & Webb (1994) demonstrated that the expression of cys- motif genes inhibits host cellular immunity through a reduction in the encapsulation response and

Fath-Goodin et al. (2006) showed that cys-motif proteins disrupt host development. Additionally, rep genes, distinctive in having a conserved 540bp repeated element motif (Theilmann &

Summers, 1987), make up roughly 50% of all IV genes discovered to date (Tanaka et al., 2007), suggesting that they too may play an important role in parasitoid virulence.

In this study we target nuclear IV genes to investigate whether the sequences of these genes are species-specific and if so, how much they vary among and within species, and how this variation compares with variation in the COI barcodes that have been (and are being) generated within the ACG. In order to test whether IV genes vary among or within species, we designed primers to target two cys-motif genes and one rep gene from species of Hyposoter, genes that we refer to as Cys-d9.2, Cys-d9.1, and Rep-c18.2. We hypothesized that IV genes may be evolving at a higher rate than COI. Therefore we compared interspecific variation in

COI and Cys-d9.2 sequences, and examined the ratio of non-synonymous to synonymous nucleotide substitutions in each of the genes. We also hypothesized that because IV genes disrupt host physiology they may vary intraspecifically in association with host use. We therefore chose to investigate two species, H. INB42-DHJ04 and H. INB-12, which exhibit different degrees of host-specificity, with the capacity to successfully parasitize different genera from the same subfamily of hosts, and multiple genera from two different families of

Lepidoptera, respectively.

Materials and Methods

Taxon Sampling. Ethanol-preserved specimens of seven species of Hyposoter reared by the parasitoid inventory of ACG, in northwestern Costa Rica (Janzen et al., 2009, 2011) and housed at the American Entomological Institute, Florida (AEI), were used. DNA from additional reared specimens of two species (H. INB42-DHJ04 and H. INB-12) was then sourced directly from the

Barcode of Life Data Systems (BOLD – Ratnasingham & Hebert, 2007). Hyposoter INB-

42DHJ04 and H. INB-12 were chosen based on their documented host ranges

(http://janzen.sas.upenn.edu and to be included in a Hyposoter revision in prep.) which constitute multiple genera from one subfamily, Eudaminae (Lepidoptera: Hesperiidae) and multiple genera from two different families of Lepidoptera (Hesperiidae and Nymphalidae) respectively. The specimens are listed in Supplemental Appendix I along with host records and individual voucher codes (http://janzen.sas.upenn.edu), the genetic loci sampled and their corresponding GenBank accession numbers. We also included published PDV gene data from Hyposoter fugitivus (Say,

1835) and Tranosema rostrale (Brishke, 1880), both available on GenBank, in our analyses.

Genetic Loci & Primer Design. Ichnovirus genome sequences from H. fugitivus and H. didymator

(unpublished, provided by Dr. A-N Volkoff, University of Montpellier, France) were separately aligned for genes from the rep and cys-motif families using MAFFT (v.7, Katoh & Standley,

2013). Homologous pairs of genes were identified by eye and primers were designed from conserved regions of these homologous pairs using Primer3 (Rozen & Skaletsky, 1999) to amplify a region of two cys-motif genes, “cysteine motif gene-d9.2”and “cysteine motif gene-

9.1”and a region of one rep gene, “repeat element protein-c18.2” (Tanaka et al., 2007), which we refer to as Cys-d9.2, Cys-d9.1 and Rep-c18.2 respectively.

For comparative analyses, FASTA files for the barcode region of COI were obtained from BOLD for all specimens (Supplemental Appendix I).

Molecular Biology

DNA Extraction: DNA was extracted from 52 specimens using a glass-fibre extraction protocol

(Ivanova et al., 2006) and the DNA was re-suspended in 30 μL of ddH2O. For 12 additional specimens DNA was extracted using a Qiagen DNeasy extraction kit following the manufacturer‟s protocol for animal tissue.

PCR Amplification & Sequencing: The DNA barcode region of cytochrome c oxidase I (COI)

(a 658bp region near the 5‟ terminus of the COI gene) was amplified using standard insect

10 primers LepF1 (5‟-ATTCAACCAATCATAAAGATATTGG -3‟) and LepR1 (5‟-

TAAACTTCTGGATGTCCAAAAAATCA -3‟) following established protocols (as in Smith et al., 2009). If amplification of the full-length barcode region failed, secondary amplifications, using overlapping mini-barcode amplifications, were conducted following protocols in Smith et al. (2009). All sequence and trace files associated with the individual specimen records can be retrieved from the Barcode of Life Data System (BOLD, www.barcodinglife.org, Ratnasingham

& Hebert, 2007). All sequence data and accessions (including GenBank) are available on BOLD in the public dataset dx.doi.org/10.5883/DS-ASHYPO [DOI not yet active – GenBank accessions are in attached .xlsx Supplemental Appendix I]. Cys-d9.2 was amplified from eight species (64 specimens) of Hyposoter and Cys-d9.1 and Rep-c18.2 were amplified from 20 and 21 specimens of H. INB-12 respectively. PCR amplifications of these regions were performed using Takara reagents in a total reaction volume of 25 μL consisting of 1X buffer, 0.3 mM dNTPs, 0.4 μM of forward and reverse primers and 0.625 U of Takara Ex Taq Polymerase, ddH₂O and 1μL template DNA. The thermal cycler protocol included an initial denaturation for 1 minute at 94 °C.

Each of the 35 cycles began with an additional denaturation period of 30 seconds at 94 °C followed by annealing for 45 seconds at a temperature that varied according to the primers used

(listed in Table 1) followed by extension, carried out at 72 °C for 1 minute. A final extension period of 7 minutes at 72 °C concluded the reactions. Gel electrophoresis was used to determine the success of the PCR, using 4 μL of PCR product on a 2.5 % agarose gel stained with ethidium bromide. PCR products deemed successful were sent to either the Advanced Genetics

Technology Centre (University of Kentucky, Lexington, KY) or Beckman Coulter Genomics

(Danvers, MA) for Sanger sequencing. Cycle sequencing of sequence strands was carried out using labeled dideoxy-nucleotides with ABI 3730, Big-Dye Terminator Mix v. 3.0 or with ABI

PRISM 3730xl, Big-Dye Terminator Mix v. 3.1 (Applied Biosystems, Foster City, California,

USA). Sequences are accessible on GenBank (see Supplementary Appendix I for Accession

Numbers).

Sequence Analysis

Alignment: Sequences of Cys-d9.2 obtained from the eight species of Hyposoter were combined with the sequences of H. fugitivus and T. rostrale. MAFFT was used to provide the initial alignment. The intron located in the middle of the sequenced region (Tanaka et al., 2007) was then excluded and the alignment of the exon was adjusted by hand in BioEdit (Hall, 1999) and

MacClade (v. 4.08, Maddison & Maddison, 2000) using the amino acid translations as a guide.

Only the exon was used in the following analyses. Evolutionary Model Assignment: The nucleotides of the aligned sequences were assigned codon positions using MacClade and the first, second and third positions were extracted in PAUP* (v. 4.0β10; Swofford, 2002). These partitions were subjected to separate analyses in jModelTest (v.2.1.4; Posada, 2008) and the evolutionary model with the lowest Bayesian Information Criterion (BIC; Schwarz, 1978) value was selected for each partition.

Tree Building: Aligned sequences were then subjected to Bayesian inference (BI) phylogenetic analysis with MrBayes (v. 3.1.2; Huelsenbeck & Ronquist, 2001; Ronquist & Huelsenbeck, 2003) with default settings incorporating the three partitions with their respective models. Two independent searches of the BI analysis with four search chains were run for 5 million generations, sampling trees every 500 generations with default settings. The tree of highest posterior probability (= maximum a posteriori or MAP tree) was calculated from the 5001 post- burn-in trees. Bayesian inference analyses (as above) were also conducted on COI sequences and a concatenated data set comprising COI and Cys-d9.2 sequences with the appropriate alterations to their corresponding Bayes command blocks. Because the COI and Cys-d9.2 data sets are composed of sequences from the same specimens, the concatenated data set had no missing sequences.

Pair-wise Distance Comparisons: PAUP* was used to calculate uncorrected pair-wise distances between unique sequences of the nine species of Hyposoter and between all sequences of species

H. INB-42DHJ04 and H. INB-12 for both Cys-d9.2 and COI and all sequences of H. INB-12 for

Cys-d9.1 and Rep-c18.2 (Supplementary Tables 1-3).

Assessment of the ratio of non-synonymous to synonymous nucleotide substitutions (ω): The codeml program in PAML (v. 3.14; Yang, 1997) was employed to assess the value of ω for each codon in both the COI and Cys-d9.2 data sets. The MAP trees produced by the BI analysis of

COI, Cys-d9.2 and the concatenated data set were pruned to include only taxa with unique sequences and were used as the input trees for the analyses. As the tree topology is predicted to affect the accuracy of the assessment of ω (Hughes, 2007) we tested the robustness of our results by using each of the three tree topologies to conduct separate analyses of Cys-d9.2. Branch lengths for each tree were calculated using only Cys-d9.2 sequences under the maximum likelihood (ML) criterion in PAUP*. The codeml model M8 (Yang et al., 2000) was employed and the output of the analysis provided a list of codons that have a ratio of ω that exceeds 1 with their corresponding posterior probabilities. Codons with ω > 1 and posterior probabilities exceeding 0.95 and 0.99 are highlighted on the amino acid alignment of Cys-d9.2 shown in

Figure 5.

Results

Our results demonstrate that each species of Hyposoter examined has a unique Cys-d9.2 sequence. However, the degree to which these sequences vary depends on the particular interspecific pair-wise comparison. We also found that all three IV genes appear to be highly conserved within species of Hyposoter, showing no sequence variation associated with the host species parasitoidized.

Species delimitation using COI barcode data

A Bayesian phylogenetic analysis of nine species of Hyposoter with T. rostrale as the outgroup produced the MAP tree shown in Figure 1. This analysis provides good support for the monophyly of H. INB-42DHJ04 and H. INB-12, which have been delimited by the ACG

13 inventory, using a combination of ecological (host data and micro-geography), morphological and

COI sequence data. The species of host from which each of the specimens were reared is shown in parentheses after the specimen name indicating the known host range of each species.

Species delimitation using Cys-d9.2 data

The MAP tree produced from a Bayesian phylogenetic analysis of the region of Cys-d9.2 is illustrated in Figure 2. Utilizing the same specimens as those in Figure 1, the trees are directly comparable and provide a similar result with incongruence in interspecific relationships likely due to the different selection pressures on each of the genes. This tree demonstrates that Cys-d9.2 sequences vary among species of Hyposoter but are conserved among specimens of the same species.

Pair-wise distances of COI and Cys-d9.2 sequences

Uncorrected pair-wise distances were calculated interspecifically for COI and Cys-d9.2 and intraspecifically for COI, Cys-d9.2, Cys-d9.1 and Rep1. Figure 3 illustrates each interspecific pair-wise comparison for each species for both COI and Cys-d9.2 sequences. The pair-wise distances between COI sequences consistently fall between 5% and 15% (with one exception where the distance is only 2.5%) whereas the distances between Cys-d9.2 gene sequences show a greater range in variation, with some less than 2% and others around 20%. In the majority of the comparisons, when COI sequence variation is high, Cys-d9.2 variation is higher and when COI sequence variation is low, Cys-d9.2 variation is lower. Exceptions to this pattern can be found in two of the comparisons for H. PRO-7. In this species, the pairwise distances to H. fugitivus and to

H. INB-12 are very low between COI sequences but very high between Cys-d9.2 sequences.

Among specimens of the same species, IV gene sequences are identical therefore intraspecific pair-wise distances are zero in each case while COI sequences vary by 0-3 base pairs (as interpreted by BOLD from trace files) within species.

The ratio of non-synonymous to synonymous nucleotide substitutions in COI and Cys-d9.2

The ratio of non-synonymous to synonymous nucleotide substitutions (ω) was assessed for each codon in the COI and Cys-d9.2 sequences. The number of codons in which ω > 1 is far higher in

Cys-d9.2 than in COI, with a total of 13 out of a possible 98 PDV amino acids predicted as having undergone more non-synonymous than synonymous substitutions with posterior probabilities greater than 0.95 (Fig. 5). These inferences are robust to tree topology, since we used the MAP trees from the BI analyses of the Cys-d9.2 gene, COI and the concatenated data set with the results varying only slightly. One fewer codon position was calculated to have ω > 1 with statistical significance when using the Cys-d9.2 tree as input than when using the concatenated tree as input. When using the COI tree as input, codeml calculated that one extra codon has ω > 1 with statistical significance and the significance of the posterior probability of a second codon with ω > 1 was increased from 0.95 to 0.99 compared with the results from the analysis with the concatenated tree. In comparison, there were no codons in the COI sequence that exhibited ω > 1 with statistical significance.

Discussion

Parasitoid Hymenoptera are of great interest to biologists, ecologists and conservationists due to their diversity and the influence they have on terrestrial ecosystems. In order to improve our understanding of these organisms, it is necessary to accurately identify species. This task is complicated greatly by the presence of morphologically and ecologically cryptic species. In the absence of morphologically distinguishing characters, molecular markers offer a wealth of evidence towards accurately resolving what a species is quickly and cost-effectively. Genes with this capacity are therefore of great value. In this study we examined nuclear PDV gene loci in

Hyposoter parasitoid wasps, exploring their potential as additional markers for species resolution in this genus.

Separate phylogenies constructed using COI and the IV gene, Cys-d9.2, for nine species

15 of Hyposoter (Figs. 1 & 2) resulted in the accurate resolution of both H. INB42DHJ04 and H.

INB-12. Figure 2 clearly illustrates that Cys-d9.2 varies among species of Hyposoter, with clades of specimens of H. INB-42DHJ04 and H. INB-12 showing no variation among specimens of the same species. Cys-d9.1 and Rep-c18.2 were also sequenced from the specimens of H. INB-12 and were also identical. These results demonstrate that each wasp species has evolved a unique IV gene which is highly conserved intraspecifically regardless of whether a single species of wasp has just one species of host, or a defined small and distinctive set of species of hosts among the thousands of potential host species. The phylogenies inferred by each of the genes are not entirely consistent with each other. Therefore the addition of Cys-d9.2 sequence data to phylogenetic analyses of Hyposoter could provide further insight to the evolutionary relationships among species of this genus.

Comparing interspecific pair-wise distances in Cys-d9.2 and COI sequences demonstrates that the variation in the mitochondrial gene is narrower across all comparisons with a maximum of about 15%. The nuclear IV gene exhibits a greater range of variation, reaching 20% in some comparisons. Figure 3 illustrates that when variation between COI sequences is high, variation between Cys-d9.2 sequences is higher and when COI sequences show less variation, the variation between Cys-d9.2 sequences is lower. However, in two instances the nuclear IV gene shows much greater variation than COI, highlighting the value of combining multiple molecular loci to examine species limits. In addition, 14% of the codons in the Cys-d9.2 sequence have a ratio of non-synonymous to synonymous nucleotide substitutions greater than 1, with statistical significance. Interestingly, the majority of these non-synonymous substitutions occur outside of the cysteine motif domain, which is highly conserved across species. Whether the high prevalence of non-synonymous substitutions in the surrounding regions is due to positive selection or relaxed purifying selection remains uncertain (see discussion in Hughes, 2007).

In summary, we show that the PDV gene Cys-d9.2 varies among species of Hyposoter

16 and that it has a wider range of interspecific variation than the barcode region of COI. Cys-d9.2,

Cys-d9.1 and Rep-c18.2 are all conserved intraspecifically, showing no sequence variation associated with the species of host used. These results indicate that Cys-d9.2 has the power to accurately distinguish these species and provides good support for the use of this region as an additional molecular marker at the species level within the genus Hyposoter.

Cys-motif genes are present in all four campoplegine IV genomes sequenced to date

(Tranosema rostrale, Campoletis sonorensis, Hyposoter fugitivus and H. didymator) (Webb et al.,

2006; Tanaka et al., 2007 & Dorémus et al., 2014) and molecular data obtained for these genes may prove useful in species level systematics and phylogenetics in this subfamily. However, in order to amplify these genes, PDV sequence data must be obtained to provide a template from which PCR primers can be designed, and because PDV genes are fast evolving it may be necessary to design unique primers in disparate taxa. The extent of species diversity in the subfamily Campopleginae remains unknown and PDV gene sequences will likely prove to be a highly valuable integrative tool for taxonomists and phylogeneticists studying this group.

Acknowledgements

The authors would like to thank Stephanie Clutts-Stoelb for technical support and John

Leavengood, Erika Tucker and Dr. Michael Strand for their comments on earlier versions of this manuscript. This study would also not have been possible without the contribution of specimens by Dr. S. van Nouhuys and sequence data from Dr. A.N. Volkoff. We gratefully acknowledge the unflagging support of the team of ACG parataxonomists (Janzen et al., 2009, Janzen &

Hallwachs, 2011) who found and reared the specimens used in this study, and the team of biodiversity managers who protect and manage the ACG forests that host these wasps and their caterpillar hosts. The study has been supported by U.S. National Science Foundation grants BSR

9024770 and DEB 9306296, 9400829, 9705072, 0072730, 0515699, and grants from the Wege

Foundation, International Conservation Fund of Canada, Jessie B. Cox Charitable Trust, Blue

Moon Fund, Guanacaste Dry Forest Conservation Fund, Area de Conservación Guanacaste,

Permian Global and University of Pennsylvania (DHJ&WH). This study has been supported by the Government of Canada through its ongoing support of Genome Canada, the Biodiversity

Institute of Ontario, and the Ontario Genomics Institute. The wasps were morphologically identified by Ian D. Gauld (RIP) of The Natural History Museum, London, and confirmed by

David B. Wahl of the American Entomological Institute, Gainesville, Florida. This work was supported by the University of Kentucky Agricultural Experiment Station State project KY-

008041 and KY2355066000. This is publication number 14-08-082 of the University of

Kentucky Agricultural Experiment Station.

Table 2.1. Details of primers including sequences and annealing temperatures. The annealing temperatures for primer pair Cys_43392 were variable. In order to amplify DNA from specimens of H. INB12 and H. PRO7, Cys_43392 Fwd was paired with Rev1, with the appropriate annealing temperature either 52°C or 56°C depending on the specimen. DNA from specimens of the remaining species was amplified using Cys_43392 Fwd paired with Rev2 with an annealing temperature of 50°C.

Annealing Gene Primer Pair Primer Sequences Temp.

Cys-d9.2 Cys_43392 Fwd: CACRCAATGCTGTGGASTTT

Rev1: ATGCTATTAAGAGGTTGGCACA 52 or 56 °C

Rev2: TGTGGAGTYATCAACCATC 50 °C

Cys-d9.1 Cys_43491 Fwd: TGCTGRAWGGTTTCCACGTTA

Rev: CGTTASGAACCWTCTGCA 49 °C

Rep-c18.2 Rep_341c18b Fwd: ACGGAGAACMAATAGAGATCSAGTA

Rev: TACGTGATTGGAGCAGTAGTGR 49 °C

Figure 2.1. MAP tree from a Bayesian analysis of COI data. The “Specimen” code is the last five digits of the full voucher code of the form DHJPAR00xxxxx, which must be used to search for the full record at http://janzen.sas.upenn.edu. BOLD also uses this code as the sample ID. The hosts from which the specimens were reared are shown in parentheses. Asterisks denote

Brassolinae in the family Nymphalidae, while all other hosts are Hesperiidae (Hesperiinae for H.

INB-12, Eudaminae for the others).

Figure 2.2. MAP tree from a Bayesian analysis of the Cys-d9.2 exon. The “Specimen” code is the last five digits of the full voucher code of the form DHJPAR00xxxxx, which must be used to search for the full record at http://janzen.sas.upenn.edu. BOLD also uses this code as the sample ID. The hosts from which the specimens were reared are shown in parentheses.

Asterisks denote Brassolinae in the family Nymphalidae, while all other hosts are Hesperiidae

(Hesperiinae for H. INB-12, Eudaminae for the others).

Figure 2.3. The range of interspecific pair-wise distances for each of the species. Distances between COI sequences are on the left of each graph and distances between Cys-d9.2 sequences are on the right. Dashed lines link the distances of COI and Cys-d9.2 sequences for each pair of species.

Figure 2.4. Alignment of all unique Cys-d9.2 protein sequences illustrating 13 amino acid sites that have undergone more non-synonymous than

synonymous substitutions with Bayes Empirical Bayes posterior probabilities of 0.95 or 0.99 shaded in dark grey or black respectively (codeml

model: M8, using the tree topology produced from the concatenated data set). Question marks (?) indicate missing data. The vertical black line

indicates the location of the intron and the pale grey box highlights the cysteine motif domain. The ^ denotes codons that are assigned posterior

25 probabilities of significance or greater significance when using the COI tree. The * denotes the codon with non-significant posterior probability

when using the Cys-d9.2 tree. Note that all input trees use ML estimated branch lengths from Cys-d9.2 sequences only.

Chapter 3: Key to the species of Megarhyssa (Hymenoptera: Ichneumonidae: Rhyssinae) in

America, north of Mexico

Statement of Authorship

This chapter is a published research article:

Pook, V. G., Sharkey, M. J. & Wahl, D. B. (2016). Key to the species of Megarhyssa

(Hymenoptera: Ichneumonidae: Rhyssinae) in America, north of Mexico. Deutsche

Entomologische Zeitschrift, 63:137-148.

The license may be found at http://creativecommons.org/licenses/by/4.0/legalcode

This article has been modified in the following ways before incorporation into this dissertation:

- a phylogenetic analysis of DNA sequence data was added to the „Materials and Methods‟ section with the resulting tree displayed in Figure 3.9.

Abstract

A dichotomous and an interactive key to the species of Megarhyssa (Hymenoptera:

Ichneumonidae) in America, north of Mexico are presented. A diagnosis accompanied by images is provided for male and female wasps of each of the four species, Megarhyssa atrata,

Megarhyssa greenei, Megarhyssa macrurus and Megarhyssa nortoni.

Introduction

The subfamily Rhyssinae Morley, of the „pimpliformes‟ Ichneumonidae (Order: Hymenoptera), is found worldwide and comprises 234 described species in eight genera (Yu et al., 2012). Though hypothesized to have originated in the northern hemisphere (Wahl & Gauld, 1998), the diversity of this subfamily is heavily biased to the tropics with nearly half of the species belonging to the circumtropical genus, Epirhyssa Cresson, 1865 (Yu et al., 2012). Rhyssinae are generally large in size and some of the most impressive specimens occur in the cosmopolitan genus Megarhyssa

Ashmead (Hymenoptera: Ichneumonidae: Rhyssinae). The majority of the 37 described species in this genus occur in the Oriental region and the Eastern Palearctic. A handful of species occur in each of the following regions: Western Palearctic, Nearctic and Australasian; with one record for both the Neotropical (Chiapas) and Afrotropical regions (Yu et al., 2012).

Though only four species of Megarhyssa occur in the Nearctic (Yu et al., 2012), they are a common sight in the forests of the United States and Canada. Members of this genus are ectoparasitoid idiobionts of wood-boring siricid larvae (Townes, 1969) and one species, M. nortoni (Cresson), is an effective biocontrol agent employed by the National Sirex Coordination

Committee to control the invasive woodwasp, Sirex noctilio Fabricius (Hymenoptera: Siricidae).

Characteristics such as their bright coloration and large size place these spectacular insects among the „charismatic megafauna‟ of the arthropod world, often capturing the attention of hobbyists and nature enthusiasts. Given the frequency with which non-specialists encounter and work with

species of Megarhyssa, image-rich dichotomous and interactive keys will increase the accuracy of identifications.

The four species of Megarhyssa found in the United States and Canada are broadly distributed across the region (Townes and Townes, 1960; Carlson, 1979). The only species native to more southern regions is Megarhyssa macrurus (Linnaeus) which is also found in Mexico

(Townes and Townes, 1960). In addition, Megarhyssa nortoni now occurs in Australia, New

Zealand and South Africa where it was introduced as a biological control agent (Taylor, 1976;

Bartlett et al., 1978; Taylor, 1978; Haugen and Underdown, 1990; Tribe and Cillié, 2004; Hurley et al., 2007). Siricid wood wasps native to north America are the common hosts of each of the four species (Beaulne, 1939; Carlson, 1979; Champlain, 1922; Heatwole and Davis, 1965;

Hopkins, 1893; Nénon, 1995; Stillwell, 1967; Townes, 1944; Townes and Townes, 1960;

Treherne, 1916) with M. nortoni also parasitizing the invasive wood wasp, Sirex noctilio

(Carlson, 1979; Nuttall, 1980; Valentine and Walker, 1991; Vincent and King, 1995).

A key to the genera of Nearctic Rhyssinae, illustrated with high quality color images, is available online at http://www.amentinst.org/GIN/Rhyssinae. Here, we present a key to the four

Nearctic species, designed for use by non-specialists. We have adopted some characters from previous keys (Merill, 1915; Townes & Townes, 1960) in addition to creating our own when necessary. This key will be linked to the website of the American Entomological Institute where it will complement its generic key. It will also be advertised on the popular website www.bugguide.net to promote its use by the general public.

Materials and Methods

Key Building: Type specimens for each species were checked for the diagnostic morphological characters assigned by Merill (1915) and Townes & Townes (1960). A broad range of specimens from the hundreds of Megarhyssa housed in the Kentucky and American Entomological Institute

collections were examined. Characters included in the keys were chosen based on the ease with which they could be assessed by a non-specialist.

Phylogenetic Analysis: DNA sequence data for the barcode region of the gene cytochrome c oxidase subunit I (COI) for at least one specimen of each of the four species of Megarhyssa was downloaded from BOLD Systems. COI data for the species Rhyssa howdenorum was also downloaded for the purpose of using this taxon as an outgroup. All the sequences were aligned using Clustal W (Thompson et al., 1994) and checked by eye. A maximum likelihood (ML) tree was generated using GARLI (v. 2.0 Zwickl 2006) using the GTR+G+I model of nucleotide substitution (Rodriguez et al., 1990) and the default settings. A 200-replicate ML bootstrap analysis (Felsenstein, 1985) was then conducted using default settings. We used the most complex nucleotide model available as per recommendations of Huelsenbeck & Rannala (2004) for likelihood-based analyses.

Key to Species

Females.

1. A. Metasoma melanic (blackish-brown) and lacking yellow markings; ovipositor sheath about 3.7 times as long as fore wing…………………………………M. atrata (Fabricius) B. Metasoma ranging from brown to reddish-brown with conspicuous bright yellow markings; ovipositor sheath 1.8 to 3 times as long as fore wing…….2

2. A. Well-defined, yellow, roundish spot on each of tergites 4-6…...... M. nortoni (Cresson) B. Angled yellow bands on each of tergites 4-6……………………..3

3. A. Vertical black stripe on face below each antennal socket; ovipositor sheath about 3 times as long as fore wing……………………..……………….M. macrurus (Linnaeus) B. Vertical stripes on face absent; ovipositor sheath about 1.8 times as long as fore wing .….…………………..…………………………………………..M. greenei Viereck

Males.

1. A. Fore wing marked with brown patch at base of cell 2R1.…….M. macrurus (Linnaeus) B. Fore wing lacking brown patch at base of cell 2R1…..……….2

2. A. Mesopleuron blackish brown with yellow spot below wing insertion, no additional yellow markings……………………………………….………..…M. nortoni (Cresson) B. Mesopleuron ranging from blackish brown to reddish- brown, yellow spot below wing insertion and additional yellow markings………….………….……3

3. A. Mesosoma color reddish-brown and yellow...... M. greenei Viereck B. Mesosoma color blackish-brown and yellow.…………………..M. atrata (Fabricius)

Taxonomy

(Modified from Merrill, 1915; Townes et al., 1960,)

Megarhyssa Ashmead, 1900

Characters diagnostic of Megarhyssa include the presence of a petiolate triangular areolet on the fore wing, a longitudinal ridge on the trochantellus of the middle leg and lateral tubercles on the apical margin of the clypeus. In addition, tergites 3-5 of female Megarhyssa are smooth to punctate and sternites 2-6 possess a pair of tubercles close to the anterior sternal margin. Male

Megarhyssa have a strong setiferous groove which is close to and paralleling the apical 0.7 of the ventral interior margin; and tergites 3-6 are strongly concave apically and possess a median apical or subapical longitudinal submembranous area. These male specific characters are not well developed in small specimens and they may key to the genus Rhyssella (Townes and Townes,

1960).

Megarhyssa atrata (Fabricius)

Figs. 3.1–3.2

Ichneumon atratus Fabricius, 1781. Species Insectorum, v. 1, p. 436.

Ichneumon tenebrator Thunberg, 1822; 1824. Acad. Imp. des Sci. St. Petersburg, Mem.

8: 266; 9: 322. Unnecessarily proposed n. name for atratus Fabricius.

Rhyssa laevigata Brullé,1846. In Lepeletier, Hist. Nat. Ins. Hym., v. 4, p. 78.

Megarhyssa atrata lineata Porter, 1957. Ent. News 68: 206. Synonymized by Carlson

(1979)

Geographic Range: Eastern Nearctic to about longitude 100° W (Townes and Townes, 1960).

Hosts: Tremex columba (Hopkins, 1893; Treherne, 1916; Beaulne, 1939; Townes, 1944; Nénon,

1995)

Diagnosis

Female: Head and antenna mostly yellow, may or may not have a dark spot above the clypeus.

Mesosoma and metasoma black. Mesosoma sometimes with a small yellow spot on posterodorsal corner of pronotum, rarely with yellow markings. Fore wing 15 to 30 mm long; wings infuscate or entirely black. Ovipositor sheath about 3.7 times as long as forewing.

Females may be distinguished from the other species occurring in the USA and Canada by their body color.

Male: Head yellow, may or may not have a dark spot above the clypeus. Mesosoma yellow and blackish brown; metasoma very dark brown to black with a yellow mark on the hind margin of the first tergite; wings hyaline, fore wing 16 to 22 mm long.

Males may be distinguished from M. macrurus by the evenly darkened fore wing and the lack of a brown patch at the base of cell 2R1; from M. nortoni by the additional yellow markings on the mesopleuron; and from M. greenei by the color of the mesosoma.

Megarhyssa greenei Viereck, 1911

Figs. 3.3–3.4

Megarhyssa greenei Viereck, 1910. In Smith, N. J. State Mus., Ann. Rpt. for 1909, p.

627. Nomen nudum.

Megarhyssa greenei Viereck, 1911. U. S. Natl. Mus., Proc. 40: 191.

Megarhyssa greenei floridana Townes, 1960. U. S. Natl. Mus. Bul. 216 (pt. 2): 424.

Synonymized by Carlson (1979).

Geographic Range: Most specimens are found in the eastern Nearctic to about longitude 96° W, with some found as far west as Wyoming (Townes and Townes, 1960).

Hosts: Tremex columba (Townes, 1944; Townes and Townes, 1960; Heatwole and Davis, 1965;

Stillwell, 1967).

Diagnosis

Female: Head mostly yellow; mesosoma reddish-brown and yellow. Metasoma reddish-brown, each tergite with an angled yellow band; bands on the third and following tergites interrupted on the midline. Fore wing 12 to 27 mm long. Wings hyaline and the fore wing usually with a large brown patch at the base of cell 2R1. Ovipositor sheath about 1.8 times as long as fore wing.

Females can be distinguished from M. atrata by their reddish-brown and yellow body color; from

M. nortoni by the angled yellow bands on their metasoma; and from M. macrurus by the lack of vertical stripes on the face.

Male: Head mostly yellow; mesosoma reddish-brown and yellow; metasoma reddish-brown with yellow and black markings on first two or three tergites. Wings hyaline; fore wing 10 to 16 mm long.

Males can be distinguished from M. atrata by their mesosoma color; from M. nortoni and M. macrurus by the lack of vertical stripes on the face.

Megarhyssa macrurus (Linnaeus, 1771)

Figs. 3.5–3.6

There are three subspecies:

Megarhyssa macrurus icterosticta Michener

Megarhyssa lunator icterosticta Michener, 1939. Pan-Pacific Ent. 15: 130.

Megarhyssa macrurus lunator (Fabricius)

Ichneumon lunator Fabricius, 1781. Species Insectorum, v. 1, p. 430.

Thalessa? histrio Kriechbaumer, 1890. Wien, Mus. der Naturgesch., Ann. 5: 487. Preocc.

in Megarhyssa by Ichneumon histrio Christ, 1791.

Megarhyssa macrurus macrurus (Linnaeus)

Ichneumon macrurus Linnaeus, 1771. Mantissa Plantarum, v. 2, p. 540.

Ichneumon georgicus Megerle, 1803. Appendix ad Cat. Ins., Quae Mense Novembris

1802 Vienne Austriae Auctionis Lege Vendita Fuere, p. 16.

Megarhyssa lunatrix Schulz, 1906. Spolia Hym., p. 115. Emendation.

Megarhyssa lunator phaeoptila Michener, 1939. Pan-Pacific Ent. 15: 129.

Note: The specific epithet macrura is commonly applied to this species, however the name macrurus was interpreted by Townes (1944) and Townes and Townes (1960) as a noun and therefore is not required to match the gender of the genus name.

Geographic Range: M. macrurus icterosticta is found in Arizona, Colorado, New Mexico, and

Utah. M. macrurus lunator ranges across the eastern Nearctic to the eastern slopes of the Rocky

Mountains. M. macrurus macrurus extends from Florida to south-western Texas, and has been collected in Mexico (Chihuahua).

Hosts: Tremex columba (Carlson, 1979).

Diagnosis:

Female: Head yellow and dark brown, with two vertical stripes on face, one below each antennal socket. Mesosoma and metasoma ranging from dark brown to reddish-brown and yellow. Each tergite with an angled yellow band interrupted on the third to sixth tergites. Wings hyaline with brown patches; fore wing 18 to 29 mm long. Ovipositor sheath about 3.0 times as long as fore wing.

Females can be distinguished from M. atrata by their body color; from M. nortoni by the angled yellow bands on the tergites; and from M. greenei by the vertical stripes on the face.

It should be noted that Carlson (1979) did not separate M. macrurus lunator from M. macrurus macrurus.

Male: Head yellow and dark brown, with two vertical stripes on face, one below each antennal socket. Mesosoma yellow and blackish brown, metasoma brown, first and second tergites with a short yellow band on hind margin. Wings hyaline, fore wing 7 to 21 mm long with a brown patch at the base of cell 2R1.

Males can be distinguished from the other species occurring in the USA and Canada by the brown patch at the base of cell 2R1 of the fore wing and the presence of two vertical stripes on the face.

Megarhyssa nortoni (Cresson, 1864)

Figs. 3.7–3.8

There are two subspecies:

Megarhyssa nortoni nortoni (Cresson)

Rhyssa nortoni Cresson, 1864. Ent. Soc. Phila., Proc. 3: 317.

Megarhyssa nortonii Dalla Torre, 1901. Cat. Hym., v. 3, p. 481. Emendation.

Megarhyssa nortoni quebecensis (Provancher)

Thalessa quebecensis Provancher, 1873. Nat. Canad. 5: 447

Geographic Range: M. nortoni nortoni is distributed along the Pacific Coast from south-western

Canada to California, and extends eastward to central Colorado. M. nortoni quebecensis is found in the north-eastern U.S. and adjacent parts of Canada. In the late 1960s and early 1970s this species was collected across the United States and Canada, encompassing the ranges of both subspecies, for introduction as a biocontrol agent in Australia (Taylor, 1976) and New Zealand

(Bartlett et al., 1978). The populations established in Australia were then introduced to South

Africa (Tribe and Cillié, 2004).

Hosts: Sirex noctilio (Carlson, 1979; Nuttall, 1980; Valentine and Walker, 1991; Vincent and

King, 1995); Sirex sp. (Carlson, 1979); Urocerus albicornis (Champlain, 1921; Townes, 1944);

Xeris morrisoni (Townes, 1944)

Diagnosis:

Female: Head black to blackish brown and yellow; mesosoma black or blackish brown, with yellow spots; metasoma brown and usually a little paler than mesosoma. Subtriangular median subapical spot on first and second tergites, large round yellow spot on side of tergites 3-5, and vertical yellow blotch on side of sixth and seventh tergites. Forewing 13 to 29 mm long.

Ovipositor sheath about 2.7 times as long as fore wing.

Females can be distinguished from M. atrata by the body color; and from M. macrurus and M. greenei by the yellow spots on the tergites.

It should be noted that Carlson (1979) did not separate M. nortoni nortoni from M. nortoni quebecensis.

Male: Head black to blackish brown and yellow; mesosoma black to blackish brown, with yellow spots; metasoma brown, the tergites usually darker medially; the first two tergites with a median subapical yellow spot. Forewing 9.5 to 20 mm long.

Males can be distinguished from M. macrurus by the lack of a brown patch at the base of cell 2R1 of the fore wing and from M. atrata and M. greenei by the single vertical black band on the face and the color of the mesopleuron.

Phylogenetic Analysis

The majority-rule consensus tree produced from the maximum likelihood analysis of COI sequence data shows good support for all four species examined.

Acknowledgements

The authors gratefully acknowledge Drs Robert Kula, Dominique Zimmerman, Mike Fitton and

Jeanne Robinson for loaning specimens and Dr Gavin Broad, Jason Weintraub and Christine

LeBeau for imaging specimens. Taxonomic information was taken from Carlson (1979), Merill

(1915) and Townes and Townes (1960). The authors also thank the Museum für Naturkunde

Berlin for their support in the publication of the manuscript. The authors would also like to extend our appreciation to Drs. llari Saaksjarvi, Alexey Reshchikov and Ralph Peters for editorial comments. This is publication No. 16-08-012 of the Kentucky Agricultural Experiment Station and is published with the approval of the Director. This work is supported by the National

Institute of Food and Agriculture, U.S. Department of Agriculture, Hatch under KY008041 and

KY008065 awarded to MJS.

Figure 3.1. Megarhyssa atrata female. A. Anterior head; B. Anterior head showing color variation; C. Lateral head and mesosoma; D. Wings; E. Lateral habitus; F. Lateral metasoma.

Figure 3.2. Megarhyssa atrata male. A. Anterior head; B. Anterior head showing color variation;

C. Lateral head and mesosoma; D. Dorsal habitus; E. Lateral habitus; F. Wings.

Figure 3.3. Megarhyssa greenei female. A. Anterior head; B. Lateral head and mesosoma; C.

Wings; D. Lateral habitus; E. Lateral metasoma.

Figure 3.4. Megarhyssa greenei male. A. Anterior head; B. Lateral head and mesosoma; C.

Dorsal habitus; D. Lateral habitus; E. Wings.

Figure 3.5. Megarhyssa macrurus female. A. Anterior head; B. Lateral metasoma; C. Lateral habitus; D. Lateral head and mesosoma; E. Wings.

Figure 3.6. Megarhyssa macrurus male. A. Anterior head; B. Lateral head and mesosoma; C.

Dorsal habitus; D. Lateral habitus; E. Wings.

Figure 3.7. Megarhyssa nortoni female. A. Anterior head; B. Lateral head and mesosoma; C.

Wings; D. Lateral habitus; E. Lateral metasoma.

Figure 3.8. Megarhyssa nortoni male. A. Anterior head; B. Lateral head and mesosoma; C.

Dorsal habitus; D. Lateral habitus; E. Wings.

Figure 3.9. Maximum likelihood tree generated from COI sequence data from specimens of four species of Megarhyssa, with Rhyssa howdenorum as the outgroup. Codes preceding each species name indicate the specimen on BOLD systems from which the sequence data was collected.

Chapter 4: Insights into the venom of the parasitoid wasp, Megarhyssa (Hymenoptera:

Ichneumonidae)

Abstract

A combined transcriptomics and proteomics approach was used to investigate the venom of two species in the genus Megarhyssa (Hymenoptera: Ichneumonidae). Sixty-four putative venom proteins were identified. Eleven of these do not contain known conserved protein domains; the remainder are predicted to code for 24 different proteins with possible functions including the disruption of the host immune response, facilitation of larval feeding, antimicrobial activity and plant cell-wall degradation. The sequences of the genes coding for these proteins are, for the most part, very different from other parasitoid wasp venom genes. This is likely due to the fact that the species investigated in this study are the first ectoparasitoid idiobionts from the superfamily

Ichneumonoidea to have their venom examined.

Introduction

A diverse range of animals have evolved venom as a means to subdue prey or to serve as a defense against predators. These taxa are predominantly invertebrate, with Hymenoptera being the largest single group, comprising a remarkable number of species of untold diversity in form and function (Quicke, 1997). The venom of Hymenoptera, composed of a complex blend of biogenic amines, peptides, enzymes and paralytic toxins, is produced in specialized venom glands derived from female reproductive tissue and has a broad range of functions (reviewed by Moreau

& Guillot, 2005). In the past, most research on hymenopteran venom focused on bees and stinging wasps (Aculeata) which use their stinger to inject these secretions into their prey or predators. More recently, studies have begun to examine the venom of parasitoid Hymenoptera – wasps that are free-living as adults but develop on (ectoparasitoids) or in (endoparasitoids) other

organisms in their larval stages. In these taxa, the stinger has retained the ancestral function of oviposition and is referred to as the ovipositor.

The venomous secretions produced by parasitoid wasps alter host physiology to provide a suitable environment for larval development (Pennacchio & Strand, 2006) and their functions are highly dependent on the developmental strategy of the wasp. Koinobiont parasitoids allow their hosts to continue to develop while their progeny are growing inside and their venom results in immunosuppression, reproductive alterations and endocrine manipulation. The venom of idiobiont parasitoids causes paralysis, developmental arrest, a reduction in metabolism and immunosuppression (reviewed by Pennacchio et al., 2014). Host-parasitoid coevolution and adaptation exert intense selection pressure on parasitoid virulence and may have led to the extraordinary diversification and specialization of the parasitic Hymenoptera likely resulting in a unique venom composition for each species (Moreau & Guillot, 2005). To date, the venom of 18 species representing five different families of parasitoid Hymenoptera have been investigated

(reviewed by Poirié et al., 2014). These venoms have great potential utility and appear to represent an unexplored pharmacopoeia that could have a wide range of applications (Moreau &

Asgari, 2015). Further investigation of this natural resource is warranted.

As ectoparasitic idiobionts, wasps in the genus Megarhyssa face a number of challenges during parasitization which are overcome through the injection of venom into the host. First of all, an egg oviposited on the surface of the host is at risk of being dislodged, particularly if the host bores through wood (Quicke, 2015). Parasitoids of concealed larvae use their venom to induce permanent paralysis, eliminating this possibility (Quicke, 2000). However, this strategy is linked to a distinct disadvantage in terms of nutrition as once the host is paralyzed, it can no longer obtain resources and therefore declines in quality immediately after parasitization (Quicke,

2015). It is imperative that the parasitoid preserves what remains of its host for as long as possible and the introduction of antimicrobial peptides into the host at oviposition to ward off pathogenic disease is a way of achieving this.

In addition, when the parasitoid larva begins feeding, it uses its mouthparts to pierce the host cuticle. It is vital at this stage that immune responses such as clotting of host haemolymph and melanization are suppressed as this can inhibit the uptake of nutrients by the parasitoid

(Strand & Pech, 1995). This is achieved by factors in the venom of the adult parasitoid as well as salivary secretions of the larval parasitoid (Richards & Edwards, 2002a, 2002b). However, immunosuppression makes the host vulnerable to microbial attack and Dani et al. (2003) suggest that antibacterial factors in the venom may be required to protect the host and the developing parasitic progeny from opportunistic pathogens. The antimicrobial properties of venom are demonstrated in a wide range of hymenopteran species and their adaptations are discussed by

Moreau (2013).

Finally, components of the venom are capable of mobilizing nutrients from host tissue, which provides the parasitoid larva with the maximum amount of resources. The venom of

Euplectrus separatae, for example, increases lipid and protein availability in the host haemolymph through the induction of fat body cell lysis (Nakamatsu & Tanaka, 2004). Acid phosphatases, which release carbohydrates from phosphoric esters, are reported to be present in

Pteromalus puparum (Zhu et al., 2010), Pimpla hypochondriaca (Dani et al., 2005) and Nasonia vitripennis (Danneels et al., 2010) and are hypothesized to be involved in providing nutrients for the developing parasitic larvae (Dani et al., 2005).

The lifecycle of members of the giant ichneumon genus, Megarhyssa, also poses an additional challenge: the hosts that they seek (the larvae of siricid wasps) are concealed inside the trunks of trees. Parasitization of these larvae necessitates the penetration of wood

(predominantly maple and beech), a feat achieved by the gracile ovipositor of Megarhyssa in a matter of minutes. The ovipositor, which lacks cutting teeth and is as fine as a horse hair, penetrates up to 10 cm of wood in order to reach the insect larva inside. No sawdust is generated during this process and images obtained by scanning electron microscopy show the plant cell walls lining the hole are collapsed (Le Lannic & Nénon, 1999). It is postulated that the venom of

Megarhyssa contains lignolytic enzymes and that are secreted by the ovipositor to facilitate the penetration of wood (Nénon et al., 1997).

In this study we combine transcriptomics and proteomics approaches to investigate the constituents of the venom of two species in the genus Megarhyssa (Hymenoptera:

Ichneumonidae), M. greenei Viereck and M. macrurus (Linnaeus). We tentatively assign functions to the putative venom proteins and discuss how they may play a role in the life history of Megarhyssa.

Materials and Methods

Collection of preparation of specimens: Adult female Megarhyssa were collected from Daniel

Boone National Forest in the summers of 2012, 2013 and 2014. Specimens were brought back to the laboratory alive and were prepared for either RNA or venom extraction. RNA extraction preparation consisted of surface sterilization of the insect followed by the removal of the terminal three segments of the abdomen and either flash freezing in liquid nitrogen or storage in RNAlater.

Preparation for venom extraction consisted of surface sterilization of the insect followed by dissection in ice-cold phosphate buffered saline (Fig. 1). The sternites were removed and the organs of the abdomen were pulled away from the tergites. The terminal three segments of the abdomen were then cut away from the rest of the body and dissected alone. The venom gland was gently eased out from between the muscle tissue, and forceps were used to detach the sclerotized duct from the base of the ovipositor. The entire venom apparatus was then placed in 15uL of PBS with protease inhibitors and was torn open with forceps. The viscous venom could be seen spilling into the solution, which was then drawn up with a pipette and frozen for later use.

Reference transcriptome assembly: Total RNA was extracted from the terminal three abdominal segments of one specimen of M. macrurus and three specimens of M. greenei using TRIzol

(Invitrogen, Carlsbad, CA) according to the manufacturer‟s protocol. RNA samples were further

purified using Qiagen RNeasy mini columns. All samples were treated with RNase-Free DNase

Sets (Qiagen, Valencia, CA) according to the manufacturer‟s protocol. RNA-seq for the specimen of M. macrurus was accomplished by Hudsen Alpha (Huntsville, Al) using a HiSeq 2000 and 100 bp paired-end sequencing, after performing polyA selection, fragmentation, and library production via ligation and PCR. The RNA-seq data produced was then assembled using Velvet

(Zerbino & Birney, 2008) and Oases (Schulz et al., 2012). RNA from three specimens of M. greenei was prepared for sequencing using the TruSeq RNA kit following the manufacturer‟s protocol and then sequenced using an Illumina MiSeq producing 150bp paired-end sequences.

This RNA-seq data was assembled using Trinity (Grabherr et al., 2011) (version: trinityrnaseq_r20140717) in paired mode. Four different assemblies were constructed, one for each specimen and one with the combined data from all three specimens.

Protein database construction: The M. macrurus protein database was constructed from the transcriptome of one specimen. The M. greenei protein database was constructed from the transcriptome assembled from three specimens. Both transcriptome databases were translated into all six reading frames using a perl script to provide two protein databases to be queried with peptide mass spectra.

Venom preparation and mass spectrometry

Venom protein quantification: Bradford assays were used to determine the amount of protein in each venom sample. The venom proteins were then separated in one dimension using SDS-PAGE with Precision Plus Protein Standard as a molecular weight marker.

Tryptic digestion: Gel bands were cut, destained and dried in a vacuum centrifuge. Proteins in the gel were reduced and after discarding the reducing liquid, proteins were alkylated and incubated at room temperature. The gel was washed twice and partially dried in a vacuum centrifuge. Dried gel was rehydrated and sequencing grade trypsin was used to perform in-gel digestion of proteins

into tryptic peptides. Peptides were extracted from the gel and the peptide solution was brought up to 12μL with 0.1% formic acid and the solution was filtered through a 0.45μm filter prior to

LC/MS/MS analysis.

Liquid chromatography-electrospray ionization-tandem mass spectrometry (LC-ESI-MS/MS) analysis: LC-MS/MS analysis was performed using an LTQ-Orbitrap mass spectrometer (Thermo

Fisher Scientific, Waltham, MA) coupled with an Eksigent Nanoflex cHiPLC (tm) system

(Eksigent, Dublin, CA) through a nano-electrospray ionization source. The peptide samples were separated with a reversed phase cHiPLC column and mass analyzed using an Orbitrap MS scan followed by a data dependent MS/MS for fragmentation of the most intense ions with the collision induced dissociation (CID) method.

Putative protein identification: The data collected by LC-ESI-MS/MS was used to search both databases created from the transcriptome sequence data described above. Protein Pilot and

MASCOT were used to assess the confidence in the putative proteins identified taking into account the number of peptide matches and the percent coverage of the protein. This resulted in two lists of candidate venom transcripts, those corresponding to peptides in M. greenei venom and in M. macrurus venom, with confidence scores of 30 or above. Since venom proteins are secreted into the venom reservoir, the SignalP4.1 Server (Petersen et al., 2011) was used to assess each transcript for the presence of a signal peptide. Those transcripts in which signal peptides were identified were deemed to be venom proteins. These putative venom proteins were then queried against the Conserved Domain Database (NCBI) to identify conserved domains of known function and also against the NCBI protein database using the BLASTp algorithm to determine the best hit for each of the transcripts.

Results

Transcriptomics

A summary of the assembly statistics of the transcriptomes can be found in Table 1. The transcriptome for the species M. macrurus, was assembled after sequencing cDNA from one specimen. Three specimens of M. greenei had cDNA sequenced and assembled. When the sequences from all three M. greenei specimens were combined before assembly, the assembly statistics improved dramatically highlighting the value of replication in studies such as these.

Proteomics

Mass spectrometry of venom peptides from two species of Megarhyssa identified 64 transcripts coding for putative venom proteins, the details of which can be found in Table 2 and

Supplementary Table S1. Twenty-seven of these transcripts corresponded to peptides present in both venoms, and of the remaining 37, the majority corresponded to M. greenei venom peptides

(Fig. 2). In addition, more than two thirds of the putative venom transcripts identified were from the M. greenei transcriptome database (Fig. 2). Eleven of the identified transcripts code for proteins in which conserved protein domains cannot be identified. However, four of these do show significant similarity to hymenopteran sequences on the NCBI protein database. Conserved protein domains were identified in 53 transcripts that code for 24 different proteins each of which is labeled on the images of the gels produced by SDS-PAGE (Fig. 3).

BLAST hits

The best NCBI BLAST hit for each venom protein can be found in Supplementary Table S1. The majority of these were distributed among the Parasitica, the Aculeata and the Symphyta with 13,

20 and 18 best hits for each group respectively (Fig. 4).

Discussion

Our investigation into the constituents of the venom of Megarhyssa using a joint transcriptomics and proteomics approach revealed 64 transcripts coding for 24 known proteins and 11 as yet uncharacterized proteins. Many of the proteins corresponded to peptides from both samples indicating a high degree of overlap in the venom components of the two species. However, only about a third of the putative venom transcripts were from the M. macrurus transcriptome database. This may be due to the differences in the construction of each database and the transitory nature of a transcriptome. The M. macrurus database was constructed from RNA extracted from only one specimen whereas the M. greenei database was constructed from RNA extracted from three specimens increasing the probability that a given venom transcript will be present in the database.

Interestingly, the majority of the best BLAST hits were not from other species of

Parasitica. Species of Aculeata or Symphyta showed greater sequence similarity in most cases.

This may be due to the fact that the nine species of ichneumonoid wasps that have had their venoms studied are koinobiont endoparasitoids. Species associated with these best hits include the orussid wood wasp, Orussus albietinus (Scopoli), the tenthredinid wood wasp, Athalia rosae

(Linnaeus) and various bees and ants. In the case of O. albietinus, the similarity could be explained by the shared life history traits of the two species, both of which drill through tree trunks to parasitize wood-boring insect larvae. The similarity with the aculeate sequences is curious but this may be an artifact of an incomplete database, lacking sequences from ectoparasitoid Ichneumonoidea. What this does show is that Megarhyssa venom genes appear to be very different from other parasitoid wasp venom genes studied to date.

Putative functions of Megarhyssa venom proteins

Immune suppression: The eggs and larvae of Megarhyssa are targeted by the siricid host‟s immune system and can only survive if this response is suppressed. A variety of components of

the venom of Megarhyssa may be associated with the inhibition of the host immune response.

Super oxide dismutases (SODs) and serine proteases both have demonstrated effects on the melanization pathways in hosts of other parasitoid wasps (Colinet et al., 2011). The venom of

Megarhyssa also contains proteins with leucine-rich repeats (LRRs) which may disrupt the host immune response through the Toll pathway by acting as scavengers for host Toll-like receptors

(TLRs) (Colinet et al., 2014). In addition, it is hypothesized that peptidase M13 modulates the host immune system by degrading immune-specific peptides (Asgari et al., 2002) while host haemocyte accumulation may be suppressed by zinc dependent metalloproteases. The suppression of the immune system leaves the host vulnerable to attack by opportunistic pathogens and it is possible that Phospholipase A2 (PLA2) in the venom of Megarhyssa acts as a microbial agent during this time.

Developmental arrest and resource uptake: As idiobiont ectoparasitoids, Megarhyssa halt the development of their hosts. This is necessary because the precarious position of the externally developing parasitoid larvae requires that the host ceases movement (Quicke, 2015). This may be achieved by the immunoglobulin-like proteins found in their venom. However, this developmental disruption creates its own problem, namely that the host begins to decline in quality as soon as it is parasitized since it can no longer consume nutrients (Quicke, 2015). It is vital that the parasitoid larvae take up enough nutrients to complete development and this may be enhanced by histidine acid phosphatases and lipases from the venom which release nutrients from the hosts‟ stores.

Facilitation of oviposition: Putative laccases were also found in the venom of Megarhyssa.

Laccases (EC: 1.10.3.2) are blue multicopper oxidases (MCOs) that catalyze the oxidation of a wide variety of aromatic substrates (Soloman et al., 1996; Messerschmidt, 1997). They are present in bacteria, plants, fungi and animals where they play roles in pigmentation, lignin synthesis and degradation, iron homeostasis and morphogenesis. We predict that the laccase present in the venom of Megarhyssa works in a similar fashion to those found in white-rot fungi

and termites which act on lignin during the process of wood degradation and we hypothesize that

Megarhyssa‟s venom laccase is secreted during oviposition to facilitate the penetration of wood.

Possible industrial applications of Megarhyssa venom proteins

Pharmaceutical agents: Animal venoms have long been recognized as valuable sources of natural medicines with records of the use of snake venom to treat arthritis and gastrointestinal ailments dating back to the 7th century B.C. (Gomes et al., 2010). Venom peptides or other derivatives from snakes, cone snails, lizards, scorpions, spiders and sea anemones are all currently in clinical use or under development (Vetter et al., 2011). In terms of pharmaceutical agents in the venom of

Megarhyssa, both super oxide dismutase (SOD) and phospholipase A2 (PLA2) could have great potential. SODs of bovine origin have been used as anti-inflammatory drugs for decades (Aehle,

2006) and venom from the wasp, Nasonia vitripennis, which contains SODs has been shown to have anti-inflammatory properties on mammalian cells (Danneels et al., 2014). The anti-microbial activity of PLA2 is well-known (reviewed by Moreau, 2013) and it is possible that the PLA2 found in the venom of Megarhyssa has similar properties.

Biopesticides: The use of chemical insecticides is proving unsustainable due to concerns over their effects on human health, non-target beneficial organisms and the environment. Between

2005 and 2009, 169 insecticides were de-registered while only nine new products were introduced to the market (Windley et al., 2012). An additional concern is the increase in resistant pests due to intense selection pressure exerted by widespread use of insecticides with a limited range of physiological targets (Windley et al., 2012). Novel insecticidal agents are therefore in high demand and parasitoid venoms constitute an outstanding natural resource of such agents.

The components of the venom of Megarhyssa that are predicted to act on the host immune system or alter host development (see Table 2) are all excellent candidates for biopesticide development.

Biofuels: The growing price and increased demand for crude oil combined with environmental concerns over global warming has re-launched interest in the development of biofuels (Schubert,

2006). Lignocellulosic biomass is the earth‟s most abundant renewable resource (Fernandes et al.,

2012) and constitutes a low cost feedstock for bioethanol production (Zaldivar et al., 2001).

However, the conversion of lignocellulose to ethanol is far more costly than converting starch to ethanol, with delignification as the central issue limiting the production of energy from this source (Martinez et al., 2009). If the laccase present in the venom of Megarhyssa demonstrates activity against lignin, it could be developed as a biocatalyst for the pretreatment of lignocellulosic biomass.

Summary

This study investigates the venom of the ichneumonid ectoparasitoid Megarhyssa. The components identified are compared to those found in other parasitoids and other Hymenoptera and are examined for conserved protein domains. This information is used to tentatively assign putative functions and to discuss potential industrial applications.

Acknowledgements

The authors would like to thank Dr. Carol Beach and Dr. Jing Chen at the University of Kentucky

Proteomics Core Facility and the team at the University of Kentucky Advanced Genetic

Technologies Center for their contributions to the acquisition of the data presented in this manuscript. We also gratefully acknowledge the help and support of Drs. Bruce Webb, Randal

Voss, Li Tian, Qian Sun, Eric Chapman and Erika Tucker. This study was supported in part by a grant from the Kentucky Science and Engineering Foundation as per grant agreement #KSEF-

3128-RDE-017 with the Kentucky Science and Technology Corporation. Additional funding for this research was provided by Hatch projects KY008041 and KY008065 (to MJS) and by the

Karri Casner Environmental Sciences Fellowship awarded to VGP. The information reported in this paper (No. 15-08-064) is part of a project of the Kentucky Agricultural Experiment Station and is published with the approval of the Director

Table 4.1. Transcriptome assembly statistics. Numbers in parentheses after the species M. greenei indicate the specimen.

Specimen # Transcripts > 100 bp N50 (bp) Mean Length (bp)

M. macrurus 33,337 3,055 1,036

M. greenei (1) 74,702 759 567

M. greenei (2) 43,114 855 602

M. greenei (3) 41,047 908 617

M. greenei (all) 87,429 1696 759.71

Table 4.2. Putative venom proteins and associated information

Predicted Venom Fraction Transcriptome Molecular Weight M. M. Putative protein Database (kDa) greenei macrurus Possible Function ADAM metalloprotease M. greenei 14.49 11 - Chitin-binding protein M. greenei 35.66 - 6 May disrupt the host immune response Chitin-binding protein M. greenei 37.48 - 6 through inhibition of the production of phenoloxidase activating protease [17]. May bind chitin in venom reservoirs, where it serves as a structural component [38]. May function to improve wound healing by accelerating the biosynthesis of chitin around the injury site that results from oviposition [38].

56 Cu-Zn Superoxide Dismutase M. greenei 21.81 - 12 Interference with host melanization

pathways and protection of other virulence factors from damage by reactive oxygen species while stored in the venom reservoir [24].

Cyclophilin M. macrurus 22.88 11 11 Cyclophilin M. greenei 22.88 11 11 Dipeptidyl-peptidase IV M. greenei 87.93 3 - General odorant binding M. greenei 14.74 12 - May be associated with host selection (e.g., protein superparasitism) or oviposition behavior [39]. Glycosyl hydrolase 27 M. greenei 49.83 - 6 Glycosyl hydrolase 35 M. macrurus 72.33 - 3 Glycosyl hydrolase 35 M. greenei 72.17 - 3

Table 4.2. continued

Heat shock protein M. macrurus 72.76 4 - Involved in final processing and export of Heat shock protein M. greenei 72.78 4 - secreted proteins [40]. Histidine acid phosphatase M. macrurus 45.43 5 8 Could be involved in providing nutrients for the developing parasitic larvae or in the disruption of host immunity [16]. Immunoglobulin-like M. greenei 87.16 - 2 May function to arrest host development [17]. Immunoglobulin-like M. macrurus 87.26 - 2 Insulin-like growth factor M. greenei 12.18 12 - Insulin-like growth factor M. greenei 9.9 12 - Laccase M. macrurus 81.58 3 2 May be secreted to degrade lignocellulosic Laccase M. macrurus 73.68 3 2 material [41, 42, 43, 44] or injected into the

57 host to cause immune suppression [45] and Laccase M. macrurus 70.67 3 2 cell death [17]. Laccase M. greenei 93.26 3 2 Leucine-rich repeat M. greenei 88.69 3 2 May disrupt the host immune response Leucine-rich repeat M. greenei 65.69 - 4 through the Toll pathway by acting as scavengers for host TLRs [25]. Lipase M. macrurus 51.22 4 5 Likely to be used to breakdown the energy Lipase M. greenei 37.85 4 5 stores contained in the host fat bodies [46]. Lipase M. greenei 61.97 4 5 Lipase M. macrurus 67.95 4 4 Lipase M. macrurus 65.02 4 5 Lipase M. macrurus 60.29 4 5 Lipase M. macrurus 64.88 4 5 Lipase M. greenei 67.86 4 4

Table 4.2. continued

Peptidase M13 M. greenei 87.25 4 4 Hypothesized to modulate the host immune system by degrading immune-specific peptides [26]. Peptidase_C1A; M. greenei 37.63 6 9 Inhibitor_I29 Peptidase_C1A; M. greenei 63.3 - 4 Inhibitor_I29 Phospholipase A2 M. greenei 27.74 9 - Antimicrobial activity [13, 47]. Protein disulphide isomerase M. greenei 56.38 4 - May be responsible for the retention, Protein disulphide isomerase M. macrurus 75.76 - 4 concentration and transport of Phospholipase A2 [48]. Protein disulphide isomerase M. greenei 75.84 - 4 Trypsin inhibitor-like M. greenei 18.88 11 - May modulate the host immune system [17].

Trypsin inhibitor-like M. greenei 9.19 11 12 Trypsin inhibitor-like M. greenei 17.1 11 - Trypsin inhibitor-like M. greenei 10.24 12 - Trypsin-like serine protease M. macrurus 43.14 - 6 May disrupt the host immune system by Trypsin-like serine protease M. greenei 43.36 4 6 competitively inhibiting endogenous peptidase S1 homologs which are involved Trypsin-like serine protease M. macrurus 38.93 4 6 in the host haemolymph melanization Trypsin-like serine protease M. greenei 39.12 4 6 cascade [49]. Trypsin-like serine protease M. macrurus 43.92 4 - Trypsin-like serine protease M. greenei 44 4 - Whey acidic protein M. greenei 18.34 11 - Zinc-dependent M. greenei 42.56 6 - May serve to prevent haemocyte metalloprotease accumulation, increasing the survival of the parasitoid eggs inside the host [50].

Table 4.2. continued

Zinc-dependent M. greenei 63.11 4 - metalloprotease γ-glutamyl-transpeptidase M. greenei 56.61 4 6 May trigger apoptosis [51]. MgV1 M. greenei 34.82 6 - MgV2 M. greenei 21.03 10 11 MgV3 M. greenei 15.02 11 13 MgV4 M. greenei 13.83 11 13 MgV5 M. greenei 14.22 11 - MgV6 M. greenei 13.43 12 13 MgV7 M. greenei 12.54 12 -

MgV8 M. greenei 10.14 12 - MmV1 M. macrurus 7.77 - 2 MmV2 M. macrurus 8.17 - 13 MmV3 M. macrurus 50.17 11 -

Figure 4.1. The terminal segment of the abdomen of M. greenei with venom apparatus.

Figure 4.2. Proportion of putative venom proteins corresponding to peptides identified by mass spectrometry of venom from each species for each database.

Figure 4.3. Venom proteins of one specimen of each species separated by SDS-PAGE. Each fraction is labeled with the putative proteins corresponding to venom peptides in that fraction.

Figure 4.4. Taxon distribution of top hits for Megarhyssa venom proteins on NCBI BLAST.

Chapter 5: Examination of a putative laccase from the venom of parasitoid wasps of the genus Megarhyssa (Hymenoptera: Ichneumonidae)

Abstract

The giant parasitoid wasp, Megarhyssa (Hymenoptera: Ichneumonidae), uses its gracile egg- laying appendage (ovipositor) to penetrate up to ten centimeters of wood in a matter of minutes in order to lay an egg on its host. It is postulated that enzymes that lyze wood are secreted from the ovipositor to facilitate this process and in this study we investigate this hypothesis. Laccase, an enzyme associated with lignin degradation in wood-rotting fungi and lignocellulose digestion in termites, is found in the venom of Megarhyssa. The sequence of this putative laccase was confirmed by reverse-transcriptase PCR and subsequently subjected to phylogenetic analysis. Its placement in the resulting phylogeny indicates a similarity with the predicted laccase of Orussus abietinus (Hymenoptera: Orussidae), another parasitoid wasp that uses a long ovipositor to penetrate wood, lending support to our hypothesis that this venom laccase may be secreted by

Megarhyssa to aid the penetration of wood. However, assays conducted using various substrates could not confirm activity of the recombinant enzyme.

Introduction

Lignocellulosic biomass is the world‟s most abundant renewable resource and has the potential to become the leading source of raw material for the production of biofuel. However, in order for lignocellulose to become a major contributor to the fulfillment of the world‟s energy requirements, it must be efficiently broken down into desirable products – a process which is currently hindered by high costs and excessive energy input (Chaturvedi & Verma, 2013).

Research into the improvement of existing methods and the development of alternatives are of significant economic and environmental interest. In terms of major industrial uses (e.g. paper manufacture and biofuel production) it is the carbohydrate polymers, cellulose and hemicellulose

that have the most potential (Belgacem & Gandini, 2008). However, lignocellulose also contains lignin, a complex of phenolic and phenylpropanoid compounds (Pettersen, 1984), which confers rigidity to the plant cell wall (Rubin, 2008) and provides protection from pathogens and saprophytic organisms (Ruiz-Dueñas & Martínez, 2009). This protective lignin barrier must be broken in order to gain access to cellulose and hemicellulose which can then be processed for industrial use.

Termed „pre-treatment‟, this phase of lignocellulosic processing is being investigated with a diverse range of techniques reviewed in Chaturvedi & Verma (2013). Existing methods of pre-treatment include using acidic or alkaline conditions, organosolv processing, oxidative delignification, microwave irradiation and biological methods (reviewed in Chaturvedi & Verma,

2013). The chemical based approaches are often harmful to the environment and costly due to the need for high temperatures and resistant equipment. Microwave irradiation is capable of disrupting the structure of lignocellulose by localized heating but on a large scale the expense of the equipment and the amount of energy required is prohibitive (Feng & Cheng, 2008). With the goal of reducing the cost of lignocellulose pre-treatment, research is being conducted on naturally occurring oxidative enzymes that could be used to break the lignin barrier (Martínez & Ruiz

Dueñas, 2009).

Organisms that degrade lignin are a potential source of cheap and eco-friendly lignolytic enzymes for lignocellulose pre-treatment (Wan & Li, 1012). Hydrogen peroxidase, manganese peroxidase and laccase are enzymes secreted by white-rot fungi to degrade lignin (Eggert et al.,

1997; Hammel et al., 2002; Hofrichter, 2002). Adaptation of lignocellulose pre-treatment to include these enzymes shows promise but the process is currently too slow to be a competitive alternative (Chaturvedi & Verma, 2013). Wood-feeding insects are also being investigated for potential lignolytic enzymes, with termites and long-horned beetles showing evidence of degraded lignin in their frass (Geib et al., 2011). The digestive process of these organisms takes hours (Geib et al., 2011) which means that the enzymes at work could potentially be faster acting

than those found in white-rot fungi which take weeks to degrade lignin (Filley et al., 2000).

However, the termite gut is a complex system, which includes symbiotic microorganisms, and there has been limited progress in unraveling the genes and organisms responsible for the expression or production of lignolytic enzymes. A study by Sethi et al. (2012) identified 300 candidate transcripts from the host-symbiont „digestome‟ that could be involved in lignin degradation indicating that extensive research is still needed to narrow down individual enzymes or enzyme combinations that could be the most useful for lignocellulose pre-treatment.

In this study we examine a novel laccase and assess its potential to degrade wood. This putative laccase is present in the venom of giant parasitoid wasps in the genus Megarhyssa which spend their immature life stage feeding off the body of their hosts, the larvae of siricid wood wasps (Hymenoptera: Siricidae), deep inside the trunks of trees. In order to parasitize larval

Siricidae, female Megarhyssa must penetrate wood using an egg-laying appendage (ovipositor), which is as fine as a horse hair and up to ten centimeters in length (Heatwole & Davis, 1965).

Nénon et al. (1997) conducted an in depth study of the morphology of the ovipositor of

Megarhyssa atrata revealing the presence of secretory pores at the distal end. They hypothesized that secretions produced in the abdomen flow out through these pores and have a lytic effect on wood. Though it dates back to the late 1990s, this hypothesis has yet to be tested. Here, we investigate the laccase present in the venom of two species of this genus commonly found in

Kentucky, Megarhyssa macrurus and Megarhyssa greenei, to assess whether this enzyme has lignin-degrading potential.

Materials and Methods cDNA Synthesis: Reverse transcriptase PCR was conducted to synthesize cDNA from M. greenei

RNA isolated previously (see Chapter 2). Two hundred units of Maloney Murine Leukaemia

Virus Reverse Transcriptase (Invitrogen) (200 U/uL) and 1 μg of oligo-dT 18mer primers were used in a total reaction volume of 20 μL with 4 μL of first strand buffer, 1 μL of 10 mM dNTP

TM mix, 1 uL RNaseOUT (Invitrogen) and 1-5 μL of template RNA with the remaining volume made up with nuclease free water (Qiagen). Reactions were incubated at 65 °C for 5 minutes and then placed on ice for 2 minutes. Reverse transcription then took place at 37 °C for 50 minutes followed by 70 °C for 15 minutes. Reactions were then diluted 1:4 with nuclease free water

(Qiagen) and stored at -20 °C for later use.

Confirmative RT-PCR: Primers were designed using Primer3 (v. 0.4.0, Koressaar & Remm,

2007; Untergrasser et al., 2012) to amplify 500-700 bp fragments of the putative venom laccase from the M. greenei transcriptome database. PCR amplifications of these regions were performed using Takara reagents in a total reaction volume of 12.5 μL consisting of 1X buffer, 0.3 mM dNTPs, 0.4 μM of forward and reverse primers and 0.625 U of Takara Ex Taq Polymerase, ddH₂O and 1μL template cDNA. The thermal cycler protocol included an initial denaturation for

1 minute at 95 °C. Each of the 40 cycles began with an additional denaturation period of 1 minute at 95 °C followed by annealing for 1 minute at a temperature that varied between 50 and 60 °C according to the primers used, followed by extension, carried out at 72 °C for 1 minute. A final extension period of 5 minutes at 72 °C concluded the reactions. Gel electrophoresis was used to determine the success of the PCR, using 4 μL of PCR product on a 2.5 % agarose gel stained with ethidium bromide. PCR products deemed successful were sent to Beckman Coulter Genomics

(Danvers, MA) for Sanger sequencing.

Sequence Analysis

Taxon Selection: The amino acid sequence of the putative laccase from the M. greenei transcriptome database was used to query NCBI‟s protein database using the BLASTp algorithm.

The sequences of the top hundred hits were downloaded and used to create a neighbor-joining tree from which redundant sequences could be eliminated, resulting in a reduction of the data set to 40 taxa that represented all the major clades from the neighbor-joining tree. Five more

sequences were then added: laccase 3 from Anopheles gambiae, (GenBank accession No.

ABQ95972), laccase 2 from Nephotettix cincticeps (GenBank accession No. BAJ06133), laccase from Pimpla hypochondriaca (GenBank accession No. CAD20461, laccase 12 from

Reticulitermes flavipes (GenBank accession No. ACX54560) and a laccase-like precursor from

Nasonia vitripennis (GenBank accession No. NP_001155159). These additional five sequences are the result of detailed proteomic analyses and can be associated with possible functions, providing greater scope for a discussion of the predicted function of the putative venom laccase found in M. greenei.

Alignment: The GUIDANCE2 server (Landan & Graur, 2008; Penn et al., 2010; Sela et al., 2015) was used with default settings to align the sequences of the 45 taxa, and the columns with a confidence score below 0.93 were removed. The alignment was then examined and adjusted by eye using BioEdit (Hall, 1999).

Evolutionary Model Assignment: The alignment was then submitted to the ProtTest server

(Abascal, 2005) to identify the evolutionary models with the lowest Akaike Information Criterion

(AIC, Akaike, 1973) and the lowest Bayesian Information Criterion (BIC, Schwarz, 1978) values.

In both instances the model, LG, has the lowest score. However, LG cannot be implemented in

MrBayes (v. 3.1.2, Huelsenbeck & Ronquist, 2001; Ronquist & Huelsenbeck, 2003) and therefore we used the model with the next lowest value which was WAG in both instances.

Tree Building: Aligned sequences were then subjected to Bayesian inference (BI) phylogenetic analysis with MrBayes (v. 3.1.2, Huelsenbeck & Ronquist, 2001; Ronquist & Huelsenbeck, 2003) incorporating the selected evolutionary model. Two independent searches of the BI analysis with four search chains were run for 10 million generations, sampling trees every 100 generations with default settings. The analysis reached an average standard deviation of split frequencies of less than 0.02 after 6,100,000 generations and the tree of highest posterior probability (= maximum a posteriori or MAP tree) was calculated from the 39,000 post-burn-in trees.

Recombinant Laccase Production: Recombinant Megarhyssa laccase was produced by GenScript using their BacuVanceTM Baculovirus Expression System. Briefly, the gene, with a His-tag incorporated into its sequence, was synthesized and subcloned into an expression vector.

Recombinant Bacmid DNA was then used in the transfection of insect cells and P1 and P2 virus stocks were generated. The P2 stock was used to infect insect cells and the expressed protein was purified using 1-step affinity purification producing 0.1 mg/mL protein in a volume of 750 μL

Tris buffer. The presence of the purified protein was confirmed by SDS-PAGE and Western Blot analyses (Fig. 3).

Assessment of recombinant laccase activity: Enzyme activity was tested against the following substrates: hydroquinone, pyrogallol, pyrocatechol, NADA and 2,6-Dimethoxyphenol. Assays were carried out in B&R buffer [0.1 M each of boric acid, o-phosphoric acid, and acetic acid in water, pH 7 (Britton and Robinson, 1931)] containing 66 mM H2O2, 5μL of enzyme preparation

(either recombinant Megarhyssa laccase or horseradish peroxidase) containing 500 ng protein, and 2 mM substrate in a total reaction volume of 250 μL. Reactions took place over four hours and absorbance across a full spectrum was then measured. All substrates were prepared immediately before use and solubilized in 100% ethanol. For the background control, substrate was replaced with an equal volume of ethanol and enzyme was replaced with an equal volume of

Tris buffer. For the substrate control, enzyme was replaced with an equal volume of Tris buffer.

Additional assays were conducted with pyrogallol only. Reactions were conducted as above but run in triplicate.

Results

Laccase sequence investigation

The sequence of the laccase identified in the venom of Megarhyssa was confirmed by RT-PCR and is illustrated in Figure 1. The open reading frame is 2457 bp encoding a putative 819 amino

acid protein with a predicted molecular weight of 93.3 kDa and isoelectric point of 6.0 pH

(calculated by Expasy Bioinformatics Resource Portal, SIB Swiss Institute of Bioinformatics,

Artimo, 2012). It possesses 10 histidine residues and one cysteine residue that bind copper ions and are diagnostic of multicopper oxidases. In addition, one methionine residue is located in the

T1 copper center which is only found in insect laccases (Dittmer & Kanost, 2010) and the NCBI

Conserved Domain Database predicts that it contains the first, second and third cupredoxin domains common to insect laccases. Glycosylation sites were predicted using NetNGlyc (Gupta et al., 2004) and NetOGlyc (Steentoft et al., 2013) (http://www.cbs.dtu.dk/services) and eight N- linked and 12 O-linked glycosylation sites were found. Though glycosylation is one of the most common forms of post-translational modification, little is known about its function in laccases but it is likely that it influences the activity of both native and recombinant enzymes (Rodgers et al.,

2010).

Phylogenetic analysis

The results of the phylogenetic analysis of arthropod laccases indicate that the putative laccase of

Megarhyssa is most similar to the predicted laccase of Orussus albietinus (Fig. 2). This is contrary to the established phylogenetic hypothesis of the Hymenoptera, which places orussid wasps nearer to the base of the tree far from the evolutionarily more derived Ichneumonoidea that includes Megarhyssa. Unfortunately, most of the sequences that are highly similar to the laccase of Megarhyssa have not been functionally characterized and remain simply „predicted‟ or

„putative‟ laccases.

Recombinant laccase activity assays

Activity of the recombinant laccase was assessed using five substrates. Only one, pyrogallol, showed evidence of product (Fig.4). However, this product is due to the auto-oxidation of the substrate as evidenced by its presence in the substrate only control treatment. In fact, the treatment containing the Megarhyssa venom laccase had less product and this difference was consistent across all three replicates.

Discussion

In this study we investigated the laccase found in the venom of parasitoid wasps in the genus

Megarhyssa. The sequence of the ~2.4 kb gene was confirmed by reverse transcriptase PCR and predicted to encode a 93.3 kDa protein. Phylogenetic analyses indicate that this protein is similar to a predicted laccase from the genome of the orussid woodwasp, O. albietinus. However, assays of the recombinant laccase produced using a baculovirus-insect cell expression system could not confirm enzyme activity.

First described by Yoshida in 1883, laccases are copper-containing enzymes found in bacteria, fungi, plants and animals that catalyze the oxidation of a wide variety of substrates.

They are implicated in processes such as lignin synthesis and degradation, iron homeostasis, morphogenesis and cuticle tanning (Dittmer & Kanost, 2010). Most research into insect laccases has focused on their role in cuticle tanning, however laccase-like activity is also found in a number of other tissues; namely the mosquito midgut (Sidjanski et al., 1997), the guts of termites

(Coy et al., 2010), the salivary glands of leafhoppers (Hattori et al., 2005), and the venom of the parasitoid wasps, Pimpla hypochondriaca (Parkinson et al., 2001, 2003; Parkinson & Weaver,

1999) and Nasonia vitripennis (de Graaf et al., 2010).

Unfortunately, the majority of the sequences that show significant similarity to

Megarhyssa’s venom laccase are functionally uncharacterized. Therefore, all we can conclude from the results of our phylogenetic analysis is that the laccase in the venom of Megarhyssa appears to be very different from those known to be involved in insect cuticle tanning (Arakane et al., 2005; Dittmer et al., 2004) and also from laccases found in the mosquito and termite guts which may play a role in metal metabolism (Sidjanski et al., 1997) and lignocellulose degradation

(Coy et al., 2010) respectively. Perhaps most interesting is that the laccase found in the venom of

Megarhyssa shows very little similarity to the venom laccases of the parasitoid wasps, Nasonia vitripennis and Pimpla hypochondriaca, neither of which bore into wood, and to which

Megarhyssa is phylogenetically closely related; the latter is in the same family. The placement of Megarhyssa‟s venom laccase indicates that it is most similar to a predicted laccase found in the primitive parasitoid wasp, Orussus albietinus. Originally placed among Siricoidea (Rohwer,

1912; Bischoff, 1926; Ross, 1937; Benson, 1938; Cooper, 1953), it is now widely accepted that

Orussoidea are the sister group to Apocrita (Quicke, 1997; Sharkey et al., 2011). Like

Megarhyssa, many wasps in the family Orussidae are also ectoparasitoids of insect larvae that develop inside tree trunks (Nutall, 1980; Rawlings, 1957), necessitating the placement of eggs deep in wood (Cooper, 1953). Orussid wasps also have disproportionately long ovipositors which, when at rest, are concealed and looped inside the body, extending through the abdomen and thorax (Cooper, 1953; Rohwer & Cushman, 1917; Vilhelmsen et al., 2001).

Figure 5 illustrates the similarity in morphology between the ovipositors of M. macrurus and Orussus japonica in contrast with that of the Tremex columba which is known to mechanically drill into wood, producing sawdust (Escherich, 1942). Both M. macrurus and O. japonica have smooth ovipositors that lack cutting teeth. In contrast, the ovipositor of the siricid wasp is much shorter and has rows of sharp, deep, cutting teeth. Though it is difficult to draw any conclusions from a comparison of two putative enzymes, we believe it may be possible that M. macrurus and O. japonica both produce laccases which could be secreted to facilitate the penetration of wood.

Assays conducted using a variety of substrates could not confirm enzymatic activity of the recombinant Megarhyssa venom laccase and even showed evidence of anti-oxidant activity in the case of pyrogallol (Fig. 4). This lack of activity may be due to the way in which the recombinant protein was produced. For example, the use of a His-tag can have negative effects on protein folding and, in turn, its activity. In addition, the buffer in which it is stored could inhibit activity and simply storage itself could reduce activity. Future work using an alternative tag or exchanging the buffer through dialysis could lead to more fruitful results.

Summary

This study characterizes the putative laccase in the venom of Megarhyssa. Given its placement in the phylogeny produced from insect laccases we conclude that it is most similar to the predicted laccase of O. albietinus. We hypothesize that these laccases may be secreted by the long, gracile ovipositors of these wasps to aid in the penetration of depths of wood disproportionate to their body size. Enzyme assays could not detect activity of the recombinant laccase and further work is needed to confirm our hypothesis.

Acknowledgements

A special thanks goes to Fan Huang for her help with the enzyme activity assays. Her knowledge and expertise were crucial to the success of these experiments. The authors would like to thank

Dr Carol Beach and Dr Jing Chen at the University of Kentucky Proteomics Core Facility and the team at the University of Kentucky Advanced Genetic Technologies Center for their contributions to the acquisition of the data presented in this manuscript. We also gratefully acknowledge the help and support of Dr Seth DeBolt, Dr Randal Voss, Dr Srikrishna Putta, Dr

Arthur Hunt, Dr Eric Chapman and Dr Erika Tucker. This study was supported in part by a grant from the Kentucky Science and Engineering Foundation as per grant agreement #KSEF-3128-

RDE-017 with the Kentucky Science and Technology Corporation. Additional funding for this research was provided by the Karri Casner Environmental Sciences Fellowship awarded to VGP.

This work is supported by the National Institute of Food and Agriculture, U.S. Department of

Agriculture, Hatch under KY008041 and KY008065 awarded to MJS.

Figure 5.1. cDNA sequence and amino acid translation of the open reading frame of the putative laccase identified in the venom of Megarhyssa. The numbers on the right indicate the position of the last nucleotide or amino acid residue on each line. The putative signal peptide is indicated by those residues that are underlined at the beginning of the sequence. The residues below the numbers 1, 2, and 3 are involved in co-ordinating the T1, T2 and T3 copper centers respectively.

The boxes indicate the N glycosylation sites and the O-glycosylation sites are denoted by emboldened and underlined residues.

Figure 5.2. Maximum a-posteriori tree resulting from a Bayesian analysis. The putative laccase from the venom of Megarhyssa is shaded in grey.

The higher classification of each taxon is indicated on the right. The level of classification is dependent on the degree of relatedness to

Megarhyssa. The subphylum is provided if the taxon is outside of Insecta; the order is provided if the taxon is within Insecta, and the family is

provided if the taxon is within Hymenoptera. The emboldened, capitalized letters following a taxon name show that these laccases are functionally

characterized or have a predicted function and indicate the location in which these laccases are found (C = cuticle, V = venom reservoir, G = gut).

A B

Figure 5.3 Analysis to show presence of purified protein. A. SDS-PAGE analysis (Lane 1: BSA

(2 μg); Lane 2: Recombinant laccase (2 μg)). B. Western Blot analysis using Anti-His antibody

(Lane 3: Recombinant laccase).

Figure 5.4. Absorbance across the full spectrum for all treatments. The peak around 270 nm indicates the presence of substrate and is only evident in the substrate control and Megarhyssa laccase treatments. The peak around 330nm indicates the presence of product. High levels of absorbance at lower wavelengths are present in the background control and do not indicate the presence of either substrate or product.

Figure 5.5. Ovipositor tips from M. macrurus (A), Orussus japonicus (B) and Tremex columba(C).

Chapter 6: Summary and Future Directions

Parasitoid wasps are hyperdiverse in form and function. It is estimated that they constitute up to 20% of all known insect species but due to the taxonomic impediment, most of them are likely to remain undescribed. However, technological advances are increasing the rate at which new species can be discovered and improving our ability to understand their biology. In this dissertation, I take advantage of these technologies to identify new molecular markers for use in parasitoid species delimitation and to examine parasitoid venom constituents. The results of these studies will aid taxonomic revisionary research and contribute to the growing body of work indicating that parasitoid venoms represent outstanding natural resources.

In Chapter Two, an additional molecular marker is identified for species delimitation in the genus Hyposoter. It is a region of a polydnavirus (PDV) gene that is involved in parasitism and may therefore be under high selective pressure. The results demonstrate that the gene is conserved within species and variable among species, much like the barcode region of COI.

However, the extent of the variation among species is not entirely consistent with that of COI and in two of species we examined, the PDV gene showed much greater variation, highlighting its utility as an additional molecular marker in this genus. PDVs occur in tens of thousands of ichneumonoid wasp species and future work investigating PDV genes as diagnostic characters could substantially improve the accuracy of taxonomic work in this group which is notoriously difficult to identify morphologically.

The key to the species of Megarhyssa in America, north of Mexico presented in Chapter

Three provides an accessible identification guide to these four species for use by the non- specialist. Specimens of Megarhyssa are a common sight in the forests of North America and are often collected by hobbyists and enthusiasts of the natural world. In addition, these wasps can be employed as biological control agents. By linking to websites such as BugGuide and the

American Entomological Institute, this key will be accessible to a wide range of users, improving

the accuracy of identifications. The genus Megarhyssa is found worldwide and further work could include the construction of species keys for other geographic regions.

Chapter Four details the investigation of the venom of the genus Megarhyssa. A range of different proteins are identified and possible functions relating to parasitism are assigned to them.

Their potential utility in industry is also discussed and future work involving the expression of recombinant proteins could confirm these predictions. This is the first study looking into the venom of an ectoparasitic idiobiont ichneumonoid and therefore many of the sequences discovered are different from those known from other parasitoid Hymenoptera and could represent novel molecular entities of scientific interest.

The attempted characterization of the putative laccase present in the venom of

Megarhyssa is presented in Chapter Five. Conserved protein domains and glycosylation sites are identified and indicate that it possesses the characters that are common to insect laccases. A phylogenetic analysis shows that the sequence is similar to a predicted laccase found in an orussid woodwasp and that it is different from the sequences of laccases found in other parasitoid wasp venoms. However, assays could not detect enzymatic activity and further research is needed to assess its activity.

In summary, this dissertation provides new insights into the identification of ichneumonid parasitoid wasps and the composition of their venom. State-of-the-art technologies were employed to conduct this research and the results indicate that technological advances will prove highly beneficial to the continuing progress of this field.

Appendices

Appendix I. Specimen-associated information including host records and DNA sequence accession numbers.

(Supplementary Appendix I: Tables 2.A.1 – 2.A.4, Chapter 2).

Table 2.A.1

COI-5P Cys-d9.2 Rep-c18.2 Cys-d9.1 COI GenBank Host Re-extracted COI-5P Seq. COI-5P # Trace Image Barcode GenBank GenBank GenBank Sample ID Process ID Accession Accession BIN AEI Length Ambiguities Count Count Compliant Accession Accession Accession

04-SRNP- DHJPAR0014269 AICC275-06 KJ768377 33997 BOLD:AAB3981 623 0 3 0 Yes KJ852681 KJ852660 05-SRNP- DHJPAR0014270 AICC276-06 KJ768369 30626 BOLD:AAB3981 554 2 3 0 Yes KJ852682 KJ852661 KJ851723 04-SRNP- DHJPAR0014271 AICC277-06 KJ768392 55653 BOLD:AAB3981 626 0 3 0 Yes KJ852688 KJ852667

83 04-SRNP- DHJPAR0014272 AICC278-06 KJ768354 61476 BOLD:AAB3981 630 0 3 0 Yes KJ852680 KJ852659

04-SRNP- DHJPAR0014273 AICC274-06 KJ768378 30129 BOLD:AAB3981 622 0 3 0 Yes KJ852679 KJ852658 04-SRNP- DHJPAR0014274 AICC273-06 KJ768385 30504 BOLD:AAB3981 622 0 3 0 Yes KJ852678 KJ852657 03-SRNP- DHJPAR0014275 AICC272-06 KJ768358 37094 BOLD:AAB3981 629 0 3 0 Yes KJ852687 KJ852666 03-SRNP- DHJPAR0014276 AICC279-06 KJ768350 37262 BOLD:AAB3981 657 0 5 0 Yes KJ852686 KJ852665 03-SRNP- DHJPAR0014277 AICC280-06 KJ768399 37255 BOLD:AAB3981 572 2 3 0 Yes KJ852685 KJ852664 04-SRNP- DHJPAR0014278 AICC281-06 KJ768371 35341 BOLD:AAB3981 419 0 2 0 No KJ852684 KJ852663 04-SRNP- DHJPAR0014279 AICC282-06 KJ768355 35342 BOLD:AAB3981 388 1 1 0 No KJ852683 KJ852662 03-SRNP- DHJPAR0014283 AICC286-06 KJ768347 37253 BOLD:AAB3981 622 0 3 0 Yes KJ852700 KJ852677 03-SRNP- DHJPAR0014284 AICC287-06 KJ768348 37095 BOLD:AAB3981 622 0 3 0 Yes KJ852699 KJ852676 06-SRNP- DHJPAR0014875 AICC878-06 KJ768400 20214 BOLD:AAB3981 657 0 2 0 Yes KJ852698 KJ852675 06-SRNP- DHJPAR0016380 ASTAP409-06 KJ768340 33334 BOLD:AAB3981 657 0 2 0 Yes KJ852697 KJ852674 06-SRNP- DHJPAR0016961 AICH866-07 KJ768360 65018 BOLD:AAB3981 657 0 2 0 Yes KJ852696 KJ852673 07-SRNP- DHJPAR0017015 AICH920-07 KJ768382 30350 BOLD:AAB3981 657 0 2 0 Yes KJ852695 KJ852672 07-SRNP- DHJPAR0019889 HCWC812-07 KJ768402 32214 BOLD:AAB3981 616 0 2 0 Yes KJ852694

Table 2.A.1 continued

06-SRNP- DHJPAR0021393 ASID118-07 KJ768387 36134 BOLD:AAB3981 657 0 2 0 Yes KJ852693 KJ852670 06-SRNP- DHJPAR0021511 ASID236-07 KJ768386 36133 BOLD:AAB3981 AEI 621 1 1 0 No KJ852692 08-SRNP- DHJPAR0023447 ASHYM199-08 KJ768374 20540 BOLD:AAB3981 657 0 2 0 Yes KJ852691 KJ852669 ASHYB1057- 08-SRNP- DHJPAR0030313 09 KJ768388 32483 BOLD:AAB3982 644 1 4 0 Yes KJ852690 KJ852668 ASHYB1413- 08-SRNP- DHJPAR0030673 09 KJ768395 37569 BOLD:AAB3981 AEI 657 0 2 0 Yes KJ852689 06-SRNP- DHJPAR0021606 ASID331-07 KJ768361 48100 BOLD:AAA4761 AEI 657 0 2 0 Yes KJ852701 06-SRNP- DHJPAR0021414 ASID139-07 KJ768390 36786 BOLD:AAA1638 AEI 657 0 2 0 Yes KJ852706 07-SRNP- DHJPAR0021447 ASID172-07 KJ768368 20461 BOLD:AAA1638 AEI 623 1 1 0 No KJ852705 07-SRNP- DHJPAR0021456 ASID181-07 KJ768389 22370 BOLD:AAA1638 AEI 622 2 1 0 No KJ852704 06-SRNP- DHJPAR0021473 ASID198-07 KJ768352 36315 BOLD:AAA1638 AEI 623 1 1 0 No KJ852703 06-SRNP- DHJPAR0021605 ASID330-07 KJ768370 36850 BOLD:AAA1638 AEI 645 0 2 0 Yes KJ852702 04-SRNP- DHJPAR0014103 AICC106-06 KJ768383 22840 BOLD:AAA5925 657 0 2 0 Yes KJ852708 03-SRNP- DHJPAR0014109 AICC112-06 KJ768345 21231 BOLD:AAA5925 657 0 2 0 Yes KJ852707 84 03-SRNP- DHJPAR0014110 AICC113-06 KJ768356 20883 BOLD:AAA5925 657 0 2 0 Yes KJ852737

02-SRNP- DHJPAR0014128 AICC131-06 KJ768339 32471 BOLD:AAA5925 657 0 2 0 Yes KJ852709 05-SRNP- DHJPAR0014162 AICC165-06 KJ768397 30440 BOLD:AAA5925 657 0 2 0 Yes KJ852736 05-SRNP- DHJPAR0014163 AICC166-06 KJ768357 30691 BOLD:AAA5925 657 0 2 0 Yes KJ852735 07-SRNP- DHJPAR0017245 HCWC750-07 KJ768373 31410 BOLD:AAA5925 657 0 2 0 Yes KJ852734 KJ852671 06-SRNP- DHJPAR0021387 ASID112-07 KJ768343 35899 BOLD:AAA5925 657 0 2 0 Yes KJ852733 06-SRNP- DHJPAR0021398 ASID123-07 KJ768379 46831 BOLD:AAA5925 657 0 2 0 Yes KJ852732 06-SRNP- DHJPAR0021412 ASID137-07 KJ768403 47466 BOLD:AAA5925 634 0 2 0 Yes KJ852731 07-SRNP- DHJPAR0023365 ASHYM117-08 KJ768363 60778 BOLD:AAA5925 631 0 2 0 Yes KJ852730 99-SRNP- DHJPAR0023748 ASHYM366-08 KJ768346 12733 BOLD:AAA5925 657 0 2 0 Yes KJ852729 98-SRNP- DHJPAR0023768 ASHYM386-08 KJ768380 15039 BOLD:AAA5925 631 0 2 0 Yes KJ852728 98-SRNP- DHJPAR0023769 ASHYM387-08 KJ768342 15033 BOLD:AAA5925 656 0 2 0 Yes KJ852727 03-SRNP- DHJPAR0024025 ASHYM453-08 KJ768353 20220 BOLD:AAA5925 656 0 2 0 Yes KJ852726 03-SRNP- DHJPAR0024059 ASHYM487-08 KJ768341 21195 BOLD:AAA5925 630 0 2 0 Yes KJ852725

Table 2.A.1 continued

05-SRNP- DHJPAR0024072 ASHYM500-08 KJ768372 32058 BOLD:AAA5925 657 0 2 0 Yes KJ852724 01-SRNP- DHJPAR0024085 ASHYM513-08 KJ768393 1275 BOLD:AAA5925 656 1 2 0 Yes KJ852723 02-SRNP- DHJPAR0024103 ASHYM531-08 KJ768375 29203 BOLD:AAA5925 619 1 2 0 Yes KJ852722 02-SRNP- DHJPAR0024105 ASHYM533-08 KJ768362 17498 BOLD:AAA5925 621 0 2 0 Yes KJ852721 02-SRNP- DHJPAR0024148 ASHYM575-08 KJ768384 28593 BOLD:AAA5925 657 0 2 0 Yes KJ852720 01-SRNP- DHJPAR0024153 ASHYM580-08 KJ768396 1276 BOLD:AAA5925 596 0 2 0 Yes KJ852719

DHJPAR0024154 ASHYM581-08 KJ768401 01-SRNP-263 BOLD:AAA5925 602 0 2 0 Yes KJ852718 00-SRNP- DHJPAR0024155 ASHYM582-08 KJ768366 2527 BOLD:AAA5925 551 0 2 0 Yes KJ852717 01-SRNP- DHJPAR0024176 ASHYM603-08 KJ768365 1277 BOLD:AAA5925 657 0 2 0 Yes KJ852716 92-SRNP- DHJPAR0024199 ASHYM626-08 KJ768391 4289 BOLD:AAA5925 348 0 1 0 No KJ852715 08-SRNP- DHJPAR0027723 AICC1033-08 KJ768376 65119 BOLD:AAA5925 657 0 0 0 No KJ852714 08-SRNP- DHJPAR0027726 AICC1036-08 KJ768364 65227 BOLD:AAA5925 657 0 0 0 No KJ852713 06-SRNP- DHJPAR0028514 ASHYF276-09 KJ768394 30541 BOLD:AAA5925 426 0 2 0 No KJ852712 85 ASHYB1089- 08-SRNP- DHJPAR0030345 09 KJ768367 32440 BOLD:AAA5925 658 0 2 0 Yes KJ852711

ASHYB1412- 08-SRNP- DHJPAR0030672 09 KJ768349 37506 BOLD:AAA5925 657 0 2 0 Yes KJ852710 07-SRNP- DHJPAR0021427 ASID152-07 KJ768351 20060 BOLD:ABZ2679 AEI 622 1 1 0 No KJ852738 06-SRNP- DHJPAR0021413 ASID138-07 KJ768398 55368 BOLD:AAA2292 AEI 657 0 2 0 Yes KJ852739 05-SRNP- DHJPAR0028231 ASHYE468-08 KJ768359 63998 BOLD:AAA9489 AEI 657 0 2 0 Yes KJ852740 06-SRNP- DHJPAR0028503 ASHYF265-09 KJ768381 45012 AEI 426 0 2 0 No KJ852741 06-SRNP- DHJPAR0021409 ASID134-07 KJ768344 35970 BOLD:AAA7553 AEI 657 0 2 0 Yes KJ852742

Table 2.A.2

Sample ID Phylum Class Order Family Subfamily Genus Species Identifier Identifier email Daniel H. DHJPAR0014269 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter Hyposoter INB-12 Janzen [email protected] Daniel H. DHJPAR0014270 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter Hyposoter INB-12 Janzen [email protected] Daniel H. DHJPAR0014271 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter Hyposoter INB-12 Janzen [email protected] Daniel H. DHJPAR0014272 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter Hyposoter INB-12 Janzen [email protected]

Table 2.A.2 continued

Daniel H. DHJPAR0014273 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter Hyposoter INB-12 Janzen [email protected] Daniel H. DHJPAR0014274 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter Hyposoter INB-12 Janzen [email protected] Daniel H. DHJPAR0014275 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter Hyposoter INB-12 Janzen [email protected] Daniel H. DHJPAR0014276 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter Hyposoter INB-12 Janzen [email protected] Daniel H. DHJPAR0014277 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter Hyposoter INB-12 Janzen [email protected] Daniel H. DHJPAR0014278 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter Hyposoter INB-12 Janzen [email protected] Daniel H. DHJPAR0014279 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter Hyposoter INB-12 Janzen [email protected] Daniel H. DHJPAR0014283 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter Hyposoter INB-12 Janzen [email protected] Daniel H. DHJPAR0014284 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter Hyposoter INB-12 Janzen [email protected] Daniel H. DHJPAR0014875 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter Hyposoter INB-12 Janzen [email protected] Daniel H. DHJPAR0016380 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter Hyposoter INB-12 Janzen [email protected] Daniel H. DHJPAR0016961 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter Hyposoter INB-12 Janzen [email protected] Daniel H. DHJPAR0017015 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter Hyposoter INB-12 Janzen [email protected] 86 Daniel H. DHJPAR0019889 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter Hyposoter INB-12 Janzen [email protected]

Daniel H. DHJPAR0021393 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter Hyposoter INB-12 Janzen [email protected] Daniel H. DHJPAR0021511 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter Hyposoter INB-12 Janzen [email protected] Daniel H. DHJPAR0023447 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter Hyposoter INB-12 Janzen [email protected] Daniel H. DHJPAR0030313 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter Hyposoter INB-12 Janzen [email protected] Daniel H. DHJPAR0030673 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter Hyposoter INB-12 Janzen [email protected] Hyposoter INB- Daniel H. DHJPAR0021606 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter 42DHJ01 Janzen [email protected] Hyposoter INB- Daniel H. DHJPAR0021414 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter 42DHJ02 Janzen [email protected] Hyposoter INB- Daniel H. DHJPAR0021447 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter 42DHJ02 Janzen [email protected] Hyposoter INB- Daniel H. DHJPAR0021456 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter 42DHJ02 Janzen [email protected] Hyposoter INB- Daniel H. DHJPAR0021473 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter 42DHJ02 Janzen [email protected] Hyposoter INB- Daniel H. DHJPAR0021605 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter 42DHJ02 Janzen [email protected] Hyposoter INB- Daniel H. DHJPAR0014103 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter 42DHJ04 Janzen [email protected] Hyposoter INB- Daniel H. DHJPAR0014109 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter 42DHJ04 Janzen [email protected]

Table 2.A.2 continued

Hyposoter INB- Daniel H. DHJPAR0014110 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter 42DHJ04 Janzen [email protected] Hyposoter INB- Daniel H. DHJPAR0014128 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter 42DHJ04 Janzen [email protected] Hyposoter INB- Daniel H. DHJPAR0014162 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter 42DHJ04 Janzen [email protected] Hyposoter INB- Daniel H. DHJPAR0014163 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter 42DHJ04 Janzen [email protected] Hyposoter INB- Daniel H. DHJPAR0017245 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter 42DHJ04 Janzen [email protected] Hyposoter INB- Daniel H. DHJPAR0021387 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter 42DHJ04 Janzen [email protected] Hyposoter INB- Daniel H. DHJPAR0021398 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter 42DHJ04 Janzen [email protected] Hyposoter INB- Daniel H. DHJPAR0021412 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter 42DHJ04 Janzen [email protected] Hyposoter INB- Daniel H. DHJPAR0023365 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter 42DHJ04 Janzen [email protected] Hyposoter INB- Daniel H. DHJPAR0023748 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter 42DHJ04 Janzen [email protected] Hyposoter INB- Daniel H. DHJPAR0023768 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter 42DHJ04 Janzen [email protected] Hyposoter INB- Daniel H. DHJPAR0023769 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter 42DHJ04 Janzen [email protected] Hyposoter INB- Daniel H. DHJPAR0024025 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter 42DHJ04 Janzen [email protected] 87 Hyposoter INB- Daniel H. DHJPAR0024059 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter 42DHJ04 Janzen [email protected]

Hyposoter INB- Daniel H. DHJPAR0024072 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter 42DHJ04 Janzen [email protected] Hyposoter INB- Daniel H. DHJPAR0024085 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter 42DHJ04 Janzen [email protected] Hyposoter INB- Daniel H. DHJPAR0024103 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter 42DHJ04 Janzen [email protected] Hyposoter INB- Daniel H. DHJPAR0024105 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter 42DHJ04 Janzen [email protected] Hyposoter INB- Daniel H. DHJPAR0024148 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter 42DHJ04 Janzen [email protected] Hyposoter INB- Daniel H. DHJPAR0024153 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter 42DHJ04 Janzen [email protected] Hyposoter INB- Daniel H. DHJPAR0024154 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter 42DHJ04 Janzen [email protected] Hyposoter INB- Daniel H. DHJPAR0024155 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter 42DHJ04 Janzen [email protected] Hyposoter INB- Daniel H. DHJPAR0024176 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter 42DHJ04 Janzen [email protected] Hyposoter INB- Daniel H. DHJPAR0024199 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter 42DHJ04 Janzen [email protected] Hyposoter INB- Daniel H. DHJPAR0027723 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter 42DHJ04 Janzen [email protected] Hyposoter INB- Daniel H. DHJPAR0027726 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter 42DHJ04 Janzen [email protected] Hyposoter INB- Daniel H. DHJPAR0028514 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter 42DHJ04 Janzen [email protected]

Table 2.A.2 continued

Hyposoter INB- Daniel H. DHJPAR0030345 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter 42DHJ04 Janzen [email protected] Hyposoter INB- Daniel H. DHJPAR0030672 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter 42DHJ04 Janzen [email protected] Hyposoter INB- Daniel H. DHJPAR0021427 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter 42DHJ05 Janzen [email protected] Hyposoter INB- Daniel H. DHJPAR0021413 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter 42DHJ06 Janzen [email protected] Hyposoter INB- Daniel H. DHJPAR0028231 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter 42DHJ07 Janzen [email protected] Hyposoter INB- Daniel H. DHJPAR0028503 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter 42DHJ07 Janzen [email protected] Daniel H. DHJPAR0021409 Arthropoda Insecta Hymenoptera Ichneumonidae Campopleginae Hyposoter Hyposoter PRO-7 Janzen [email protected]

Table 2.A.3

Sample ID Reproduction Life Stage Extra Info Notes

DHJPAR0014269 S A Carystoides Burns01 Hesperiidae, I.D.Gauld,Feb2005

DHJPAR0014270 S A Carystina aurifer Hesperiidae, I.D.Gauld,Jun2006

DHJPAR0014271 S A Carystoides Burns01 Hesperiidae, I.D.Gauld,Feb2005

DHJPAR0014272 S A Carystoides Burns01 Hesperiidae, I.D.Gauld,Sep2005

DHJPAR0014273 S A Dubiella belpa Hesperiidae, I.D.Gauld,Aug2004

DHJPAR0014274 S A Caligo eurilochus Nymphalidae, I.D.Gauld,Aug2004

DHJPAR0014275 S A Caligo eurilochus Nymphalidae, I.D.Gauld,Aug2004

DHJPAR0014276 S A Opsiphanes tamarindi Nymphalidae, I.D.Gauld,Aug2004

DHJPAR0014277 S A Opsiphanes tamarindi Nymphalidae, I.D.Gauld,Aug2004

DHJPAR0014278 S A Opsiphanes quiteria Nymphalidae, I.D.Gauld,Aug2004

DHJPAR0014279 S A Opsiphanes quiteria Nymphalidae, I.D.Gauld,Aug2004

DHJPAR0014283 S A Opsiphanes tamarindi Nymphalidae, I.D.Gauld,Aug2004

DHJPAR0014284 S A Caligo eurilochus Nymphalidae, I.D.Gauld,Aug2004

DHJPAR0014875 S A Opsiphanes bogotanus Nymphalidae, I.D.Gauld,Aug2006

DHJPAR0016380 S A Opsiphanes quiteria Nymphalidae, I.D.Gauld,Apr2008

DHJPAR0016961 S A Carystoides orbius Hesperiidae, I.D.Gauld,Apr2008

DHJPAR0017015 S A Carystoides basoches Hesperiidae, I.D.Gauld,Apr2008

Table 2.A.3 continued

Carystoides see DHJPAR0019889 S A description Hesperiidae, I.D.Gauld,Apr2008

DHJPAR0021393 S A Opsiphanes quiteria Nymphalidae, D.H.Janzen,Mar2008

DHJPAR0021511 S A Opsiphanes quiteria Nymphalidae, D.H.Janzen,Mar2008

DHJPAR0023447 S A Caligo telamonius Nymphalidae, D.H.Janzen,Sep2008

DHJPAR0030313 S A Dubiella belpa Hesperiidae

DHJPAR0030673 S A Carystoides escalantei Hesperiidae

DHJPAR0021606 S A Nascus Burns02 Hesperiidae, D.H.Janzen,Nov2007

DHJPAR0021414 S A Astraptes HIHAMP Hesperiidae, D.H.Janzen,Nov2007

DHJPAR0021447 S A Astraptes INGCUP Hesperiidae, D.H.Janzen,Sep2008

DHJPAR0021456 S A Astraptes LOHAMP Hesperiidae, D.H.Janzen,Sep2008

DHJPAR0021473 S A Astraptes LOHAMP Hesperiidae, D.H.Janzen,Nov2007

DHJPAR0021605 S A Astraptes LOHAMP Hesperiidae, D.H.Janzen,Nov2007

DHJPAR0014103 S A Astraptes talus Hesperiidae, I.D.Gauld,Aug2004

DHJPAR0014109 S A Epargyreus Burns07 Hesperiidae, I.D.Gauld,Aug2004

DHJPAR0014110 S A Epargyreus Burns07 Hesperiidae, I.D.Gauld,Aug2004

DHJPAR0014128 S A Epargyreus Burns05 Hesperiidae, I.D.Gauld,Aug2004

DHJPAR0014162 S A Urbanus belliDHJ01 Hesperiidae, I.D.Gauld,Jun2006

DHJPAR0014163 S A Urbanus belliDHJ01 Hesperiidae, I.D.Gauld,Jun2006

DHJPAR0017245 S A Chioides catillus Hesperiidae, D.H.Janzen,Sep2008

DHJPAR0021387 S A Urbanus viterboana Hesperiidae, D.H.Janzen,Nov2007

DHJPAR0021398 S A Epargyreus Burns05 Hesperiidae, D.H.Janzen,Nov2007

DHJPAR0021412 S A Urbanus belli Hesperiidae, D.H.Janzen,Nov2007

DHJPAR0023365 S A Proteides mercurius Hesperiidae, Mariano Pereira,Dic2007

DHJPAR0023748 S A Urbanus pronta Hesperiidae, I.D.Gauld,May2000

DHJPAR0023768 S A Astraptes tucuti Hesperiidae, I.D.Gauld,Sep1999

DHJPAR0023769 S A Astraptes tucuti Hesperiidae, I.D.Gauld,Sep1999

DHJPAR0024025 S A Epargyreus Burns07 Hesperiidae, I.D.Gauld,Aug2004

Table 2.A.3 continued

DHJPAR0024059 S A Epargyreus Burns07 Hesperiidae, I.D.Gauld,Aug2004

DHJPAR0024072 S A Epargyreus Burns07 Hesperiidae, I.D.Gauld,Jun2006

DHJPAR0024085 S A Urbanus dorantes Hesperiidae, I.D.Gauld,Nov2002

DHJPAR0024103 S A Epargyreus Burns02 Hesperiidae, I.D.Gauld,Nov2002

DHJPAR0024105 S A Urbanus proteus Hesperiidae, I.D.Gauld,Nov2002

DHJPAR0024148 S A Spathilepia clonius Hesperiidae, I.D.Gauld,Nov2002

DHJPAR0024153 S A Urbanus dorantes Hesperiidae, I.D.Gauld,Nov2002

DHJPAR0024154 S A Epargyreus Burns02 Hesperiidae, I.D.Gauld,Nov2002

DHJPAR0024155 S A Nascus solon Hesperiidae, I.D.Gauld,Nov2002

DHJPAR0024176 S A Urbanus dorantes Hesperiidae, I.D.Gauld,Nov2002

DHJPAR0024199 S A Epargyreus Burns02 Hesperiidae, I.D.Gauld,Sep1994

DHJPAR0027723 S A Urbanus proteus Hesperiidae, D.H.Janzen,Oct2008

DHJPAR0027726 S A Urbanus proteus Hesperiidae, D.H.Janzen,Oct2008

DHJPAR0028514 S A Urbanus belli Hesperiidae

DHJPAR0030345 S A Epargyreus Burns07 Hesperiidae

DHJPAR0030672 S A Urbanus viterboana Hesperiidae

DHJPAR0021427 S A Astraptes anaphus annetta Hesperiidae, D.H.Janzen,Sep2008

DHJPAR0021413 S A Nascus paulliniae Hesperiidae, D.H.Janzen,Nov2007

DHJPAR0028231 S A Proteides mercurius Hesperiidae, D.H.Janzen,Sep2008

DHJPAR0028503 S A Phocides lilea Hesperiidae

DHJPAR0021409 S A Mylon lassia Hesperiidae, D.H.Janzen,Mar2008

Table 2.A.4

Country/ State/ Sample ID Collectors Collection Date Ocean Province Region Sector Exact Site Lat Lon Elev

Area de Conservacion DHJPAR0014269 Petrona Rios 15-Aug-04 Costa Rica Guanacaste Guanacaste Sector Pitilla Sendero Memos 10.982 -85.43 740 Area de Conservacion DHJPAR0014270 Petrona Rios 25-Mar-05 Costa Rica Guanacaste Guanacaste Sector Pitilla Sendero Orosilito 10.983 -85.44 900

Table 2.A.4 continued

Area de Conservacion DHJPAR0014271 Calixto Moraga 31-Oct-04 Costa Rica Guanacaste Guanacaste Sector Pitilla Sendero Naciente 10.987 -85.43 700 Area de Conservacion Sector San DHJPAR0014272 Elda Araya 6-Jan-05 Costa Rica Alajuela Guanacaste Cristobal Rio Blanco Abajo 10.9 -85.37 500 Area de Conservacion DHJPAR0014273 Petrona Rios 27-Feb-04 Costa Rica Guanacaste Guanacaste Sector Pitilla Sendero Bernales 10.984 -85.42 660 Area de Conservacion DHJPAR0014274 Calixto Moraga 29-Feb-04 Costa Rica Guanacaste Guanacaste Sector Pitilla Sendero Orosilito 10.983 -85.44 900 Area de Conservacion DHJPAR0014275 Petrona Rios 26-Dec-03 Costa Rica Guanacaste Guanacaste Sector Pitilla Sendero Memos 10.982 -85.43 740 Area de Conservacion DHJPAR0014276 Calixto Moraga 12-Jan-04 Costa Rica Guanacaste Guanacaste Sector Pitilla Estacion Pitilla 10.989 -85.43 675 Area de Conservacion DHJPAR0014277 Lucia Rios 12-Jan-04 Costa Rica Guanacaste Guanacaste Sector Pitilla Estacion Pitilla 10.989 -85.43 675 Area de Conservacion DHJPAR0014278 Harry Ramirez 6-May-04 Costa Rica Guanacaste Guanacaste Sector Cacao Estacion Cacao 10.927 -85.47 1150 Area de Conservacion DHJPAR0014279 Harry Ramirez 8-May-04 Costa Rica Guanacaste Guanacaste Sector Cacao Estacion Cacao 10.927 -85.47 1150 Area de Conservacion DHJPAR0014283 Lucia Rios 12-Jan-04 Costa Rica Guanacaste Guanacaste Sector Pitilla Estacion Pitilla 10.989 -85.43 675 Area de Conservacion DHJPAR0014284 Petrona Rios 26-Dec-03 Costa Rica Guanacaste Guanacaste Sector Pitilla Sendero Memos 10.982 -85.43 740 Area de Conservacion DHJPAR0014875 Lucia Rios 25-Jan-06 Costa Rica Guanacaste Guanacaste Sector Del Oro Canyon Rio Mena 10.996 -85.46 560 Area de Conservacion DHJPAR0016380 Petrona Rios 6-Sep-06 Costa Rica Guanacaste Guanacaste Sector Pitilla Sendero Naciente 10.987 -85.43 700 91 Area de Conservacion DHJPAR0016961 Calixto Moraga 23-Nov-06 Costa Rica Guanacaste Guanacaste Sector Pitilla Sendero Orosilito 10.983 -85.44 900

Area de Conservacion DHJPAR0017015 Calixto Moraga 18-Jan-07 Costa Rica Guanacaste Guanacaste Sector Pitilla Sendero Laguna 10.989 -85.42 680 Area de Conservacion DHJPAR0019889 Manuel Rios 21-May-07 Costa Rica Guanacaste Guanacaste Sector Pitilla Sendero Naciente 10.987 -85.43 700 Area de Conservacion Sendero DHJPAR0021393 Manuel Pereira 17-Oct-06 Costa Rica Guanacaste Guanacaste Sector Cacao Ponderosa 10.915 -85.46 1060 Area de Conservacion Sendero DHJPAR0021511 Manuel Pereira 1-Oct-06 Costa Rica Guanacaste Guanacaste Sector Cacao Ponderosa 10.915 -85.46 1060 Area de Conservacion DHJPAR0023447 Roster Moraga 20-Feb-08 Costa Rica Guanacaste Guanacaste Del Oro Quebrada Trigal 11.027 -85.5 290 Area de Conservacion DHJPAR0030313 Manuel Rios 24-Oct-08 Costa Rica Guanacaste Guanacaste Sector Pitilla Sendero Naciente 10.987 -85.43 700 Area de Conservacion DHJPAR0030673 Harry Ramirez 27-Dec-08 Costa Rica Guanacaste Guanacaste Sector Cacao Sendero Nayo 10.924 -85.47 1090 Area de Conservacion DHJPAR0021606 Manuel Pereira 19-Dec-06 Costa Rica Guanacaste Guanacaste Sector Cacao Puente Gongora 10.885 -85.47 540 Area de Conservacion DHJPAR0021414 Harry Ramirez 22-Dec-06 Costa Rica Guanacaste Guanacaste Sector Cacao Sendero Nayo 10.924 -85.47 1090 Area de Conservacion DHJPAR0021447 Lucia Rios 26-Feb-07 Costa Rica Guanacaste Guanacaste Sector Del Oro Bosque Aguirre 11.001 -85.44 620 Area de Conservacion DHJPAR0021456 Elieth Cantillano 30-Jul-07 Costa Rica Guanacaste Guanacaste Sector Del Oro Maderos 11.005 -85.48 510 Area de Conservacion DHJPAR0021473 Harry Ramirez 9-Nov-06 Costa Rica Guanacaste Guanacaste Sector Cacao Sendero Arenales 10.925 -85.47 1080 Area de Conservacion DHJPAR0021605 Dunia Garcia 30-Dec-06 Costa Rica Guanacaste Guanacaste Sector Cacao Sendero Arenales 10.925 -85.47 1080

Table 2.A.4 continued

Area de Conservacion DHJPAR0014103 Roster Moraga 4-Jul-04 Costa Rica Guanacaste Guanacaste Sector Del Oro Puente Mena 11.046 -85.46 280 Area de Conservacion DHJPAR0014109 Petrona Rios 25-Oct-03 Costa Rica Guanacaste Guanacaste Sector Pitilla Loaiciga 11.02 -85.41 445 Area de Conservacion DHJPAR0014110 Calixto Moraga 24-Sep-03 Costa Rica Guanacaste Guanacaste Sector Pitilla Loaiciga 11.02 -85.41 445 Area de Conservacion DHJPAR0014128 Guillermo Pereira 11-Nov-02 Costa Rica Guanacaste Guanacaste Sector Santa Rosa Quebrada Puercos 10.859 -85.57 155 Area de Conservacion DHJPAR0014162 Petrona Rios Costa Rica Guanacaste Guanacaste Sector Pitilla Ingas 11.003 -85.42 580 Area de Conservacion DHJPAR0014163 Calixto Moraga 8-Mar-05 Costa Rica Guanacaste Guanacaste Sector Pitilla Ingas 11.003 -85.42 580 Area de Conservacion DHJPAR0017245 Calixto Moraga 19-Mar-07 Costa Rica Guanacaste Guanacaste Sector Pitilla Colocho 11.024 -85.42 375 Area de Conservacion DHJPAR0021387 Dunia Garcia 28-Aug-06 Costa Rica Guanacaste Guanacaste Sector Cacao Sendero a Maritza 10.957 -85.5 570 Area de Conservacion DHJPAR0021398 Yendry Ruiz 3-Sep-06 Costa Rica Guanacaste Guanacaste Sector Cacao Estacion Gongora 10.887 -85.47 570 Area de Conservacion DHJPAR0021412 Yendry Ruiz 3-Oct-06 Costa Rica Guanacaste Guanacaste Sector Cacao Cuesta Caimito 10.891 -85.47 640 Jose Alberto Area de Conservacion Sector Mundo DHJPAR0023365 Sanchez 16-Dec-07 Costa Rica Guanacaste Guanacaste Nuevo Vado Miramonte 10.772 -85.43 305 Area de Conservacion Sector San DHJPAR0023748 Gloria Sihezar 23-Aug-99 Costa Rica Alajuela Guanacaste Cristobal Sendero Corredor 10.879 -85.39 620 Area de Conservacion Sector San Vado Rio DHJPAR0023768 Osvaldo Espinoza 2-Dec-98 Costa Rica Alajuela Guanacaste Cristobal Cucaracho 10.87 -85.39 640 92 Area de Conservacion Sector San Vado Rio DHJPAR0023769 Osvaldo Espinoza 2-Dec-98 Costa Rica Alajuela Guanacaste Cristobal Cucaracho 10.87 -85.39 640

Area de Conservacion DHJPAR0024025 Petrona Rios 1-Aug-03 Costa Rica Guanacaste Guanacaste Sector Pitilla Pasmompa 11.019 -85.41 440 Area de Conservacion DHJPAR0024059 Petrona Rios 21-Oct-03 Costa Rica Guanacaste Guanacaste Sector Pitilla Loaiciga 11.02 -85.41 445 Area de Conservacion DHJPAR0024072 Petrona Rios 23-Jun-05 Costa Rica Guanacaste Guanacaste Sector Pitilla Loaiciga 11.02 -85.41 445 Area de Conservacion Sector San DHJPAR0024085 Freddy Quesada 23-Apr-01 Costa Rica Alajuela Guanacaste Cristobal Rio Blanco Abajo 10.9 -85.37 500 Area de Conservacion DHJPAR0024103 Dunia Garcia 21-Sep-02 Costa Rica Guanacaste Guanacaste Sector Del Oro Quebrada Raiz 11.029 -85.49 280 Area de Conservacion DHJPAR0024105 Elieth Cantillano 25-Jul-02 Costa Rica Guanacaste Guanacaste Sector Del Oro Quebrada Romero 11.005 -85.47 490 Area de Conservacion DHJPAR0024148 Roster Moraga 27-Aug-02 Costa Rica Guanacaste Guanacaste Sector Del Oro Quebrada Romero 11.005 -85.47 490 Area de Conservacion Sector San DHJPAR0024153 Freddy Quesada 26-Apr-01 Costa Rica Alajuela Guanacaste Cristobal Rio Blanco Abajo 10.9 -85.37 500 Area de Conservacion Sector San DHJPAR0024154 Carolina Cano 5-Feb-01 Costa Rica Alajuela Guanacaste Cristobal Sendero Vivero 10.867 -85.39 730 Area de Conservacion DHJPAR0024155 Lucia Rios 14-May-00 Costa Rica Guanacaste Guanacaste Sector Del Oro Quebrada Serrano 11 -85.46 585 Area de Conservacion Sector San DHJPAR0024176 Freddy Quesada 23-Apr-01 Costa Rica Alajuela Guanacaste Cristobal Rio Blanco Abajo 10.9 -85.37 500 Area de Conservacion Quebrada Costa DHJPAR0024199 gusaneros 25-Sep-92 Costa Rica Guanacaste Guanacaste Sector Santa Rosa Rica 10.827 -85.64 275 Area de Conservacion DHJPAR0027723 Duvalier Briceno 22-Feb-08 Costa Rica Alajuela Guanacaste Brasilia Moga 11.012 -85.35 320

Table 2.A.4 continued

Area de Conservacion DHJPAR0027726 Duvalier Briceno 18-Mar-08 Costa Rica Alajuela Guanacaste Brasilia Moga 11.012 -85.35 320 Area de Conservacion DHJPAR0028514 Manuel Rios 31-Jan-06 Costa Rica Guanacaste Guanacaste Sector Pitilla Ingas 11.003 -85.42 580 Area de Conservacion DHJPAR0030345 Manuel Rios 29-Oct-08 Costa Rica Guanacaste Guanacaste Sector Pitilla Amonias 11.042 -85.4 390 Area de Conservacion DHJPAR0030672 Manuel Pereira 19-Dec-08 Costa Rica Guanacaste Guanacaste Sector Cacao Cerro Pedregal 10.928 -85.47 1080 Area de Conservacion DHJPAR0021427 Roster Moraga 6-Feb-07 Costa Rica Guanacaste Guanacaste Sector Del Oro San Antonio 11.035 -85.45 335 Jose Alberto Area de Conservacion Sector Mundo DHJPAR0021413 Sanchez 18-Feb-06 Costa Rica Guanacaste Guanacaste Nuevo Vado Huacas 10.755 -85.39 490 Area de Conservacion DHJPAR0028231 Freddy Quesada 10-Dec-05 Costa Rica Guanacaste Guanacaste Potrerillos Rio Azufrado 10.812 -85.54 95 Area de Conservacion DHJPAR0028503 Manuel Pereira 29-Jan-06 Costa Rica Guanacaste Guanacaste Sector Cacao Estacion Gongora 10.887 -85.47 570 Area de Conservacion DHJPAR0021409 Dunia Garcia 19-Sep-06 Costa Rica Guanacaste Guanacaste Sector Cacao Estacion Cacao 10.927 -85.47 1150

Appendix II. Pair-wise uncorrected p-distance tables

(Supplementary Tables 1-3, Chapter 2)

Table S1 Pair-wise uncorrected p-distances among species

Species / Specimen 1 2 3 4 5 6 7 8 9 10 ……………………………………………………………………………………………...... 1. H. fugitivus - 0.198 0.201 0.199 0.182 0.208 0.174 0.089 0.199 0.349 2. H. INB-42DHJ01 / DHJPAR0021606 0.142 - 0.027 0.021 0.027 0.021 0.014 0.186 0.181 0.381 3. H. INB-42DHJ02 / DHJPAR0021414 0.130 0.064 - 0.027 0.021 0.016 0.026 0.186 0.173 0.359 4. H. INB-42DHJ04 / DHJPAR0014103 0.129 0.083 0.083 - 0.037 0.021 0.028 0.187 0.181 0.371 5. H. INB-42DHJ05 / DHJPAR0021427 0.127 0.072 0.067 0.024 - 0.027 0.021 0.170 0.159 0.359 6. H. INB-42DHJ06 / DHJPAR0021413 0.122 0.069 0.050 0.076 0.067 - 0.034 0.186 0.179 0.375 7. H. INB-42DHJ07 / DHJPAR0028231 0.137 0.081 0.078 0.072 0.063 0.066 - 0.163 0.133 0.346 8. H. INB-12 / DHJPAR0021511 0.039 0.156 0.140 0.139 0.136 0.140 0.151 - 0.185 0.322 9. H. PRO-7 / DHJPAR0021409 0.098 0.142 0.144 0.138 0.142 0.141 0.144 0.103 - 0.362 10. T. rostrale 0.142 0.190 0.188 0.188 0.191 0.189 0.188 0.148 0.172 -

Lower left, COI p-distances; upper right, Cys-d9.2 p-distances.

Table S2 Pair-wise uncorrected p-distances among specimens of H. INB-12

94 Specimen 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 …………………………………………………………………………………………………………………………………………………

1. DHJPAR0014269 - 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 2. DHJPAR0014270 0.000 - 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 3. DHJPAR0014271 0.000 0.000 - 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 4. DHJPAR0014272 0.002 0.002 0.002 - 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 5. DHJPAR0014273 0.002 0.002 0.002 0.000 - 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 6. DHJPAR0014274 0.000 0.000 0.000 0.002 0.002 - 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 7. DHJPAR0014275 0.000 0.000 0.000 0.002 0.002 0.000 - 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 8. DHJPAR0014276 0.000 0.000 0.000 0.002 0.002 0.000 0.000 - 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 9. DHJPAR0014277 0.000 0.000 0.000 0.002 0.002 0.000 0.000 0.000 - 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 10. DHJPAR0014278 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 - 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 11. DHJPAR0014279 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 - 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 12. DHJPAR0014283 0.000 0.000 0.000 0.002 0.002 0.000 0.000 0.000 0.000 0.000 0.000 - 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 13. DHJPAR0014284 0.000 0.000 0.000 0.002 0.002 0.000 0.000 0.000 0.000 0.000 0.000 0.000 - 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 14. DHJPAR0014875 0.003 0.004 0.003 0.002 0.002 0.003 0.003 0.003 0.004 0.002 0.003 0.003 0.003 - 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 15. DHJPAR0016380 0.002 0.002 0.002 0.000 0.000 0.002 0.002 0.002 0.002 0.000 0.000 0.002 0.002 0.002 - 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 16. DHJPAR0016961 0.002 0.002 0.002 0.000 0.000 0.002 0.002 0.002 0.002 0.000 0.000 0.002 0.002 0.002 0.000 - 0.000 0.000 0.000 0.000 0.000 0.000 0.000 17. DHJPAR0017015 0.002 0.002 0.002 0.000 0.000 0.002 0.002 0.002 0.002 0.000 0.000 0.002 0.002 0.002 0.000 0.000 - 0.000 0.000 0.000 0.000 0.000 0.000 18. DHJPAR0019889 0.000 0.000 0.000 0.002 0.002 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.003 0.002 0.002 0.002 - 0.000 0.000 0.000 0.000 0.000 19. DHJPAR0021393 0.000 0.000 0.000 0.002 0.002 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.003 0.002 0.002 0.002 0.000 - 0.000 0.000 0.000 0.000 20. DHJPAR0021511 0.000 0.000 0.000 0.002 0.002 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.003 0.002 0.002 0.002 0.000 0.000 - 0.000 0.000 0.000 21. DHJPAR0023447 0.002 0.002 0.002 0.000 0.000 0.002 0.002 0.002 0.002 0.000 0.000 0.002 0.002 0.002 0.000 0.000 0.000 0.002 0.002 0.002 - 0.000 0.000 22. DHJPAR0030313 0.032 0.035 0.031 0.033 0.033 0.032 0.031 0.031 0.034 0.047 0.046 0.032 0.032 0.031 0.033 0.033 0.033 0.030 0.031 0.032 0.033 - 0.000 23. DHJPAR0030673 0.000 0.000 0.000 0.002 0.002 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.003 0.002 0.002 0.002 0.000 0.000 0.000 0.002 0.031 -

Lower left, COI p-distances; upper right, Cys-d9.2 p-distances.

Table S3 Pair-wise uncorrected p-distances among specimens of H. INB-42DHJ04

Specimen 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 ………………………………………………………………………………………………………………………………………………………………………………………….. 1. DHJPAR0014103 - 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 2. DHJPAR0014109 0.002 - 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 3. DHJPAR0014110 0.000 0.002 - 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 4. DHJPAR0014128 0.003 0.002 0.003 - 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 5. DHJPAR0014162 0.000 0.002 0.000 0.003 - 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 6. DHJPAR0014163 0.000 0.002 0.000 0.003 0.000 - 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 7. DHJPAR0017245 0.000 0.002 0.000 0.003 0.000 0.000 - 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 8. DHJPAR0021387 0.000 0.002 0.000 0.003 0.000 0.000 0.000 - 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 9. DHJPAR0021398 0.002 0.000 0.002 0.002 0.002 0.002 0.002 0.002 - 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 10. DHJPAR0021412 0.000 0.002 0.000 0.003 0.000 0.000 0.000 0.000 0.002 - 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 11. DHJPAR0023365 0.000 0.002 0.000 0.003 0.000 0.000 0.000 0.000 0.002 0.000 - 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 12. DHJPAR0023748 0.000 0.002 0.000 0.003 0.000 0.000 0.000 0.000 0.002 0.000 0.000 - 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 13. DHJPAR0023768 0.000 0.002 0.000 0.003 0.000 0.000 0.000 0.000 0.002 0.000 0.000 0.000 - 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 14. DHJPAR0023769 0.000 0.002 0.000 0.003 0.000 0.000 0.000 0.000 0.002 0.000 0.000 0.000 0.000 - 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 15. DHJPAR0024025 0.000 0.002 0.000 0.003 0.000 0.000 0.000 0.000 0.002 0.000 0.000 0.000 0.000 0.000 - 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 16. DHJPAR0024059 0.000 0.002 0.000 0.003 0.000 0.000 0.000 0.000 0.002 0.000 0.000 0.000 0.000 0.000 0.000 - 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 17. DHJPAR0024072 0.000 0.002 0.000 0.003 0.000 0.000 0.000 0.000 0.002 0.000 0.000 0.000 0.000 0.000 0.000 0.000 - 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 18. DHJPAR0024085 0.000 0.002 0.000 0.003 0.000 0.000 0.000 0.000 0.002 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 - 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 19. DHJPAR0024103 0.000 0.002 0.000 0.003 0.000 0.000 0.000 0.000 0.002 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 - 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 20. DHJPAR0024105 0.000 0.002 0.000 0.003 0.000 0.000 0.000 0.000 0.002 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 - 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 21. DHJPAR0024148 0.000 0.002 0.000 0.003 0.000 0.000 0.000 0.000 0.002 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 - 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 22. DHJPAR0024153 0.000 0.002 0.000 0.003 0.000 0.000 0.000 0.000 0.002 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 - 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.002 0.000 0.003 0.000 0.000 0.000 0.000 0.002 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 - 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000

95 23. DHJPAR0024154 24. DHJPAR0024155 0.000 0.002 0.000 0.004 0.000 0.000 0.000 0.000 0.002 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 - 0.000 0.000 0.000 0.000 0.000 0.000 0.000 25. DHJPAR0024176 0.000 0.002 0.000 0.003 0.000 0.000 0.000 0.000 0.002 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 - 0.000 0.000 0.000 0.000 0.000 0.000 26. DHJPAR0024199 0.000 0.003 0.000 0.003 0.000 0.000 0.000 0.000 0.003 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 - 0.000 0.000 0.000 0.000 0.000 27. DHJPAR0027723 0.000 0.002 0.000 0.003 0.000 0.000 0.000 0.000 0.002 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 - 0.000 0.000 0.000 0.000 28. DHJPAR0027726 0.002 0.000 0.002 0.002 0.002 0.002 0.002 0.002 0.000 0.002 0.002 0.002 0.002 0.002 0.002 0.002 0.002 0.002 0.002 0.002 0.002 0.002 0.002 0.002 0.002 0.003 0.002 - 0.000 0.000 0.000 29. DHJPAR0028514 0.002 0.004 0.002 0.002 0.002 0.002 0.002 0.002 0.004 0.002 0.002 0.002 0.002 0.002 0.002 0.002 0.002 0.002 0.002 0.002 0.002 0.002 0.002 0.002 0.002 0.000 0.002 0.004 - 0.000 0.000 30. DHJPAR0030345 0.000 0.002 0.000 0.003 0.000 0.000 0.000 0.000 0.002 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.002 0.002 - 0.000 31. DHJPAR0030672 0.000 0.002 0.000 0.003 0.000 0.000 0.000 0.000 0.002 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.002 0.002 0.000 -

Lower left, COI p-distances; upper right, Cys-d9.2 p-distances.

Appendix III. Proteomics data associated with each putative Megarhyssa venom transcript.

Supplementary Table S1 Chapter 4 Predicted GenBank Molecular M. greenei Venom M. macrurus Venom Accession Transcriptome Weight # # Transcript # Database (kDa) Fraction Score Coverage Peptides Fraction Score Coverage Peptides

c5973_g1_i3_Frame.5 XXXXXXXX M. greenei 35.66 - - - - 6 151.76 21.05 6 c5973_g1_i1_Frame.5 XXXXXXXX M. greenei 37.48 - - - - 6 140.15 16.05 4 Locus_427_5/7_Frame.2 XXXXXXXX M. macrurus 51.22 4 97.16 10.58 11 5 278.88 22.38 21 c12559_g1_i1_Frame.3 XXXXXXXX M. greenei 37.85 4 198.86 33.65 12 5 469.38 36.86 18 c9943_g1_i1_Frame.1 XXXXXXXX M. greenei 61.97 4 567.65 52.02 26 5 446.92 30.28 19 Locus_1282_2/4_Frame.2 XXXXXXXX M. macrurus 67.95 4 158.65 12.95 15 4 251.96 26.72 31 Locus_1714_1/2_Frame.6 XXXXXXXX M. macrurus 65.02 4 95.69 14.96 8 5 334.13 43.53 26 Locus_427_2/7_Frame.2 XXXXXXXX M. macrurus 60.29 4 222.21 29.13 23 5 651.4 33.86 32

96 Locus_427_7/7_Frame.2 XXXXXXXX M. macrurus 64.88 4 222.21 31.79 25 5 706.62 37.7 37

c15924_g1_i1_Frame.3 XXXXXXXX M. greenei 67.86 4 309.04 22.9 19 4 342.06 26.18 27 Locus_45_12/21_Frame.1 XXXXXXXX M. macrurus 81.58 3 67.99 5.78 14 2 115.83 5.38 14 Locus_45_16/21_Frame.1 XXXXXXXX M. macrurus 73.68 3 67.99 5.3 14 2 115.83 4.93 14 Locus_45_21/21_Frame.1 XXXXXXXX M. macrurus 70.67 3 67.99 5.34 14 2 115.83 4.97 14 c15431_g1_i1_Frame.1 XXXXXXXX M. greenei 93.26 3 261.71 21.44 19 2 73.97 11.09 11 c12994_g1_i1_Frame.4 XXXXXXXX M. greenei 21.81 - - - - 12 49.24 10.67 4 c11799_g1_i1_Frame.4 XXXXXXXX M. greenei 56.61 4 387.86 29.08 15 6 32.97 6.46 5 c13643_g1_i1_Frame.5 XXXXXXXX M. greenei 49.83 - - - - 6 89.62 3.78 2 Locus_3644_4/4_Frame.2 XXXXXXXX M. macrurus 72.33 - - - - 3 215.46 10.06 8 c14652_g1_i1_Frame.5 XXXXXXXX M. greenei 72.17 - - - - 3 144.23 7.84 7 Locus_1101_2/10_Frame.3 XXXXXXXX M. macrurus 45.43 5 91.98 4.92 10 8 552.57 12.74 23 Locus_2648_1/2_Frame.6 XXXXXXXX M. macrurus 72.76 4 54.81 2.36 2 - - - - c14557_g1_i1_Frame.6 XXXXXXXX M. greenei 72.78 4 54.81 2.46 2 - - - -

Supplementary Table S1 Chapter 4 continued

c13971_g1_i1_Frame.3 XXXXXXXX M. greenei 88.69 3 918.9 48.49 40 2 109.9 10.88 9 c16369_g1_i1_Frame.4 XXXXXXXX M. greenei 65.69 - - - - 4 51.33 3.54 2 c14451_g1_i1_Frame.5 XXXXXXXX M. greenei 87.25 4 1156.65 32.94 37 4 142.09 9.54 14 c520_g1_i1_Frame.2 XXXXXXXX M. greenei 14.74 12 76.25 10.1 2 - - - - c2771_g1_i1_Frame.1 XXXXXXXX M. greenei 56.38 4 34.29 3.52 3 - - - - Locus_2657_1/1_Frame.3 XXXXXXXX M. macrurus 75.76 - - - - 4 80.12 2.28 2 c15268_g1_i1_Frame.5 XXXXXXXX M. greenei 75.84 - - - - 4 87.03 2.65 2 c11644_g1_i1_Frame.6 XXXXXXXX M. greenei 37.63 6 236.72 9.44 7 9 71.91 2.8 2 c15471_g2_i1_Frame.2 XXXXXXXX M. greenei 63.3 - - - - 4 50.34 10.98 8 c12309_g1_i1_Frame.2 XXXXXXXX M. greenei 87.93 3 230.51 20.41 17 - - - - c8862_g3_i1_Frame.6 XXXXXXXX M. greenei 18.88 11 56.53 17.65 5 - - - - c13472_g1_i1_Frame.4 XXXXXXXX M. greenei 9.19 11 146.51 13.21 3 12 50.48 9.43 3 c8787_g1_i1_Frame.5 XXXXXXXX M. greenei 17.1 11 46.81 6.75 2 - - - -

97 c8322_g1_i1_Frame.5 XXXXXXXX M. greenei 10.24 12 77.11 10.55 4 - - - -

Locus_2763_15/15_Frame.5 XXXXXXXX M. macrurus 43.14 - - - - 6 244 29.23 12 c8118_g1_i3_Frame.1 XXXXXXXX M. greenei 43.36 4 94.54 12.89 4 6 199.1 7.01 4 Locus_637_3/6_Frame.1 XXXXXXXX M. macrurus 38.93 4 68.26 6.4 5 6 48.85 6.3 4 c13334_g1_i1_Frame.3 XXXXXXXX M. greenei 39.12 4 163.73 18.8 9 6 53.53 10.57 4 Locus_1560_10/15_Frame.2 XXXXXXXX M. macrurus 43.92 4 108.17 12.34 9 - - - - c15594_g1_i1_Frame.1 XXXXXXXX M. greenei 44 4 277.18 17.58 12 - - - - c13622_g1_i1_Frame.5 XXXXXXXX M. greenei 18.34 11 91.27 2.99 4 - - - - c12203_g1_i1_Frame.6 XXXXXXXX M. greenei 14.49 11 67.87 10.48 2 - - - - Locus_2663_1/1_Frame.3 XXXXXXXX M. macrurus 22.88 11 207.29 21.59 13 11 83.39 16.05 8 c10783_g1_i1_Frame.2 XXXXXXXX M. greenei 22.88 11 179.63 24.95 13 11 96.83 18.55 8 c15689_g1_i3_Frame.5 XXXXXXXX M. greenei 87.16 - - - - 2 114.01 13.6 10 Locus_1125_1/9_Frame.6 XXXXXXXX M. macrurus 87.26 - - - - 2 169.27 7.79 12 c1037_g1_i1_Frame.1 XXXXXXXX M. greenei 12.18 12 84.81 2.87 3 - - - -

Supplementary Table S1 Chapter 4 continued

c10827_g1_i1_Frame.1 XXXXXXXX M. greenei 9.9 12 53.5 4.85 4 - - - - c14193_g1_i1_Frame.3 XXXXXXXX M. greenei 27.74 9 1172.57 17.03 26 - - - - c5399_g1_i1_Frame.3 XXXXXXXX M. greenei 42.56 6 451.74 19.46 11 - - - - c11127_g1_i1_Frame.2 XXXXXXXX M. greenei 63.11 4 204.77 7.85 11 - - - - Locus_32710_1/3_Frame.1 XXXXXXXX M. macrurus 50.17 11 32.75 6.68 2 - - - - c67479_g1_i1_Frame.5 XXXXXXXX M. greenei 21.03 10 92.8 10.57 7 11 78.99 4.89 3 c8236_g1_i1_Frame.2 XXXXXXXX M. greenei 34.82 6 121.54 12.11 7 - - - - c8590_g1_i1_Frame.5 XXXXXXXX M. greenei 12.54 12 37.38 10.26 2 - - - - Locus_32701_1/1_Frame.6 XXXXXXXX M. macrurus 7.77 - - - - 2 55.33 29.35 2 Locus_33047_1/1_Frame.1 XXXXXXXX M. macrurus 8.17 - - - - 13 207.53 23.3 2 c11580_g1_i1_Frame.5 XXXXXXXX M. greenei 14.22 11 43.77 14.76 4 - - - - c14348_g1_i1_Frame.3 XXXXXXXX M. greenei 15.02 11 132.75 22.39 7 13 118.24 10.42 2 c14348_g1_i2_Frame.3 XXXXXXXX M. greenei 13.83 11 117.39 18.75 5 13 147.15 19.2 5

98 c658_g1_i1_Frame.1 XXXXXXXX M. greenei 10.14 12 176.55 14.83 5 - - - -

c7165_g1_i1_Frame.4 XXXXXXXX M. greenei 13.43 12 40.91 18.66 4 13 55.95 9.7 2

References

Abascal F, Zardoya R & Posada D (2005). ProtTest: Selection of best-fit models of protein evolution. Bioinformatics, 21:2104-2105

Aehle W (2006). Enzymes in Industry: Products and Applications. New York: John Wiley and Sons.

Akaike H (1998). Information theory and an extension of the maximum likelihood principle. In: Selected Papers of Hirotugu Akaike (pp. 199-213). Springer, New York.

Arakane Y, Muthukrishnan S, Beeman R W, Kanost M R & Kramer K J (2005). Laccase 2 is the phenoloxidase gene required for beetle cuticle tanning. Proceedings of the National Academy of Sciences USA, 102:11337-11342.

Artimo P, Jonnalagedda M, Arnold K, Baratin D, Csardi G, De Castro E, Duvaud S, Flegel V,

Fortier A, Gasteiger E & Grosdidier A (2012). ExPASy: SIB bioinformatics resource portal. Nucleic acids research, gks400.

Asgari S, Reineke A, Beck M & Schmidt O (2002). Isolation and characterization of a neprilysin- like protein from Venturia canescens virus-like particles. Insect Molecular Biology, 11:477-485.

Asgari S, Zhang G, Zareie R & Schmidt O (2003). A serine proteinase homolog venom protein from an endoparasitoid wasp inhibits melanization of the host hemolymph. Insect Biochemistry and Molecular Biology, 33:1017-1024.

Ashmead WH (1900). Order Hymenoptera. In Smith JB. Insects of New Jersey, with notes on those of economic importance (pp. 775). MacCrellish and Quigley, Trenton.

Askew RR & Shaw MR (1986).Parasitoid communities: their size, structure and development. In: Waage J, Greathead D (eds) Insect Parasitoids (pp. 225-264). Academic Press, London.

Bartlett BR, Clausen CP, DeBach P, Goeden RD, Legner EF, McMurtry JA & Oatman ER (1978). Introduced parasites and predators of arthropod pests and weeds: A world review. Agriculture Handbook, United States Department of Agriculture (480).

Beaulne JI (1939). Parasites and predators reared at Quebec. Canadian Entomologist, 71: 120.

Beckage NE (2012). Polydnaviruses as endocrine regulators. In: Beckage NE, Drezen J-M (eds) Parasitoid viruses, symbionts and pathogens( pp. 163-168). Academic Press, San Diego.

Beckage NE & Drezen J (eds) (2011). Parasitoid viruses: symbionts and pathogens. Academic Press, San Diego.

Belgacem MN & Gandini A (eds) (2008). Monomers, Polymers and Composites from Renewable Resources (pp. 39-66). Elsevier.

Benson RB (1938). On the classification of sawflies (Hymenoptera: Symphyta). Transactions of the Royal Entomological Society of London. 87: 353-384.

Bischoff H (1926). Über die systematische Stellung der Orussidae. In: Jordan K, Horn W (eds) III. Internationaler Entomologen-Kongress Zürich (pp. 134-144).

Boutrin MC, Foster HA & Pentreath VW (2008). The effects of bee (Apis mellifera) venom phospholipase A2 on Trypanosoma brucei brucei and enterobacteria. Experimental Parasitology, 119:246-251.

Britton HTK & Robinson RA (1931). CXCVIII. Universal buffer solutions and the dissociation constant of veronal. Journal of the Chemical Society (resumed), 1456-1462.

Carlson RW (1979). Family Ichneumonidae. Stephanidae. In: Krombein KV, Hurd Jr. PD, Smith DR, Burks BD Catalog of Hymenoptera in America north of Mexico (pp. 315-741. Smithsonian Institution Press, Washington.

Caterino MS, Cho S & Sperling FAH (2000). The current state of insect molecular systematics: A thriving tower of babel. Annual Review of Entomology, 45:1-54.

Champlain AB (1921). The curious mating habits of Megarhyssa atrata (Fab.). (Hymen.: Ichneumonoidea). Entomological News, 32:241.

Chaturvedi V & Verma P (2013). An overview of key pretreatment processes employed for bioconversion of lignocellulosic biomass into biofuels and value added products. 3 Biotech, 3:415-431.

Colinet D, Cazes D, Belghazi M, Gatti JL & Poirié M (2011). Extracellular superoxide dismutase in insects: characterization, function, and interspecific variation in parasitoid wasp venom. Journal of Biological Chemistry, 286:40110-40121.

Colinet D, Anselme C, Deleury E, Mancini D, Poulain J, Azéma-Dossat C, Belghazi M, Tares S, Pennacchio F, Poirié M & Gatti JL (2014). Identification of the main venom protein components of Aphidius ervi, a parasitoid wasp of the aphid model Acyrthosiphon pisum. BMC Genomics, 15:342.

Cooper KW (1953). Egg gigantism, oviposition, and genital anatomy: their bearing on the biology and phylogenetic position of Orussus (Hymenoptera: Siricoidea). Proceedings of the Rochester Academy of Science, 10:38-68.

Coy MR, Salem TZ, Denton JS, Kovaleva ES, Liu Z, Barber DS, JH Campbell JH, Davis DC, Buchman GW, Boucias DG & Scharf ME (2010). Phenol-oxidizing laccases from the termite gut. Insect Biochemistry and Molecular Biology, 40:723-732.

Crawford AM, Brauning R, Smolenski G, Ferguson C, Barton D, Wheeler TT & McCulloch A (2008). The constituents of Microctonus sp. parasitoid venoms. Insect Molecular Biology, 17:313-24.

100

Dani MP, Edwards JP & Richards EH (2005). Hydrolase activity in the venom of the pupal endoparasitic wasp, Pimpla hypochondriaca. Comparative Biochemistry and Physiology Part B, 141:373-81.

Dani MP, Richards EH, Isaac RE & Edwards JP (2003). Antibacterial and proteolytic activity in venom from the endoparasitic wasp Pimpla hypochondriaca (Hymenoptera: Ichneumonidae). Journal of Insect Physiology, 49:945-954.

Danneels EL, Gerlo S, Heyninck K, Van Craenenbroeck K, De Bosscher K, Haegeman G & de Graaf DC (2014). How the venom from the ectoparasitoid wasp Nasonia vitripennis exhibits anti- inflammatory properties on mammalian cell lines. PlosOne, 9:e96825. doi: 10.1371/journal.pone.0096825

Danneels EL, Rivers DB & de Graaf DC (2010). Venom proteins of the parasitoid wasp Nasonia vitripennis: recent discovery of an untapped pharmacopeia. Toxins, 2:494-516.

Darwell CT, al-Beidh S & Cook JM (2014). Molecular species delimitation of a symbiotic fig- pollinating wasp species complex reveals extreme deviation from reciprocal partner specificity. BMC Evolutionary Biology, 14:189.

De Graaf DC, Aerts M, Brunain M, Desjardins CA, Jacobs FJ, Werren JH & Devreese B (2010). Insights into the venom composition of the ectoparasitoid wasp Nasonia vitripennis from bioinformatic and proteomic studies. Insect molecular biology, 19:11-26.

Dib-Hajj SD, Webb BA & Summers MD (1993). Structure and evolutionary implications of a "cysteine-rich" Campoletis sonorensis polydnavirus gene family. Proceedings of the National Academy of Sciences, 90:3765-3769.

Dittmer NT, Suderman RJ, Jiang H, Zhu YC, Gorman MJ, Kramer KJ & Kanost MR (2004). Characterization of cDNAs encoding putative laccase-like multicopper oxidases and developmental expression in the tobacco hornworm, Manduca sexta, and the malaria mosquito, Anopheles gambiae. Insect Biochemistry and Molecular Biology, 34:29-41.

Dittmer NT & Kanost MR (2010). Insect multicopper oxidases: diversity, properties, and physiological roles. Insect Biochemistry and Molecular Biology, 40:179-188.

Dorémus T, Darboux I, Cusson M, Ravallec M, Jouan V, Frayssinet M, Stoltz DB, Webb BA & Volkoff A-N (2014). Specificities of ichnoviruses associated with campoplegine wasps: Genome, genes and role in host-parasitoid interaction. Current Opinion in Insect Science, 2: 44-51.

Du YJ, Poppy GM & Powell W (1996). Relative importance of semiochemicals from first and second trophic levels in host foraging behavior of Aphidius ervi. Journal of Chemical Ecology, 22:1591-1605.

Eggert C, Temp U & Eriksson K-EL (1997). Laccase is essential for lignin degradation by the white-rot fungus Pycnoporus cinnabarinus. FEBS Letters, 407:89-92.

Escherich K (1942). Hymenoptera (Hautflügler) und Diptera (Zweiflügler). In: Die Forstinsekten Mitteleuropas. Ein Lehr-und Handbuch (vol. 5). Paul Parey.

101

Falabella P, Riviello L, Caccialupi P, Rossodivita T, Valente MT, De Stradis ML, Tranfaglia A, Varricchio P, Gigliotti S, Graziani F & Malva C (2007). A γ-glutamyltranspeptidase of Aphidius ervi venom induces apoptosis in the ovaries of host aphids. Insect Biochemistry and Molecular Biology, 37:453-465.

Fath-Goodin A, Gill TA, Martin S & Webb BA (2006). Effect of Campoletis sonorensis Ichnovirus cys-motif proteins on Heliothis virescens larval development. Journal of Insect Physiology, 52:576-585.

Felsenstein J (1985). Confidence limits on phylogenies: An approach using the bootstrap. Evolution, 39:783-791.

Feng L & Cheng Z-L (2008). Research progress on dissolution and functional modification of cellulose in ionic liquids. Journal of Molecular Liquids, 142:1-5.

Fernandes DLA, Pereira SR, Serafim LS, Evtuguin DV & Xavier AMRB (2012). Second Generation Bioethanol from Lignocellulosics: Processing of Hardwood Sulphite Spent Liquor. In: Lima MAP, Natalense APP (eds) Bioethanol. Intech, Rijeka.

Fernández-Triana JL (2010). Eight new species and an annotated checklist of Microgastrinae (Hymenoptera: Braconidae) from Canada and Alaska. ZooKeys, 63:1.

Fernández-Triana JL, Whitfield JB, Rodriguez JJ, Smith MA, Janzen DH, Hallwachs WD, Hajibabaei M, Burns JM, Solis MA, Brown J, Cardinal S, Goulet H & Hebert PDN (2014). Review of Apanteles sensu stricto (Hymenoptera: Braconidae, Microgastrinae) from Area de Conservación Guanacaste, northwestern Costa Rica, with keys to all described species from Mesoamerica. ZooKeys, 383:1-565.

Filley TR, Hatcher PG, Shortle WC & Praseuth RT (2000). The application of 13C-labeled tetramethylammonium hydroxide (13C-TMAH) thermochemolysis to the study of fungal degradation of wood. Organic Geochemistry, 31:181-198.

Fleming JG, & Summers MD (1991). Polydnavirus DNA is integrated in the DNA of its parasitoid wasp host. Proceedings of the National Academy of Sciences, 88: 9770-9774.

Folmer O, Black M, Hoeh W, Lutz R &Vrijenhoek R (1994). DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology, 3:294-299.

Geervliet J, Vet LE & Dicke M (1994). Volatiles from damaged plants as major cues in long‐range host‐searching by the specialist parasitoid Cotesia rubecula. Entomologia Experimentalis et Applicata, 73: 289-297.

Geib SM, Filley TR, Hatcher PG, Hoover K, Carlson JE, del Mar Jimenez-Gasco M, Nakagawa- Izumi A, Sleighter RL & Tien M (2008). Lignin degradation in wood-feeding insects. Proceedings of the National Academy of Sciences, 105:12932-7.

Gupta R, Jung E & Brunak S (2004). Prediction of N-glycosylation sites in human proteins. In preparation.

102

Godfray HCJ (1994). Parasitoids: Behavioral and Evolutionary Ecology. Princeton University Press, Princeton, NJ.

Gomes A, Bhattacharjee P & Mishra R (2010). Anticancer potential of animal venoms and toxins. Indian Journal of Experimental Biology, 48:93-103.

Grabherr MG, Haas BJ, Yassour M, Levin JZ, Thompson DA, Amit I, Adiconis X, Fan L, Raychowdhury R, Zeng Q & Chen Z (2011). Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nature Biotechnology, 29:644-52.

Guerrieri E, Poppy GM, Powell W, Tremblay E & Pennacchio F (1999). Induction and systemic release of herbivore-induced plant volatiles mediating in-flight orientation of Aphidius ervi. Journal of Chemical Ecology, 25:1247-1261.

Hall TA (1999). BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series, 41:95-98.

Hammel K, Kapich E, Alexander N, Jensen KA & Ryan ZC (2002). Reactive oxygen species as agents of wood decay by fungi. Enzyme and Microbial Technology, 30:445-453.

Hattori M, Konishi H, Tamura Y, Konno K & Sogawa K (2005). Laccase-type phenoloxidase in salivary glands and watery saliva of the green rice leafhopper, Nephotettix cincticeps. Journal of Insect Physiology, 51:1359-1365.

Haugen DA & Underdown MG (1990). Sirex noctilio control program in response to the 1987 green triangle outbreak. Australian Forestry, 53:33-40.

Heatwole H & Davis DM (1965). Ecology of three sympatric species of parasitic insects of the genus Megarhyssa (Hymenoptera: Ichneumonidae). Ecology, 46:140-150.

Heavner ME, Gueguen G, Rajwani R, Pagan PE, Small C & Govind S (2013). Partial venom gland transcriptome of a Drosophila parasitoid wasp, Leptopilina heterotoma, reveals novel and shared bioactive profiles with stinging Hymenoptera. Gene, 526:195-204.

Hebert PDN, Cywinska A & Ball SL (2003) Biological identifications through DNA barcodes. Proceedings of the Royal Society of London. Series B: Biological Sciences, 270:313-321.

Hernández M, Hernández-Coronado MJ, Ball AS & Arias ME (2001). Degradation of alkali- lignin residues from solid-state fermentation of wheat straw by streptomycetes. Biodegradation, 12: 219-223.

Hofrichter M (2002). Review: lignin conversion by manganese peroxidase (MnP). Enzyme and Microbial Technology, 30:454-466.

Hopkins AD (1893). Catalogue of West Virginia forest and shade tree insects. West Virginia Agricultural Experiment Station Bulletin, 32: 171-251.

Huelsenbeck JP & Rannala B (2004). Frequentist properties of Bayesian posterior probabilities of phylogenetic trees under simple and complex substitution models. Systematic Biology, 53:904– 913.

103

Huelsenbeck JP & Ronquist F (2001). MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics, 17:754-755.

Hughes AL (2007). Looking for Darwin in all the wrong places: the misguided quest for positive selection at the nucleotide sequence level. Heredity, 99:364-373.

Humphreys JM, Hemm MR & Chapple C (1999). New routes for lignin biosynthesis defined by biochemical characterization of recombinant ferulate 5-hydroxylase, a multifunctional cytochrome P450-dependent monooxygenase. Proceedings of the National Academy of Sciences USA, 96:10045-10050.

Hurley BP, Slippers B & Winfield MJ (2007). A comparison of control results for the alien invasive woodwasp, Sirex noctilio, in the Southern Hemisphere. Agricultural and Forest Entomology, 9:159-171.

Ivanova NV, DeWaard JR & Hebert PDN (2006). An inexpensive, automation-friendly protocol for recovering high-quality DNA. Molecular Ecology Notes, 6:998-1002.

Janzen DH, Hallwachs W, Blandin P, Burns JM, Cadiou J, Chacon I, Dapkey T, Deans AR, Epstein ME, Espinoza B, Franclemont JG, Haber WA, Hajibabaei M, Hall JPW, Hebert PDN, Gauld ID, Harvey DJ, Hausmann A, Kitching I, Lafontaine D, Landry J, Lemaire C, Miller JY, Miller JS, Miller L, Miller SE, Montero J, Munroe E, Green SR, Ratnasingham S, Rawlins JE, Robbins RK, Rodriguez JJ, Rougerie R, Sharkey MJ, Smith MA, Solis MA, Sullivan JB, Thiaucourt P, Wahl DB, Weller SJ, Whitfield JB, Willmott KR, Wood DM, Woodley NE & Wilson JJ (2009). Integration of DNA barcoding into an ongoing inventory of complex tropical biodiversity. Molecular Ecology Resources, 9:1-26 doi:10.1111/j.1755-0998.2009.02628.x

Janzen DH & Hallwachs W (2011). Joining inventory by parataxonomists with DNA barcoding of a large complex tropical conserved wild land in north-western Costa Rica. PLoS ONE, 6:e18123. doi:10.1371/journal.pone.0018123

Kankare M, Stefanescu C, Van Nouhuys S & Shaw MR (2005). Host specialization by Cotesia wasps (Hymenoptera: Braconidae) parasitizing species‐rich Melitaeini (Lepidoptera: Nymphalidae) communities in north‐eastern Spain. Biological Journal of the Linnean Society, 86:45-65.

Katoh K & Standley DM (2013). MAFFT multiple sequence alignment software Version 7: improvements in performance and usability. Molecular Biology and Evolution, 30:772-780.

Khalaim AI & Ruiz-Cancino E (2013). A new species of Megarhyssa Ashmead (Hymenoptera: Ichneumonidae: Rhyssinae) from tropical Mexico with a key to Mexican species. Zootaxa, 3619:195-200.

Koressaar T & Remm M (2007). Enhancements and modifications of primer design program Primer3. Bioinformatics, 23:1289-91.

Landan G & Graur D (2008). Local reliability measures from sets of co-optimal multiple sequence alignments. Pacific Symposium on Biocomputing, 13:15-24.

LaSalle J & Gauld ID (1991). Parasitic Hymenoptera and the biodiversity crisis. Redia, 74:315- 334.

104

LaSalle J & Gauld ID (1993). Hymenoptera and Biodiversity. CAB International, Oxford. Brown JK, Fauquet CM, Briddon RW, Zerbini M, Moriones E, Navas-Castillo J, King AM, Adams MJ, Carstens EB & Lefkowitz EJ (2012). Virus taxonomy: Ninth report of the International Committee on Taxonomy of Viruses. King AMQ, Lefkowitz E, Adams MJ, Carstens EB (eds). Amsterdam: Elsevier.

Le Lannic J & Nénon J-P (1999). Functional morphology of the ovipositor in Megarhyssa atrata (Hymenoptera: Ichneumonidae) and its penetration into wood. Zoomorphology, 119:73-79.

Li X & Webb BA (1994). Apparent functional role for a cysteine-rich polydnavirus protein in suppression of the insect cellular immune response. Journal of Virology, 68:7482-7489.

Lin C-P & Danforth BN (2004). How do insect nuclear and mitochondrial gene substitution patterns differ? Insights from Bayesian analyses of combined datasets. Molecular Phylogenetics and Evolution, 30:686-702.

Maddison DR & Maddison WP (2000). MacClade 4. Sinauer Associates, Sunderland, Massachusetts.

Martínez ÁT, Ruiz-Dueñas FJ, Martínez MJ, del Río JC & Gutiérrez A (2009). Enzymatic delignification of plant cell wall: from nature to mill. Current Opinion in Biotechnology, 20:348- 357.

Marzec M, Eletto D, Argon Y (2012). GRP94: An HSP90-like protein specialized for protein folding and quality control in the endoplasmic reticulum. Biochimica et Biophysica Acta, 1823:774-787.

Mattiacci L & Dicke M (1995). The parasitoid Cotesia glomerata (Hymenoptera: Braconidae) discriminates between first and fifth larval instars of its host Pieris brassicae, on the basis of contact cues from frass, silk and herbivore-damaged leaf tissue. Journal of insect behavior, 8:485-498.

Merrill JH (1915). On some genera of the pimpline Ichneumonidae. Transactions of the American Entomological Society, 41:109-154.

Messerschmidt A (1997). Multi-copper oxidases. Singapore: World Scientific.

Moreau SJM & Asgari S (2015). Venom proteins from parasitoid wasps and their biological functions. Toxins, 7:2385-2412.

Moreau SJM (2013). It stings a bit but it cleans well: venoms of Hymenoptera and their antimicrobial potential. Journal of Insect Physiology, 59:186-204.

Moreau SJM & Guillot S (2005). Advances and prospects on biosynthesis, structures and functions of venom proteins from parasitic wasps. Insect Biochemistry and Molecular Biology, 35:1209-1223.

Nakamatsu Y & Tanaka T (2004). Venom of Euplectrus separatae causes hyperlipidemia by lysis of host fat body cells. Journal of Insect Physiology, 50:267-275.

105

Nénon JP (1995). Bioecology of Megarhyssa atrata (Hymenoptera: Ichneumonidae), an ectoparasitoid of Tremex columba (Hymenoptera: Siricidae) in Quebec. Phytoprotection, 76: 115- 122.

Nénon J-P, Kacem N & le Lannic JL (1997). Structure, sensory equipment, and secretions of the ovipositor in a giant species of Hymenoptera: Megarhyssa atrata F. (Ichneumonidae, Pimplinae). Canadian Entomologist, 129:789-799.

Nuttall MJ (1980). Insect parasites of Sirex (Hymenoptera: Ichneumonidae, Ibaliidae, and Orussidae). Forest and Timber Insects of New Zealand, 47:1-11.

Parkinson NM, Conyers CM, Keen JN, MacNicoll AD, Smith I & Weaver RJ (2003). cDNAs encoding large venom proteins from the parasitoid wasp Pimpla hypochondriaca identified by random sequence analysis. Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology, 134:513-20.

Parkinson N, Richards EH, Conyers C, Smith I & Edwards JP (2002). Analysis of venom constituents from the parasitoid wasp Pimpla hypochondriaca and cloning of a cDNA encoding a venom protein. Insect Biochemistry and Molecular Biology, 32:729-735.

Parkinson NM, Smith I, Weaver R & Edwards JP (2001). A new form of arthropod phenoloxidase is abundant in venom of the parasitoid wasp Pimpla hypochondriaca. Insect Biochemistry and Molecular Biology, 31:57-63.

Parkinson NM & Weaver RJ (1999). Noxious components of venom from the pupa-specific parasitoid Pimpla hypochondriaca. Journal of Invertebrate Pathology, 73:74-83.

Penn O, Privman E, Ashkenazy H, Landan G, Graur D & Pupko T (2010). GUIDANCE: a web server for assessing alignment confidence scores. Nucleic Acids Research, 38:W23-8.

Pennacchio F & Strand MR (2006). The evolution of developmental strategies in parasitic Hymenoptera. Annual Review of Entomology, 51:233-58.

Pennacchio F, Caccia S & Digilio MC (2014). Host regulation and nutritional exploitation by parasitic wasps. Current Opinion in Insect Science, 6:74-79.

Petersen TN, Brunak S, von Heijne G & Nielsen H (2011). SignalP 4.0: discriminating signal peptides from transmembrane regions. Nature Methods, 8:785-786.

Pettersen RC (1984). The chemical composition of wood. The chemistry of solid wood, 207:57- 126.

Poirié M, Colinet D & Gatti JL (2014). Insights into function and evolution of parasitoid wasp venoms. Current Opinion in Insect Science, 6:52-60.

Quicke DLJ (1997). Parasitic Wasps. Chapman and Hall, London.

Quicke DLJ (2015). The Braconid and Ichneumonid Parasitoid Wasps: Biology, Systematics, Evolution and Ecology. John Wiley and Sons, New York.

Quicke DLJ, LeRac A & Vilhelmsen L (2000). Ovipositor structure and function in the parasitic

106

Hymenoptera with an exploration of new hypotheses. Rendiconti, 47:197-239.

Posada D (2008). jModelTest: phylogenetic model averaging. Molecular Biology and Evolution, 25:1253-1256.

Powell W, Pennacchio F, Poppy GM & Tremblay E (1998). Strategies involved in the location of hosts by the parasitoid Aphidius ervi Haliday (Hymenoptera: Braconidae: Aphidiinae). Biological Control, 11: 104-112.

Ratnasingham S & Hebert PDN (2007). BOLD: The Barcode of Life Data System (http://www. barcodinglife. org). Molecular Ecology Notes, 7:355-364.

Rasnitsyn AP (1988). An outline of evolution of the hymenopterous insects (order Vespida). Oriental Insects, 22:115-45.

Rawlings GB (1957). Guiglia schauinslandi (Ashmead) (Hym. Orussidae), a parasite of Sirex noctilio (Fabricius) in New Zealand. Entomologist, 90:35-36.

Richards EH & Edwards JP (2002a). Larvae of the ectoparasitic wasp, Eulophus pennicornis, release factors which adversely affect haemocytes of their host, Lacanobia oleracea. Journal of Insect Physiology, 48:845-855.

Richards EH & Edwards JP (2002b). Parasitism of Lacanobia oleracea (Lepidoptera) by the ectoparasitic wasp, Eulophus pennicornis, disrupts the cytoskeleton of host haemocytes and suppresses encapsulation in vivo. Archives of Insect Biochemistry and Physiology, 49:108-124.

Rodgers CJ, Blanford CF, Giddens SR, Skamnioti P, Armstrong FA & Gurr SJ (2010). Designer laccases: a vogue for high-potential fungal enzymes? Trends in Biotechnology, 28:63-72.

Rodriguez JJ, Fernández‐Triana JL, Smith MA, Janzen DH, Hallwachs W, Erwin TL & Whitfield JB (2013). Extrapolations from field studies and known faunas converge on dramatically increased estimates of global microgastrine parasitoid wasp species richness (Hymenoptera: Braconidae). Insect Conservation and Diversity, 6:530-536.

Rodriguez F, Oliver JL, Marin A & Medina JR (1990). The general stochastic model of nucleotide substitution. Journal of Theoretical Biology, 142:485-501.

Rohwer SA (1912). Studies in the woodwasp superfamily Oryssoidea, with descriptions of new species. Proceedings of the United States National Museum, 43:141-158.

Rohwer SA & Cushman RA (1917). Idiogastra, a new suborder of Hymenoptera with notes on the immature stages of Orussus. Proceedings of the Entomological Society of Washington, 19:89- 98.

Ronquist F & Huelsenbeck JP (2003). MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics, 19:1572-1574.

Ross HH (1937). A generic classification of the Nearctic sawflies (Hymenoptera: Symphyta). Illinois Biological Monographs, 15:1-173.

107

Rozen S & Skaletsky H (1999). Primer3 on the WWW for general users and for biologist programmers. Bioinformatics Methods and Protocols (pp. 365-386). Humana Press.

Rubin EM (2008). Genomics of cellulosic biofuels. Nature, 454:841-845.

Ruiz‐Dueñas FJ & Martínez ÁT (2009). Microbial degradation of lignin: how a bulky recalcitrant polymer is efficiently recycled in nature and how we can take advantage of this. Microbial Biotechnology, 2:164-177.

Schubert C (2006). Can biofuels finally take centre stage? Nature Biotechnology, 24:777-784.

Schulz MH, Zerbino DR, Vingron M & Birney E (2012). Oases: robust de novo RNA-seq assembly across the dynamic range of expression levels. Bioinformatics, 28:1086-1092.

Schwarz G (1978). Estimating the dimension of a model. The Annals of Statistics, 6:461-464.

Sela I, Ashkenazy H, Katoh K & Pupko T (2015). GUIDANCE2: accurate detection of unreliable alignment regions accounting for the uncertainty of multiple parameters. Nucleic Acids Research, 43:W7-W14.

Sethi A, Slack J, Kovaleva ES, Buchman GW & Scharf ME (2012). Lignin-associated metagene expression in a lignocellulose-digesting termite. Insect Biochemistry and Molecular Biology, 43:91-101.

Sharkey MJ, Carpenter JM, Vilhelmsen L, Heraty J, Liljeblad J, Dowling AP, Schulmeister S, Murray D, Deans AR, Ronquist F, Krogmann L (2012). Phylogenetic relationships among superfamilies of Hymenoptera. Cladistics, 28:80-112.

Shelby KS & Webb BA (1999). Polydnavirus-mediated suppression of insect immunity. Journal of Insect Physiology, 45:507-514.

Sidjanski S, Mathews GV & Vanderberg JP (1997). Electrophoretic separation and identification of phenoloxidases in hemolymph and midgut of adult Anopheles stephensi mosquitoes. Journal of Parasitology, 83:686-691.

Smith MA, Rodriguez JJ, Whitfield JB, Deans AR, Janzen DH, Hallwachs W & Hebert PDN (2008). Extreme diversity of tropical parasitoid wasps exposed by iterative integration of natural history, DNA barcoding, morphology, and collections. Proceedings of the National Academy of Sciences, 105:12359-12364.

Smith MA, Fernández-Triana J, Roughley R & Hebert PDN (2009). DNA barcode accumulation curves for understudied taxa and areas. Molecular Ecology Resources, 9:208216.

Smith MA, Eveleigh ES, McCann KS, Merilo MT, McCarthy PC & Van Rooyen KI (2011). Barcoding a quantified food web: crypsis, concepts, ecology and hypotheses. PLoS One, 6:e14424.

108

Smith MA, Fernández‐Triana JL, Eveleigh E, Gómez J, Guclu C, Hallwachs W, Hebert PDN, Hrcek J, Huber JT, Janzen D, Mason PG, Miller S, Quicke DLJ, Rodriguez JJ, Rougerie R, Shaw MR, Várkonyi G, Ward DF, Whitfield JB & Zaldívar‐Riverón A (2013). DNA barcoding and the taxonomy of Microgastrinae wasps (Hymenoptera: Braconidae): impacts after 8 years and nearly 20,000 sequences. Molecular Ecology Resources, 13:168-176.

Solomon EI, Sundaram UM & Machonkin TE (1996). Multicopper oxidases and oxygenases. Chemical Reviews, 96:2563-2605.

Šribar J, Anderluh G, Fox JW & Križaj I (2005). Protein disulphide isomerase binds ammodytoxin strongly: possible implications for toxin trafficking. Biochemical and Biophysical Research Communications, 329:733-7.

Stahlhut JK, Fernández-Triana J, Adamowicz SJ, Buck M, Goulet H, Hebert PD, Huber JT, Merilo MT, Sheffield CS, Woodcock T & Smith MA (2013). DNA barcoding reveals diversity of Hymenoptera and the dominance of parasitoids in a sub-arctic environment. BMC Ecology, 13:2.

Steentoft C, Vakhrushev SY, Joshi HJ, Kong Y, Vester‐Christensen MB, Katrine T, Schjoldager BG, Lavrsen K, Dabelsteen S, Pedersen NB & Marcos‐Silva L (2013). Precision mapping of the human O‐GalNAc glycoproteome through SimpleCell technology. The EMBO journal, 32:1478- 88.

Stillwell MA (1967). The pigeon tremex, Tremex columba (Hymenoptera: Siricidae), in New Brunswick. Canadian Entomologist, 99:685-689.

Stoltz DB, Guzo D, Belland ER, Lucarotti CJ & MacKinnon EA (1988). Venom promotes uncoating in vitro and persistence in vivo of DNA from a braconid polydnavirus. Journal of General Virology, 69:903-907.

Stoltz DB, Krell P, Summers MD & Vinson SB (1984). Polydnaviridae - a proposed family of insect viruses with segmented, double-stranded, circular DNA genomes. Intervirology, 21:1-4. Stoltz DB, Vinson SB (1979). Viruses and parasitism in insects. Advances in Virus Research, 24:125-171.

Strand MR (2010). Polydnaviruses. In: Asgari S, Johnson KN (eds). Insect Virology (pp. 171- 197). Caister Academic Press, Norfolk, UK. Strand MR & Burke GR (2012). Polydnaviruses as symbionts and gene delivery systems. PLoS Pathogens, 8:e1002757. doi:10.1371/journal.ppat.1002757

Strand MR & Dover BA (1991). Developmental disruption of Pseudoplusia includens and Heliothis virescens larvae by calyx fluid and venom of Microplitis demolitor. Archives of Insect Biochemistry and Physiology, 18:131-145.

Strand MR & Drezen J-M (2012). Family polydnaviridae. In: King AMQ, Adams MJ, Carstens EB & Lefkowitz EJ (eds). Virus taxonomy: ninth report of the international committee on taxonomy of viruses (pp. 237-248). Amsterdam: Elsevier.

Strand MR & Noda T (1991). Alterations in the haemocytes of Pseudoplusia includens after parasitism by Microplitis demolitor. Journal of Insect Physiology, 37:839-850.

109

Strand MR & Pech LL (1995). Immunological basis for compatibility in parasitoid-host relationships. Annual Review of Entomology, 40:31-56.

Swofford DL (2002). PAUP*: Phylogenetic Analysis Using Parsimony (and Other Methods) 4.0 Beta 10. MA: Sinauer, Sunderland.

Tanaka K, Lapointe R, Barney WE, Makkay AM, Stoltz D, Cusson M & Webb BA (2007). Shared and species-specific features among ichnovirus genomes. Virology, 363:26-35.

Taylor KL (1976). The introduction and establishment of insect parasitoids to control Sirex noctilio in Australia. Entomophaga, 21:429-440.

Taylor KL (1978). Evaluation of the insect parasitoids of Sirex noctilio (Hymenoptera: Siricidae) in Tasmania. Oecologia, 32:1-10.

Theilmann DA & Summers MD (1987). Physical analysis of the Campoletis sonorensis virus multipartite genome and identification of a family of tandemly repeated elements. Journal of Virology, 61:2589-2598.

Thompson JD, Higgins DG & Gibson TJ (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research, 22:4673-80.

Townes HK (1944). A Catalogue and Reclassification of the Nearctic Ichneumonidae (Hymenoptera). Part I. The subfamilies Ichneumoninae, Tryphoninae, Cryptinae, Phaeogeninae and Lissonotinae. Memoirs of the American Entomological Society, 11:1-477.

Townes HK (1969). The genera of Ichneumonidae, Part 1. Memoirs of the American Entomological Institute, 11:300.

Townes HK & Townes M (1951). Family Ichneumonidae. In: Muesebeck CFW, Krombein KV,

Townes HK & Townes M (1960). Ichneumon-flies of American north of Mexico: 2 Subfamily Ephialtinae, Xoridinae, Acaenitinae. United States National Museum Bulletin, 216:1-676.

Treherne RC (1916). A preliminary list of parasitic insects known to occur in Canada. Reports of the Entomological Society of Ontario, 46:178-193.

Tribe GD & Cillié JJ (2004). The spread of Sirex noctilio Fabricius (Hymenoptera: Siricidae) in South African pine plantations and the introduction and establishment of its biological control agents. African Entomology, 12:9-17.

Turlings TC, Tumlinson JH, Heath RR, Proveaux AT & Doolittle RE (1991). Isolation and identification of allelochemicals that attract the larval parasitoid, Cotesia marginiventris (Cresson), to the microhabitat of one of its hosts. Journal of Chemical Ecology, 17:2235-2251.

Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M & Rozen SG (2012). Primer3 - new capabilities and interfaces. Nucleic Acids Research, 40:e115.

Valentine EW & Walker AK (1991). Annotated catalogue of New Zealand Hymenoptera. D.S.I.R. Plant Protection.

110

Vet LE (1999). Evolutionary aspects of plant-carnivore interactions. In: Chadwick DJ & Goode JA (eds). Insect-Plant Interactions and Induced Plant Defence, Novartis Foundation Symposium 223 (pp. 3-13). John Wiley & Sons, Ltd, Chichester.

Vetter I, Davis JL & Rash LD (2011). Venomics a new paradigm for natural products based drug discovery. Amino Acids, 40:15-28.

Vilhelmsen L, Isidoro N, Romani R, Basibuyuk HH & Quicke DL (2001). Host location and oviposition in a basal group of parasitic wasps: the subgenual organ, ovipositor apparatus and associated structures in the Orussidae (Hymenoptera, Insecta). Zoomorphology, 121:63-84.

Vincent JFV & King MJ (1995). The mechanism of drilling by wood wasp ovipositors. Biomimetics, 3:187-201.

Wäckers FL, Mitter E & Dorn S (1998). Vibrational sounding by the pupal parasitoid Pimpla (Coccygomimus) turionellae: an additional solution to the reliability-detectability problem. Biological Control, 11:141-146.

Wahl DB & Gauld ID (1998). The cladistics and higher classification of the Pimpliformes (Hymenoptera: Ichneumonidae). Systematic Entomology, 23:265-298.

Wan C & Li Y (2012). Fungal pretreatment of lignocellulosic biomass. Biotechnology Advances, 30:1447-1457.

Webb BA, Beckage NE, Hayakawa Y, Krell PJ, Lanzrein B, Strand MR, Stoltz DB & Summers MD (2000). Family Polydnaviridae. In: van Regenmortel CMF, Bishop DHL, Carstens EC, Estes MK, Lemon SM, Maniloff J, Mayo MA, McGeoch DJ, Pringle CR, Wickner RB (eds). Taxonomy of Viruses: VII Report of the International Committee on Virus Taxonomy (pp. 253-259). Academic Press, London.

Webb BA & Strand MR (2005). The biology and genomics of polydnaviruses. Comprehensive Molecular Insect Science, 6:323-60.

Whitfield JB (1998). Phylogeny and evolution of host-parasitoid interactions in Hymenoptera. Annual Review of Entomology, 43:129-51.

Whitfield JB (2003). Phylogenetic insights into the evolution of parasitism in Hymenoptera. Advances in Parasitology, 54:69-100.

Whitman DW & Eller FJ (1990). Parasitic wasps orient to green leaf volatiles. Chemoecology, 1:69-76.

Whitfield JB & Kjer KM (2008). Ancient rapid radiations of insects: challenges for phylogenetic analysis. Annual Review of Entomology, 53:449-472.

Wiemers M, Keller A & Wolf M (2009). ITS2 secondary structure improves phylogeny estimation in a radiation of blue butterflies of the subgenus Agrodiaetus (Lepidoptera: Lycaenidae: Polyommatus). BMC Evolutionary Biology, 9:300.

111

Windley JM, Herzig V, Dziemborowicz SA, Hardy MC, King GF & Nicholson GM (2012). Spider-venom peptides as bioinsecticides. Toxins, 4:191-227.

Xu DM & Stoltz D (1991). Evidence for a chromosomal location of polydnavirus DNA in the ichneumonid parasitoid Hyposoter fugitivus. Journal of virology, 65:6693-6704.

Yang Z (1997). PAML: a program package for phylogenetic analysis by maximum likelihood. Computer Applications in the Biosciences: CABIOS, 13:555-556.

Yang Z, Nielsen R, Goldman N & Krabbe Pedersen A-M (2000). Codon-substitution models for heterogeneous selection pressure at amino acid sites. Genetics, 155:431-434.

Yoshida H (1883). Chemistry of Lacquer (Urusbz) part 1. Journal of the Chemical Society, 43:72-486.

Yu DSK, van Achterberg C & Horstmann K (2012). Taxapad 2012, Ichneumonoidea 2011. Database on flash-drive. www.taxapad.com, Ottawa, Ontario, Canada.

Zaldivar J, Nielsen J & Olsson L (2001). Fuel ethanol production from lignocellulose: a challenge for metabolic engineering and process integration. Applied Microbiology and Biotechnology, 56:17-34.

Zerbino DR & Birney E (2008). Velvet: algorithms for de novo short read assembly using de Bruijn graphs. Genome Research, 18:821-829.

Zhang G, Schmidt O & Asgari S (2004). A novel venom peptide from an endoparasitoid wasp is required for expression of polydnavirus genes in host hemocytes. Journal of Biological Chemistry, 279:41580-41585.

Zhu J‐Y, Fang Q, Wang L, Hu C & Ye G-Y (2010). Proteomic analysis of the venom from the endoparasitoid wasp Pteromalus puparum (Hymenoptera: Pteromalidae). Archives of Insect Biochemistry and Physiology, 75:28-44.

Zhu Y, Ye XH, Liu Y, Yan ZC, Stanley D, Ye GY & Fang Q (2015). A venom gland extracellular chitin-binding-like protein from pupal endoparasitoid wasps, Pteromalus puparum, selectively binds chitin. Toxins, 7:5098-5113.

Zwickl DJ (2006). Genetic algorithm approaches for the phylogenetic analysis of large biological sequence datasets under the maximum likelihood criterion. PhD dissertation. The University of Texas at Austin. [http://garli.nescent.org]

112

VITA

Place of Birth

Cheltenham, United Kingdom

Education

University of Kentucky, Lexington, KY, USA 2011-2016

Doctorate: Entomology, May 2016 (expected)

University of Bristol, United Kingdom 2003-2006

Bachelor of Science: Zoology, June 2006

Professional Experience

University of Kentucky, USA 2011-present

Research Assistant

Teaching Assistant for General Entomology (ENT 300) Fall 2014

Teaching Assistant for Insect Biology (ENT 110) Fall 2015

Institute of Zoology, London, United Kingdom 2009-2011

Research Technician

University of Cape Town, South Africa 2009

Laboratory Technician

SOS-Hermann Gmeiner Children‟s Villages, Awassa, Ethiopia 2008

IGCSE Teacher

University of Bristol, United Kingdom 2006-2008

Research Assistant

113

Scholastic & Professional Honors

Awards

- Clarke & Knapp Travel Award (2012)

- University of Kentucky Graduate School Travel Award (2012)

- University of Kentucky Graduate School Travel Award (2013)

- University of Kentucky Publication Submission Award (2014)

- Best Poster Finalist, Kentucky Innovation & Entrepreneurship Conference (2014)

- 3rd Place, Three-Minute Thesis for Doctoral Students, University of Kentucky (2014)

- 2nd Place, 10 Minute Oral Presentation Student Competition, Entomological Society of

America Annual Meeting (2014)

- NSF Diversity Scholarship to attend SEEC (2015)

- University of Kentucky Publication Award (2015)

- Awarded membership to AAAS/Science Program for Excellence in Science (2015)

- University of Kentucky Publication Award (2016)

Grants/Fellowships

- Karri Casner Environmental Sciences Fellowship Award for Research (2014) - $1,088

- University of Kentucky Graduate School Academic Year Fellowship (2014) - $15,000

- Kentucky Science & Engineering Foundation Research & Developmental Excellence Program

(2014) - $29,982

Publications

- Dornhaus A, Holley J-A, Pook VG, Worswick G & Franks FR (2008). Why do not all workers work? Colony size and workload during emigrations in the ant Temnothorax albipennis.

Behavioural Ecology and Sociobiology, 63 (1): 43-51.

- Windmill JF, Pook VG, & Robert D (2008). The nanomechanics of mechanosensory neurones in vivo. The Journal of the Acoustical Society of America, 123(5), 3772-3772.

114

- Jackson JC, Windmill JFC, Pook VG, & Robert D (2009). Synchrony through twice-frequency forcing for sensitive and selective auditory processing. Proceedings of the National Academy of

Sciences U. S. A., 106(25): 10177–10182.

- Pook VG, Chapman EG, Janzen DH, Hallwachs W, Smith MA & Sharkey MJ. (2015)

Polydnavirus gene provides accurate identification of species in the genus Hyposoter

(Hymenoptera: Ichneumonidae). Insect Conservation & Diversity doi: 10.1111/icad.12118

- Pook VG, Sharkey MJ & Wahl DB (2016). Key to the species of Megarhyssa (Hymenoptera:

Ichneumonidae: Rhyssinae) in America, north of Mexico. Deutsche Entomologische Zeitschrift

63(1): 137-148.

- Pook VG, Palli SR & Sharkey MJ (2016). Insights into the venom of the parasitoid wasp,

Megarhyssa (Hymenoptera: Ichneumonidae). In prep.

- Windmill JFC, Jackson JC, Pook VG & Robert D. (submitted). Motility of in vivo mechanosensory neurons reveals non-linear feedback in the mosquito ear. Submitted to

Proceedings of the Natural Academy of Sciences of the United States of America.

Victoria G. Pook

115