Difficulties in the molecular diagnosis of helicobacter rodent infections Scott Poynter, Julian D. Phipps, Angel Naranjo-Pino, Jose M. Sanchez-Morgado
To cite this version:
Scott Poynter, Julian D. Phipps, Angel Naranjo-Pino, Jose M. Sanchez-Morgado. Difficulties in the molecular diagnosis of helicobacter rodent infections. Veterinary Microbiology, Elsevier, 2009, 134 (3-4), pp.272. 10.1016/j.vetmic.2008.08.009. hal-00532462
HAL Id: hal-00532462 https://hal.archives-ouvertes.fr/hal-00532462 Submitted on 4 Nov 2010
HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Accepted Manuscript
Title: Difficulties in the molecular diagnosis of helicobacter rodent infections
Authors: Scott Poynter, Julian D. Phipps, Angel Naranjo-Pino, Jose M. Sanchez-Morgado
PII: S0378-1135(08)00332-5 DOI: doi:10.1016/j.vetmic.2008.08.009 Reference: VETMIC 4118
To appear in: VETMIC
Received date: 1-4-2008 Revised date: 31-7-2008 Accepted date: 14-8-2008
Please cite this article as: Poynter, S., Phipps, J.D., Naranjo-Pino, A., Sanchez- Morgado, J.M., Difficulties in the molecular diagnosis of helicobacter rodent infections., Veterinary Microbiology (2007), doi:10.1016/j.vetmic.2008.08.009
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. Manuscript
1 Difficulties in the molecular diagnosis of helicobacter rodent infections.
2
3 Scott Poynter 1, Julian D. Phipps 1, Angel Naranjo-Pino 2 and Jose M. Sanchez-
4 Morgado *3
5
6 1Laboratory Animal Science, GlaxoSmithkline, The Frythe, Welwyn, Herts,
7 AL6 9AR, UK.
8 2Centro Nacional de Biotecnologia, C/ Darwin 3, Campus de Cantoblanco,
9 28049 Madrid (Spain)
10 3MRC-National Institute for Medical Research, The Ridgeway, Mill Hill,
11 London, NW7 1AA, UK.
12 *Corresponding author. Fundación Centro Nacional de Investigaciones
13 Cardiovasculares Carlos III (CNIC), C/ Melchor Fernández Almagro 3, 28029
14 Madrid, Spain. Fax: + 34 914531265. E-mail: [email protected]
15
16
17
18
19 Accepted Manuscript
1
Page 1 of 31 20 Abstract
21
22 Molecular diagnostic methods using the polymerase chain reaction (PCR) are
23 the gold standard in Helicobacter diagnostics. Most rely on the amplification
24 of parts of the 16S rRNA gene sequence. Therefore, the validity and accuracy
25 of results depends heavily on the PCR design at the time of its publication
26 even though new sequences are constantly published. Here we report
27 inconsistency amongst different commercial laboratories in identifying
28 Helicobacter hepaticus infection in commercially bred mice supposedly free of
29 this infection. Furthermore, 3 out of 6 different commercial laboratories
30 performing helicobacter testing on the same spiked faecal samples failed to
31 detect and identify H.hepaticus . We designed a simple generic PCR assay
32 that amplifies a 261 bp amplicon spanning two of the seven variable regions
33 in the 16S rRNA of helicobacter. Using this assay together with an
34 established generic assay designed by Bohr (Bohr et al., 2002) and then
35 cloning and sequencing their products, we detected the H.hepaticus used in
36 the study that three commercial laboratories failed to detect. We also think we
37 can detect all the currently known species of helicobacter and hopefully the
38 new ones as well. And we have been able to identify different species of
39 helicobacter and their relative proportions infecting a single animal. This 40 informationAccepted has also shown that some helicobacters Manuscript may have a much 41 broader host range than originally reported.
42
43
44 Keywords: Helicobacter , rodents, PCR.
2
Page 2 of 31 45 1. Introduction
46 Since the identification of Helicobacter hepaticus in mice, many different PCR
47 assays have been developed for the detection and identification of
48 Helicobacter in rodents. This is due to the difficulty in growing the bacteria in
49 culture. Most Helicobacter diagnostic PCRs target the 16S ribosomal RNA
50 gene (Battles et al., 1995; Beckwith et al., 1997; Fermer et al., 2002; Ge et
51 al., 2001; Grehan et al., 2002; Mahler et al., 1998; Nilsson et al., 2004; Riley
52 et al., 1996; Shames et al., 1995). A current search of sequences for the 16S
53 ribosomal RNA gene of Helicobacter spp in NCBI produces at least 513
54 different sequences (Table 1). This is a growing database, which constantly
55 incorporates new sequences to the genus. Therefore, the validity and
56 accuracy of results depends heavily on the PCR design and the time of its
57 publication. Nowadays the genus contains 31 formally named species
58 (http://www.bacterio.cict.fr/h/helicobacter.html).14 are currently known to
59 infect rodents, and 9 of them have been found in mice (Fox and Whary, 2007)
60 In 2001, H. hepaticus -free mice received straight from commercial vendors
61 tested positive in our laboratory for this organism by two different PCR assays
62 (Mahler et al., 1998; Shames et al., 1995), culture and electron microscopy.
63 This prompted an investigation into the cause of this discrepancy in health
64 status. 65 Here, weAccepted report further inconsistencies between Manuscript different commercial 66 laboratories in identifying H. hepaticus on the same spiked faecal samples in
67 2007. We also highlight the deficiencies of two published assays (Mahler et
68 al., 1998; Shames et al., 1995) used in our laboratory in 2001 by cloning and
69 sequencing their products. We have also designed a simple generic PCR
3
Page 3 of 31 70 assay that amplifies a 261 bp amplicon, which was validated with and proved
71 as effective as an already published 800 bp assay also used for generic
72 helicobacter testing (Bohr et al., 2002).
73 Finally, by cloning and sequencing the products from several different PCR
74 assays we have been able to identify the species of helicobacter and their
75 relative proportions infecting a single animal and to show that some species
76 of helicobacter have a much broader host range than originally reported. The
77 new 261bp assay also detected a naturally occurring infection by a single
78 helicobacter strain in a mouse facility that some currently used assays failed
79 to detect.
Accepted Manuscript
4
Page 4 of 31 80 2. Materials and Methods.
81 2.1. H. hepaticus strain MIT 96-1809 controls.
82 H. hepaticus strain MIT 96-1809 was grown on trypticase soy broth
83 supplemented with 10% foetal calf serum at 37 oC. Genomic DNA from H.
84 hepaticus strain MIT 96-1809 was extracted using the DNeasy Tissue Kit
85 (QIAGEN, West Sussex, UK) and quantified by quantitative PCR. Dilutions of
86 10 7, 10 5 and 100 genomic DNA copies were prepared. Three triplicates of
87 each dilution plus a negative sample were pippeted into eppendorfs to which
88 a faecal pellet from Helicobacter negative animals was added. In 2007 ten
89 samples were sent frozen at -20 oC from Centro Nacional de Biotecnología
90 (CNB) in Madrid to each of six different commercial laboratories, two of them
91 located in the US and four of them in Europe, plus to MRC-NIMR for PCR
92 helicobacter detection. Diagnostic laboratories were named A, B, C, D, E and
93 F.
94 2.2. Bacteria.
95 The following NCTC/ATCC bacteria strains have been used in this study:
96 H. hepaticus (ATCC 51448), H. muridarum (NCTC 12714), H. cinaedi (NCTC
97 11611), H. fennelliae (NCTC 11612), H. canis (NCTC 12220) H. pylori
98 (NCTC 11637), H. nemestrinae (NCTC 12491), H. acinonychis (NCTC
99 12686), H. mustelae (NCTC12031), H. bilis (ATCC 51630), H. rodentium 100 (NCTC 700285Accepted ), Staphylococcus aureus (NCTCManuscript 10017), Escherichia coli 101 (NCTC10002), Yersinia enterocolitica (NCTCC 10460), Streptobacillus
102 moniliformis (NCTC 10651), Salmonella typhimurium (NCTC 12416) ,
103 Salmonella enteritidis (NCTC 12694) Pasteurella pneumotropica (ATCC
104 35149), Campylobacter jejuni (NCTC 10983), Campylobacter coli (NCTC
5
Page 5 of 31 105 11350), Campylobacter fetus (NCTC 10384) Shigella flexneri (NCTC 10512),
106 Shigella boydii (NCTC 10024) Shigella sonnei (NCTC 10352). A laboratory
107 isolate identified by biochemical characteristics and DNA sequencing was
108 also used: Actinobacillus muris (EF597221) .
109 All the bacteria except the helicobacter species were grown on Horse Blood
o 110 agar (Oxoid Limited, Hampshire, UK) at 37 C in an atmosphere of 5% CO 2.
111 The helicobacter strains were cultured on H. pylori selective medium (Oxoid
112 Limited, Hampshire, UK) in a MACS VA Variable Atmosphere Workstation
113 (Don Whitley Scientific Limited, West Yorkshire, UK) with 88% Nitrogen, 2%
114 Oxygen, 5% Hydrogen and 5% Carbon dioxide at 37°C. H. ganmani was
115 cultured anaerobically in a MACS VA Variable Atmosphere Workstation (Don
116 Whitley Scientific Limited, West Yorkshire, UK) with a 10% Carbon dioxide,
117 10% hydrogen and 80% nitrogen gas mixture.
118 2.3. DNA extraction.
119 DNA was extracted from bacteria using the Qiagen QIAamp Kit and from
120 faecal samples using the Qiagen Stool Kit (QIAGEN, West Sussex, UK)
121 according to the manufacturer's instructions. The DNA was dissolved in 200
122 µl of elution buffer (AE buffer, QIAGEN, West Sussex, UK) and stored at –
123 70 0C. PCR products for cloning and sequencing were cleaned using the
124 QIAquick kit (QIAGEN, West Sussex, UK) according to the manufacturer's 125 instructions.Accepted Manuscript 126 2.4. PCR assay.
127 Table 2 shows the various primers used in this study. PCRs were carried out
128 as follows: 50 ng of template was added to a PCR mix containing 2 mM
129 dNTPs, 10 pmol of each primer, and 2.5 units of HotStart Taq DNA
6
Page 6 of 31 130 polymerase (QIAGEN, West Sussex, UK) in PCR buffer containing 15 mM
131 MgCl 2. PCR for the Helicobacter spp assay and the H. hepaticus assay
132 followed conditions defined previously (Mahler et al. 1998; Shames et al.
133 1995). PCR conditions for the 800 bp (Bohr et al. 2002) consisted of an initial
134 denaturation step of 940C for 5 minutes followed by 35 cycles of 94 0C for 15
135 seconds, 65 0C for 45 seconds and 72 0C for 90 seconds, and a final extension
136 step at 72 0C for 10 minutes. A new PCR assay (261bp assay) was developed
137 that amplified a 261 nucleotide fragment (Table 2) (Poynter, 2004; Sanchez-
138 Morgado, 2004; Sanchez-Morgado and Poynter, 2003). Conditions for the
139 261 bp assay were identical to the 800bp assay except for an annealing
140 temperature of 50 0C. PCR was performed using the Robocycler Gradient 96
141 (Stratagene, London, UK). Amplified DNA was resolved by use of gel
142 electrophoresis in ethidium bromide prestained 1.5% agarose gels.
143 2.5. Quantitative PCR
144 Primers and probes were designed using the application Beacon Designer
145 (PREMIER Biosoft International, Palo Alto, USA) based on the sequence
146 H..hepaticus strain MIT 96-1809. Using Beacon Designer, the sense primer
147 (5-GGCAGCAGTAGGGAATATTG-3), antisense primer (5-
148 TCTAACAAAAGGAGTTTACAATCC-3) and antisense LNA probe 5-
149 cctTcaTccTccAcgc-3, LNA nucleotides in uppercase) were blast against 150 GeneBankAccepted sequences and shown to have crossManuscript homology with this strain of 151 H..hepaticus . We then optimised the maximum analytical sensitivity of the
152 assay using different concentrations of primers and probes. The standard
153 curve to calculate the genome copy number was done using pGEM-T cloning
154 vector containing the 5’ end, nucleotides 78 to 469, of the 16S ribosomal RNA
7
Page 7 of 31 155 gene from H. hepaticus strain MIT 96-1809 (pGEM-T-Hh16S (78-469)). The
156 reaction was carried out as follows: increasing concentrations of template
157 were added to a qPCR mix containing 12.5 ml of the A βgene Mix (Fisher
158 Scientific UK, Loughborough, UK), 600 nM of the forward primer, 800 nM of
159 the reverse primer and 250 nM of the dual labelled FAM-TAMRA probe.
160 Reaction conditions consisted of an initial denaturation step of 94 oC for 15
161 minutes followed by 40 cycles of 94 0C for 15 seconds and 60 0C for 60
162 seconds. QPCR was performed using the Mx3000P system (Stratagene,
163 London, UK). The lowest copy number we could detect was between 10 and
164 100 copies for the plasmid.
165 2.6. DNA cloning.
166 PCR products were cloned using pGEM-T Vector (Promega, Southampton,
167 UK), according to the manufacturer's instructions. Briefly, PCR products were
168 ligated using T4 DNA ligase (Promega, Southampton, UK) and the ligation
169 transformed by heat shock at 42 oC for 45 seconds into JM109 Escherichia
170 coli competent cells (Promega, Southampton, UK). Cells were incubated in 1
171 ml of SOC medium (2.0% tryptone, 0.5% yeast extract, 10 mM NaCl, 2.5 mM
172 KCl, 10 mM MgCl 2, 20 mM MgSO 4 and 20 mM glucose) and plated on Luria
173 Bertani (LB) medium (1.0% tryptone, 0.5% yeast extract and 171 m M NaCl)
174 plates containing ampicillin (100 µg/ml), IPTG (0.5 mM) and Xgal (80 µg/ml).
175 Positive Acceptedclones from each PCR product were Manuscript sent for sequencing.
176 2.7. DNA sequencing and sequence analysis.
177 Sequencing was carried out using the Big Dye Version 1.0 Sequence
178 Reaction Kit (Applied Biosystems, Foster City, C.A., U.S.A.). Samples were
8
Page 8 of 31 179 sequenced by use of an ABI Prism 3700 Capillary Sequencer (Applied
180 Biosystems, Foster City, C.A., U.S.A.)
181 Primers from all the PCR assays used in this study were used for sequencing.
182 Sequences were edited and analysed using EditSeq, Megalign and SeqMan
183 of Lasergene programs (DNAStar, Konstanz, Germany). Sequences were
184 identified using BLAST from the NCBI (National Center for Biotechnology
185 Information ( http://www.ncbi.nlm.nih.gov/BLAST/ )). 16S sequences were
186 analysed also using the ribosomal database project (Cole et al., 2005; Cole et
187 al., 2003).
Accepted Manuscript
9
Page 9 of 31 188 3. Results.
189 3.1. Commercial laboratory analysis of Helicobacter hepaticus strain MIT 96-
190 1809 controls.
191 Ten faecal pellets spiked with different amounts of H. hepaticus genomic DNA
192 were sent to 6 different commercial laboratories to test the reproducibility of
193 their helicobacter diagnostic assays. We asked for a positive or negative
194 result for Helicobacter spp . Only one of the positive samples, the higher copy
195 number, was consistently identified by three laboratories. Three of the
196 commercial laboratories were not able to identify any of the positive samples.
197 (Table 3). Samples were also analysed in our laboratory at MRC-NIMR
198 (control in table 3). After analysing the DNA extracted we found the two
199 highest copy triplicates to have lost one logarithmic unit.
200 3.2. Published H. hepaticus and H. species PCR tests.
201 We used two assays to detect the presence of helicobacter in the mice
202 received from commercial breeders in 2001. We followed Mahler’s method
203 (Mahler et al., 1998) to detect and differentiate H. muridarum , " H. rappini ," H.
204 hepaticus , and H. bilis , and Shame’s PCR (Shames et al., 1995) to detect H.
205 hepaticus . These assays detected H. hepaticus in mice from commercial
206 vendors supposedly H. hepaticus free. PCR products from these two assays
207 were cloned and then sequenced to discover exactly what they were 208 detecting.Accepted Initial focus was on the H. hepaticus Manuscript species assay due to concern 209 about H. hepaticus pathogenicity in mice. We found that out of 158 positive
210 samples only 42% of them corresponded to H. hepaticus sequences. 25% of
211 the samples gave poor sequencing results, or amplified DNA not present in
212 the GeneBank database (Table 4). The other 33% of sequences were
10
Page 10 of 31 213 identified as H. rappini , H. typhlonius , and Helicobacter spp . It is possible that
214 H.hepaticus could have been present in sequences identified as H. spp due
215 to too short a sequence for speciation. It is true to say then that 7% of
216 sequences were definitely not H.hepaticus but those identified as H.
217 typhlonius and H.rappini .
218 We also sequenced a small number of the generic assay products focusing
219 mostly on the 390 bp band, as this band is for H. bilis detection, and found
220 that 57% of the 390 bp bands amplified corresponded to H.bilis , 28% to H.
221 apodemus and 14% to H. ganmani . H. trogontum was detected in all the 210
222 bp band samples sequenced (Table 4).This band can also be generated by
223 the presence of H.hepaticus and H.muridarum.
224 3.3. Design and set up of a new 261 bp Helicobacter assay.
225 Since we were having problems with the reliability of current in-house
226 Helicobacter assays, we decided to look at the possibility of designing an
227 assay that would detect all the current and even potentially new Helicobacter
228 species. The 16S ribosomal RNA gene from the 14 different Helicobacter
229 species infecting rodents were aligned and variable regions along the
230 sequence were identified. The total length of the variable regions is about 314
231 nucleotides. We also observed in some sequences an insertion of up to 290
232 nucleotides at the 5’ end of the gene. We established that Helicobacter has 8 233 conservedAccepted and 7 variable regions plus an insertionManuscript on the 16S ribosomal RNA 234 gene (Fig 1). We designed primers that span the variable regions 3 and 4
235 (Table 2 and Fig 1). We validated our new primers together with a published
236 method (Bohr et al., 2002) that will amplify variable region 2 (Figure 1) against
11
Page 11 of 31 237 different helicobacter and non-helicobacter genomic DNA. The 261 bp assay
238 and the 800 bp assay amplified only helicobacter sequences (Fig 2).
239 We took one randomly chosen sample from each of 4 physically separated
240 known helicobacter positive animal facilities. 261 bp PCR products were
241 obtained and cloned. Plasmid DNA was purified then sequenced and blasted.
242 We managed to identify a single helicobacter infection and three multiple
243 helicobacter infections using the described new primers spanning variable
244 regions 3 and 4 (Table 5).
245 To improve the identification of the sequences obtained we decided to include
246 the 800 bp assay in parallel because of its larger product size. We ran both
247 assays on 32 samples from a different H.hepaticus positive colony. From 120
248 clones, a unique sequence corresponding to H. hepaticus strain MIT 96-1809
249 was identified and subsequently used for the spiked faecal samples study.
Accepted Manuscript
12
Page 12 of 31 250 4. Discussion
251 H.hepaticus free mice from commercial vendors tested positive for this
252 organism by PCR (Mahler et al., 1998; Shames et al., 1995), culture and
253 electron microscopy in 2001. We are not the first to report such a discrepancy
254 in the helicobacter status of commercially bred mice (Bohr et al., 2006). In
255 2007 we decided to send quantified spiked samples to different commercial
256 laboratories in order to check the consistency current helicobacter testing.
257 The amount of helicobacter excreted in infected animal’s faeces isn’t known
258 so we decided to send three different concentrations representing 10 7, 10 5
259 and 100 copies of the genome. When we analysed the same samples we saw
260 a loss in copy number of one logarithmic unit, which may be due to the DNA
261 extraction method used in our laboratory .Results showed an inconsistency
262 amongst different commercial laboratories performing helicobacter PCR tests
263 on the same samples. This suggests that the helicobacter status of many
264 rodent colonies may depend not on the presence of the bacteria but on the
265 laboratory performing the tests. Our findings support previous reports by Dew
266 (Dew et al., 1997) and Karkas (Karkas et al., 2000).
267 We also found that published PCR diagnostic methods for helicobacter can
268 fail to detect and identify this infection in rodents. We have proved by
269 sequencing, that the H. hepaticus assay (Shames et al., 1995) amplifies other 270 species ofAccepted this genus. The assay detected ManuscriptH.hepaticus, H.rappini and H. 271 typhlonius as well as other helicobacters (Table 4). A possible reason for
272 these high numbers of false-positive results was found when the primers were
273 compared with known sequences for some different helicobacters. The
274 reverse H.hepaticus PCR primer was able to anneal with sequences from H.
13
Page 13 of 31 275 aurati , H. rappini , H. trogontum , H. typhlonius , and H. hepaticus (Figure 3).
276 This primer then is non specific and could account for the different species
277 found when sequencing the PCR product from this assay.
278 The helicobacter generic assay was designed to detect H.muridarum,
279 H.hepaticus, H.bilis and “H. rappini “ (Mahler et al., 1998). We have found
280 additional helicobacters to those mentioned in the original paper as would be
281 expected (Table 4) .Some of these are relatively new and their significance
282 and host range is not established yet so this is all useful information.
283 H.trogontum was originally reported in rats ( Mendes E.N et al., 1996) and
284 H.apodemus in striped field mice (Jeon et al 2001).
285 Mahler’s PCR reverse primer hybridised with nucleotides 440-459 for H. bilis
286 U18766, and with nucleotides 261-280 for H. bilis AF047847. Different
287 positions of sequences complementary for this primer found even in the same
288 species ( H. bilis ), could account for the different sequences found when the
289 390bp band from this assay was sequenced. This helps explain why the
290 helicobacters could not always be speciated from the assay result alone.
291 The generic assay does not always give a 210bp band when H.hepaticus is
292 known to be present in the same sample after the PCR product was
293 sequenced from the H.hepaticus assay. Unless the two assays were run in
294 parallel one could wrongly assume H.hepaticus to be absent in these 295 samples.Accepted This may suggest some strains ofManuscript H. hepaticus have changed in the 296 region targeted by the generic primers or that there could be a new
297 helicobacter species present in the animal.
298 The deficiencies found in these primers may also explain the reported
299 discrepancies found between different laboratories when testing the same
14
Page 14 of 31 300 samples. Different laboratories are using different primers with their own
301 inherent strengths or weaknesses and this, coupled with the fact that
302 individual animals may intermittently shed helicobacter and harbour more
303 than one species makes complete correlation highly unlikely. We have shown
304 that with some assays it is necessary to sequence amplified DNA before it
305 can be relied on to speciate an organism. In addition to all this, new
306 helicobacters in rodents are being reported often enough to make old assays
307 invalid by drastically reducing the number of positions in the 16S rRNA gene
308 specific for any particular species. An example of this is H. typhlonius cross
309 reacting with in house H.hepaticus primers as shown in the results (Table 5).
310 H.typhlonius was first reported in 1999 (Franklin et al., 1999) and the details
311 of the H.hepaticus assay were first published in 1995 (Shames et al., 1995).
312 Other helicobacter assay primers may frequently amplify other unwanted
313 helicobacter sequences or, even worse, other closely related bacteria. In
314 some cases they may miss sequences they were supposed to detect.
315 To improve testing, we designed a simple generic PCR assay that generates
316 a 261 bp amplicon and amplifies variable regions 3 and 4 of the 16S rRNA
317 gene of all the current and even potentially new helicobacter species. This
318 PCR was used together with a published generic PCR (Bohr et al., 2002) that
319 spans variable region 2. By cloning and sequencing the products from these 320 two differentAccepted PCR assays we have been ableManuscript to identify different species of 321 helicobacter and their relative proportions infecting a single animal, to identify
322 species of helicobacter with a broader host range than originally reported, and
323 to identify a naturally occurring infection by a single Helicobacter strain in a
324 mouse facility. The cloned 261 bp product gave us more information after
15
Page 15 of 31 325 sequencing on how many different helicobacter species are present in one
326 animal (Table 5). H. cinaedi has previously been reported in Hamsters,
327 Rhesus monkeys, rats, dogs ,foxes, and people (Fox et al., 2001) but not to
328 our knowledge in mice. This is another example of how such an approach can
329 shed light on the host range of different helicobacters.
330 The larger 800 bp fragment gave us more information after sequencing for
331 the purpose of speciation. However a smaller PCR product is advantageous
332 when trying to amplify DNA extracted from formalin fixed tissue. This is
333 because the DNA from such samples tends to degrade into shorter lengths as
334 has been shown previously (Greer et al., 1995). The 261 bp PCR assay could
335 be used in formalin fixed tissues although we have not tried this yet.
336 Clearly, there are issues with the diagnosis of helicobacter in mice which
337 could lead to the introduction of positive animals into negative colonies with
338 animal welfare and research implications. The level of excretion in faeces of
339 helicobacter infected animals should be quantified in the future so we can
340 evaluate a diagnostic test against a limit of detection. We can discard
341 reliability issues related to the presence of unknown inhibitors in the extracted
342 nucleic acids as the DNA spike samples and the known positive faecal pellets
343 we sent were also analysed in our laboratory following the same shipment
344 protocol. As the focus of this study is not to analyse sample processing 345 amongstAccepted the different diagnostic laboratories Manuscript we cannot evaluate why they 346 failed to identify the H. hepaticus positive samples sent.
347 The continuous detection of new helicobacters may make the 16 srRNA
348 gene a poor target for species assays. The likely horizontal transfer of 16S
349 rRNA gene fragments and the creation of mosaic molecules with the
16
Page 16 of 31 350 consequent loss of phylogenetic information will add to this problem (Dewhirst
351 et al., 2005; Ueda et al., 1999; Wang and Zhang, 2000). Dewhurst claims that
352 the 23S rRNA gene would render a much more robust phylogenetic analysis
353 in accordance with phenotypic DNA-DNA hybridisation analysis. We think that
354 diagnostic methods based on the 16S rRNA gene should be supported by
355 sequencing and possibly 23SrRNA gene analysis until such time that enough
356 sequences are known to make it a realistic target.
357 There is therefore a need to clearly identify and define the pathogenic
358 Helicobacter species in rodents. The use of a reliable generic helicobacter
359 PCR and subsequent cloning and sequencing, is one way forward to a better
360 understanding of helicobacter infection in rodents.
Accepted Manuscript
17
Page 17 of 31 361 Acknowledgements
362
363 We would like to thank Dr. Kathleen Mathers for her critical reading of the
364 manuscript. We would also like to acknowledge MRC-National Institute for
365 Medical Research, Centro Nacional de Biotecnología and GlaxoSmithKline
366 for their financial support to carry out this work.
367
Accepted Manuscript
18
Page 18 of 31 368 References
369
370 Battles, J.K., Williamson, J.C., Pike, K.M., Gorelick, P.L., Ward, J.M., Gonda, M.A.,
371 1995, Diagnostic assay for Helicobacter hepaticus based on nucleotide
372 sequence of its 16S rRNA gene. J Clin Microbiol 33, 1344-1347.
373 Beckwith, C.S., Franklin, C.L., Hook, R.R., Jr., Besch-Williford, C.L., Riley, L.K.,
374 1997, Fecal PCR assay for diagnosis of Helicobacter infection in laboratory
375 rodents. J Clin Microbiol 35, 1620-1623.
376 Bohr, U.R., Primus, A., Zagoura, A., Glasbrenner, B., Wex, T., Malfertheiner, P.,
377 2002, A group-specific PCR assay for the detection of Helicobacteraceae in
378 human gut. Helicobacter 7, 378-383.
379 Bohr, U.R., Selgrad, M., Ochmann, C., Backert, S., Konig, W., Fenske, A., Wex, T.,
380 Malfertheiner, P., 2006, Prevalence and spread of enterohepatic Helicobacter
381 species in mice reared in a specific-pathogen-free animal facility. J Clin
382 Microbiol 44, 738-742.
383 Cole, J.R., Chai, B., Farris, R.J., Wang, Q., Kulam, S.A., McGarrell, D.M., Garrity,
384 G.M., Tiedje, J.M., 2005, The Ribosomal Database Project (RDP-II):
385 sequences and tools for high-throughput rRNA analysis. Nucleic Acids Res
386 33, D294-296.
387 Cole, J.R., Chai, B., Marsh, T.L., Farris, R.J., Wang, Q., Kulam, S.A., Chandra, S., 388 McGarrell,Accepted D.M., Schmidt, T.M., Garrity, Manuscript G.M., Tiedje, J.M., 2003, The 389 Ribosomal Database Project (RDP-II): previewing a new autoaligner that
390 allows regular updates and the new prokaryotic taxonomy. Nucleic Acids Res
391 31, 442-443.
19
Page 19 of 31 392 Dew, J.A., Clifton, L.G., Sanders, B.L., Reynolds, R.P. 1997. Comparison of results
393 of Helicobacter tests performed by commercial laboratories. In AALAS
394 National Meeting (Anaheim, California).
395 Dewhirst, F.E., Shen, Z., Scimeca, M.S., Stokes, L.N., Boumenna, T., Chen, T.,
396 Paster, B.J., Fox, J.G., 2005, Discordant 16S and 23S rRNA gene phylogenies
397 for the genus Helicobacter: implications for phylogenetic inference and
398 systematics. Journal of bacteriology 187, 6106-6118.
399 Fermer, C., Lindberg, A.V., Feinstein, R.E., 2002, Development and use of a simple
400 polymerase chain reaction assay to screen for Helicobacter spp. and H.
401 hepaticus in intestinal and fecal samples from laboratory mice. Comp Med 52,
402 518-522.
403 Fox, J.G., Whary, M.T., 2007, Helicobacter infections in mice, In: Fox, J.G.,
404 Barthold, S.W., Davisson, M.T., Newcomer, C.E., Quimby, F.W., Smith, A.L.
405 (Eds.) The mouse in biomedical research. Academic Press, London, pp. 407-
406 435.
407 Franklin, C.L., Riley, L.K., Livingston, R.S., Beckwith, C.S., Hook, R.R., Jr., Besch-
408 Williford, C.L., Hunziker, R., Gorelick, P.L., 1999, Enteric lesions in SCID
409 mice infected with "Helicobacter typhlonicus," a novel urease-negative
410 Helicobacter species. Lab Anim Sci 49, 496-505.
411 Ge, Z., White, D.A., Whary, M.T., Fox, J.G., 2001, Fluorogenic PCR-based 412 quantitativeAccepted detection of a murine pathogen, Manuscript Helicobacter hepaticus. J Clin 413 Microbiol 39, 2598-2602.
414 Greer, C.E., Wheeler, C.M., Manos, M.M., 1995, PCR amplification from paraffin
415 embedded-tissues: sample preparation and effects of fixation, In:
20
Page 20 of 31 416 Dieffenbach, C.W., Dveksler, G.S. (Eds.) PCR primer: a laboratory manual.
417 pp. 99-112.
418 Grehan, M., Tamotia, G., Robertson, B., Mitchell, H., 2002, Detection of
419 Helicobacter colonization of the murine lower bowel by genus-specific PCR-
420 denaturing gradient gel electrophoresis. Appl Environ Microbiol 68, 5164-
421 5166.
422 Karkas, J., McCullen, A., Smith, A.L., Banknieder, A.R. 2000. Helicobacter and PCR
423 testing: What do the results really mean? In AALAS National Meeting (San
424 Diego, California).
425 Mahler, M., Bedigian, H.G., Burgett, B.L., Bates, R.J., Hogan, M.E., Sundberg, J.P.,
426 1998, Comparison of four diagnostic methods for detection of Helicobacter
427 species in laboratory mice. Lab Anim Sci 48, 85-91.
428 Nilsson, H.O., Ouis, I.S., Stenram, U., Ljungh, A., Moran, A.P., Wadstrom, T., Al-
429 Soud, W.A., 2004, High prevalence of Helicobacter Species detected in
430 laboratory mouse strains by multiplex PCR-denaturing gradient gel
431 electrophoresis and pyrosequencing. J Clin Microbiol 42, 3781-3788.
432 Poynter, S., 2004. Sample preparation and development of a generic PCR test. In:
433 LASA winter meeting.
434 Riley, L.K., Franklin, C.L., Hook, R.R., Jr., Besch-Williford, C., 1996, Identification
435 of murine helicobacters by PCR and restriction enzyme analyses. J Clin 436 MicrobiolAccepted 34, 942-946. Manuscript 437 Sanchez-Morgado, J.M., 2004. Problems with the Helicobacter diagnostic PCR tests.
438 In: LASA winter meeting.
21
Page 21 of 31 439 Sanchez-Morgado, J.M., Poynter, S., 2003. Problems with the Helicobacter spp.
440 Diagnosis in rodents. In: VII Congreso de la Sociedad Española para las
441 Ciencias del Animal de Laboratorio, San Sebastian, Spain.
442 Shames, B., Fox, J.G., Dewhirst, F., Yan, L., Shen, Z., Taylor, N.S., 1995,
443 Identification of widespread Helicobacter hepaticus infection in feces in
444 commercial mouse colonies by culture and PCR assay. J Clin Microbiol 33,
445 2968-2972.
446 Ueda, K., Matsuda, K., Takano, H., Beppu, T., 1999, A putative regulatory element
447 for carbon-source-dependent differentiation in Streptomyces griseus.
448 Microbiology (Reading, England) 145 ( Pt 9), 2265-2271.
449 Wang, Y., Zhang, Z., 2000, Comparative sequence analyses reveal frequent
450 occurrence of short segments containing an abnormally high number of non-
451 random base variations in bacterial rRNA genes. Microbiology (Reading,
452 England) 146 ( Pt 11), 2845-2854.
453
454
Accepted Manuscript
22
Page 22 of 31 455 Figures
456
457 Figure 1. Schematic representation of the constant and variable regions found
458 along the Helicobacter 16S rRNA gene. The number intervals represent the
459 length of the variable regions. IVS, intervening sequence; C, constant; V,
460 variable.
461
462 Figure 2. A. Bohr 800bp PCR validation. B. New 261bp PCR validation.
463 Lanes 1 to 25, they follow the same order as the bacteria listed in section 2.2.
464 Lane 26, negative control. Lane 27, 100 bp nucleotide molecular weight
465 marker. Image contrast has been enhanced by using `Adobe Photoshop
466 software.
467
468 Fig. 3. Alignment of the reverse primer from Shames (Shames et al., 1995)
469 and the 16S rRNA gene from the different Helicobacter found to infect
470 rodents. Alignment was done using Megalign and SeqMan of Lasergene
471 programs (DNAStar, Konstanz, Germany). Adjacent to the species name and
472 in brackets is the Gene Bank accession number. On the right, the last
473 nucleotide position is annotated.
474 Accepted Manuscript
23
Page 23 of 31 Table 1
TABLE 1. Number of 16S sequences per Helicobacter species. (NCBI)
Species 16S Species 16S Species 16S Species 16S H. pylori 134 H. pullorum 15 H. pametensis 1 H. rodentium 3 H. acinonychis 1 H. canadensis 17 H. cholecystus 2 H. ganmani 8 H. cetorum 4 H. muricola 1 H. mesocricetorum 2 H. muridarum 4 H. felis 17 H. marmotae 1 H. mustelae 5 H. typhlonius 1 H. bizzozeronii 4 H. fennelliae 3 H. trogontum 2 H. bilis 20 H. salomonis 3 H. canis 12 Uncultured Helicobacter 116 H. cinaedi 14 H. aurati 1 H. suncus 2 H. winghamensis 7 H. hepaticus 9 H. sp. 117
Accepted Manuscript
Page 24 of 31 Table 2
TABLE 2. Oligonucleotide primers used for Helicobacter PCR testing and sequencing.
Name Sequence (5' to 3') Reference Year Gene Positiona Species Orientation Forward TAGCTTGCTAGAAGTGGATT Mahler et al. 1998 16S 72-91 H. spp Forward rRNA Reverse ACCCTCTCAGGCCGGATACC Mahler et al. 1998 16S 262-281 H. spp Reverse rRNA B38 GCATTTGAAACTGTTACTCTG Shames et al. 1995 16S 585-605 H. hepaticus Forward rRNA B39 GGGGAGCTTGAAAACAG Shames et al. 1995 16S 985-1001 H. hepaticus Reverse rRNA C97-20 GGCTATGACGGGTATCCGGC Bohr et al. 2002 16S 252-271 H. spp Forward rRNA H3A-20 GCCGTGCAGCACCTGTTTTC Bohr et al. 2002 16S 994-1013 H. spp Reverse rRNA New F TACCTAGGCTTGACATTGAT Poynter et al. 2004 16S 912-931 H. spp Forward rRNA New R CCATTGTAGCACGTGTGTA Poynter et al. 2004 16S 1155-1173 H. spp Reverse Accepted ManuscriptrRNA
a Numbering is based upon starting nucleotide of the 16S rRNA gene of Helicobacter hepaticus ATCC 51449 (NCBI accession number NC_004917).
Page 25 of 31 Table 3
TABLE 3. Results from the Helicobacter PCR tests carried out at different commercial laboratories. (2007)
Ref Control Lab A Lab B Lab C Lab D Lab E Lab F
7 10 copies 1/07 + + - - + - +
2/07 + + - - + - + 3/07 + + - - +/- - + 5 10 copies 4/07 + ------
5/07 + - - - - - +
6/07 + ------2 10 copies 7/07 ------+
8/07 ------
9/07 ------
Negative 10/07 ------
* Samples sent at environmental temperature as requested by the commercial laboratory.
Accepted Manuscript
Page 26 of 31 Table 4
Table 4. Helicobacter hepaticus (Shames et al 1995) and Helicobacter spp assay (Mahler et al 1998)sequencing results.
Assay Species detected # of sequences
Helicobacter hepaticus
Helicobacter hepaticus 67/158
Helicobacter spp. 41/158
Helicobacter rappini 5/158
Helicobacter typhlonius 6/158
Non significant data 39/158
Helicobacter spp
Helicobacter apodemus 2/7 (390bp)*
Helicobacter ganmani 1/7 (390bp)*
Helicobacter bilis 4/7 (390bp)*
Helicobacter trogontum 3/3 (210bp)* Accepted Manuscript *PCR band size
Page 27 of 31 Table 5
TABLE 5. Sequencing results from the new 261 bp diagnostic assay.
Mouse Organism Sequences 1 H. ganmani 12 2 H. ganmani 30 H. hepaticus 3 H. apodemus 1 3 H. hepaticus 3 H. apodemus 1 4 H. typhlonius 20 H. cinaedi 1 H. bilis 1
Accepted Manuscript
Page 28 of 31 Figure 1
1495-1545 985-1010 1255-1288
120-200 825-910 1070-1100 1383-1394 290 nt
C1 V1 C2 V2 C3 C4 C5 C6 C7 V7 C8
IVS V3 V4 V5 V6 Accepted Manuscript
Page 29 of 31 Figure 2
Accepted Manuscript
Page 30 of 31 Figure 3
Shames et al. reverse G G G G A G C T T G A A A A C A G 17
Helicobacter apodemus (AY009130) G - G G A G C T T G A A A A C A G 999
Helicobacter aurati (AF297868) G G G G A G C T T G A A A A C A G 1000
Helicobacter bilis (AF047847) C C A G A G C T T G A A A A C A G 984
Helicobacter cholecystus (U46129) C C A G A G C T T G A A A A C A G 991
Helicobacter ganmani (AF000224) C T A G A A C T T G A A A A C A G 981
Helicobacter hepaticus (AF302103) G G G G A G C T T G A A A A C A G 979
Helicobacter mesocricetorum (AF072334) C T A G A A C T T G A A A A C A G 986
Helicobacter muridarum (AF010140) G T G G A G C T T G A A A A C A G 983
Helicobacter rappini (AY034817) G G G G A G C T T G A A A A C A G 985
Helicobacter rodentium (U96297) C T A G A A C T T G A A A A C A G 985
Helicobacter suncus (AB006148) C T A G A C C T T G A A A A C A G 1006
Helicobacter trogontum (U65103) G G G G A G C T T G A A A A C A G 985 Helicobacter typhloniusAccepted (AF061104) G GManuscriptG G A G C T T G A A A A C A G 1134 Helicobacter muricola (AF264783) A G G G A G C T T G A A A A C A G 1276
Page 31 of 31