(12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2017/049002 Al 23 March 2017 (23.03.2017) P O P C T

(51) International Patent Classification: AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, A01K 67/00 (2006.01) G01N 33/00 (2006.01) BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, C12N 15/00 (2006.01) DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, IL, IN, IR, IS, JP, KE, KG, KN, KP, KR, (21) International Application Number: KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, PCT/US20 16/052003 MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, (22) International Filing Date: OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, 15 September 2016 (15.09.201 6) SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, (25) Filing Language: English ZW. (26) Publication Language: English 4 Designated States (unless otherwise indicated, for every (30) Priority Data: kind of regional protection available): ARIPO (BW, GH, 62/219,105 15 September 2015 (15.09.2015) US GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, TZ, UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, (71) Applicant: MASSACHUSETTS INSTITUTE OF TJ, TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, TECHNOLOGY [US/US]; 77 Massachusetts Avenue, DK, EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, Cambridge, MA 02139 (US). LV, MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, SM, TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, (72) Inventors: CHEN, Jianzhu; 3 1 Wyman Road, Lexington, GW, KM, ML, MR, NE, SN, TD, TG). MA 02420 (US). DRAKE, Adam, C ; 101 Spring Hill Road, North Andover, MA 01845 (US). KAUR, Declarations under Rule 4.17 : Mandeep; 31 Standish Road, Watertown, MA 02472 (US). — of inventorship (Rule 4.17(iv)) PHENNICIE, Ryan, T.; 2 Greenbriar Drive, Unit 306, North Reading, MA 01864 (US). Published: (74) Agents: SANDERS, Deirdre, E. et al; Hamilton, Brook, — with international search report (Art. 21(3)) Smith & Reynolds, P.C., 530 Virginia Rd., P.O. Box 9133, — before the expiration of the time limit for amending the Concord, MA 01742-9133 (US). claims and to be republished in the event of receipt of (81) Designated States (unless otherwise indicated, for every amendments (Rule 48.2(h)) kind of national protection available): AE, AG, AL, AM, — with sequence listing part of description (Rule 5.2(a))

(54) Title: A HUMANIZED MOUSE MODEL OF DE NOVO HUMAN ACUTE MYELOID LEUKEMIA WITH A MATCHING HUMAN IMMUNE SYSTEM

o o hCD45 HUMANIZATION

FIG. 8 A

© (57) Abstract: Method of producing a non-human mammal that is a model for human NPMlc + acute myeloid leukemia are de- scribed, as well as a viral vector useful in producing the non-human mammal. Also described are methods of identifying one or more Q agents that can be used to treat human acute myeloid leukemia using the non-human mammals. A HUMANIZED MOUSE MODEL OF DE NOVO HUMAN ACUTE MYELOID LEUKEMIA WITH A MATCHING HUMAN IMMUNE SYSTEM

RELATED APPLICATIONS

[0001] This application claims the benefit of U.S. Provisional Application No. 62/219,105, filed on September 15, 2016. The entire teachings of the above application are incorporated herein by reference.

INCORPORATION BY REFERENCE OF MATERIAL IN ASCII TEXT FILE

[0002] This application incorporates by reference the Sequence Listing contained in the following ASCII text file being submitted concurrently herewith: a) File name: 00502281001Sequence.txt; created September 15, 2016, 44 KB in size.

BACKGROUND OF THE INVENTION

[0003] In 2015, acute myeloid leukemia (AML) was projected to account for -38% of all new leukemia diagnoses and -43% of leukemic patient deaths in the U.S. As AML primarily occurs in older adults, disease incidence is increasing as the population ages. Although certain subtypes of AML can be cured by combination chemotherapy, for the majority of patients a 40-year-old chemotherapy regimen possibly combined with a hematopoietic stem cell (HSC) transfer represents the best treatment option. Most of these patients die from their disease (1, 2). Therefore, there is an unmet need to develop a small animal model that recapitulates the human disease and can be used as a pre-clinical tool to test new therapies.

SUMMARY OF THE INVENTION

[0004] Described herein is a method of producing a non-human mammal that is a model for human NPMlc + acute myeloid leukemia with an autologous human immune system. Mutant NPMl is also referred to as NPMlc because of its predominantly cytoplasmic localization. The method can include introducing human hematopoietic stem cells (HSCs) genetically engineered to express mutant human NPMl, wherein the HSCs are not genetically engineered to express human FLT3-ITD, into an immunodeficient non-human mammal; and maintaining the immunodeficient non-human mammal under conditions in which the non-human mammal's human blood lineage is reconstituted by the human HSCs, thereby producing a non-human mammal that is a model for human PM l c+ acute myeloid leukemia with an autologous human immune system. In some embodiments, the mutant human PM 1 can be PM l c mutation A, B, C, D, E or F. In some instances, the mutant human PM 1 can be NPMlc mutation A . In some instances, the mutant human NPM1 is expressed in the non-human mammal in human blood lineage cells. The non-human mammal can be a mouse. The human hematopoietic stem cells genetically engineered to express mutant human NPM1 can be further genetically engineered to express a reporter protein. In some embodiments, the reporter protein can be a green fluorescent protein, red fluorescent protein, an antibiotic resistance protein, luciferase, a cell surface protein, or a combination thereof. In some instances, the HSCs can be transduced with a virus expressing mutant human NPM1 under the control of a ubiquitous promoter. Prior to introducing the human HSCs genetically engineered to express mutant human NPM1 into an immunodeficient non- human mammal, the embodiments can further include transducing human hematopoietic stem cells with a virus capable of expressing mutant human NPM1 under the control of a ubiquitous promoter, such as the PGK promoter (also known as the phosphoglycerate kinase 1 promoter). In some instances, the virus can be a lentivirus, including a pseudotyped lentivirus, such as VSV-G pseudotyped. In some embodiments, the method can further include introducing human hematopoietic stem cells that have not been genetically engineered to express mutant human NPM1 into the immunodeficient non-human mammal. [0005] Also described herein is a non-human mammal that is a model for human NPMlc + acute myeloid leukemia. The non-human mammal can be produced by the methods described herein. In some instances, the non-human mammal can have human hematopoietic stem cells genetically engineered to express mutant human NPM1, but not genetically engineered to express human FLT3-ITD. [0006] Also described herein is a lentiviral vector for use in producing a non-human mammal that is a model for human acute myeloid leukemia. The lentiviral vector can include (be characterized by) one or more of: i) deletion of U6 promoter, and ii) deletion of anti- repressor element. [0007] Also described herein is a method of identifying one or more agents that can be used to treat human NPMlc + acute myeloid leukemia. In an alternative embodiment, the method is a method of identifying one or more agents or treatment regimens that can be used to treat human acute myeloid leukemia. The method can include administering the one or more agents to a non-human mammal and determining the toxicity or therapeutic efficacy of the agent, or in some instances the treatment regimen. The non-human mammal can have human hematopoietic stem cells genetically engineered to express mutant human PM 1, but not genetically engineered to express human FLT3-ITD. In some instances, the agent can be a biologic, such as an antibody or fragment thereof, or a small molecule. Determining the toxicity can include monitoring one or more of: body weight of the non-human mammal and human cytokine production of the non-human mammals. The cytokines monitored can include, e.g., interleukin-6, interferon gamma, and TNF-alpha. Determining the therapeutic efficacy can include monitoring the presence of leukemic cells, e.g., in the blood or bone marrow of the non-human mammal. Monitoring the presence of leukemic cells can include, for example, detecting green fluorescent protein (GFP) expression by flow cytometry of cells from, e.g., the blood or bone marrow of the non-human mammal that is a model for human PM l c+ acute myeloid leukemia. In some embodiments, the agent can be an agonist or antagonist of CD123, CD47, PD-L1, or PD-1. In some embodiments, the agent is a bi- specific Fab conjugate that binds CD3 and CD123. [0008] Also described herein is a method of reducing viability of a population of CD123+ cells. The method includes contacting the population of CD123+ cells (e.g., leukemic stem cells) with a Myc inhibitor, such as JQl, and contacting the population of CD123+ cells with a bi-specific Fab conjugate that binds CD3 and CD12, such as the BFC described herein. In some instance, the Myc inhibitor indirectly inhibits Myc, such as by inhibiting BRD4 or by causing degradation of BRD4. In some instances, the Myc inhibitor is a BRD4 inhibitor, such as JQl or OTX015. In some instances, the population of CD123+ cells are contacted with the Myc inhibitor, and subsequently contacted with the bi-specific Fab conjugate that binds CD3 and CD123. In some instances, at least some cells of the cell population express mutant human PM 1. [0009] The lack of preclinical small animal models that faithfully mimic human cancers and recapitulate autologous tumor-immune system interactions has impeded the discovery and testing of targeted therapies. We have addressed this challenge by developing a mouse model of human Acute Myeloid Leukemia (AML) with an autologous immune system. The de novo AML is driven by the expression of the Nucleophosmin oncogene (NPMlc) in human hematopoietic stem/progenitor cells (HSPCs) in mice. The disease resembles human AML in clinical presentation, phenotype of leukemic cells and leukemic stem cells (LSCs), and transcriptional profile. The utility of this model is demonstrated by showing targeted

elimination of LSCs with a T cell re-directed immunotherapy and identifying Myc as a co operating factor in NP -driven leukemogenesis. [0010] AML is one of the most common leukemias afflicting the elderly with no curative treatments. PMl c, a mutation found in -30% of AML cases, does not consistently result in AML when expressed in mouse HSPCs. The results herein show rapid development of myeloid leukemia with full penetrance following expression of NPMlc in human HSPCs and reveal intrinsic differences between humans and mice, highlighting the advantage of studying leukemogenesis in human cells. The presence of an autologous human immune system also makes this model ideal for evaluating immunotherapeutics for AML. Full penetrance refers to the fact that all mice engrafted with human HSCs transduced with mutant human NPM1 exhibit a phenotype characteristic of myeloid leukemia. [0011] The results described herein demonstrate development of a mouse model of human AML with an autologous human immune system; targeted elimination of leukemic stem cells by a T cell re-directed immunotherapy; demonstration of driver oncogenic activity of NPMlc in human leukemogenesis; and identification of Myc as a co-operating factor in NPMlc-driven leukemogenesis. [0012] Here, we report a model of de novo human AML with an autologous human immune system in immunocompromised mice. In this model, AML is driven by enforced expression of NPMlc in human stem/progenitor cells (HSPCs) and results in a disease that resembles human NPMlc + AML in clinical presentation and transcriptional profile. Importantly, the non-transduced, normal HSPCs give rise to a functional human immune system in the same mouse. The de novo AML also produces CD123 + LSCs in the bone marrow, which can be depleted with a bi-specific fragment antigen-binding (Fab) conjugate targeting CD3 and CD 123 in a T cell-dependent manner. Transcriptome analysis further identifies up-regulation of Myc as a co-operating factor in NPMlc-dnven leukemogenesis and a potential target for intervention. The de novo induction of human AML in the presence of an autologous human immune system uniquely positions this model as a platform for studying early events in human leukemogenesis and as a preclinical tool for testing biologies, especially immune-based therapies.

BRIEF DESCRIPTION OF THE DRAWINGS [0013] The foregoing will be apparent from the following more particular description of example embodiments of the invention, as illustrated in the accompanying drawings. The drawings are not necessarily to scale, emphasis instead being placed upon illustrating embodiments of the present invention. [0014] FIGs. 1A-D: AML humouse development driven by NPMlc oncogene expression. FIG. 1A : Schematic of workflow for the development of AML humouse. Briefly, 1-2 x 105 CD34 + human hematopoietic stem cells (HSCs) are transduced with lentivirus and engrafted into 24-48 hour old non-obese diabetic severe combined immunodeficiency IL2Rg-/- neonates (NSG pups). Mice are monitored for presence of human leukocytes (CD45 expressing) in the peripheral blood and GFP-expressing human cells (surrogate for transduced cells). FIG. IB: Western blots showing the cytoplasmic localization of NPMlc when expressed in a human cell line. Cell lysates were obtained from 293 cells transiently transfected with empty vector or vector expressing NPMlc. Lysates were fractionated into nuclear and cytoplasmic fractions and subjected to SDS-PAGE. Antibodies for NPMlc and Tubulin (for cytoplasmic fraction) were used for detection. FIG. 1C: Kaplan-Meier survival analysis for mice engrafted with human hematopoietic stem cells (HSCs) transduced with lentivirus expressing GFP (G control) or lentivirus expressing GFP-NPMlc (GN). Increased mortality is observed in GN mice compared to the control cohort. The spleens from GN mice show signs of splenomegaly and the femurs from GN mice are pale, anemic and hypocellular. Blast cells are observed in the blood and bone marrow of leukemic cells. FIG. ID: Histology of G and GN mice. Top row: Hematoxylin and eosin stains (H&E). a-c: Bone marrow

sections; d : Liver section showing infiltrating cells. Second row: Geimsa Wright stains of blood or bone marrow smears e-g: blood smears; h : bone marrow smear. Third and fourth rows: Immunohistochemistry (IHC) of fixed organs. Third row: Anti-GFP IHC. i-k: Bone

marrow sections; 1: Liver section showing infiltrating GFP positive cells. Fourth row: Anti-

NPMlc IHC. m-p: Bone marrow sections a-f, i-j, 1-n: imaged with 20x objective; g,k o-p: imaged with 63x objective and h imaged with lOOx objective. [0015] FIGs. 2A-E: Phenotypic characterization of AML humouse. FIG. 2A: Peripheral blood analysis of human cells (GFP positive, top graph; or GFP positive CD33 positive, bottom graph) in G or GN mice at 8 weeks post-engraftment. FIG. 2B: Dot-plot representation of flow cytometry analysis of live cells from bone marrow of G or GN mice with the indicated antibodies. Note enrichment of GFP+ myeloid cells (CD13+ CD33+) in GN mice vs G mice. This indicates a positive selection pressure that induces the expansion of the tumorigenic GFP+ myeloid population in GN mice. Phenotypic analysis of GFP+ NPMlc expressing cells in leukemic mice (GN) compared to control mice (G). Bone marrow cells were stained with the appropriate antibodies. All dot-plots represent live cells. CD 13+ CD33+ GFP+ cells accumulate in GN mice. FIG. 2C: Histograms showing expression of the indicated cell surface markers in bone marrow from GN mice gated on live, human CD45 cells. Leukemic cells express CD33, CD38 and CD123 with minimal expression of CD14 and CD1 lb. As seen in patients, NPMlc driven leukemia cells lowly express CD34. Solid line trace: specific antibody; dashed line trace: isotype control. FIG. 2D: Bone marrow cells from G or GN mice stained for CD123 leukemic stem cell marker. Enlarged population of CD123+ GFP+ AML leukemic stem cells (LSCs) in AML humanized mice (GN) compared to control mice (G). FIG. 2E: Presence of normal B (CD 19), T (CD3) and NK (CD56) cells in AML humanized mice (GN). Normal human immune cells in G and GN mice. Cells are gated on live, human CD45 GFP negative cells. [0016] FIGs. 3A-B: Absence of disease when NPMlc and FLT3-ITD are co-expressed, or when NPMlc is expressed with a myeloid specific promoter. FIG. 3A : Cohorts of mice were made with virus expressing GFP along with NPMlc and FLT3-ITD (referred to as GFN). None of the mice in the GFN cohort developed disease as did the GFP-NPMlc mice (GN, refer to FIGs. 1A-D and 2A-E). Five months after engraftment with transduced cells, three of the GFN mice were sacrificed and the bone marrow cells were analyzed for human cells and the presence of GFP+ cells. The left panels show mouse and human leukocyte in the bone marrow of these mice. The right panel shows the absence of GFP+ cells in the human leukocyte population. As shown in FIG. 3A, while human cells persist in the bone marrow of GFN mice, no detectable GFP+ cells were observed. FIG. 3B: Mice engrafted with virus expressing GFP and NPMlc under the control of the CD14 myeloid promoter also failed to develop a myeloid disease. Both panels show data from peripheral blood of mice engrafted with GFP-NPMlc (GN) virus under the control of the CD 14 or PGK promoter. The histogram is gated on live, human CD45+ cells. Note the absence of GFP+ cells in CD14 GN mice at 6 months post engraftment compared to 38% GFP+ cells in PGK GN mice at 13 weeks post engraftment. In both FIGs. 3A and 3B, the absence of accumulation of GFP+ cells in GFN mice and CD 14 GN mice indicate the lack of a selection pressure for the development of the cells indicating the non-tumorigenic nature of the transduced cells. This data suggests that the co-expression of PM l c and FLT3-ITD or the expression of PM l c under the control of a myeloid promoter is not sufficient to drive disease in this model system. [0017] FIGs. 4A-I: Plasmid maps and sequences. FIG. 4A: Map for pLB2 backbone. FIG. 4B: Map of pL3 plasmid used in these studies. FIG. 4C: Schematic of multiple cloning site (MCS) generated for insertion of promoters and oncogenes. FIG. 4D: Alternative view of the plasmid map of FIG 4A . FIG. 4E: Alternative view of the plasmid map of FIG. 4B. FIG. 4F: Sequence of the pL3-2A-EGFP plasmid of FIG. 4B and 4E. FIG. 4G: Sequence of the pLB2U6(EFlalpha)GFP plasmid of FIGs. 4A and 4D. FIG. 4H: Plasmid map for the

pL3-PGK-eGFP-2A-NPMlMutA related to FIG. 4C. FIG. 41: Sequence of the pL3-PGK-eGFP-2A-NPMlMutA construct used to make lentivirus.

[0018] FIG. 5 : Secondary transplant data. To assess tumorigenicity of leukemic cells from GN mice, we transferred 2 million cells from the bone marrow of leukemic mice into irradiated secondary NSG recipients that had been primed with human IL3 and GM-CSF. Secondary AML mice show accumulation of GFP+ myeloid cells in the periphery and developed disease starting from 8 weeks post engraftment. Histological analysis (H&E stains) shows presence of myeloid cells in the spleen, bone marrow and liver of a matched primary and secondary mouse. Note the presence of mitotic figures in the spleen of secondary mouse (zoomed inset) indicating highly tumorigenic cells and the infiltration of myeloid cells in the livers of primary and secondary mice. Primary mouse (top) and secondary mouse (bottom). Note presence of mitotic figure in spleen of secondary transplant recipient. [0019] FIGs. 6A-B: Transcriptomics data. We performed genome-wide transcriptome analysis on bone marrow cells from 3 independent GN mice. All 3 mice were made from separate human HSC donors and transduced at separate times. The bone marrow cells from GN mice were sorted into leukemic (GFP+ CD33+) and leukemic stem cell (GFP+CD123+CD33+) fractions followed by RNA purification. The RNA was then processed according to the OVATION RNA-Seq System V2 (available from NuGen, San Carlos, California, USA) to generate cDNA libraries for Illumina sequencing. FIG. 6A: The sorted cells from independent HSC donors cluster together indicating similar gene expression profiles. We also analyzed the presence of previously defined HOX gene signatures, which are used to characterize NPMlc+ patient AML samples. FIG. 6B: qRT-PCR from GFP+ CD33+ bone marrow cells from control mice (G) or AML mice (GN) show high expression of HOXA5, HOXA6 and HOXA9 genes in GN mice. Transcriptomic analysis confirms the stem-cell like expression profile of these cells. [0020] FIGs. 7A-H: Human NPMl sequences showing alignment of nucleotides 952-989. Bold, underlined = nucleotide insertion. FIG. 7A: Overview of human NPMl sequences and mutations. FIG. 7B: Sequence of wild type human NPMl (GenBank Accession No. NU_002520, SEQ ID NO:l). FIG. 7C: Sequence of NPMl Mutation A (GenBank Accession No. AY740634, SEQ ID NO:2). FIG. 7D: Sequence of NPMl Mutation B (GenBank Accession No. AY740635, SEQ ID NO:3). FIG. 7E: Sequence of NPMl Mutation C (GenBank Accession No. AY740636, SEQ ID NO:4). FIG. 7F: Sequence of NPMl Mutation D (GenBank Accession No. AY740637, SEQ ID NO:5). FIG. 7G: Sequence of NPMl Mutation E (GenBank Accession No. AY740638, SEQ ID NO:6). FIG. 7H: Sequence of NPMl Mutation F (GenBank Accession No. AY740639, SEQ ID NO:7). These sequences were identified, e.g., in Reference (10) on pages 262-263, incorporated herein by reference, and are described at the identified GenBank Accession Nos., which are also incorporated herein by reference. [0021] FIGs. 8A-K: Development of AML by enforced expression of NPMlc in CD34+ HSPCs. FIG. 8A: Schematic of experimental approach to generate AML in humanized mice. Oncogenes refer to NPMlc or FLT3-ITD or both. FIG. 8B: Percentages of GFP+ cells within human CD45+ leukocytes in the peripheral blood of G, GN and GFN mice. Each dot represents one mouse and the average is indicated. FIG. 8C: Percentages of CD33 + human myeloid cells within human CD45+GFP+ leukocytes in the peripheral blood of G, GN and GFN mice. Each dot represents one mouse and the average is indicated. **p-value<0.01. n.s., not significant. FIG. 8D: Kaplan-Meier survival analysis of G, GN and GFN mice. P value indicates comparison between GN mice and G or GFN mice. FIG. 8E: Representative Geimsa-Wright stains of peripheral blood of a G mouse and peripheral blood and bone marrow of a GN mouse. Inset shows a higher magnification of the indicated area. Magnifications are indicated. FIG. 8F: Visual comparison of the size of the spleens and coloration of the bones of G and GN mice. FIG. 8G: Number of human CD45+ leukocytes per femur of G and GN mice. Each dot represents one mouse and the average is indicated. **p- value<0.01. FIG. 8H: Representative H&E stains of bone marrow (BM) of a G mouse and bone marrow and liver of a GN mouse (N: normal, T: tumor). Magnifications are indicated.

FIG. 81: Immunohistochemistry stains for GFP and NPMlc in the bone marrow sections of G and GN mice. Sections were stained with either an anti GFP antibody or an anti-NPMlc antibody, followed by HRP-conjugated secondary antibody, and final HRP substrate (brown) and DAPI (blue). Representative sections are shown with inset showing higher magnification of the indicated areas. Magnifications are indicated. All images were taken on a Zeiss inverted microscope. FIG. 8J : Comparison of human leukocyte reconstitution in the peripheral blood among G, GN and GFN mice. Chimerism is the percentage of human CD45+ cells among total (human and mouse) leukocytes. Each dot represents one mouse and the average and SEM are shown. FIG. 8K: Flow cytometry analysis of bone marrow cells of G (n=5) and GFN (n=3) mice at 6 months of age. Shown are representative dot plots of human CD45 vs. mouse CD45 staining profiles of total live cells and human CD45 vs. GFP staining profiles of human CD45+ cells. The numbers indicate percentages of cells in the gated areas. [0022] FIGs. 9A-F: Phenotype of NPMlc-driven AML. FIGs. 9A and 9B: Analysis of myeloid cells in the bone marrow of moribund GN mice and age-matched G mice. Bone marrow cells were stained for mCD45, hCD45.1, CD13 and CD33. FIG. 9A: Shown are staining profiles of hCD45 vs. mCD45.1 of live cells (DAPI ), hCD45 vs GFP gating on human CD45+ cells, and CD33 vs. CD13 gating on either human CD45+GFP+ or human CD45+GFP cells. The numbers indicate percentages of cells in the gated areas. FIG. 9B: Numbers of human CD45+CD33 + leukocytes per femur in the GFP+ and GFP fractions of G and GN mice. FIG. 9C: Phenotype of human CD45+GFP+ cells in the bone marrow of moribund GN mice. Bone marrow cells were stained for mCD45.1, hCD45, plus one of the indicated markers or isotype control. Shown are histograms of CD13, CD33, CD38, CD47, CDl lb, CD14, CD34 or CD123 stains of human CD45 +GFP+ leukocytes. Solid line trace: specific antibody; dashed line trace: isotype control. FIG. 9D: Analysis of leukemic stem cells. Bone marrow cells were stained for hCD45, CD123, CD38, CD34 and CD33. Shown are staining profiles of CD38 vs. CD123 gating on human CD45+GFP+ cells and CD33 vs. CD34 gating on human CD45+GFP+C123 +CD38+ cells. The numbers indicate percentages in the gated areas. FIG. 9E: Phenotype of leukemic cells in primary and secondary mice. Total bone marrow cells from primary moribund GN mice were transferred into cytokine- expressing and irradiated NSG recipient mice. Cells from bone marrow and spleen of moribund primary and secondary mice were stained for mCD45.1, hCD45, CD33 and CD13. Shown are staining profiles of hCD45 vs. GFP gating on live human CD45 + cells and CD33 vs. CD23 gating on human CD45 +GFP + cells in primary mice and the corresponding secondary mice. FIG. 9F: Sorted populations of GFP+CD123+CD34+ and GFP+CD123+CD34- cells from the bone marrow of GN mice were stained with Pyronin Y and HOECHST and processed for flow cytometry. Shown are Pyronin Y vs HOECHST staining profiles (top) and HOECHST histograms (bottom) of the sorted cell populations. Gated areas indicate cells and their percentages in different stages of the cell cycle. [0023] FIGs. 10A-I. Effect of CD123/CD3 BFC on CD123 + leukemic stem cells. FIGs. lOA-C: Presence of human T cells, B cells and NK cells in AML mice. Cells from peripheral blood, bone marrow and spleen from G and GN mice were stained for mCD45.1, hCD45, CD3, CD56 and CD19. Shown are staining profiles of CD56 vs. CD3 gating on live cells in peripheral blood of 9 week-old G and GN mice (FIG. 10A), CD19 vs. CD3 or CD56 vs. CD3 gating on human CD45 +GFP cells in the bone marrow (FIG. 10B) and spleen (FIG. IOC) of moribund GN mice and aged-matched G mice. Numbers indicate percentages of cells in the gated areas. FIGs. 10D and 10E: Effect of BFC on CD123 LSC and T cells. Primary AML mice were given daily g of CD213/CD3 BFC intravenously for 7 days. Some mice were injected with DNA plasmid expressing IL-7 10 days before treatment. Some other mice were given OKT3 2 days before BFC injection. Mice were bled 2 days before treatment (day -1) and 1 (day 8) and 10 (day 17) days after the last BFC injection. The levels of CD123 + LSCs and CD3 + T cells were quantified by flow cytometry. The relative level of GFP CD123 LSCs (FIG. 10D) and CD45 +CD3 + T cells (FIG. 10E) in each mouse after normalization to its level before treatment. T cells from day 8 bled were also stained for hCD45.1, CD3, CD8, CD45RO and CD45RA. Percentages of CD45 +CD3 +CD8 + (CD8) T cells and CD45 +CD3 +CD8 (CD4) T cells that express CD45RA or CD45RO are shown (FIG. 10F). Each dot represents one mouse. **p-value<0.01, ***p-value<0.001. FIG. 10G: Effect of

BFC on CD123 + LSC. Primary AML mice (3 per group) were treated with either

CD123/CD3 BFC or control BFC (CD3/KLH) and sacrificed on day 8. Bone marrow cells were harvested, counted and stained for mCD45.1, hCD45 and CD123. The number of GFP + and GFP human CD45 +CD123 + LSCs are shown. *p-value<0.05. FIGs. 10H and 101: Effect of BFC on CD123 + LSCs in vitro. Total bone marrow cells and purified autologous CD3 + T cells from blood or spleen were incubated in the presence or absence of CD123/CD3 BFC for 4 or 48 hours at 37°C. Cells were stained for hCD45, CD123, CD3, CD8 and CD107a. Shown are normalized percentages of viability of CD123 + cells and percentages of CD107a+ among CD8+ cells. [0024] FIGs. 11A-K. Transcriptome analysis of PM l c leukemic cells and LSCs (see also Table 2 and Table 3). FIG. 11A : Unsupervised hierarchical clustering of RNAseq data. FIG. 1IB: Scatter plot showing genes that are differentially expressed in bulk leukemic cells vs. LSCs. Genes in red with a positive log fold change are up-regulated in bulk leukemic cells (p<0.01) and genes in red with a negative log fold change are up-regulated in LSCs (p- value<0.01). FIG. 11C: A list of genes up-regulated in two published datasets (Alcalay et al. and Verhaak et al.) with genes up-regulated in bulk leukemic cells. FIG. 1ID: Quantitative RT-PCR analysis for transcript levels of HOX signature genes in purified GFP+CD33 + cells in G and GN mice. FIG. 1IE: The level of Myc transcript in bulk leukemic cells (GFP+CD123 CD33 +) and LSCs (GFP+CD123 +CD33 +) from bone marrow of GN mice. FIG. 1IF: Effect of Myc inhibitor JQl on cell survival. GFP+CD123 CD33 + and GFP+CD123 +CD33 + cells were purified from the bone marrow of G and GN mice, and treated with Ι η JQl for 48 hrs. Viable cells were counted with Trypan blue stain and normalized to the number of input cells. FIGs. 11G and 11H: Effect of BFC and JQl combination. Bone marrow cells from GN mice were treated with JQl overnight as indicated. Cells were washed to remove JQl and incubated with purified autologous CD3 + T cells in the presence or absence of CD123/CD3 BFC. Shown are normalized percentages of viability of CD123 + cells (FIG. 11G) and percentages of CD107a+ among CD8+ cells (FIG. 11H). FIG. 1II: Staining profiles of CD123 vs. GFP gating on live CD33+ cells before and after sorting. Numbers indicate percentages of cells in the gated areas. FIG. 11J : Summary of RNA sequencing data. FIG. 1IK: Relative levels of Myc in the indicated populations in G and GN mice as assayed by quantitative RT-PCR.

DETAILED DESCRIPTION OF THE INVENTION

[0025] A description of example embodiments of the invention follows. [0026] Acute Myeloid Leukemia (AML) is a cancer that primarily occurs in older adults who unfortunately, do not tolerate standard chemotherapy and often die of the disease. While new immunotherapies are being developed to treat AML, the lack of suitable preclinical model makes it difficult to accurately test the efficacy and toxicity of these therapies in vivo where the leukemia exists alongside a normal human immune system which is required to elicit the cytotoxic effects of immunotherapies. Here, we demonstrate the development of a humanized mouse model of de novo Acute Myeloid Leukemia (AML) with an autologous human immune system. By lentiviral mediated expression of a patient-derived mutation of Nucleophosmin (NPMlc) in human hematopoietic stem cells (HSCs), followed by engraftment of a mixed pool of transduced and untransduced HSCs in immune-compromised

ΟΌ -scid IL2rg _ (NSG) mice, we have modeled AML which develops alongside an autologous immune system. PM 1 expression is monitored by GFP expression as both proteins are encoded by the lentiviral construct and expressed in equal stoichiometry. The latency of disease is 14-26 weeks. Tumorigenicity of the transduced leukemic cells was confirmed with secondary transplantation. In this model, the leukemia resembles the broad M2-M5 category of the human disease as per the French-American-British (FAB) classification system, mirroring the pattern demonstrated by patient AMLs with an PM 1 mutation. As is seen in AML patients and in AML xenograft mouse models, the disease in this model is characterized by the presence of blasts in the peripheral blood and bone marrow, anemia, weight loss, splenomegaly and hypocellularity of the bone marrow. Leukemic blasts are primarily CD13 and CD33 positive with low expression of CD14. We detect the presence of leukemic stem cells (LSC), which are hypothesized to seed the disease and are responsible for disease relapse upon conventional chemotherapy. Transcriptome analysis of the CD123+ LSCs demonstrates their stem cell-like expression. Leukemic PM l c+ cells also express the HOX gene signature shown to be present in PM l c+ patient AML samples. In summary, we have developed a model of human AML with an autologous human immune system, which recapitulates important features of the human disease. The co-existence of leukemic cells and normal immune cells in this model makes it a useful pre-clinical tool for testing immunotherapies that require functional normal immune cells. [0027] Acute myeloid leukemia (AML) is one of the most common leukemias in the United States. Adults over 50 years of age stand a high risk of developing adult-onset AML and incidence is expected to rise with an aging population. Other contributing factors include a diagnosis of myelodysplasia or prior treatment with chemotherapeutic drugs. Standard-of- care treatment for AML consists of a combination of chemotherapy and radiation therapy, which is neither curative nor well tolerated by the elderly. While combination therapies can achieve clinical remission, they are unable to eliminate disease reservoir in the bone marrow, resulting in disease relapse in 3-5 years in most patients (Paietta, 2012). Relapse is caused by minimal residual disease (MRD) in the bone marrow resulting from AML leukemic stem cells (LSC) that seed the disease and are refractory to standard therapies (Horton and Huntly, 2012). Therefore, there is an urgent need to develop targeted therapies that can eliminate leukemic burden and MRD. [0028] At a molecular level, AML is a heterogeneous disease with a common feature of impaired hematopoiesis. The most commonly recurring genetic alterations in AML fall into distinct categories including DNA methylation enzymes, transcription factors and proteins involved in signaling cascades (Cancer Genome Atlas Research, 2013). Mutations in the nucleophosmin (NPM1) gene form a distinct subset and are present in approximately 30% of all adult AML cases (Falini et al., 2005). Mutations in NPM1 occur in exon 12 and result in the loss of a nuclear localization signal (Falini et al., 2007, Falini et al., 2005). Wild-type PM1, which has a nucleo-cytoplasmic distribution, is involved in a multitude of cellular processes from ribosome biogenesis to stabilization of tumor suppressor genes (Falini et al., 2007). Mutant PM 1 is also referred to as PMl c because of its predominantly cytoplasmic localization, and has been shown to destabilize the pl9 (Art) tumor suppressor (Colombo et al., 2006) and prevent the degradation of Myc (Bonetti et al., 2008), which in turn controls the transcription of NPM1 (Zeller et al., 2001). PM 1 mutations are postulated to be driver mutations because of their presence in all leukemic cells, including LSCs, the stable nature of the mutation throughout disease (detected at relapse), and its occurrence prior to genetic lesions in other genes such as internal tandem duplications in FMS like kinase 3 (FLT3-ITD)

(Falini et al., 201 1, Martelli et al., 2010). [0029] Based on recent successes of cancer immunotherapies, enormous effort is being poured into the development of immune-based targeted therapies for the treatment of cancer, including AML. However, one of the major hurdles is the lack of suitable small animal models for preclinical testing. Ideally, such models should have stable reconstitution of human cancer cells and human immune cells including T cells, Natural Killer (NK) cells and macrophages - immune cells that mediate the cytotoxic effect of immunotherapeutics. These models would serve as preclinical platforms to evaluate the efficacy and elucidate the mechanisms of action of immunotherapies. [0030] For AML, many small animal models have been developed over the years, including transplantable xenograft models, chemically and virally induced murine leukemic models, and genetically engineered models in mice (3). Transplantable xenograft models were among the first developed due to the ease in generating these models. Human AML patient cells are expanded in vitro and engrafted in immune-compromised mice. Several groups have demonstrated the development of human AML in xenograft models (e.g., 4). However, a major limitation of these models is the lack of a matching human immune system. Several groups have attempted to circumvent this problem by introducing non-HLA- matched human peripheral blood mononuclear cells (PBMC), but the survival of these mice is very short due to the mis-matched tumor and human immune system. This makes the utility of these models limited with respect to testing therapies that require an intact human immune system, such as the many immunotherapies that are currently under development. Moreover, in these systems, early events in tumorigenesis cannot be studied since the cells used to develop these xenograft models are already tumorigenic. [0031] Whilst the techniques described herein are generally applicable to oncogenic lesions found in cancer, we have specifically identified that mutated nucleophosmin (NPMl), which is found in 30% of adult AML cases in the United States (1), can be used to provide a particularly good model for human AML. With respect to NPMl induced AML, several groups have tried to "humanize" mice by introducing patient-derived NPMl mutations (referred to as NPMlc) into the corresponding mouse locus but have not observed robust development of AML (5, 6). Vassillou et al. restricted the expression of human NPMlc in mouse hematopoietic cells and observed AML development in only a third of the mice (5). In these "NPMlc humanized" mice, the latency of disease was long, with an average survival of 617 days. A subsequent publication by the same group demonstrated that knocking-in the FMS-like tyrosine kinase 3 internal tandem duplication (FLT3-ITD), another commonly occurring genetic lesion in AML, into NPMlc mice dramatically accelerates disease progression (7). These data suggest that unlike what is observed in human patients, expression of NPMlc alone in mouse HSCs is insufficient to drive mouse AML. Importantly, all these models focus on the development of mouse leukemia with a human oncogenic lesion. [0032] More recently, human HSCs were transduced with oncogenes and transplanted into immune-compromised mice to generate de novo cancers. The most successful of these models have transplanted human HSCs transduced with various mixed lineage leukemia (MLL) fusion genes in retroviral and lentiviral vectors. These models have recapitulated the phenotype seen in patients with MLL-ENL producing B-cell acute lymphocytic leukemia (ALL), and MLL-AF9 producing a mixture of diseases with -25% AML presentation (8). [0033] These models represent poor systems to test new therapeutics, especially biologies, as no model to-date has reported the stable co-existence of human AML and an autologous human immune system. The humanized mouse MLL fusion models have come closest but the low prevalence of AML makes these models more suitable for studying ALL and MLL. [0034] Here, we report a model of de novo human AML with an autologous human immune system in immunocompromised mice. In this model, AML is driven by enforced expression of PMl c in human stem/progenitor cells (HSPCs) and results in a disease that resembles human PMl c+ AML in clinical presentation and transcriptional profile. Importantly, the non-transduced, normal HSPCs give rise to a functional human immune system in the same mouse. The de novo AML also produces CD123 + LSCs in the bone marrow, which can be depleted with a bi-specific Fab conjugate targeting CD3 and CD123 in a T cell-dependent manner. Transcriptome analysis further identifies up-regulation of Myc as a co-operating factor in NPMlc-dnven leukemogenesis and a potential target for intervention. The de novo induction of human AML in the presence of an autologous human immune system uniquely positions this model as a platform for studying early events in human leukemogenesis and as a preclinical tool for testing biologies, especially immune-based therapies. [0035] Described herein is a humanized mouse model of de novo human Acute Myeloid Leukemia (AML) with an autologous human immune system (referred to as AML-humouse hereafter) as a model of human AML. The AML-humouse can be used to develop new therapies for AML, for discovering new drug targets in AML and, more generally, to develop therapies and discover drug targets for human cancer. This model can be used to understand the process of cancer development and develop new vaccines against AML as well as more generally for developing adjuvants for cancer vaccines. It can also be used as a pre-clinical model to assess the blood toxicity of new treatments prior to clinical testing due to the co existence of an autologous human immune system with the AML. [0036] The AML-humouse is a mouse model of de novo human AML in the presence of an autologous human immune system. In one embodiment, this "humanized" mouse model of AML can be generated by engrafting human hematopoietic stem cells (HSCs) transduced with a lentiviral vector encoding an oncogene frequently deregulated in AML into

immunocompromised mice suitable for engraftment of these cells (e.g., NOD-SCID I12rg_ (NSG) mice) (FIGs. 1A-D). The lentiviral vector can cause constitutive expression of the oncogene in the transduced cells as expression is driven by the phosphoglycerate kinase 1 (PGK) promoter. As the transduction process affects approximately 10-30% of the HSCs, the remaining untransduced HSCs generate a normal human immune system (B cell, T cells, Natural Killer cells and myeloid cells) (e.g., an autologous immune system) alongside the human leukemia. Whilst this technique is generally applicable to oncogenic lesions found in cancer, we have specifically used mutated Nucleophosmin (NPM1) which is found in 30% of adult AML cases in the United States (1). Lentivirus encoding mutant human NPM1, hereafter referred to as NPMlc, is used to transduce human HSCs. In addition to mutant human NPM1, the lentivirus also encodes for and expresses a green fluorescent protein (GFP) in equimolar ratio, which serves as a surrogate marker for transduced cells and allows for the monitoring of leukemia development in the peripheral blood of these mice. The latency of AML development is typically 14-26 weeks post-engraftment. The leukemia can be characterized by dramatic weight loss, anemia, an expanded myeloid population in the blood and bone marrow, and the presence of leukemic blast cells in the blood.

[0037] As used herein, HSCs (e.g., human HSCs) are self renewing stem cells that, when engrafted into a recipient, can "repopulate" or "reconstitute" the hematopoietic system of a graft recipient (e.g., a non-human mammal; an immunodeficient non-human mammal) and

sustain (e.g., long term) hematopoiesis in the recipient. The hematopoietic system refers to

the organs and tissue involved in the production of the blood cell lineages (e.g., bone marrow, spleen, tonsils, lymph nodes). HSCs are multipotent stem cells that give rise to (differentiate into) blood cell types including myeloid cell lineages (e.g., monocytes and macrophages, neutrophils, basophils, eosinophils, erythrocytes, megakaryocytes/platelets, dendritic cells)

and lymphoid cell lineages (e.g., T-cells, B-cells, NK-cells). [0038] HSCs express the cell marker CD34, and are commonly referred to as "CD34+". As understood by those of skill in the art, HSCs can also express other cell markers, such as CD133 and/or CD90 ("CD133+", "CD90+"). In some instances, HSCs are characterized by

markers that are not expressed, e.g., CD38 ("CD38-"). While HSCs are described as CD34+, hematopoietic progenitor cells may also express CD34+, and therefore references to HSCs includes hematopoietic progenitor cells that also express CD34 (e.g., hematopoietic stem/progenitor cells (HSPCs)). [0039] HSCs are found in bone marrow such as in femurs, hip, ribs, sternum, and other bones of, e.g., a donor (e.g., vertebrate animals such as mammals, including humans, primates, pigs, mice, etc.). Other sources of HSCs for clinical and scientific use include umbilical cord blood, placenta, fetal liver, mobilized peripheral blood, non-mobilized (or unmobilized) peripheral blood, fetal liver, fetal spleen, embryonic stem cells, and aorta- gonad-mesonephros (AGM), or a combination thereof. [0040] As will be understood by persons of skill in the art, mobilized peripheral blood refers to peripheral blood that is enriched with HSCs (e.g., CD34+ cells). Administration of agents such as chemotherapeutics and/or G-CSF mobilizes stem cells from the bone marrow to the peripheral circulation. For example, administration of granulocyte colony-stimulating factor (G-CSF) for at least, or about, 5 days mobilizes CD34+ cells to the peripheral blood. A 30-fold enrichment of circulating CD34+ cells is observed with peak values occurring on day 5 after the start of G-CSF administration. Without mobilization of peripheral blood, the number of circulating CD34+ cells is very low, estimated between 0.01 to 0.05% of total mononuclear blood cells. [0041] The human HSCs for use in the methods can be obtained from a single donor or multiple donors. In addition, the HSCs used in the methods described herein can be freshly isolated HSCs, cryopreserved HSCS, or a combination thereof. [0042] As known in the art, HSCs can be obtained from these sources using a variety of methods known in the art. For example, HSCs can be obtained directly by removal from the bone marrow, e.g., in the hip, femur, etc., using a needle and syringe, or from blood following pre-treatment of the donor with cytokines, such as granulocyte colony-stimulating factor (G-CSF), that induce cells to be released from the bone marrow compartment. [0043] The HSCs for use in the methods of the invention can be introduced into the non- human mammal directly as obtained (e.g., unexpanded) or manipulated (e.g., expanded) prior to introducing the HSCs into the non-human mammal. In one embodiment, the HSCs are expanded prior to introducing the HSCs into the non-human mammal. As will be appreciated by those of skill in the art there are a variety of methods that can be used to expand HSCs (see e.g., Zhang, Y., etal., Tissue Engineering, 12(8):2161-2170 (2006); Zhang CC, etal, Blood, 7770:3415-3423 (2008)). In a particular embodiment, a population of HSCs can be expanded by co-culturing the HSCs with mesenchymal stem cells (MSCs) in the presence of growth factors (e.g., angiopoietin-like 5 (Angplt5) growth factor, IGF-binding protein 2 (IGFBP2), stem cell factor (SCF), fibroblast growth factor (FGF), thrombopoietin (TPO), or a combination thereof) to produce a cell culture. The cell culture is maintained under conditions in which an expanded population of HSCs is produced (e.g., see Maroun, K., et al, ISSCR, 7th Annual Meeting, Abstract No. 1401 (July 8-1 1, 2009), WO/2010/138873, filed May 28, 2010, which is incorporated herein by reference). [0044] The vectors can comprise additional elements known to those of skill in the art. For example, the vector can further comprise an IRES-driven reporter. In addition, as described herein, viral pseudotype can be used to further optimize infection. For example, viruses (e.g., lentivirus) pseudotyped with the envelope protein RD1 14, the surface glycoprotein VSV-G (Brenner, S. and H.L. Malech. 2003. Biochim. Biophys. Acta. 1640: 1- 24; Sandrin, V., et al. 2002. Blood 100: 823-832; Di Nunzio, et al. 2007. Hum. Gene Ther.

18: 8 11-20), or Gibbon ape leukemia virus (GALV) coat protein can be used. [0045] In the methods of the invention, the HSCs are introduced into a non-human mammal. As used herein, the terms "mammal" and "mammalian" refer to any vertebrate animal, including monotremes, marsupials and placental, that suckle their young and either give birth to living young (eutharian or placental mammals) or are egg-laying (metatharian or nonplacental mammals). Examples of mammalian species that can be used in the methods described herein include non-human primates (e.g., monkeys, chimpanzees), rodents (e.g., rats, mice, guinea pigs), canines, felines, and ruminents (e.g., cows, pigs, horses). In one embodiment, the non-human mammal is a mouse. The non-human mammal used in the methods described herein can be adult or newborn (e.g., < 48 hours old; pups). [0046] In particular embodiments, the non-human mammal is an immunodeficient non- human mammal, that is, a non-human mammal that has one or more deficiencies in its immune system (e.g., NSG or NOD scid gamma ( Ό .Cg-Prkdcscid Il2rgtmlWjl/SzJ) mice) and, as a result, allow reconstitution of human blood cell lineages by the human HSCs when introduced. For example, the non-human mammal lacks its own T cells, B cells, NK cells or a combination thereof. In particular embodiments, the non-human mammal is an immunodeficient mouse, such as a non-obese diabetic mouse that carries a severe combined immunodeficiency mutation (NOD/scid mouse); a non-obese diabetic mouse that carries a severe combined immunodeficiency mutation and lacks a gene for the cytokine-receptor γ chain (NOD/scid IL2R γ-/- mouse); or a Balb/c rag-/- yc-l- mouse. [0047] Other specific examples of immunodeficient mice include, but are not limited to, severe combined immunodeficiency (scid) mice, non-obese diabetic (NOO)-scid mice, IL2rg ~ ~ mice {e.g., NOD/LySz- IL2rg ~ ~ mice, NOD/Shi- scid IL2rg ~~mice (NOG mice), BALB/c- Rag IL2rg mice, -Rag IL2rg mice), IRag ^rg mice. [0048] Non-obese diabetic (NOD) mice carrying the severe combined immunodeficiency (scid) mutation are currently the most widely-used xenotransplant recipients. The engraftment of human cells in these NOD/scid mice, however, still does not exceed several percent, probably because of the residual presence of innate immunity and the low but

present NK-cell activity in these mice (Shultz, L.D., et al. 2007. Nat. Rev. Immunol. 7 : 118- 130; Chicha L., R . et al. 2005. Ann. N. Y. Acad. Sci. 1044:236-243). Their usefulness is further limited by their high predisposition to thymic lymphomas and thus a relatively short life span (-37 weeks) (Shultz, L.D., et al. 2005. J. Immunol. 174: 6477-6489). [0049] Recently, Shultz et al. generated NOD/scid mice that were lacking the gene for the common cytokine-receptor γ chain, a vital subunit of receptors for various cytokines crucial for lymphoid development (Shultz, L.D., et al. 2005. J. Immunol. 174: 6477-6489;

Cao, X., et al. 1995. Immunity 2 : 223-238). The resulting NOD/scid, c 11 mice are free of thymic lymphomas, have a much longer life span (-90 weeks), and have more profound deficiencies in their innate immunity than the NOD/scid mice; consequently they permit > 10- fold greater engraftment of human cells in their bone marrow (-70% of cells in their bone marrow are human, vs. -6% in NOD/scid mice) (Shultz, L.D., et al. 2005. J. Immunol. 174: 6477-6489; Ishikawa, F., et al. 2005. Blood 106(5): 1565-1573). [0050] Human HSCs in these mice gave rise to B cell precursors and mature IgM+ B cells in the bone marrow, as well as NK cells, myeloid cells, dendritic cells, and stem cells. The thymus contained T cell precursors, and peripheral blood leukocytes were primarily CD4+ and CD8+ T cells. The majority of splenocytes were human B cells arranged in follicular structures; soluble human IgM and IgG were detected in the peripheral blood, indicating the occurrence of class switching. Finally, follicle-like structures containing mostly B cells surrounding some T cells were observed in the spleen and mesenteric lymph nodes, and B cells were shown to be able to produce antigen-specific antibodies (both IgM and IgG) after immunization with ovalbumin (Shultz, L.D., et al. 2005. J. Immunol. 174: 6477-6489; Ishikawa, F., etal. 2005. Blood 106(5): 1565-1573). [0051] In some embodiments, the non-human mammal is treated or manipulated prior to introduction of the HSCs {e.g., to further enhance reconstitution of the human HSCs). For example, the non-human mammal can be manipulated to further enhance engraftment and/or reconstitution of the human HSCs. In one embodiment, the non-human mammal is irradiated prior to introduction of the HSCs. In another embodiment, one or more agents {e.g., chemotherapeutics) are administered to the non-human mammal prior to introduction of the HSCs. [0052] As will also be appreciated by those of skill in the art, there are a variety of ways to introduce HSCs engineered to encode the mutant human PM 1 into a non-human mammal. Examples of such methods include, but are not limited to, intradermal, intramuscular, intraperitoneal, intraocular, intrafemoral, intraventricular, intracranial, intrathecal, intravenous, intracardial, intrahepatic, intra-bone marrow, subcutaneous, topical, oral and intranasal routes of administration. Other suitable methods of introduction can also include, in utero injection, hydrodynamic gene delivery, gene therapy, rechargeable or biodegradable devices, particle acceleration devices ("gene guns") and slow release polymeric devices. The HSCs can be introduced into the non-human mammal using any such routes of administration or the like. [0053] In the methods of the invention, after the human HSCs are introduced into the non-human mammal, the non-human mammal is maintained under conditions in which the non-human mammal is reconstituted with the human HSCs and human mutant PM 1 are expressed in the mammal. Such conditions under which the non-human animals of the invention are maintained include meeting the basic needs {e.g., food, water, light) of the mammal as known to those of skill in the art. [0054] The methods of the invention can further comprise determining whether the nucleic acid encoding the mutant human PM 1 is expressed and/or the non-human mammal is reconstituted with the HSCs. Methods for determining whether the nucleic acid is expressed and/or the non-human mammal's blood cell lineage is reconstituted by the HSCs are provided herein and are well known to those of skill in the art. For example, flow cytometry analysis using antibodies specific for surface cell markers of human HSCs can be used to detect the presence of human HSCs or the progeny of the human HSCs in the non- human mammal (e.g., the blood lineage cell into which the human HSCs have differentiated in the non-human mammal). In addition, following reconstitution, the general health of recipient mice can be carefully monitored. Such monitoring can include obtaining peripheral white blood cell counts and cell marker phenotype. In particular embodiments, flow cytometry and immunohistochemistry can be used to characterize the cellular composition of the non-human mammal's primary and secondary lymphoid organs. In addition, reconstitution of human blood cell lineages by the human HSCs in the non-human mammal can be assessed by detecting human PM 1 in the non-human mammal's blood lineage that has been reconstituted by the human HSCs. [0055] In another aspect, the methods of the invention can further comprise serially transplanting the human myeloid leukemia of the non-human mammal (i.e., the humanized non-human mammal model that is a model for human acute myeloid leukemia (produced by the methods described herein); the primary humanized non-human mammal model) to other non-human mammals, thereby producing one or more additional non-human mammals that are models for human acute myeloid leukemia (secondary humanized non-human mammal model). In this aspect, the method comprises introducing human cells that express the mutant human NPM1 from the humanized non-human mammal that is a model for a human myeloid cancer (e.g., human myeloid obtained from the humanized non-human mammal) into one or more immunodeficient non-human mammals. The one or more non-human mammals are maintained under conditions in which the human HSCs are reconstituted and the mutant human PM 1 is expressed in the second non-human mammal, thereby producing one or more additional non-human mammals that are models for a human AML cancer. In particular embodiments, the additional one or more non-human mammals are the same or a similar species as the original humanized non-human mammal model (i.e., the original non-human mammal model is a humanized mouse model and the additional non-human mammal models are mice). In other embodiments, the additional one or more non-human mammals are a different species than the original humanized non-human mammal model. [0056] As will be appreciated by those of skill in the art, several types of cells obtained from the humanized non-human mammal can be used in the method. For example, human cells obtained from the bone marrow or the spleen of the humanized non-human mammal can be used. In a particular embodiment, the cells are splenocytes of the humanized non-human mammal (the primary humanized non-human mammal). [0057] Methods for obtaining (e.g., isolating, purifying, substantially purifying) such cells are known to those of skill in the art. As used herein, "isolated" refers to substantially isolated with respect to the complex (e.g., cellular) milieu in which it naturally occurs, or organ, body, or culture medium. In some instances, the isolated material will form part of a composition (for example, a crude extract containing other substances), buffer system or reagent mix. In other circumstances, the material can be purified to essential homogeneity. An isolated cell population can comprise at least about 50%, at least about 80%, at least about

85% , at least about 90%, at least about 95%, or at least about 99% (on a total cell number basis) of all cells present. [0058] In some aspects, the cells obtained from the humanized non-human mammal can be injected directly into one or more non-human mammals. In other aspects, the cell can be expanded as described herein prior to introduction into the non-human mammal(s). [0059] Thus, cohorts (e.g., about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 20, about 30, about 40, about 50, about 60, about 70, about 80, about 90, about 100 etc.) of non-human mammals that are models for a human AML can be produced using human cells that express PM 1 obtained from the original (first; primary) non-human mammal that was produced by introducing human HSCs engineered to express PM 1. As will be appreciated by those of skill in the art, these mice also be used to serially transplant one or more cohorts. [0060] Based on our understanding of the importance of the immune system in controlling tumor progression and the recent successes of immunotherapies for cancer treatment, there is a need to develop small animal models that faithfully recapitulate the human tumor-immune system interaction. These models would serve as preclinical platforms to test immunotherapies and to better understand immune editing of tumors in vivo. While new immunotherapies are being developed to treat AML, the lack of suitable preclinical model makes it difficult to accurately test the efficacy and toxicity of these therapies in vivo where the leukemia exists alongside a normal human immune system which includes T cells, Natural Killer cells and macrophages - immune cells that are required to elicit the cytotoxic effects of immunotherapies. [0061] This AML humanized model has several advantages over existing models, namely: i) Disease characteristics (weight loss, anemia, enlarged myeloid compartment, blast cells in the peripheral blood) mirror patient AML cases as presented in the clinic making this model clinically relevant ii) A sub-population of leukemic cells express an AML leukemic stem cell marker CD123, as observed in patient AMLs. This marker is thought to be one of the important markers to target in developing AML specific therapy iii) Presence of a human oncogenic mutation, PM l c, enables the development of therapies, especially immunotherapies, that specifically target leukemic cells with minimal side effects on normal tissue; a highly sought after characteristic for new anti-cancer therapies iv) The NPMlc mutation generates a neo-epitope (neo-antigen) presented on human major histocompatibility complex I (MHC-I, HLA-A2*0201 allele) v) This neo-epitope (neo-antigen) allows for the development of CD 8 T cell targeting immunotherapies for the treatment of AML cells vi) Presence of a normal immune system with normal CD8 T cells enables the testing of efficacy and toxicity of such therapies vii) It allows the initiating events of a human leukemia to be studied in an in vivo setting viii) The disease generated is wholly human with known genetic lesions, meaning that any discovery is directly applicable to genetically similar disease in the clinic without having to deal with the confounding species differences, engraftment failures and passaging effects that limit current models ix) The unique presence of an autologous human immune system alongside a de novo human leukemia allows for the investigation of the role of various components of the human immune system in leukemia development and/or progression x) Allows for the modulation of the tumor-immune system interaction to improve efficacy of existing therapeutics xi) Enables use as a pre-clinical tool for the testing and development of anti-cancer biologies such as antibody therapies, cell based therapies and vaccine based approaches in which the tumor-immune system interaction is essential for the success of the therapy xii) Drug toxicity can be assessed in vivo in the presence of normal human cell populations including stem cells xiii) Hypotheses about the early events in disease progression can be tested. [0062] This AML humanized model system offers significant improvements over existing model systems. Below is a list of limitations in current models that are addressed by our model: i) The current gold standard model system in AML research is a xenotransplantation model of engrafting patient AML samples (from peripheral blood) into immunocompromised mice. One of the biggest limitations of this model is the low efficiency of human graft establishment. With current protocols, only about 50% of patient samples engraft in these mice. Additionally, these mice do not possess any other human cells. This means that they lack both an autologous human immune system for testing treatments that require interaction with other immune cells and the system lacks human cells to assess toxicity ii) In terms of other mouse models used in AML research, several genetic mouse model systems exist in which the human oncogenes have been introduced into the native mouse locus thus "humanizing" the allele. The most pertinent of these models is one that has humanized the mouse Npml allele to human PM l c. However, in this model, not all animals succumb to disease and only 25% of the tumors that develop are AML. The rest of the tumors are B cell leukemias and non-hematopoietic cancers. Additionally, the average latency of AML development is markedly long at 617 days. As with the xenotransplantation model, a major disadvantage of this model that is overcome in our AML humanized model, is the lack of a normal human immune system compartment iii) While humanized mouse models for other diseases exist there is at present none for AML and the existing models either produce variable disease, have poor/no penetrance or (in an already patented model from our lab) model a B-cell leukemia/lymphoma. iv) AML cells expressing human NPMlc in this model allow for the development of immunotherapies that are tumor-specific, a highly sought after goal in cancer immunotherapy v) Presence of an autologous human immune system allows for this system to be used as a pre-clinical tool for testing the efficacy and safety of immune- based therapies the efficacy of which depends on an intact normal human immune system vi) Presence of an oncogenic patient mutation that generates a neoantigen presented on the MHC-I complex, allows for the development of CD8 T cell directed therapies for the treatment of AML. [0063] Surprisingly, we have observed that NPMlc alone is sufficient to promote AML when expressed in human HSCs. In particular, we have observed that it is not necessary to express FMS-like tyrosine kinase 3 internal tandem duplication (FLT3-ITD) in order to promote AML, and that expression of FLT3-ITD actually inhibits the development of AML in the model. This result is particularly surprising for several reasons. FLT3 is commonly mutated in humans suffering from AML. Prior studies of AML models have reported that the presence of both a mutated NPM1 and a FLT3-ITD is required. In some prior AML models, NPM1 was reported to be expressed in the whole organism, which only reportedly shows myelodysplasia, but no AML development. Other studies have reported that NPMlc transgenic mice under control of a myeloid promoter reportedly induces myeloproliferation, not AML. Other studies have reported that NPMlc in mice reportedly perturbs megakaryopoiesis, but no AML develops in 1.5 year follow-up. Other studies have reported that expressing PM l c in the entire mouse did not exhibit AML, only myelodysplasia. Thus, in many other studies, the authors have reported that expressing NPMlc alone in a mouse does not provide a suitable model for AML. [0064] The AML model described herein also improves upon mixed lineage results that have only a murine immune (not an human immune system). For example, when a human NPMlc was reported to be knocked-in in the mouse locus and expression restricted of NPMlc to mouse HSCs, there was reported to be a long latency of disease and only approximately 30% of the diseased mice demonstrated a myeloid leukemia as a cause of death. Other deaths were reported to be due to B cell and non hematopoietic malignancies. [0065] Surprisingly, we have observed that a non-human mammal that is a model for human AML can be produced when the human mutant NPMlc is expressed under the control of a ubiquitous promoter. This is particularly surprising because prior work suggested that a

lineage-specific promoter (e.g., a myeloid promoter) would be most likely to generate a non- human mammal that is a model for human AML. In contrast, transducing HSCs so that they express NPMlc under the control of the CD14 myeloid promoter failed to develop AML. [0066] Thus, it is particularly surprising that we have discovered that NPMlc alone can drive a successful model for AML. In particular, it is further surprising that using a ubiquitous promoter to express NPMlc can contribute to development of AML in an average range 14-26 weeks. Further surprising is that we have demonstrated death due to myeloid disease in all mice. [0067] The modeled disease resembles AML category M2-M5 based on the British- French-American classification system, which is a monocytic to myelomonocytic disease. Additionally, CD123+ leukemic stem cells (LSCs) are detected in this model and transcriptomic analysis confirms the stem-cell like expression profile of these cells. NPMlc driven leukemic cells also express a HOX gene signature, resembling AML presented in the clinic. Importantly, the disease develops alongside a matched autologous immune system thus allowing the study of various aspects of the tumor-immune system interaction, including developing and testing new immunotherapies pre-clinically. [0068] The presence of normal T cells can be especially useful for testing the efficacy of checkpoint blockade therapies, including anti-PDl and anti-CLTA4. Another major advantage of some embodiments is the ability to screen for severe toxicities that could be imparted by the human immune system, thus reducing the likelihood of unwanted toxicities in the clinic. [0069] Without wishing to be bound by theory, it is believed that the methods described herein provide for a non-human mammal that is a model for human acute myeloid leukemia with an autologous human immune system. For example, the data in FIG. 2E shows the presence of B, T, and NK cells from the GFP negative human leukocyte population. Additionally, without wishing to be bound by theory, and only in some embodiments, it is believed that the methods described herein provide for reconstituting the non-human mammal's blood lineage with human HSCs, wherein NPMlc is expressed in the non-human mammal solely in the human blood lineage cells. [0070] Surprisingly, we have also discovered synergistic results arising from inhibiting Myc in conjunction with administering a bi-specific Fab conjugate that binds CD3 and CD123, to NPMlc+ cells. Myc can be directly or indirectly inhibited. Here, we have administered JQl . Without wishing to be bound by theory, JQl binds BRD4, a bromodomain protein, which causes BRD4 to dissociate from Myc, thereby rendering Myc unable to transcribe its target genes. Because Myc activates itself, administering JQl causes further depletion of Myc through a feedback loop effect. Significantly, co-administering JQl and a bi-specific Fab conjugate that binds CD3 and CD123 results in decreased viability of a population of CD123+ cells, particularly those that express mutant human NPM1 (e.g., NPMlc + cells). Myc can also be indirectly inhibited by targeting BRD4 for degradation by, for example, administering proteolysis targeting chimeras that transfer ubiquitin to BRD4, thereby targeting BRD4 for degradation. Such proteolysis targeting chimeras are available from, e.g., Arvinas Inc. (New Haven, Connecticut, USA). See also CM. Crews et al., J . Biol. Chem. 285, 11057 (2010); see also CM. Crews et al., ACS Chem. Biol. 3, 677 (2008); see also Lu, J . et al., Chem. Biol. 22, 755-63 (2015). JQl is a compound having the following structure: [0071] Another compound that inhibits BRD4 is OTX015, which is a compound having the following structure:

[0072] One embodiment is a method of reducing viability of a population of CD123+ cells, the method comprising contacting the population of CD123+ cells with a Myc inhibitor and contacting the population of CD123+ cells with a bi-specific Fab conjugate that binds CD3 and CD123. Another embodiment is a method of reducing CD123+ cells in a patient in need thereof, such as a patient with NPMlc + AML, the method comprising administering to the patient an effective amount of a Myc inhibitor and an effective amount of a bi-specific Fab conjugate that binds CD3 and CD123. Another embodiment is a method of treating NPM1C + AML in a patient in need thereof, the method comprising administering to the patient an effective amount of a Myc inhibitor and an effective amount of a bi-specific Fab conjugate that binds CD3 and CD 123. In some instances, the Myc inhibitor indirectly inhibits Myc. In some instances, the Myc inhibitor is a BRD4 inhibitor. In some instances, the BRD4 inhibitor is JQ1 or OTX015. In some instances, the Myc inhibitor causes degradation of BRD4. In some instances, the population of CD123+ cells are contacted with the Myc inhibitor, and subsequently contacted with the bi-specific Fab conjugate that binds CD3 and CD123. In some instances, the Myc inhibitor is administered to the patient first, and subsequently the bi-specific Fab conjugate that binds CD3 and CD123 is administered to the patient. In some instances, at least some cells of the cell population express mutant human NPM1.

EXEMPLIFICATION Example #1 [0073] Here, we demonstrate the development of a humanized mouse model of de novo Acute Myeloid Leukemia (AML) with an autologous human immune system. Initially, based on the mutation profile of aggressive AMLs with poor prognosis, we attempted to model human AML by expressing the oncogenes NPMlc and FLT3-ITD (Internal Tandem Duplication) (2, 9). We hypothesized that the combination of both oncogenes would result in aggressive disease. Moreover, data from transgenic mouse models supported this hypothesis (7). Surprisingly, we did not observe disease development under these conditions. Instead, expression of NPMlc alone in human HSCs resulted in AML, as described in more detail below. [0074] To develop a de novo human AML, we transduced human HSCs with a lentivirus expressing a patient-derived mutation of Nucleophosmin (NPMlc). A schematic of the plasmid used is shown in FIGs. 4A-4C. The pL3 lentivirus plasmid backbone used in these experiments was designed based off the pLB2 plasmid (see, e.g., Published PCT Application No. WO 201 1/002721). To generate pL3, the following modifications were made: i) deletion of U6 promoter and extraneous mouse DNA sequence downstream of U6, ii) deletion of human EFla promoter, iii) deletion of anti-repressor element, and iv) introduction of a multiple cloning site (MCS). The particular mutant human PM 1 used in the experiments described herein is Mutation A, the sequence for which is listed in FIG. 7C (SEQ ID NO:2). [0075] Depicted in FIG. IB is the confirmation of cytoplasmic localization of the NPMlc protein, as has been previously described (10). The resulting virus expresses NPMlc and GFP in equimolar ratio under the control of the PGK promoter and allows us to monitor GFP expression as a surrogate for NPMlc expression. The transduced HSCs are engrafted into

immune-compromised NOD-scid IL2rg _ (NSG) mice. Since viral transduction of HSCs results in 10-20% of transduced cells, the pool of cells that is introduced into NSG mice is a mix of transduced (oncogenic) and untransduced (normal HSCs). Starting from 6 weeks post engraftment, mice are monitored for AML development by assessing peripheral blood for human CD45 cells and GFP expression. GFP expression serves as a surrogate for the oncogenic, transduced NPMlc expressing cells. GFP expressing human cells can be observed in these mice as early as 6 weeks post engraftment. Mice engrafted with human HSCs expressing NPMlc have a shorter lifespan compared to control mice and present with splenomegaly and anemia (FIG. 1C). The resulting disease resembles AML as presented in the clinic with a prevalence of blast cells both in the blood and bone marrow of moribund mice (FIG. ID). Infiltration of GFP+ cells is observed in the liver of sick mice, as is cytoplasmic expression of NPMlc (FIG. ID). This data supports the oncogenic role of NPMlc in initiating and promoting disease. Surprisingly, NPMlc alone is sufficient to promote disease when expressed in human HSCs. This data corroborates patient AML data and contradicts data obtained from mouse AML models suggesting a species-specific difference while highlighting the importance of developing suitable small animal models that can recapitulate human disease (5, 6, and 7). [0076] To further characterize the disease caused by expression of NPMlc we assessed the phenotype of the diseased cells. NPMlc expressing mice demonstrate a higher level of GFP expressing CD33 myeloid cells (FIG. 2A) and an accumulation of myeloid cells in the bone marrow at terminal stages of the disease (FIG. 2B). Phenotypically, the disease that develops in this humouse AML model resembles the broad M2-M5 category of the human disease as per the French-American-British (FAB) classification system, mirroring the pattern demonstrated by patient AMLs with an NPMlc mutation. As shown in FIG. 2C, NPMlc expressing cells express CD123, CD33 and CD38 and low levels of CD34, CDl lb and CD14. In the bone marrow, which is the primary site of disease, we detect the presence of CD 123 expressing leukemic stem cells (LSC) (FIG. 2D). These LSCs are hypothesized to seed the disease and are responsible for disease relapse upon conventional chemotherapy. [0077] FIG. 3A shows the lack of GFP+ cells in the bone marrow of mice transduced with virus expressing both NPMlc and FLT3-ITD. These mice never developed disease and were sacrificed 5 months post engraftment. FIG. 3B shows the lack of disease development as assessed by a lack of GFP+ cells in the peripheral blood of mice transduced with virus expressing NPMlc under the control of the myeloid CD 14 promoter. At 6 months post engraftment no human GFP+ cells are observed in the peripheral blood in contrast to PGK-

GN mice which are shown as a comparison at week 13 post engraftment. [0078] Secondary transfer studies of leukemic cells from primary AML mice into IL3 and GM-CSF primed secondary recipients confirm the tumorigenicity of the leukemic cells. An additional feature of this system, and perhaps the most important with respect to its utility as a pre-clinical tool for testing the efficacy of immunotherapies, is the presence of an autologous human immune system that develops alongside the leukemic cells. FIG. 2E demonstrates the presence of normal B, T and Natural Killer cells in AML mice. This unique feature occurs due to the transfer of a pool of cells (only <20% of which are transduced with virus) into NSG mice at the start of the experiment. Since the disease that develops in this model is eventually fatal but does not develop at a grossly accelerated rate, the bone marrow supports the development of normal immune cells alongside the leukemic cells. This is another feature of the AML humouse that is reminiscent of patient AML, as adult AML is usually a slow-growing, smoldering disease that eventually destroys the bone marrow niche ultimately disrupting hematopoiesis. [0079] To assess tumorigenicity of leukemic cells from GN mice, we transferred 2 million cells from the bone marrow of leukemic mice into irradiated secondary NSG recipients that had been primed with human IL3 and GM-CSF. Secondary AML mice show accumulation of GFP+ myeloid cells in the periphery and developed disease starting from 8 weeks post engraftment. Histological analysis (H&E stains) shows presence of myeloid cells in the spleen, bone marrow and liver of a matched primary and secondary mouse. Note the presence of mitotic figures in the spleen of secondary mouse indicating highly tumorigenic cells and the infiltration of myeloid cells in the livers of primary and secondary mice. [0080] We performed genome-wide transcriptome analysis on bone marrow cells from 3 independent GN mice. All 3 mice were made from separate human HSC donors and transduced at separate times. The bone marrow cells from GN mice were sorted into leukemic (GFP+ CD33+) and leukemic stem cell (GFP+CD123+CD33+) fractions followed by RNA purification. The RNA was then processed according to the NuGen method to generate cDNA libraries for Illumina sequencing. As shown in FIG. 6A, the sorted cells from independent HSC donors cluster together indicating similar gene expression profiles. We also analyzed the presence of previously defined HOX gene signatures, which are used to characterize PM l c+ patient AML samples. qRT-PCR from GFP+ CD33+ bone marrow cells from control mice (G) or AML mice (GN) show high expression of HOXA5, HOXA6 and HOXA9 genes in GN mice. [0081] In this model system, the expression of NPMlc is not restricted to the myeloid lineage due to the use of the PGK promoter. While we observe GFP positive B and T cells, these transduced cells do not cause disease. We conclude the above based on the following observations: i) transfer of CD33 negative CD123 negative GFP expressing cells does not result in disease in secondary mice, and ii) histological analyses of moribund mice, even those that have a significant portion of B and T cells expressing GFP has not revealed signs of lymphoid disease. While this may seem surprising at first, a survey of the literature supports the idea that the expression of NPMlc is oncogenic only when expressed in the myeloid lineage. In patients, NPMlc is only observed in hematologic cancers of the myeloid lineage and mice expressing NPMlc systemically only develop myelodysplasia ( 11). Importantly, we have tried to use both the CDl lb and CD14 promoters to model NPMlc driven leukemia and have been unsuccessful. This unexpected result could perhaps be attributed to the low levels of expression of CD14 and CDl lb observed on patient AML cells (12) or the requirement for the NPMlc lesion to be present in hematopoietic progenitor cells in which the CDl lb or CD14 promoters may not be active (13, 14). [0082] Significantly, our unexpected finding that expression of NPMlc alone in human HSCs can drive myeloid leukemia makes this the first model of de novo human AML with an autologous human immune system which can be used as a pre-clinical tool and also a model to study early events in tumorigenesis to decipher novel pathways that can be targeted for therapy.

Reference Numbers 1-14 [0083] 1. B . Falini, E . Tiacci, M . P. Martelli, S. Ascani, S. A . Piled, New classification of acute myeloid leukemia and precursor-related neoplasms: changes and unsolved issues. DiscovMed 10, 281-292 (2010).

[0084] 2 . S. Takahashi, Downstream molecular pathways of FLT3 in the pathogenesis

of acute myeloid leukemia: biology and therapeutic implications. J Hematol Oncol 4, 13 (201 1)10. 1186/1756-8722-4-13). [0085] 3 . E . McCormack, O . Bruserud, B . T. Gjertsen, Animal models of acute myelogenous leukaemia - development, application and future perspectives. Leukemia 19, 687-706 (2005); published online EpubMay (10.1038/sj.leu.2403670). [0086] 4 . T. Lapidot, C . Sirard, J . Vormoor, B . Murdoch, T. Hoang, J . Caceres-Cortes, M . Minden, B . Paterson, M . A . Caligiuri, J . E . Dick, A cell initiating human acute myeloid leukaemia after transplantation into SCID mice. Nature 367, 645-648 (1994); published online EpubFeb 17 (10.1038/367645a0).

[0087] 5. G . S. Vassiliou, J . L . Cooper, R . Rad, J . Li, S. Rice, A . Uren, L . Rad, P. Ellis, R . Andrews, R . Banerjee, C . Grove, W . Wang, P. Liu, P. Wright, M . Arends, A . Bradley, Mutant nucleophosmin and cooperating pathways drive leukemia initiation and progression in mice. Nat Genet 43, 470-475 (201 1); published online EpubMay (10.1038/ng.796). [0088] 6 . P. Sportoletti, E . Varasano, R . Rossi, A . Mupo, E . Tiacci, G . Vassiliou, M . P. Martelli, B . Falini, Mouse models of NPMl -mutated acute myeloid leukemia: biological and clinical implications. Leukemia 29, 269-278 (2015); published online EpubFeb (10.1038/leu.2014.257).

[0089] 7 . A . Mupo, L . Celani, O . Dovey, J . L . Cooper, C . Grove, R . Rad, P. Sportoletti,

B . Falini, A . Bradley, G . S. Vassiliou, A powerful molecular synergy between mutant Nucleophosmin and Flt3-ITD drives acute myeloid leukemia in mice. Leukemia 27, 1917- 1920 (2013); published online EpubSep (10.1038/leu.2013.77).

[0090] 8. F. Barabe, J . A . Kennedy, K . J . Hope, J . E . Dick, Modeling the initiation and progression of human acute leukemia in mice. Science 316, 600-604 (2007); published online EpubApr 27 (316/5824/600 [pii] 10.1 126/science.l l39851). [0091] 9 . G . J . Roboz, Novel approaches to the treatment of acute myeloid leukemia. Hematology Am Soc Hematol Educ Program 2011, 43-50 (201 1)10.1 182/asheducation- 201 1.1.43). [0092] 10. B . Falini, C . Mecucci, E . Tiacci, M . Alcalay, R . Rosati, L . Pasqualucci, R . La Starza, D . Diverio, E . Colombo, A . Santucci, B . Bigerna, R . Pacini, A . Pucciarini, A . Liso, M . Vignetti, P. Fazi, N . Meani, V. Pettirossi, G . Saglio, F. Mandelli, F. Lo-Coco, P. G . Pelicci, M . F. Martelli, Cytoplasmic nucleophosmin in acute myelogenous leukemia with a normal karyotype. Engl J Med 352, 254-266 (2005); published online EpubJan 20 (10.1056/NEJMoa041974). [0093] U . K . Cheng, P. Sportoletti, K . Ito, J . G . Clohessy, J . Teruya-Feldstein, J . L . Kutok, P. P. Pandolfi, The cytoplasmic PM mutant induces myeloproliferation in a transgenic mouse model. Blood 115, 3341-3345 (2010); published online EpubApr 22 (10.1 182/blood-2009-03-208587). [0094] 12. G . Tsykunova, H . Reikvam, R . Hovland, O . Bruserud, The surface molecule signature of primary human acute myeloid leukemia (AML) cells is highly associated with PM 1 mutation status. Leukemia 26, 557-559 (2012); published online EpubMar (10.1038/leu.201 1.243). [0095] 13. M . P. Martelli, V. Pettirossi, C . Thiede, E . Bonifacio, F. Mezzasoma, D . Cecchini, R . Pacini, A . Tabarrini, R . Ciurnelli, I . Gionfriddo, N . Manes, R . Rossi, L . Giunchi, U . Oelschlagel, L . Brunetti, M . Gemei, M . Delia, G . Specchia, A . Liso, M . Di Ianni, F. Di Raimondo, F. Falzetti, L . Del Vecchio, M . F. Martelli, B . Falini, CD34+ cells from AML with mutated PM 1 harbor cytoplasmic mutated nucleophosmin and generate leukemia in immunocompromised mice. Blood 116, 3907-3922 (2010); published online EpubNov 11 (10.1 182/blood-2009-08-23 8899). [0096] 14. D . C . Taussig, J . Vargaftig, F. Miraki-Moud, E . Griessinger, K . Sharrock, T.

Luke, D . Lillington, H . Oakervee, J . Cavenagh, S. G . Agrawal, T. A . Lister, J . G . Gribben, D . Bonnet, Leukemia-initiating cells from some acute myeloid leukemia patients with mutated nucleophosmin reside in the CD34(-) fraction. Blood 115, 1976-1984 (2010); published online EpubMar 11 (10.1 182/blood-2009-02-206565).

Example #2 Results [0097] Enforced expression ofNPMlc drives the development of human myeloid leukemia [0098] To develop human AML in mice, we introduced human oncogenes into HSPCs and engrafted the transduced cells in NOD-scid ILR2 _ (NSG) mice. Specifically, we tested two oncogenes: NPMlc, the mutant form of nucleophosmin found in 35% of adult AML (Falini et al., 2005), and FLT3-ITD, an oncogenic form of FLT3 with an internal tandem duplication (ITD), found in 23% of AML patients (Kiyoi et al., 1999, Falini et al., 2005). For ease of identification of transduced human leukocytes and tumor cells, green fluorescent protein (GFP) was expressed together with oncogenes in equal stoichiometry using the 2A peptide. Three lentiviral vectors were constructed to express GFP alone (referred to as G), GFP plus NPMlc (referred to as GN), or GFP plus FLT3-ITD and NPMlc (referred to as GFN) all under the control of the ubiquitous phosphoglycerate kinase 1 (PGK) promoter (FIG. 8A). Human CD34+ HSPCs were transduced with lentiviruses individually with a transduction efficiency of 5-20%. Mixtures of transduced and untransduced HSPCs were engrafted into sub-lethally irradiated NSG neonates within 24-48 hours of birth by intracardiac injection. Mice were monitored for human leukocyte reconstitution and GFP expression in the peripheral blood starting around 8 weeks of age. Mice that were engrafted with HSPCs transduced with G, GN and GFN lentiviruses are referred to as G, GN and GFN mice, respectively. [0099] G, GN and GFN mice all had similar levels of human leukocyte reconstitution in the peripheral blood at 9 weeks post-reconstitution (FIG. 8J). While G mice had -15% of GFP+ human leukocytes, GN mice had 22% of GFP+ human leukocytes, of which a large fraction were myeloid cells (FIGs. 8B and 8C). In contrast, a lower level of GFP+ human leukocytes was detected in the peripheral blood of GFN mice at 9 weeks of age although the GFN lentivirus titer was similar to the other two. All GN mice died within 14-27 weeks post- engraftment (FIG. 8D and see below), whereas G and GFN mice had a normal lifespan of -1.5 years. To investigate the unexpected absence of AML development in GFN mice, we analyzed bone marrow for human cells and GFP expression at 6 months of age. Although the human cell engraftment persisted, no or very few GFP+ cells were detected (FIG. 8K), suggesting poor survival of cells with simultaneous expression of both NPMlc and FLT3- ITD. For this reason, GFN mice were excluded from subsequent analysis. [00100] GN mice develop AML with similar presentations as in human patients. Blasts were readily detected in the blood and bone marrow of GN mice (FIG. 8E). Moribund GN mice had visibly fewer red blood cells and pale femurs with significantly reduced cellularity compared to G mice (FIGs. 8F and 8G). Histological analysis confirmed the reduced cellularity in the bone marrow of GN mice (FIG. 8H). Leukocyte infiltration was often detected in the liver (FIG. 8H) and lung of moribund GN mice. Immunohistochemistry confirmed GFP expression in the bone marrow sections of both G and GN mice but cytoplasmic expression of NPMlc only in GN mice (FIG. 81). Moribund GN mice also displayed splenomegaly as in human patients. [00101] Disease development in GN mice was further examined by flow cytometry. Nine weeks post engraftment, although G and GN mice had similar levels of human leukocyte reconstitution in the blood, a significantly higher fraction in GN mice was GFP+ and expressed CD33, a myeloid marker commonly expressed by human NPMlc + AML cells (FIG. 8B and 8C). By the time GN mice started to lose weight and become sick, there was a marked increased in the percentage and number of human GFP+CD33 + myeloid cells that were also CD 13 , whereas in the same GN mice GFP CD33 +CD13 myeloid cells did not expand (FIG. 9A and 9B). The GFP+CD45+ human myeloid cells in sick GN mice were strongly positive for CD13, CD33, CD47 and CD38, modest for CDl lb and CD14, and low or negative for CD34 (FIG. 9C). In addition, a small but distinct fraction of GFP+CD45+ human myeloid cells in the bone marrow of GN mice expressed the leukemic stem cell markers CD123 and CD38 (FIGs. 9C and 9D), of which a small fraction was positive for CD34. By staining RNA with Pyronin Y and DNA with HOECHST, a higher fraction of GFP+CD123 +CD34+ cells were in G0/G1 phase as compared to GFP+CD123 CD34 cells (FIG. 9F). This data shows that enforced expression of NPMlc in CD34+ HSPCs drives the expansion of myeloid cells, which have a similar immunophenotype to NPMlc + leukemic cells in AML patients. [00102] The short life span of GN mice suggests that the expanded human myeloid cells are aggressive leukemic cells. To test this, we adoptively transferred total bone marrow cells from moribund GN mice into 6-8 week old NSG recipient mice. Because human interleukin- 3 (IL-3) and human granulocyte macrophage colony stimulating factor (GM-CSF) are known to enhance AML engraftment, we expressed these cytokines in sub-lethally irradiated recipient mice prior to engraftment (Lapidot et al., 1994). As with AML cells from patients, secondary mice became sick and died only when recipient mice were irradiated and expressed human IL3 and GM-CSF, and not all secondary mice developed disease (Table 1). Flow cytometry and histology analysis showed that most of the cells in the spleen and bone marrow of the diseased secondary mice were human GFP+CD33 +CD13 + leukemic cells (FIG. 9E). Since a small fraction of human T cells, B cells and NK cells were also GFP+, we isolated GFP+CD123 CD34 cells from the bone marrow of moribund GN mice and transferred them into cytokine-expressing and sub-lethally irradiated NSG recipients, but no engraftment was observed (Table 1). Consistently, no sign of lymphoid tumor was observed even in mice that had a significant portion of GFP-expressing B and T cells. Together, these data show that enforced expression of NPMlc in CD34+ HSPCs is sufficient to drive the development of de novo human AML in mice.

Table 1: Summary of secondary transfer experiments.

[00103] Development of normal human immune cells in AML mice [00104] Next, we assayed reconstitution of human immune cells in GN mice. As early as 9 weeks of age, CD3 + (GFP ) T cells were detected in the peripheral blood of both G and GN mice (FIG. 10A). In sick GN mice, both CD3 + T cells and CD19 B cells were detected in the spleen and bone marrow at significant levels (FIGs. 10B and IOC). CD56+CD3 NK cells were also detected in the spleen and bone marrow but at lower levels. Most of the T cells, B cells and NK cells were GFP , indicating their development from non-transduced, normal HSPCs. Thus, as enforced expression of NPMlc drives the development of AML, the non- transduced HSPCs give rise to autologous human immune cells in the same GN mice. [00105] Evaluating T cell-based immunotherapy in GN mice [00106] GN mice with human AML and autologous immune system make them ideally suited to evaluate the efficacy and mechanism of action of immune-based therapies. We tested a bi-specific Fab conjugate (referred to as BFC) in which one arm binds to CD3 and the other arm binds to CD123, therefore redirecting T cells to CD123 + LSCs. Mice were given g BFC daily for 7 days and bled two days before BFC treatment (day -1), one (day 8) and ten (day 17) days after BFC treatment, and analyzed by flow cytometry for GFP, hCD45, CD123 and CD3. The level of GFP+CD123 + LSCs and hCD45 +CD3 + T cells in each mouse after treatment was normalized to its level before treatment. As shown in FIG. 10D, the percentage of human CD45+GFP+CD123 + cells decreased significantly (~2-fold) on day 8 following BFC treatment. Although the percentage of human CD45+GFP+CD123 + cells was still lower on day 17, the difference was no longer significant. In contrast following PBS injection, the percentage of human CD45 +GFP+CD123 + cells did not change much in GN mice. There was no significant change in the percentage of human CD45+CD3 + T cells in the peripheral blood at day 8 and 17 following either PBS or BFC injection. Administration of a single dose of OKT3 two days before BFC treatment led to a complete absence of human CD45+CD3 + T cells on day 8, a 3-fold reduction on day 17, and consequently abolished BFC- mediated depletion of human CD45+GFP+CD123 + cells (FIGs. 10D and 10E). [00107] We also enhanced T cell numbers by expressing human IL-7 10 days before BFC treatment. As a result a more severe depletion (~5-fold) of human CD45+GFP+CD123 + cells was detected on day 8 following BFC treatment (FIG. 10D). Consistent with previous reports showing expansion of CD45RA effector memory T cells following treatment with CD123/CD3 BFC (Klinger et al., 2012, Wong et al., 2013), a decrease in percentages of CD45RA + but an increase in percentages of CD45RO + CD4 and CD8 T cells were observed on day 8 (FIG. 10F). When bone marrow was analyzed on day 8, significantly fewer CD45+GFP+CD123 + LSCs were detected in BFC-treated GN mice than in GN mice treated with a CD3/KLH BFC, in which one arm of BFC binds to CD 123 but the other arm binds to keyhole limpet hemocyanin (KLH, FIG. 10G). The number of GFP CD45 +CD123 + cells in CD123/CD3 BFC treated mice was similar to those observed in CD123/KLH treated mice (FIG. 10G). Thus, CD123/CD3 BFC is able to eliminate CD123 + leukemic stem cells in a T cell-dependent manner in GN mice. [00108] To further elucidate the mechanism of action of the BFC, we performed in vitro killing assays. Naive T cells were purified from the peripheral blood and spleens of GN mice and incubated with autologous bone marrow cells at an effector to target ratio of 5 :1 in the presence or absence of CD123/CD3 BFC. There was no significant change in viability of GFP +CD123 + LSC when bone marrow cells were incubated with T cells in the absence of BFC (FIG. 10H). However, there was a significant reduction of human CD45 +GFP +CD123 + cells when bone marrow cells were incubated with T cells from both peripheral blood and spleen in the presence of BFC. Consistently, T cells incubated with bone marrow cells in the presence of BFC showed a significant increase in CD 107a, an indication of degranulation (FIG. 101), which was further enhanced by increasing incubation time from 4 hours to 48 hours. This data further validates the functionality of T cells in GN mice and highlights the utility of this model as a preclinical tool for testing immunotherapeutics for AML. [00109] ρ -regulation ofMyc in NPMlc driven leukemogenesis [00110] To understand the molecular mechanisms underlying NPMlc-mediated tumorigenesis, we performed transcriptome analysis on bulk human leukemic cells and LSCs. GFP +CD33 + bulk leukemic cells and GFP +CD123 +CD33 + LSCs were purified by cell sorting from the bone marrow of three GN mice generated with three different human CD34 + donor cells (FIG. 1II). RNA was isolated from the sorted cell populations (>85% purity), converted into cDNA and sequenced. Each sample yielded 36 to 65 million reads with less than 1.4% reads from rRNAs (FIG. 11J), indicating high quality of RNAseq. Unsupervised hierarchical clustering of sequence data showed that three LSC populations were similar to each other and clustered together whereas three leukemic cell populations were similar to each other and clustered together (FIG. 11A). To identify differentially expressed genes between bulk leukemic cells and LSCs, log fold changes were plotted against p values (FIG. 1IB). Transcripts for 486 genes were up-regulated two-fold or more in LSCs (p-value <0.05) and transcripts for 465 genes were up-regulated two-fold or more in bulk leukemic cells (p-value <0.05). Genes up-regulated in bulk leukemic cells were enriched in those involved in cell cycle and DNA replication, in line with previous reports (FIG. 11A and Table 2) (Gal et al., 2006). [00111] To assess the similarity between the transcriptomes of patient AML samples and de novo AML generated in GN mice, we compared the expression profiles of NPMlc + AML cells from two independent datasets (Verhaak et al., 2005, Alcalay et al., 2005) with bulk leukemic cells from GN mice. We assessed the similarity between genes up-regulated in each of the published datasets with each other and with bulk leukemic cells. 16% of genes up- regulated in the Verhaak dataset were up-regulated in the Alcalay dataset, and 19.5% were up-regulated in bulk leukemic cells from GN mice. When compared to the Alcalay dataset, the Verhaak dataset showed a 26% similarity and GN bulk leukemic cells had a 21% similarity (FIG. 11C). Eight genes were up-regulated in all three datasets including HOXA9, which is part of the HOX gene signature characteristic of NPMlc + AML samples. qRT-PCR analysis confirmed the statistically significant up-regulation of additional genes that make up the HOX gene signature, including HOXA5, HOXA6 and HOXA9, in GFP+CD33 + bone marrow cells from GN mice as compared to G mice (FIG. 1ID). Thus, the similarities in transcription profile further suggest that the de novo generated AML in GN mice are similar to NPMlc + AML from patients. [00112] The transcript for the Myc oncogene was much highly expressed in bulk leukemic cells than in LSCs (FIG. 11A and Table 3). Myc has been implicated in NPMlc + AML (Bonetti et al., 2008) but its role is not well understood. To investigate whether up-regulation of Myc plays any role in NPMlc driven leukemogenesis, we confirmed a higher level of Myc transcript in purified bulk leukemic cells than in LSCs in GN mice (FIG. 1IE). Compared between GN and G mice, both GFP+CD33 + cells and GFP+CD123 +CD33 + cells from GN mice expressed a higher level of Myc than the corresponding cell populations from G mice (FIG. 1IK). We then tested the sensitivity of these cell populations to Myc inhibition using the indirect Myc inhibitor JQl (Delmore et al., 201 1). Following incubation with 1 µΜ of JQl for 48 hours, less than 20% of GFP+CD123 +CD33 + cell from GN mice remained whereas -80% of cells were alive from G mice (FIG. 11F). Similarly, -40% of GFP+CD33 + cells from GN mice were alive whereas -95% were alive from G mice. To test the effect of combination of JQl and CD123/CD3 BFC, bone marrow cells from moribund GN mice were cultured with or without JQl for 24 hours and washed to remove the inhibitor. The cells were then incubated with autologous T cells from the same GN mice in the presence or absence of CD123/CD3 BFC. Compared to no treatment, the viability of GFP+CD123 + LSCs was decreased by 70% following BFC treatment alone (FIG. 11G). When bone marrow cells were pre-treated with 1, but not 0.1, µΜ JQl, the viability of GFP+CD123 + LSCs decreased by 80.8% , compared to a 70% decrease when treated with BFC alone. No change in CD 107a degranulation of T cells was observed when target cells were pre-treated with JQl or not (FIG. 11H). These data suggest that up-regulation of Myc plays a role in the survival of leukemic and leukemic stem cells from GN mice.

Table 2 : Downregulated > 2 fold in bulk leukemic cells compared to LSCs. Gene logFC PValue FDR

EPHA2 - 11.087496 4.55E-05 0.0813185

LILRA4 -10.960522 3.93E-05 0.0813185

LOC101927921 -10.877659 3.98E-05 0.0813185

WNT10A -10.727925 4.62E-05 0.0813185

NLRP7 -10.093798 5.98E-05 0.0813185

KRT5 -9.7982319 8.00E-05 0.0813185

GZMB -9.5181047 6.86E-05 0.0813185

GRB14 -9.3587782 0.0001069 0.0813185

CCDC183 -9.0377132 0.00016808 0.0813185

LC L 1 -8.8604567 0.00014917 0.0813185

CLIC3 -8.8570298 0.00029984 0.0813185

TTC39A -8.8209444 9.76E-05 0.0813185

SCT -8.7929786 0.00017573 0.0813185

SLITRK5 -8.7576055 0.00037637 0.086701 12

PACSIN1 -8.4654579 7.25E-05 0.0813185

SLC9C2 -8.4290313 0.00023861 0.0813185

SLC4A10 -8.4060268 0.00022757 0.0813185

LOC101928651 -8.1896514 0.00030865 0.0813185 Gene logFC PValue FDR

PTGDS -8.1267189 8.06E-05 0.0813185

EPHB1 -8.1243707 6.78E-05 0.0813185

LRRC36 -7.8529074 0.0004213 0.086701 12

PDZRN3 -7.7803861 0.00039428 0.086701 12

PLXNA4 -7.7386927 8.22E-05 0.0813185

MMP23A -7.6584032 0.00038341 0.086701 12

SCAMP5 -7.5626458 0.00019334 0.0813185

GUCY2D -7.5167354 0.00024864 0.0813185

CDHR5 -7.4872319 0.00041 149 0.086701 12

SLC35F3 -7.3428005 7.43E-05 0.0813185

SHD -7.2654131 0.00083018 0.10028572

SCARA5 -7.054283 0.00044095 0.086701 12

MOGAT 1 -6.9746345 0.00034027 0.086701 12

RGS7 -6.9197871 8.16E-05 0.0813185

PTCRA -6.7923026 0.00086801 0.1016242

PLA2G16 -6.7552996 0.00287524 0.151 1574

CUX2 -6.5146745 0.00017632 0.0813185

LAMP -6.5073508 0.0001587 0.0813185

DUSP5 -6.5049492 0.0001558 0.0813185 Gene logFC PValue FDR

SNAP25 -6.4531968 0.00069219 0.09158001

NRP 1 -6.2328205 0.00029551 0.0813185

GPR55 -6.1306821 0.00087052 0.1016242

IGJ -6.1087075 0.00012694 0.0813185

PTPRS -6.0352191 0.00023631 0.0813185

CIB2 -6.0166834 0.00074312 0.09558672

C4BPB -5.9598998 0.00022781 0.0813185

ZFAT-AS1 -5.9505694 0.00044312 0.086701 12

EPS8L2 -5.944219 0.00257534 0.14627279

RGPD8 -5.9209761 0.03008978 0.34142258

PPM1J -5.9009996 0.0004297 0.086701 12

C5orf45 -5.8525545 0.00456847 0.18049064

LINC00158 -5.8298225 0.00053896 0.08966265

CYP46A1 -5.801 1675 0.00130669 0.1 1262409

FAM160A1 -5.7729601 0.00038813 0.086701 12

SLC12A3 -5.7513932 0.00012801 0.0813185

IL3RA -5.6065869 0.00017137 0.0813185

KCNK10 -5.5744144 0.0001 1607 0.0813185

LOC101927438 -5.5497712 0.00028499 0.0813185 Gene logFC PValue FDR

KLKB1 -5.5381953 0.00182946 0.1321 1526

TNN -5.5241228 0.00180726 0.13144717

SERPINF1 -5.48431 14 0.00010151 0.0813185

CLDN23 -5.4428529 0.0025368 0.14627279

PCDHGC3 -5.3955055 0.0006502 0.09128034

STARD13 -5.2782015 0.0010984 0.10750529

CXCR3 -5.2666222 0.00049145 0.08752905

ENAM -5.2452153 0.00140206 0.1 1457341

CMKLR1 -5.1922797 0.00029395 0.0813185

SEL1L3 -5.173129 0.00015099 0.0813185

LTK -5.1315213 0.00245257 0.14627279

CLEC4C -5.0578741 0.00014551 0.0813185

CRYM -5.0545921 0.001 15356 0.10755742

KIRREL3 -5.0294631 0.00816385 0.21768725

SIT1 -5.0075757 0.00478525 0.18313131

CCR3 -4.9945319 0.00068733 0.09158001

FAM196A -4.9888684 0.001 12409 0.10755742

GJA9 -4.9830528 0.0173661 0.27761783

RHOF -4.9527164 0.00269473 0.14680452 Gene logFC PValue FDR

SNAI1 -4.914201 0.00276315 0.14820745

PHEX -4.9077323 0.00017897 0.0813185

IRF7 -4.8232717 0.00027923 0.0813185

PCSK4 -4.8155157 0.0033914 0.15863067

CCDC50 -4.782287 0.00025141 0.0813185

SAMD12 -4.7237677 0.00028166 0.0813185

SMPD3 -4.7020324 0.00031024 0.0813185

MAPI A -4.6780053 0.0002555 0.0813185

NT5C1B-RDH14 -4.6586229 0.005571 11 0.1944571

PROC -4.6419632 0.00224731 0.14258704

DAB2 -4.6240799 0.00016782 0.0813185

ST14 -4.6013378 0.00042636 0.086701 12

FAM221B -4.5951 0.0017089 0.12832453

COBLL1 -4.588665 0.0002251 1 0.0813185

IRF8 -4.5401279 0.00027954 0.0813185

T RSF21 -4.5388316 0.00022813 0.0813185

OPN3 -4.5349644 0.0006505 0.09128034

DPP4 -4.5031992 0.00034588 0.086701 12

GABRR2 -4.4882182 0.00551704 0.19354233 Gene logFC PValue FDR

IGFLR1 -4.4794851 0.00077859 0.09744279

LO RF2 -4.4775802 0.02218537 0.29835349

TRIP 10 -4.4567484 0.0044123 0.17847528

DERL3 -4.4186898 0.0005586 0.09098788

GARNL3 -4.3322497 0.00135825 0.1 1378033

EGLN3 -4.3154586 0.00043994 0.086701 12

SI 1 -4.284758 0.0015023 0.1 1724654

AR -4.2472102 0.00047466 0.08752905

Z 775 -4.2336566 0.00199869 0.1330445

LAMA2 -4.2279946 0.0043577 0.1782453

TLR7 -4.2125702 0.00037399 0.086701 12

AMIG02 -4.2122263 0.00082288 0.10027569

ABCA6 -4.1816509 0.00091098 0.10285226

NOTCH4 -4.1805587 0.00146425 0.1 1690458

LOC101927153 -4.1414981 0.00640979 0.19876073

SETBP1 -4.1233356 0.00037368 0.086701 12

CCDC102B -4.1206718 0.0013596 0.1 1378033

TGFBI -4.1 183101 0.00026912 0.0813185

KCNA5 -4.0993643 0.00060769 0.09128034 Gene logFC PValue FDR

TLR9 -4.0902256 0.00067508 0.09158001

PHEX-AS1 -4.0868446 0.00382974 0.16526242

MGARP -4.0813401 0.00562192 0.19508518

GP MB -4.0808325 0.01704141 0.27680342

TRAF4 -4.0651475 0.00063934 0.09128034

LTB -4.0555864 0.00258654 0.14627279

DNASE1L3 -4.0477199 0.00060808 0.09128034

E PP2 -4.0067214 0.00045613 0.08752905

RUNX2 -4.005676 0.00058385 0.09102367

SERPINF2 -4.0018215 0.00783421 0.21423786

LINC00865 -3.9730876 0.00040726 0.086701 12

KLHL13 -3.9661 181 0.00391308 0.16689937

LEPREL1 -3.9628066 0.00035485 0.086701 12

THBD -3.9500944 0.00088381 0.10231613

C5orf64 -3.9453756 0.00067903 0.09158001

KCNK17 -3.9375548 0.00051341 0.08868539

C6orfl0 -3.9278598 0.00694085 0.20659038

FAM177B -3.9120651 0.00266525 0.14627279

LY9 -3.8896882 0.00106047 0.10675364 Gene logFC PValue FDR

AREG -3.88792 0.01 185374 0.24837425

AJAPI -3.8808534 0.00256693 0.14627279

TSPAN 13 -3.8636313 0.00091806 0.10285226

VEGFB -3.8543243 0.00050101 0.088101 14

RPS6KA4 -3.8166673 0.00202822 0.1341718

MOXD1 -3.81 19394 0.02960608 0.33934626

LOC100130476 -3.8028661 0.00563126 0.19508518

TNFRSF17 -3.7998484 0.00457333 0.18049064

NLRP4 -3.7925922 0.02352392 0.30513003

ABHD6 -3.7679097 0.0009095 0.10285226

MYOM1 -3.733082 0.00163856 0.12646041

LOCI 02467223 -3.7181526 0.00505243 0.1874528

CA8 -3.7020226 0.00076574 0.0967061 1

CUEDC1 -3.6853016 0.00350254 0.161 11696

GMPPB -3.6829506 0.00638466 0.19876073

PNOC -3.6777244 0.01404144 0.26244878

ZNF556 -3.6640356 0.00835149 0.21854864

CYB561A3 -3.6435018 0.00047174 0.08752905

LOC100996634 -3.6414973 0.01032817 0.23621 184 Gene logFC PValue FDR

C12orf75 -3.6356499 0.001 16781 0.10755742

TDRD1 -3.6276874 0.00066444 0.09158001

IL18R1 -3.6254816 0.00095862 0.1061 171 1

CARD1 1 -3.6185064 0.00052385 0.08874777

HOXB2 -3.5643981 0.00355464 0.16137581

PLVAP -3.5607144 0.01 195576 0.24900968

CYTH4 -3.5515394 0.00084791 0.10067713

SCN9A -3.5353451 0.00041831 0.086701 12

LOC339622 -3.5353299 0.00816618 0.21768725

SLC15A4 -3.5084458 0.00054216 0.08966265

FAM129C -3.5058534 0.00139253 0.1 1457341

SH3D19 -3.5050012 0.00081446 0.10027569

ZFAT -3.504244 0.0004881 0.08752905

SH3BGR -3.4972941 0.0098005 0.23433476

HERPUD1 -3.4754257 0.00056327 0.09098788

MED1 1 -3.45101 17 0.006491 18 0.19950312

AHNAK2 -3.4498009 0.00101547 0.10675364

TTYH2 -3.409171 1 0.00105879 0.10675364

CDKN1A -3.3900385 0.00105264 0.10675364 Gene logFC PValue FDR

GPR183 -3.3744448 0.00120486 0.10755742

SLC2A8 -3.3710645 0.00504659 0.1874528

FLJ30403 -3.351 1938 0.00255856 0.14627279

POU4F1 -3.3504322 0.01870971 0.28470532

LINC00996 -3.3444489 0.00135176 0.1 1378033

SLC4A3 -3.3414818 0.00883751 0.22403404

STARD13-AS -3.3265318 0.00766803 0.21304841

ABHD15 -3.3226036 0.00103889 0.10675364

PCED1B -3.3121233 0.00547538 0.19256714

RBMS3 -3.3059813 0.00183546 0.1321 1526

PARP10 -3.2829513 0.01283664 0.25475237

IFNLR1 -3.282483 0.0010172 0.10675364

PMEPA1 -3.2789072 0.00279982 0.14854944

SIGLEC6 -3.2777892 0.001 18217 0.10755742

LGMN -3.2694847 0.00068925 0.09158001

P2RY14 -3.2425384 0.00064291 0.09128034

MIR1244-2 -3.2415952 0.04167885 0.3798664

MIR1244-1 -3.2405662 0.04159232 0.3798664

MIR1244-3 -3.240437 0.04158147 0.3798664 Gene logFC PValue FDR

CCR2 -3.2385444 0.00063453 0.09128034

ATHL1 -3.2365529 0.00295014 0.15183121

GPRC5C -3.2193022 0.01491564 0.26667703

MMP1 1 -3.2129543 0.00634193 0.19876073

FAS-AS1 -3.1909279 0.00600364 0.19669809

ADAM 19 -3.1823792 0.00099334 0.10675364

PC1 -3.1654273 0.00058648 0.09102367

ERN1 -3.155885 0.0009096 0.10285226

KCTD19 -3.1535052 0.01039331 0.23621 184

NAP SB -3.1410675 0.00416863 0.17442952

FAAH2 -3.1374032 0.01978067 0.28655587

RNF122 -3.1297263 0.00581999 0.19624106

SH3RF3 -3.1265432 0.00873207 0.22242312

APOC4 -3.1 157422 0.02096909 0.29339275

SLC41A2 -3.1 135333 0.000721 16 0.09362903

GPR37L1 -3.1033876 0.02170892 0.29629456

TPM2 -3.0971915 0.00096994 0.1061 171 1

VIMP -3.0875182 0.0010802 0.1071864

MCOLN2 -3.085181 0.0006124 0.09128034 Gene logFC PValue FDR

TNFRSFl l A -3.0815351 0.00470967 0.18203281

BEND6 -3.0809413 0.00323175 0.15534781

RHOC -3.0760878 0.01687631 0.27680342

IFI44L -3.0733684 0.00261755 0.14627279

EPB41L1 -3.0722875 0.00771548 0.21308841

RGS1 -3.0722467 0.00528902 0.19136545

SLC20A1 -3.0566968 0.0005897 0.09102367

KCNH8 -3.0436461 0.00631 127 0.19876073

IDH3A -3.0376359 0.00062913 0.09128034

HS3ST3B1 -3.0288484 0.0025771 1 0.14627279

GAS6 -3.01 12852 0.00584206 0.19650831

FMNL3 -3.0030236 0.00101514 0.10675364

TCF4 -3.0026424 0.0019657 0.1330445

SH3TC1 -2.9962015 0.01 147189 0.2437476

NIPA1 -2.9866793 0.00107806 0.1071864

SIDT1 -2.9830124 0.00197728 0.1330445

PPP1R16B -2.9795707 0.00148194 0.1 1717654

TBC1D4 -2.9783413 0.00075905 0.0967061 1

ADAMTS4 -2.9702099 0.00321616 0.15513528 Gene logFC PValue FDR

PPP1R14B -2.9622944 0.00433902 0.1782453

CXCR2P1 -2.9585961 0.0070192 0.20659038

DTX2P1-UPK3BP1- -2.9584373 0.01366497 0.26040288 PMS2P1 1

KCTD5 -2.9573981 0.00191863 0.1330445

PTP4A3 -2.9479433 0.02413757 0.30848475

DBNDD2 -2.9414597 0.00613219 0.19838846

SLA2 -2.938564 0.00122522 0.10755742

LINC00494 -2.9327663 0.01513297 0.26750406

CCR5 -2.9308991 0.00198974 0.1330445

ITM2C -2.9284125 0.00121 119 0.10755742

IFI44 -2.9196868 0.002541 18 0.14627279

DTX4 -2.91414 0.00099866 0.10675364

COL8A2 -2.8927629 0.01249172 0.25448052

TP63 -2.8858976 0.00317554 0.15422564

TGFBR3 -2.8843879 0.00709333 0.20789134

UGCG -2.8748264 0.0012124 0.10755742

OAS1 -2.8739541 0.00865103 0.22173448

PLEKHG4 -2.8697635 0.00822247 0.21815692 Gene logFC PValue FDR

UNC5CL -2.8659408 0.00780789 0.21423786

SLAMF7 -2.8558174 0.001 16482 0.10755742

SPHK1 -2.8551889 0.01534928 0.26849402

LOC101928567 -2.8540072 0.00812898 0.21768725

PLD4 -2.8506099 0.01270783 0.25448052

CPT1B -2.8487572 0.00870979 0.22241982

PLAC8 -2.8406512 0.00103046 0.10675364

TTC24 -2.8343463 0.02035638 0.28974468

TXNDC5 -2.8220329 0.01643275 0.27631529

COR01B -2.817818 0.01842673 0.28316663

FBX06 -2.8055302 0.00838514 0.21854864

9-Mar -2.7961992 0.005751 0.19613747

C8orf58 -2.7918168 0.01516689 0.26750406

GPX1 -2.7745373 0.00253977 0.14627279

CLCN5 -2.7615835 0.00122348 0.10755742

ADCK2 -2.7603274 0.01777154 0.28022954

ADAM33 -2.7568863 0.007221 13 0.20800617

DDIT4 -2.7559024 0.01 149735 0.2437476

FMN1 -2.751 1901 0.001 11741 0.10755742 Gene logFC PValue FDR

PFKFB2 -2.7215881 0.00123104 0.10755742

SULF2 -2.7188004 0.00137566 0.1 1443514

POLB -2.7187244 0.00193842 0.1330445

CYP2U1 -2.7083152 0.00676425 0.20428028

SEC61B -2.702184 0.00197042 0.1330445

ADAMTSL4-AS 1 -2.70021 15 0.00165779 0.12708706

CPED1 -2.6861821 0.0033744 0.15836863

CCS -2.6809159 0.0075908 0.21 196489

PAPLN -2.6625668 0.00168327 0.12708706

SLC30A8 -2.6563264 0.01889331 0.28470532

LINC01 176 -2.6491219 0.00225807 0.14258704

MGC12916 -2.6464947 0.00212948 0.13824828

MZB1 -2.6398865 0.00930759 0.22906318

TCEA3 -2.6353912 0.0294379 0.3385358

RUFY4 -2.6298886 0.02067441 0.29158271

RNASE6 -2.6252512 0.00167977 0.12708706

MVP -2.6147122 0.0102923 0.23621 184

MYOIE -2.6071345 0.00250508 0.14627279

PLAU -2.6048163 0.01244582 0.25448052 Gene logFC PValue FDR

AXL -2.6035731 0.00433876 0.1782453

MPEG1 -2.5934281 0.0045284 0.18025385

SYCP2L -2.5876481 0.00318433 0.15422564

DF B59 -2.5866945 0.0101 1929 0.23539937

FAM43A -2.5838151 0.00298373 0.15183121

RAP1GAP2 -2.5667877 0.00488597 0.18647222

PC2 -2.564817 0.00149272 0.1 1717654

N4BP2L1 -2.5607284 0.00312401 0.15389624

PTPRO -2.5551443 0.00293253 0.15183121

ELL -2.5480179 0.00602671 0.19669809

DNLZ -2.541 1055 0.04801089 0.39715464

ZNRF3-AS1 -2.5358098 0.00829434 0.21854864

SRC -2.5345241 0.00605483 0.19673021

PEA 15 -2.530321 1 0.00265382 0.14627279

RELB -2.5278942 0.02576064 0.31892794

MCC -2.525167 0.00272625 0.14739052

C12orf45 -2.5237454 0.00264814 0.14627279

SERTAD3 -2.5234178 0.0146678 0.26545573

CRLF2 -2.522746 0.02685362 0.32652003 Gene logFC PValue FDR

COL24A1 -2.5149779 0.00262468 0.14627279

IRF2BPL -2.5097255 0.01899057 0.28470532

HS3ST1 -2.5048378 0.01844701 0.28316663

DNAJB9 -2.5042992 0.0043753 0.1782453

CDH23 -2.491 1855 0.00519387 0.1908817

CMTM3 -2.490771 1 0.00853391 0.22076917

ZDHHC4 -2.4863903 0.0083348 0.21854864

CISH -2.4813248 0.01 194106 0.24900968

GNG1 1 -2.481 1833 0.01516338 0.26750406

GP2 -2.4796254 0.01253104 0.25448052

HPR -2.4792703 0.0320224 0.34803416

ME8 -2.4783827 0.00325412 0.15588343

C5or£20 -2.46957 0.00225275 0.14258704

1-Sep -2.4676355 0.03848299 0.36971351

AMACR -2.4628204 0.0494414 0.40071531

SOCS3 -2.4534068 0.02974661 0.33955621

ANKRD20A5P -2.4528337 0.00985874 0.23489937

TXN -2.448725 0.00267444 0.14627279

TMEM132B -2.4456121 0.01463355 0.26544772 Gene logFC PValue FDR

FGD2 -2.44231 1 0.00236528 0.14539136

ATP13A2 -2.4374259 0.01291048 0.25585223

MAPKAPK2 -2.4332752 0.00314333 0.15405623

TRAF1 -2.4232231 0.0072181 0.20800617

CRIPl -2.4224675 0.0381 1879 0.3677404

ME3 -2.4169846 0.03408501 0.3538931

UNC1 19 -2.4156605 0.01935798 0.28515498

CTNS -2.4124675 0.01424282 0.26264727

TSEN54 -2.41 18275 0.01416906 0.26244878

CBLN3 -2.41 10235 0.02875892 0.33522937

B2M -2.4065255 0.0044031 0.17847528

DNAJC22 -2.4058249 0.00761377 0.21 196489

STOX1 -2.3893407 0.01679053 0.27680342

SECTM1 -2.3883298 0.03566451 0.35969997

FCER1G -2.3862991 0.00189706 0.1330445

C10orfl l 8 -2.3844873 0.00376713 0.16508818

Z 385C -2.383107 0.04417632 0.38620725

SEC1 1C -2.381359 0.00346238 0.16028378

GP5 -2.380397 0.04419757 0.38620725 Gene logFC PValue FDR

GPR1 14 -2.3799641 0.00619598 0.19838846

TIFAB -2.3757575 0.00970584 0.23379352

RWDD2A -2.3708701 0.01916688 0.28470532

LDHAL6B -2.3668497 0.0481 1273 0.39715464

MSL3P1 -2.3664871 0.02519461 0.31617306

CNTNAP1 -2.3633001 0.01553887 0.2696842

VASH1 -2.3597581 0.00744223 0.2097108

TMCC3 -2.3509124 0.0360867 0.36023908

LHFPL2 -2.3476017 0.002169 0.1394987

GLI2 -2.3446032 0.03092975 0.34570324

PAFAH2 -2.3416384 0.002334 0.14474983

TMEM45A -2.3405975 0.02124729 0.29405301

TMEM255A -2.3383436 0.031 19079 0.34676896

PANDAR -2.3376813 0.04914283 0.40040594

ZCCHC24 -2.330302 0.01654713 0.27631529

LOC101926924 -2.3301312 0.0179807 0.281 1463

STAMBPL1 -2.3270854 0.00376476 0.16508818

TUBG2 -2.318925 0.01871 132 0.28470532

EXT1 -2.3174793 0.00603177 0.19669809 Gene logFC PValue FDR

MIR155HG -2.3171479 0.01794775 0.28109368

RASD1 -2.3150976 0.01095949 0.2427377

CD4 -2.31 19068 0.00245479 0.14627279

PTPRM -2.3086707 0.0191418 0.28470532

CYYR1 -2.3031444 0.00314944 0.15405623

PALDl -2.3017745 0.02665447 0.32528085

ST6GALNAC4 -2.2989092 0.03801993 0.36742991

TBC1D9 -2.2975666 0.0069957 0.20659038

HHAT -2.2954265 0.00687158 0.20573269

B4GALT1 -2.2925222 0.00239368 0.14627279

COR01C -2.2885569 0.00213037 0.13824828

TMEM129 -2.285768 0.00618609 0.19838846

SPIB -2.2815717 0.00280161 0.14854944

PRR5L -2.2787894 0.01535956 0.26849402

GPM6B -2.2773035 0.0059485 0.19668866

CECR5 -2.273994 0.01813391 0.28210107

SEMA3C -2.2723261 0.01068377 0.24016002

SMPD1 -2.267443 0.03200819 0.34803416

LOCI 00287792 -2.2639761 0.00749742 0.21083827 Gene logFC PValue FDR

FLNB -2.2550912 0.00306817 0.15297019

ULK1 -2.2550053 0.0059835 0.19669809

BCL1 1A -2.2497667 0.00250292 0.14627279

RNF165 -2.2487405 0.03248671 0.34944007

SLC2A6 -2.2486847 0.01280777 0.25454301

ALOX5AP -2.245405 0.00370546 0.16480362

HDHD3 -2.241928 0.02045547 0.2900334

LOC101928537 -2.2377688 0.0320154 0.34803416

CEMP1 -2.2306014 0.02617417 0.3217801 1

TMED1 -2.2293077 0.04948091 0.40071531

ADPRH -2.2256077 0.00382823 0.16526242

BTG2 -2.2242739 0.00307556 0.15297019

TRIM8 -2.2223101 0.00496804 0.1874528

ARHGAP27 -2.2220894 0.002762 0.14820745

CSF2RB -2.2216672 0.00382999 0.16526242

CCR7 -2.2153626 0.03249687 0.34944007

OGT -2.21 16124 0.00295352 0.15183121

SLC7A5 -2.210285 0.00768839 0.21308841

GNN -2.2008246 0.02635015 0.32290073 Gene logFC PValue FDR

LINC-PINT -2.1993867 0.00370802 0.16480362

AKAP6 -2.1991836 0.01420274 0.26264727

MIR4709 -2.1969999 0.04172733 0.3798664

MYCL -2.1907442 0.00500562 0.1874528

TMEM161A -2.1845565 0.04472659 0.38793817

ACAD 11 -2.184126 0.00371318 0.16480362

SLC7A1 1 -2.1807153 0.00474331 0.18203281

TRADD -2.1763016 0.0161312 0.27328608

SEMA7A -2.1752449 0.01756721 0.27986653

C7orfil -2.164623 0.00698977 0.20659038

PIK3R5 -2.162519 0.00673627 0.20389508

GRIP1 -2.15831 16 0.0260307 0.321 15318

MKRN20S -2.1501762 0.01397765 0.26169472

ARHGAP42 -2.1470304 0.03763924 0.36514268

ADCK1 -2.1458774 0.03089136 0.34570324

LYSMD2 -2.1446399 0.01014692 0.23539937

DRG1 -2.1413521 0.01471357 0.26545573

AVEN -2.1391742 0.02779534 0.33144457

ARL4C -2.1302832 0.00474344 0.18203281 Gene logFC PValue FDR

MTCL1 -2.1271372 0.0471 1835 0.39503205

ABTB2 -2.1267905 0.0334957 0.35198361

BLN -2.1241889 0.00815856 0.21768725

T SF9 -2.1230127 0.02326595 0.30348405

TMEM187 -2.1 18149 0.04866696 0.39852285

LOCI 009963 5 1 -2.1 178365 0.01263317 0.25448052

NEIL2 -2.1 103572 0.03473654 0.35574658

ACN9 -2.1071365 0.00646278 0.19907093

CHRNB 1 -2.1034983 0.00733603 0.2097108

RECQL5 -2.097797 0.02524147 0.31618986

RABL2A -2.0960999 0.02394241 0.30740103

HLA-DMB -2.0951495 0.00827866 0.21854864

MIF4GD -2.0939393 0.02180323 0.29632583

EK8 -2.0930509 0.02270659 0.30163787

DMAPI -2.091 1607 0.0480931 1 0.39715464

ARHGAP18 -2.0832557 0.00560361 0.19508518

MAGIX -2.0826735 0.04881408 0.39888442

RASA4 -2.0794033 0.00512696 0.18942496

ZNRF2 -2.0760284 0.00467177 0.18186012 Gene logFC PValue FDR

FCHSD2 -2.0754982 0.00327665 0.15642355

RHBDF2 -2.072362 0.01892051 0.28470532

FHL l -2.0718377 0.00977556 0.23414162

MDFIC -2.0645304 0.00384248 0.16526242

MOGS -2.0633236 0.01276617 0.25448052

FAM213A -2.0628251 0.00545359 0.19256714

TP53I13 -2.059923 0.03139415 0.34803416

SLC2A4RG -2.0556819 0.01 14191 1 0.2437476

MS4A6A -2.0552455 0.00333646 0.15819124

FAM160B2 -2.0514185 0.04761577 0.39704576

CAPN15 -2.050639 0.01899465 0.28470532

PDIA4 -2.0472882 0.00546929 0.19256714

C18orf61 -2.0456674 0.00588562 0.19668866

KIAA0226L -2.0438306 0.01 122245 0.24346828

GPR52 -2.0393245 0.01716391 0.27725706

SYNGR2 -2.0386632 0.02247096 0.30073852

FAM1 18A -2.0329487 0.00462266 0.1808956

CTSB -2.028683 0.00359544 0.16216837

L2 -2.02841 13 0.02559574 0.31804657 Gene logFC PValue FDR

LRP1B -2.0275834 0.02218375 0.29835349

LIMD1 -2.0212048 0.00591065 0.19668866

DHRS7 -2.0188465 0.01033756 0.23621 184

FARP2 -2.0160127 0.01697305 0.27680342

LILRB4 -2.0140204 0.00539377 0.19256714

PLEK -2.0130432 0.00376541 0.16508818

SERPING1 -2.0128671 0.00850861 0.22072315

FM06P -2.0042295 0.03066573 0.34518925

IL1 1RA -2.000597 0.03265948 0.34944007

TOR3A -1.9981741 0.00738544 0.2097108

GGA2 -1.9974699 0.00556245 0.1944571

CACFD1 -1.9968408 0.03198409 0.34803416

TMEM8B -1.9959255 0.02260168 0.30161622

PRICKLEl -1.9923673 0.02834976 0.33338408

KCNJ5 -1.9914007 0.024641 17 0.31204014

DLG5 -1.9908326 0.04779757 0.39715464

E2F5 -1.9901312 0.03528938 0.35810002

CBX7 -1.9878303 0.04483488 0.38793817

TSPYL2 -1.9852564 0.0127385 0.25448052 Gene logFC PValue FDR

RNASET2 -1.9840971 0.00722982 0.20800617

PPCDC -1.980621 1 0.0412901 1 0.37961759

TMEM185A -1.9797636 0.02522664 0.31618986

Z 512B -1.9768632 0.04726868 0.39605341

SFT2D2 -1.972919 0.01483445 0.26632808

LOC100996455 -1.9721894 0.01553149 0.2696842

Clorfl86 -1.9713425 0.0101036 0.23539937

BIN 1 -1.9696279 0.04872004 0.39859765

GRAMD3 -1.9691789 0.02151226 0.29530473

INGX -1.966353 0.03176161 0.34803416

CD300A -1.965335 0.00913184 0.22857572

TBC1D9B -1.961381 1 0.00626772 0.19876073

ABCA2 -1.960726 0.01999106 0.28749048

Table 3 : Upregualted >2 fold in bulk leukemic cells compared to LSCs.

Gene logFC PValue FDR

DDX60L 2.00183995 0.00545767 0.19256714

PYGOl 2.00669156 0.01689394 0.27680342

BAG2 2.00732258 0.02346196 0.304904 Gene logFC PValue FDR

ARHGEF12 2.00778274 0.01397092 0.26169472

TMEM71 2.008723 0.00843731 0.21949642

PNKP 2.0088551 1 0.04953747 0.40077914

WDHD1 2.01764963 0.00391658 0.16689937

TRAPPC5 2.01995789 0.04595456 0.39069817

ENG 2.0205278 0.03379819 0.35249585

WDFY3 2.0217651 0.00629999 0.19876073

GDAP1 2.02707536 0.0488841 1 0.39900004

FZD5 2.02745397 0.01503989 0.26750406

BST1 2.0293191 0.01365442 0.26040288

DIAPH3 2.0304315 0.00713987 0.20800617

LCMT1 2.03080466 0.03942305 0.3737544

ACTN1 2.03392887 0.02342428 0.304904

SYNGAP1 2.03426082 0.01336795 0.25828594

WT1 2.03818662 0.0348269 0.35574658

EDA2R 2.03918231 0.0454868 0.39027143

RALGAPA IP 2.04138216 0.0471 1128 0.39503205

HBD 2.04161354 0.03531508 0.35810002

CCDC183-AS1 2.04209506 0.03205167 0.34803416 Gene logFC PValue FDR

HIST1H2AE 2.04913588 0.02763149 0.33085298

FAM72A 2.05024566 0.01983556 0.28655587

RASAL2 2.05074184 0.04423502 0.38624321

ZFP1 2.05125685 0.01524175 0.2680232

CSF3R 2.05214554 0.01984434 0.28655587

RMI2 2.05319133 0.00532439 0.19212044

1-Mar 2.05408602 0.02420273 0.30902973

ZBTB37 2.05859846 0.04399667 0.38610345

RNF26 2.06145622 0.02575716 0.31892794

TACC3 2.06338704 0.00442629 0.17847528

PRKAR2B 2.064991 17 0.00580244 0.19613747

C19orf68 2.06764977 0.02176037 0.29629456

TALI 2.07871614 0.01763438 0.2802078

Z F90 2.08088128 0.00571483 0.19554302

CDC42BPA 2.08567248 0.00628492 0.19876073

CHAF1B 2.08955406 0.01854251 0.28400498

ALOX12P2 2.09200775 0.03479303 0.35574658

MTX1 2.09440635 0.03268318 0.34944007

CC B2 2.09505382 0.00666919 0.2031763 Gene logFC PValue FDR

RIC8B 2.09813413 0.03155094 0.34803416

FAIM3 2.1083637 0.0337919 0.35249585

DEPDC1 2.10909418 0.00758961 0.21 196489

HIST1H1D 2.10969364 0.01482184 0.26632808

RNF217 2.1 1054515 0.02051586 0.29038737

ST20-MTHFS 2.1 1131281 0.01242736 0.25448052

HBG2 2.1 1314966 0.02823384 0.33338408

MKI67 2.1 161505 0.010771 19 0.24088513

ESC02 2.1 1870781 0.01731359 0.27761783

CDKN3 2.12101359 0.01470461 0.26545573

KIAA1328 2.12256142 0.01 121366 0.24346828

PSD3 2.12319934 0.03904552 0.37294464

WEE1 2.12329468 0.00336297 0.15836863

D M T3B 2.13145223 0.01388616 0.26169472

MS4A1 2.13371629 0.02487081 0.31409574

MAP7 2.13478869 0.01074597 0.24088513

PILRA 2.13523073 0.02275634 0.30163787

PIP5K1B 2.13877144 0.006824 0.20474948

KIF23 2.14251749 0.00318621 0.15422564 Gene logFC PValue FDR

CKAP2L 2.14669893 0.00619504 0.19838846

PLCH1 2.14837429 0.02237518 0.30040619

GIMAP2 2.15085961 0.03983654 0.37474373

TEC 2.15378752 0.0221265 0.29813905

MYBL1 2.15422822 0.02567006 0.31868502

STXBP5L 2.1549485 0.03759362 0.36514268

ARHGEFl l 2.15583384 0.01603775 0.27203471

HIST1H4E 2.157938 0.01568755 0.2696842

DNAJC28 2.15836487 0.04405372 0.3861415

NEFH 2.15846499 0.04555353 0.39027143

GSE1 2.16152753 0.00298054 0.15183121

Z F724P 2.16494451 0.01457824 0.26507982

CLEC9A 2.1710947 0.04180571 0.38008173

KIF20A 2.17323634 0.00540596 0.19256714

BLVRA 2.17544406 0.0193072 0.28472995

ACSM4 2.1757428 0.0240551 1 0.30827822

ΜΓΝΡΡ 1 2.18291 162 0.01416566 0.26244878

HOOK1 2.18817905 0.012467 0.25448052

HBG 1 2.18968121 0.00999766 0.23539937 Gene logFC PValue FDR

EMR1 2.19016898 0.02691404 0.32652003

NHS 2.19198574 0.03989743 0.37474991

PRKCQ 2.19416251 0.0156892 0.2696842

ACP6 2.19623 0.04558866 0.39027143

AKAP12 2.20083759 0.0230334 0.30273193

PRC1 2.21048374 0.00503855 0.1874528

HMMR 2.21733126 0.00258856 0.14627279

RIMKLB 2.21792238 0.00806467 0.21754257

SASS6 2.21947969 0.00643906 0.19878095

ZNF443 2.22220546 0.02907924 0.33636034

PABPN1 2.22251696 0.03575768 0.35969997

CKAP4 2.22544726 0.01818076 0.28219791

SLC39A8 2.2401298 0.00606108 0.19673021

LINC00623 2.2405632 0.01690541 0.27680342

RAG 1 2.24230939 0.0195705 0.28648406

BCL2L1 2.24325216 0.04183969 0.38014194

EXOl 2.24564255 0.00394399 0.16755308

SLC25A37 2.24826082 0.01567645 0.2696842

KIF15 2.26160797 0.00343984 0.1598201 1 Gene logFC PValue FDR

GBP2 2.2639481 1 0.01726933 0.27761783

SY E 1 2.271 17757 0.00528037 0.19136545

IKBKE 2.27418668 0.03206764 0.34803416

TMEM106B 2.27513594 0.0042947 0.17809544

CEMIP 2.2759393 0.03172532 0.34803416

SLC4A1 2.27734459 0.02476961 0.31310223

PIPB9 2.28139548 0.03366873 0.35249585

FAM72D 2.28354416 0.01487285 0.26632808

ARHGAP23 2.28740076 0.03957621 0.3737544

CE PF 2.28795685 0.00579908 0.19613747

GBP5 2.29477591 0.00467349 0.18186012

ME3 2.30503361 0.02186395 0.29632583

SELENBP1 2.30847896 0.03154134 0.34803416

SIL1 2.31347594 0.02103507 0.29339275

ACSM3 2.32135977 0.01 122588 0.24346828

PLD1 2.32495567 0.01425283 0.26264727

UBE2T 2.32518688 0.0104061 1 0.23621 184

GPSM2 2.32623982 0.00579701 0.19613747

SLC2A14 2.33086287 0.02184299 0.29632583 Gene logFC PValue FDR

SLC17A9 2.33275699 0.03567666 0.35969997

FE2 2.33698569 0.02138887 0.29419224

ASB9P1 2.34295915 0.02136469 0.29419224

DHRS1 2.34345598 0.03703978 0.36464585

GRB10 2.34598979 0.0299192 0.34055275

UROS 2.34833905 0.01002444 0.23539937

FOX04 2.35474253 0.04159384 0.3798664

GFOD1 2.35881258 0.0237775 0.30701392

RUSC2 2.36585644 0.02833979 0.33338408

DGKH 2.36636074 0.01617279 0.27365702

CLGN 2.36885358 0.00874963 0.22242312

HBB 2.37049992 0.0030889 0.15297019

GTF2H2C 2 2.37215085 0.0178943 0.28109368

UBE2C 2.37604457 0.0141 1667 0.26244878

OSBP2 2.37812001 0.03329524 0.35171 191

PPP1R9A 2.37998935 0.01447312 0.26455442

AURKB 2.38141 103 0.02017371 0.2887813

OLIG1 2.38653155 0.026151 18 0.3217801 1

SLC26A8 2.38942369 0.01664548 0.27680342 Gene logFC PValue FDR

OXER1 2.39638936 0.03966529 0.374341 16

KCNJ2 2.40020748 0.00492501 0.18694861

FAM45B 2.40406008 0.00371316 0.16480362

FAM198A 2.40543338 0.04818142 0.39715464

KIT 2.40628167 0.00539832 0.19256714

HIST1H1E 2.40787044 0.01572446 0.2696842

GAS2L3 2.40857175 0.00384197 0.16526242

DOCK9 2.40921389 0.03344648 0.35181788

XYLB 2.41422194 0.00935122 0.22906318

EMR3 2.41903657 0.01393454 0.26169472

RASGRP1 2.42632389 0.0083401 1 0.21854864

PTTG1 2.42762689 0.00308287 0.15297019

APLP2 2.43006514 0.00234563 0.14482462

PARM1 2.43213614 0.02965778 0.33937877

RON 2.43668936 0.00982529 0.23452383

ECRP 2.44095503 0.03745365 0.36488068

TPPP 2.45296356 0.03826643 0.36839725

CP E2 2.45558278 0.01299399 0.25654909

TMEM56 2.46196179 0.00589282 0.19668866 Gene logFC PValue FDR

C12orf77 2.46314216 0.01801388 0.281 1784

Z 804A 2.4680625 0.04478966 0.38793817

ERG 2.47004849 0.00543873 0.19256714

DEPDC1B 2.47064995 0.00347289 0.16028378

SLC03A1 2.47545037 0.02184397 0.29632583

KNSTRN 2.47694229 0.02465362 0.31204014

FBXL14 2.49083852 0.04544107 0.39027143

MRPS18C 2.49384742 0.01896017 0.28470532

SPIN4 2.50395621 0.0021396 0.13824828

CD34 2.50453456 0.01771026 0.2802078

LRRC6 2.520351 0.0241 1477 0.30848475

ERCC6L 2.53331745 0.00446649 0.17875775

RRP1 2.54080726 0.02173515 0.29629456

LRRN1 2.55745667 0.0096647 0.23349914

LRIG1 2.55996434 0.01988482 0.28655587

Z 730 2.55999309 0.02671649 0.32528085

RIMS1 2.5610746 0.01629414 0.27504029

VCAN 2.5621 1356 0.00596069 0.19668866

ASGR2 2.56573623 0.03166701 0.34803416 Gene logFC PValue FDR

MED19 2.56726731 0.03931734 0.3737544

IRS2 2.56869307 0.01843091 0.28316663

FBN1 2.57153945 0.04099136 0.37809338

ITGA5 2.57523439 0.00589001 0.19668866

PTPN13 2.5762068 0.00416761 0.17442952

Z F768 2.59142959 0.04690827 0.39454313

A PEP 2.59336686 0.0153048 0.26849402

THBS4 2.59431995 0.04747164 0.39679661

LGALS12 2.59615722 0.02932185 0.33785771

TMEM63B 2.59656801 0.01703702 0.27680342

INCE P 2.59688234 0.00447795 0.17875775

STK39 2.60099623 0.0017446 0.12891459

LOXL4 2.60361661 0.03610242 0.36023908

CYTL1 2.60959204 0.03120222 0.34676896

OLFM1 2.60995713 0.0398698 0.37474373

SPEF2 2.610861 12 0.00353854 0.161 17198

ZNF354C 2.61432747 0.03431 195 0.35518754

SLC6A9 2.61490163 0.04208559 0.38088145

CD 160 2.6185532 0.02018881 0.2887813 Gene logFC PValue FDR

HIST1H2AC 2.62451824 0.01258027 0.25448052

SYNJ2 2.62593733 0.01587838 0.27074547

RAD54L 2.63394889 0.01 1121 11 0.24346828

ZSCAN21 2.64029947 0.03942212 0.3737544

CA2 2.64274525 0.012018 0.24950832

SEMA4B 2.65044254 0.02046017 0.2900334

CTNNALl 2.6507922 0.00519202 0.1908817

USP51 2.65683468 0.01601838 0.27203471

SMIM10 2.6608929 0.00798047 0.2169564

PPM1H 2.67293143 0.01971 172 0.28655587

ZNRF 1 2.67455214 0.02087806 0.29267213

HNRNPA1P33 2.67470246 0.01900999 0.28470532

DPY19L2 2.68048505 0.00817552 0.21768725

LRP1 1 2.68277915 0.03462617 0.35574658

CEACAM3 2.6841398 0.04190453 0.3802823

DHCR7 2.69369561 0.01413296 0.26244878

LINC00936 2.69545589 0.01741706 0.2781 1244

PTGER2 2.69774081 0.00785002 0.21424845

HIST1H3D 2.69780462 0.03345461 0.35181788 Gene logFC PValue FDR

EU3 2.71473621 0.0109669 0.2427377

ZFP69B 2.717416 0.01 192998 0.24900968

AMER1 2.71975268 0.03471625 0.35574658

PTPRD 2.7207533 0.02449171 0.31 127783

PPP5C 2.72084302 0.04300416 0.38233274

RNF175 2.7252971 0.02858291 0.33480086

RBFOX2 2.72823466 0.02817034 0.33334106

MYC 2.7309501 0.00224136 0.14258704

KIF3C 2.73213147 0.01912883 0.28470532

DCLRE1A 2.7333544 0.00742216 0.2097108

EGR2 2.73729036 0.031 11019 0.34660828

TPSB2 2.74094461 0.01773618 0.2802078

LOC728024 2.74430621 0.03449331 0.35574658

VNN3 2.77298791 0.01912381 0.28470532

ABLIM1 2.77948696 0.00547082 0.19256714

DET1 2.79030807 0.02666497 0.32528085

RNASE2 2.79164378 0.00415171 0.17442952

TRIM10 2.79427513 0.01565094 0.2696842

SERPINA1 2.8029762 0.0034329 0.1598201 1 Gene logFC PValue FDR

KCNQ5 2.80621299 0.0086337 0.22173448

HOXA9 2.80958661 0.0244735 0.31 127783

S K-AS1 2.81468153 0.00495609 0.1874528

S100Z 2.81682351 0.01355634 0.25968569

ADCYAP 1 2.81768704 0.03763915 0.36514268

ARHGEF5 2.81791679 0.0327463 0.34944007

DNAH14 2.8179673 0.02638154 0.32290073

ARHGEF35 2.81975657 0.01 11733 0.24346828

FANCB 2.82013763 0.00958727 0.2324179

KIAA121 1 2.82834138 0.01035739 0.23621 184

GATA1 2.83635812 0.01675646 0.27680342

SLC43A1 2.83975209 0.01 181808 0.24837425

CYP1B1 2.84594627 0.01707605 0.27680342

HIST1H2BG 2.8528179 0.00471452 0.18203281

FAT1 2.86434651 0.04194162 0.38031 111

CTSE 2.86559058 0.00640698 0.19876073

KCNQ5-IT1 2.86688871 0.0076077 0.21 196489

LINC00426 2.86690784 0.01 11447 0.24346828

HEMGN 2.87773207 0.00173645 0.12891459 Gene logFC PValue FDR

NCEH1 2.87874042 0.00432294 0.1782453

LPO 2.88033221 0.0434423 0.38366205

LGALS3BP 2.89069331 0.01669981 0.27680342

SSBP3-AS1 2.89396974 0.01375292 0.26096896

TMPO-AS1 2.89453915 0.00523613 0.1913087

TARP 2.89806444 0.01926012 0.28472995

CFH 2.89894924 0.03502966 0.35729225

HIST1H1B 2.90122361 0.00567337 0.19508518

ARAP3 2.90738091 0.01829912 0.28277135

COL9A2 2.9085675 0.01089922 0.24237444

RAB27B 2.91380189 0.01261531 0.25448052

BACH2 2.91455024 0.03147981 0.34803416

GBP1 2.9151698 0.0362344 0.36057904

ZBED3 2.91809695 0.02455378 0.31 150781

HMGN5 2.92183914 0.00156939 0.12179866

ANKRD 18A 2.92667634 0.02018763 0.2887813

ST6GALNAC3 2.92989614 0.03709652 0.36464585

ALAS2 2.93161494 0.02263755 0.30163787

SY E2 2.94351932 0.00190406 0.1330445 Gene logFC PValue FDR

FAM89A 2.94401593 0.00409102 0.17274298

A S6 2.94453265 0.01519297 0.26750406

PET1 12 2.94515564 0.01098992 0.2427377

PTTG3P 2.94691899 0.00802456 0.2174791

SLC22A15 2.95352922 0.02795509 0.33220883

EPN2 2.95523628 0.02124249 0.29405301

GPT2 2.95625316 0.01986487 0.28655587

FOXOl 2.95712898 0.00907889 0.22848401

T FAIP6 2.96334617 0.02608018 0.3214533

DSC2 2.96389091 0.02380176 0.30701392

DMTN 2.96612771 0.0242828 0.30976742

STAG3 2.97730214 0.03212836 0.34815953

HIST1H2BC 2.99403773 0.0018931 0.1330445

DNTT 2.99898009 0.01410312 0.26244878

Z F462 3.00536373 0.00742785 0.2097108

FAXDC2 3.01985673 0.00952947 0.23143956

DZIP1L 3.02075054 0.02903889 0.33617356

YBX3 3.02246768 0.00460204 0.1808956

HSPA4L 3.04404776 0.00650892 0.19960682 Gene logFC PValue FDR

LEF1 3.05767796 0.00864465 0.22173448

HIST1H3B 3.05776766 0.00229601 0.14367657

PBK 3.05875831 0.00420338 0.17483043

FHIT 3.0597931 1 0.04263838 0.38172475

ADAMTS3 3.07197895 0.03287149 0.34944007

PRG2 3.08288623 0.04509465 0.38834583

GIMAP4 3.08817454 0.00631039 0.19876073

SPA17 3.0938422 0.00712546 0.20800617

HIST1H3I 3.09498803 0.00719662 0.20800617

EHD3 3.10074583 0.00444518 0.17847528

GIMAP7 3.10272798 0.01312235 0.25685132

GNAI1 3.1 1701074 0.002781 16 0.14854944

HIST1H2AL 3.12514282 0.00289708 0.15130169

PYHIN1 3.1297548 0.01 131536 0.24346828

DGKG 3.13586268 0.00261818 0.14627279

AGTR1 3.14550791 0.01806603 0.28147464

HRASLS5 3.14865939 0.04595077 0.39069817

MAPK3 3.15772535 0.00492537 0.18694861

IGLL1 3.15803576 0.01002755 0.23539937 Gene logFC PValue FDR

PNKD 3.16315043 0.007196 0.20800617

SLC16A14 3.16866681 0.03457442 0.35574658

EBF1 3.18821 198 0.01 130827 0.24346828

PCDH9 3.19590007 0.00838193 0.21854864

CELSR2 3.19664062 0.01828433 0.28277135

TEX9 3.20492667 0.02160123 0.29594107

SLC16A9 3.20613873 0.001331 11 0.1 134462

LOC103021295 3.21 141529 0.03583296 0.36019642

NFIA 3.21259355 0.00104762 0.10675364

CD 163 3.21307545 0.01653362 0.27631529

CDC42EP4 3.21344537 0.01914848 0.28470532

SRGAP3 3.21931761 0.01008637 0.23539937

LIN28B 3.22839833 0.04663664 0.39360642

IL15RA 3.23449745 0.00673682 0.20389508

GTDC1 3.24435759 0.00097012 0.1061 171 1

GYPA 3.25613267 0.00168223 0.12708706

TFR2 3.27352948 0.01624121 0.27448041

GYPB 3.2829792 0.00659738 0.2016332

SPRY1 3.28652827 0.01463669 0.26544772 Gene logFC PValue FDR

ANO10 3.29016531 0.0133082 0.25828594

MFHAS1 3.30245074 0.01556429 0.2696842

CLTCL1 3.30906214 0.01270404 0.25448052

PRTN3 3.31248724 0.03530815 0.35810002

HIST1H2BF 3.31290835 0.00524623 0.1913087

CAMK2D 3.33841962 0.00374037 0.16508818

ELOVL6 3.34172562 0.00200161 0.1330445

CCDC180 3.343031 13 0.01447353 0.26455442

EPX 3.35192924 0.03290435 0.34944007

FKBP1B 3.35257702 0.02746892 0.32990241

NGFRAP1 3.3548646 0.01009071 0.23539937

SPTA1 3.35890301 0.00185758 0.13301813

ICA1 3.38584589 0.01341 128 0.25840428

AIM2 3.39665526 0.01378867 0.26097032

HIST1H2BH 3.40734243 0.00263758 0.14627279

C RIP 1 3.4092895 0.0027267 0.14739052

A 1 3.41304627 0.00187137 0.1330445

Z F831 3.41442382 0.0312986 0.34728445

CD40LG 3.41829493 0.020435 0.2900334 Gene logFC PValue FDR

SOX6 3.4231439 0.00535137 0.19256714

PLOD2 3.42329108 0.01059287 0.23850269

SLC38A5 3.427341 12 0.00856507 0.221 16342

SCN4A 3.44146033 0.022838 0.30215762

ATP9A 3.47564066 0.01248279 0.25448052

TSPAN5 3.47626088 0.00443613 0.17847528

MORN2 3.50082351 0.01 150689 0.2437476

LTBP1 3.50213538 0.00293822 0.15183121

RAG2 3.5028953 0.02387542 0.30736676

PCNXL2 3.51524091 0.0073662 0.2097108

DTX1 3.53750075 0.01641524 0.27631529

E PP5 3.54002345 0.01306007 0.25654909

ALDHIAI 3.55160858 0.00461691 0.1808956

GYPC 3.5577326 0.00499216 0.1874528

JPH1 3.55792376 0.02738028 0.32932196

MNS1 3.55842221 0.00455102 0.18049064

CA1 3.55929041 0.00197219 0.1330445

Cl lorf48 3.56495589 0.04636242 0.3927236

AHSP 3.56910065 0.00829014 0.21854864 Gene logFC PValue FDR

XK 3.57195499 0.00172272 0.12866656

HIST1H2AH 3.59192649 0.03203148 0.34803416

ABCG2 3.59485814 0.00436628 0.1782453

RHAG 3.61989965 0.00635737 0.19876073

SLC16A10 3.6202143 0.01 158225 0.2445298

CNN3 3.63509426 0.01396717 0.26169472

Clorfl98 3.63693472 0.01321757 0.25752936

SLC6A8 3.64370521 0.01296325 0.25653191

CCDC34 3.65307212 0.00084446 0.10067713

BLOC1S5- 3.6531 1276 0.03344725 0.35181788 TXNDC5

PAX5 3.65780012 0.0024719 0.14627279

PLCG1 3.66203012 0.00838262 0.21854864

KATNAL2 3.67280888 0.01 148613 0.2437476

HIST1H4C 3.67780587 0.00817973 0.21768725

HIST1H3J 3.68636503 0.01 135671 0.24346828

MEST 3.68810259 0.0017826 0.13102613

MYH10 3.701 11376 0.001 1031 0.10750529

CMTM1 3.70701 111 0.01275552 0.25448052 Gene logFC PValue FDR

RAI14 3.70734008 0.02314431 0.30303561

KEL 3.713 15596 0.00639747 0.19876073

HIST1H2AJ 3.74432067 0.0019769 0.1330445

ADD2 3.74901485 0.00296637 0.15183121

LOC145783 3.74935429 0.0188158 0.28470532

LRP6 3.7657605 0.01817146 0.28219791

H SL2 3.76762405 0.00756265 0.21 196489

MTSS1 3.84823125 0.00258237 0.14627279

GFI1B 3.8516641 0.00859143 0.2214326

MNAT3 3.85804815 0.00472866 0.18203281

MY07A 3.87141402 0.02727989 0.32896302

PREX2 3.8768125 0.04936343 0.40071531

HIST1H2BE 3.89007898 0.00776263 0.21396514

RNASE3 3.9380388 0.00420235 0.17483043

PTX3 3.94655239 0.01657051 0.27631529

GPX3 3.95747028 0.0058028 0.19613747

MPZL2 4.00722264 0.02246388 0.30073852

CDK14 4.05190062 0.00524681 0.1913087

IGF2 4.05237638 0.0030942 0.15297019 Gene logFC PValue FDR

CMTM8 4.05417636 0.02413784 0.30848475

PRDX2 4.05827983 0.0074307 0.2097108

SPTB 4.06904586 0.00082097 0.10027569

TIMP3 4.07335329 0.01090441 0.24237444

EHF 4.08188458 0.00528969 0.19136545

APOBEC3B 4.08361289 0.00595482 0.19668866

RXFP2 4.09275684 0.01506301 0.26750406

EPB42 4.1 1830602 0.00351652 0.161 17198

LOXHD1 4.18869736 0.00501227 0.1874528

TGM2 4.19297249 0.00144751 0.1 1690004

GSTM1 4.22455334 0.03530205 0.35810002

PTTG2 4.23225173 0.00207941 0.13690576

HIST2H2BC 4.27478742 0.01348646 0.25949289

FAM151B 4.29016659 0.00259078 0.14627279

SLC22A4 4.29650425 0.0092884 0.22906318

Z 844 4.29693066 0.00851624 0.22072315

MITF 4.31390773 0.00304494 0.15297019

OSBPL6 4.32733646 0.02536688 0.31747453

RFX2 4.3612013 0.00387945 0.16633719 Gene logFC PValue FDR

LINC00669 4.40338469 0.0104959 0.23708791

CLIP2 4.42765432 0.01567437 0.2696842

CLCN4 4.47137401 0.001793 0.1310965

NPL 4.4821001 1 0.00284327 0.15018501

ARSG 4.6650919 0.0040205 0.1702827

PEG10 4.66532334 0.0021 1277 0.13824828

LY75-CD302 4.67718345 0.01992415 0.28682523

HIST1H2AG 4.81009729 0.001 17069 0.10755742

REREP3 4.81636495 0.01078538 0.24088513

RHCE 4.85092304 0.00300764 0.15248976

HIST1H2AI 4.94853927 0.00357801 0.16190785

TE M 1 4.974301 14 0.00258922 0.14627279

HIST1H4H 4.97809925 0.001 10663 0.10750529

KCNH2 5.00038181 0.00145578 0.1 1690004

HN PUL2- 5.06222001 0.00231775 0.14438675 BSCL2

VPREB3 5.1225981 1 0.01036984 0.23621 184

RNF152 5.1345608 0.0036131 0.16243772

HIST1H3C 5.15782297 0.00305899 0.15297019 Gene logFC PValue FDR

TMOD1 5.20271626 0.00380789 0.16526242

SLC41A1 5.23126319 0.00048667 0.08752905

SLC25A21 5.24222631 0.00353349 0.161 17198

PROM1 5.274645 0.0019527 0.1330445

LGR4 5.39480846 0.00131335 0.1 1262409

ACSM1 5.44719239 0.0090981 1 0.22848401

FREM1 5.45634412 0.00229534 0.14367657

SLC37A4 5.46483838 0.00243233 0.14627279

GPR133 5.52005705 0.00288344 0.151 1574

CTAGE4 5.5325027 0.00331742 0.1578272

NPR3 5.64033656 0.001 16046 0.10755742

FAM72B 5.72881066 0.01 141771 0.2437476

PLSCR4 5.76791257 0.001401 16 0.1 1457341

HIST2H2BF 5.85151469 0.00128009 0.1 1114357

ATP7B 6.0061 182 0.00243793 0.14627279

GAD 1 6.06956013 0.00336712 0.15836863

MUC1 6.33681959 0.001 14359 0.10755742

LCA5 6.38958313 0.00120795 0.10755742

EPCAM 6.43951619 0.0005171 0.08868539 Gene logFC PValue FDR

UGT3A2 6.56076726 0.00149296 0.1 1717654

LOC100652999 6.61912044 0.0006996 0.09168701

Z 423 6.62299281 0.00142147 0.1 154798

HTR1F 7.234096 0.00046713 0.08752905

NUP62CL 7.32030186 0.00057265 0.09102367

ABO 7.43174033 0.0003081 1 0.0813185

VPS37B 7.80984416 0.00029842 0.0813185

PKLR 8.13979935 0.00029707 0.0813185

Discussion [00113] We report the development of a mouse model of de novo human AML which develops in the presence of an autologous human immune system. In the NPMlc AML humanized mice, referred to as GN mice, disease is driven by a frequently found human mutation NPMlc in human HSPCs and faithfully recapitulates features of the human disease: anemia, perturbed hematopoiesis, presence of leukemic blasts, and infiltration of leukemic cells into other organs. Leukemic cells are CD33 and CD13 positive with minimal expression of CD34, and share similar transcriptional profile as patient NPMlc + AML. A distinct fraction of leukemic cells also express LSC markers CD123 and CD38. In addition, GN mice express a full complement of human immune cells, including CD4+ and CD8+ T cells, B cells, N cells and macrophages. The de novo development of human AML with an autologous immune system makes this model unique for studying mechanisms of human leukemogenesis and tumor-immune system interaction. The proof-of-principle approach should open the possibility to model other human hematologic and solid tumors with an autologous immune system. [00114] In the NPMlc-driven AML model reported here, enforced expression of NPMlc alone in human HSPCs leads to rapid development (an average survival of -100 days following HSPC engraftment) of AML with 100% penetrance. In contrast, systemic expression of human NPMlc in mice leads to myeloproliferation (Cheng et al., 2010) and restricted expression of human NPMlc in hematopoietic compartment leads to AML and B cell malignancies with poor penetrance and long latencies (Vassiliou et al., 201 1). Disease latency is significantly shortened by knocking-in the FLT3-ITD, another commonly occurring genetic lesion in AML (Mupo et al., 2013). Thus, expression of human oncogenic lesion NPMlc in human but not mouse HSPCs is sufficient to drive AML development, suggesting intrinsic differences in cellular context between human and mouse. [00115] Our transcriptional analysis further sheds light on how the enforced expression of NPMlc alone in human HSPCs drives development of AML. Approximately 500 genes are up-regulated in LSC and bulk leukemic cells. Most of the genes up-regulated in bulk leukemic cells are involved in cell cycle and DNA replication, consistent with a tumorigenic phenotype. As observed in patient NPMlc AML, a HOX gene signature, which is characteristic of NPMlc + AML, is observed in de novo NPMlc AML. In addition, we found that Myc is up-regulated in bulk leukemic cells. NPMlc is known to prevent the degradation of Myc (Bonetti et al., 2008), which in turn positively regulates (endogenous) NPM1 transcription (Zeller et al., 2001). This positive feedback pathway could play a significant role in tumorigenesis. Consistently, NPMlc + LSC and AML cells are more sensitive to Myc inhibition. While detailed mechanisms of leukemogenesis by enforced NPMlc expression have yet to be elucidated, our de novo AML model is ideal for dissecting early events of human leukemogenesis. [00116] The presence of an autologous human immune system allows our model to be used as a preclinical tool to test the efficacy and mechanism of immune-based therapies. Here, we demonstrate as a proof-of-principle, the efficacy of a CD123/CD3 bi-specific Fab conjugate in eliminating CD123 + LSCs both in vivo and in vitro in a T cell-dependent manner. This data demonstrates the functionality and responsiveness of human T cells in this system and provides support that humanized mouse models can be used to dissect the mechanism of action of immunotherapies. While T cells developed in humanized mice, including those that develop in the presence of human thymic grafts (Covassin et al., 2013, Seung and Tager, 2013), may not be fully functional, our data suggests that CD3 dependent activation and target cell elimination by T cells occurs reliably in these models. The relatively short-term effect, i.e., significant decrease of GFP+CD123 + LSCs at day 8 but not day 17, is likely because of the short half-life of BFCs due to the lack of Fc. [00117] There has been significant effort in the development of targeted therapies for AML. The most promising of such therapies was Gemtuzumab ozogamicin, a CD33- calicheamicin conjugated antibody therapy, which was approved by the FDA but had to be pulled off the market due to toxicity (Rowe and Lowenberg, 2013). To eliminate residual disease in the bone marrow, CD123 is being investigated as a target. CD123 targeting antibodies, CD123/CD3 bi-specific antibodies and T cell chimeric antigen receptor cells (CAR-T) have shown promising results for treating AML (Gill et al., 2014, Jin et al., 2009). In addition, the PM l c mutation used to model AML here has been reported to generate a CD8 neo-epitope (Greiner et al., 2012, Greiner et al., 2013). This AML specific neoantigen can be used to develop vaccination approaches, bi-specific antibodies and CAR-T type therapies. Our de novo AML model, in which a normal human immune system and leukemia co-exist, should facilitate the assessment of the efficacy of these immune-based therapies prior to clinical testing.

Experimental Procedures [00118] Purification of CD34+HSPCs and viral transduction [00119] 16-22 week human fetal liver tissue was procured from Advanced Bioscience Resources (Alameda, CA) and processed as previously described (Chen et al., 2013). Briefly, tissue was dissected into 5mm3 pieces in digestion buffer containing DNasel and collagenase D, and incubated at 37°C for 30 minutes followed by homogenization. Following top layering with Ficoll-Paque (GE Healthcare) interphase containing immune cells and CD34+ HSPCs were collected and washed with PBS. EasySep human CD34 positive selection kit (StemCell Technologies) was then used to purify CD34+ HSPCs. For viral transduction, lentivirus was produced by transient transfection of 293 cells with plasmids encoding VSVG, delta8.9 and pGL3-derived lentivirus plasmids encoding GFP, GFP and NPMlc or GFP, NPMlc and FLT3-ITD. MOI of 10 was used for viral transductions. HSPCs were propagated in Stem Span media supplemented with Angiopoietin-like 5 (Angptl5, Abnova), human stem cell factor (SCF), human fibroblast growth factor (FGF, Invitrogen), insulin-like growth factor binding protein 2 (IGFBP2, R&D systems), heparin (Sigma) and thrombopoietin (R&D systems). All cytokines were reconstituted in PBS + 0.1% BSA. [00120] Generation of NPMlc AML humanized mice and secondary transplant mice [00121] 2xl0 5 lentivirus transduced CD34+ HSPCs were engrafted into 24-48 hour old NSG neonates via intracardiac injection. Pups were irradiated with 0.7Gy prior to engraftment. Beginning at 8 weeks post-engraftment, mice were serially bled every two weeks and leukocytes analyzed for human CD45 and GFP expression. For secondary transplants, mice were hydrodynamically injected with lOC^g DNA plasmids encoding human IL-3 and GM-CSF, as previously described (Chen et al., 2009). Ten to 14 days later, 6-8 week old NSG recipient mice were irradiated with 2.7Gy followed by tail vein injections with leukemic cells. Four weeks post-engraftment mice were serially bled to monitor disease development. All mouse work was approved by the Institutional Animal Care and Use Committee (IACUC) and the use of fetal tissue was approved by Institutional Review Committee (IRB) at Massachusetts Institute of Technology. [00122] Histology and immunohistochemistry [00123] Bones were fixed in Bouin's and other organs were fixed in 10% buffered formalin (Sigma) for one week prior to embedding in paraffin. Paraffin sections were stained with H&E as per standard protocols. For immunohistochemistry, slides were incubated at 97°C for 20 minutes using citrate buffer pH6 for antigen retrieval. Slides were then incubated with the following antibodies for immunohistochemistry: goat anti-GFP (1:200) or rabbit anti-nucleophosmin mutant (1:100) followed by secondary antibodies and DAB. Slides were counter-stained with DAPI to demarcate nuclei. [00124] Flow cytometry [00125] Mice were bled via the tail vein to assess human cell reconstitution and GFP expression. Mice were also bled before and after BFC treatments. Terminal mice were

sacrificed with C0 2 followed by cardiac puncture for blood collection. Bone marrow cells were collected from the femurs of mice by flushing the bones. Blood samples and bone marrow cells were then incubated with ACK lysis buffer (Lonza Technologies) to lyse red blood cells. Leukocytes were resuspended in PBS, stained with the appropriate antibodies on ice for 20 minutes and excess antibody was washed out. Stained cells were resuspended in PBS + 10% FBS with DAPI and filtered. At least 10,000 events were collected on a BD LSRII flow cytometer. Data was analyzed using the FlowJo software. Cell sorting was performed on a BD Aria3 machine. For secondary transplant experiments, sorted cells were washed and resuspended in PBS for immediate tail vein injections. For mRNA processing, sorted cells were pelleted, snap-frozen and stored at -80°C. [00126] Preparation of CD3-CD123 bispecifw Fab conjugates (BFC) and treatments [00127] The mIgG2a anti-CD3 clone OKT3 (Janssen, Orthoclone OKT3), mIgG2a anti- CD 123 clone 7G3 (BD Pharmingen, 554526), and null arm control mlgGl anti-KLH (R&D

Systems, MAB002) were digested to F(ab') 2 using immobilized pepsin or ficin (Thermo Pierce, 44988 and 44980) following manufacturer's instructions. Undigested parental antibody was removed from F(ab') 2 using Protein AG columns (Thermo Pierce, 89950).

F(ab') 2 was reduced by addition of TCEP (Thermo Pierce, 77720) to a final concentration of 2.5mM, and buffer exchanged to lOOmM phosphate buffer, 150mM NaCl, pH 8. Anti-CD3 and null control Fab' were modified with equimolar maleimido trioxa-4-formyl benzamide (MTFB, Solulink, S-1035-105). Anti-CD123 Fab' and additional null control Fab' were modified with equimolar 3-N-maleimido-6-hydraziniumpyridine hydrochloride (MHPH, Solulink S-1009-010). To generate BFC, equimolar Fab-MTFB and Fab-MHPH were conjugated overnight at 4°C in the presence of 10% (v/v) aniline catalyst (Solulink S-2006- 105) and a twofold molar excess of Ellman's reagent (Enzo Life Sciences, ALX-400-034- G005) at pH 6 . Unreacted Fab monomers were removed from BFC conjugation products using Sephadex G-100 (Sigma, G10050-10G) gravity gel filtration in PBS. BFC was diluted in PBS and mice were dosed with \ x BFC for seven consecutive days via tail vein injections. [00128] In vitro T cell killing assay and JQ1 treatments [00129] For in vitro T cell killing assays, autologous T cells and bone marrow cells from GN mice were harvested. T cells were purified from the spleens or blood of mice with an EasySep CD3 enrichment kit (StemCell technologies). Briefly, single cell suspension were prepared from spleens and the resulting cell suspension was ACK lysed and resuspended in appropriate medium for purification, as per manufacturer's protocol. T cells with a purity of >90% were used for in vitro killing assays. Bone marrow cells were harvested and processed as described above. Cells were counted and stained with APC-conjugated anti-CD 123 and PE-conjugated anti-CD33 antibody to determine absolute cell numbers. For in vitro killing assays, T cells and target cells were resuspended in RPMI + 10% FBS and incubated at the indicated ratios in wells of 96 well plates. Five microliters of anti-CD 107a antibody and g of BFC was added to the cells and incubated for 4 to 48 hours at 37°C. For JQ1 pre- treatments, bone marrow cells were treated with JQl for 12-16 hours and the drug was washed out. Bone marrow cells were then incubated with T cells, BFC and anti-CD 107a antibody as indicated. At the end of the incubation period, cells were washed with PBS + 0 .1%BSA, stained with Live/Dead Aqua (Invitrogen) followed by staining with the indicated antibodies. Samples were processed on a BD LSRII cytometer and data was analyzed with the FlowJo software. For JQl treatments, a fixed number of cells were treated with Ι Μ of JQl for 48 hours in 96 well plates. At the end of the incubation period, cells were washed and viable cells were counted with Trypan blue stain. [00130] qRT-PCR, RNA sequencing and data analysis [00131] For qRT-PCR analysis, RNA was harvested with TRIZOL (Invitrogen), as per manufacturer's instructions. cDNA was generated with Superscript Frist Strand (Invitrogen) and qPCR was performed using LightCycler 480 SYBR green mix (Roche). Primer sequences are as follows: Tubulin FWD: CCAGATCTTTAGACCAGACAAC (SEQ ID NO: 8), Tubulin RVS: CAGGACAGAATCAACCAGCTC (SEQ ID NO: 9); Human CD34 FWD: GAGACAACCTTGAAGCCTAG (SEQ ID NO: 10), Human CD34 RVS: CTGAGTCAATTTCACTTCTCTG (SEQ ID NO: 11); HOXA9 FWD: CTTGTGGTTCTCCTCCAGTTG (SEQ ID NO: 12), HOXA9 RVS: CATGAAGCCAGTTGGCTGCTG (SEQ ID NO: 13); HOXA5 FWD: GCAAGCTGCACATAAGTC (SEQ ID NO: 14), HOXA5 RVS: CCAGATTTTAATTTGTCTCTCGG (SEQ ID NO: 15); HOXA6 FWD: GTTTACCCTTGGATGCAGC (SEQ ID NO: 16), HOXA6 RVS: GTAGCGGTTGAAGTGGAACTC (SEQ ID NO: 17); Myc FWD: CTCCAGCTTGTACCTGCAGGATCTGAG (SEQ ID NO: 18), Myc RVS: GAGCCTGCCTCTTTTCCACAG (SEQ ID NO: 19). For RNA sequencing, frozen pellet of sorted cells were thawed on ice and RNA was extracted with an RNeasy Micro Kit (Qiagen) and analyzed on a BioAnalyzer. Due to the limited amount of RNA obtained, the Ovation RNA-seq system from Nugen was used for library preparation. Adapters were ligated on the amplified library and sequenced with an Illumina HiSeq2000. Quality control was performed on the data followed by RSEM analysis using the Bowtie2 option. Raw counts were aligned to the human transcriptome (hgl9 reference database). EdgeR was then used for paired analysis with a p-value cutoff of 0.01. [00132] Statistical Analysis [00133] Where indicated, two-tailed T tests were performed to compute statistical significance between datasets. *p-value<0.05, **p-value<0.01 and ***p-value<0.001.

References for Example #2 [00134] ALCALAY, , TIACCI, E., BERGOMAS, R., BIGERNA, B., VENTURINI, E.,

MINARDI, S. P., MEANI, N., DIVERIO, D., BERNARD, L., TIZZONI, L., VOLORIO, S., LUZI, L., COLOMBO, E., LO COCO, F., MECUCCI, C , FALINI, B . & PELICCI, P. G . 2005. Acute myeloid leukemia bearing cytoplasmic nucleophosmin (NPMc+ AML) shows a distinct gene expression profile characterized by up-regulation of genes involved in stem-cell maintenance. Blood, 106, 899-902. [00135] BONETTI, P., DAVOLI, T., SIRONI, C , AMATI, B., PELICCI, P. G . & COLOMBO, E . 2008. Nucleophosmin and its AML-associated mutant regulate c-Myc turnover through Fbw7 gamma. J Cell Biol, 182, 19-26. [00136] CANCER GENOME ATLAS RESEARCH, N . 2013. Genomic and epigenomic landscapes of adult de novo acute myeloid leukemia. N Engl J Med, 368, 2059-74. [00137] CHEN, Q., KHOURY, M . & CHEN, J . 2009. Expression of human cytokines dramatically improves reconstitution of specific human-blood lineage cells in humanized mice. Proc Natl Acad Sci U S A, 106, 21783-8. [00138] CHEN, Q., KHOURY, M., LIMMON, G , CHOOLANI, M., CHAN, J . K . & CHEN, J . 2013. Human fetal hepatic progenitor cells are distinct from, but closely related to, hematopoietic stem/progenitor cells. Stem Cells, 31, 1160-9. [00139] CHENG, K., SPORTOLETTI, P., ITO, K., CLOHESSY, J . G , TERUYA- FELD STEIN, J., KUTOK, J . L . & PANDOLFI, P. P. 2010. The cytoplasmic NPM mutant induces myeloproliferation in a transgenic mouse model. Blood, 115, 3341-5. [00140] COLOMBO, E., MARTINELLI, P., ZAMPONI, R., SHING, D . C , BONETTI, P., LUZI, L., VOLORIO, S., BERNARD, L., PRUNERI, G., ALCALAY, M . & PELICCI, P. G . 2006. Derealization and destabilization of the Arf tumor suppressor by the leukemia- associated NPM mutant. Cancer Res, 66, 3044-50. [00141] COVASSIN, L., JANGALWE, S., JOUVET, N., LANING, J., BURZENSKI, L., SHULTZ, L . D . & BREHM, M . A . 2013. Human immune system development and survival of non-obese diabetic (NOD)-scid IL2rgamma(null) (NSG) mice engrafted with human thymus and autologous haematopoietic stem cells. Clin Exp Immunol, 174, 372-88. [00142] DELMORE, J . E., ISSA, G . C , LEMIEUX, M . E., RAHL, P. B., SHI, J., JACOBS, H . M., KASTRITIS, E., GILPATRICK, T., PARANAL, R . M., QI, J., CHESI, M., SCHINZEL, A . C , MCKEOWN, M . R., HEFFERNAN, T. P., VAKOC, C . R., BERGSAGEL, P. L., GHOBRIAL, I . M., RICHARDSON, P. G , YOUNG, R . A., HAHN,

W. C , ANDERSON, K . C , KUNG, A . L., BRADNER, J . E . & MITSIADES, C . S. 201 1. BET bromodomain inhibition as a therapeutic strategy to target c-Myc. Cell, 146, 904-17. [00143] FALINI, B., MARTELLI, M . P., BOLLI, N., SPORTOLETTI, P., LISO, A.,

TIACCI, E . & HAFERLACH, T. 201 1. Acute myeloid leukemia with mutated nucleophosmin (NPMl): is it a distinct entity? Blood, 117, 1109-20. [00144] FALINI, B., MECUCCI, C , TIACCI, E., ALCALAY, M., ROSATI, R., PASQUALUCCI, L., LA STARZA, R., DIVERIO, D., COLOMBO, E., SANTUCCI, A., BIGERNA, B., PACINI, R., PUCCIARINI, A., LISO, A., VIGNETTI, M., FAZI, P., MEANI, N., PETTIROSSI, V., SAGLIO, G , MANDELLI, F., LO-COCO, F., PELICCI, P. G . & MARTELLI, M . F. 2005. Cytoplasmic nucleophosmin in acute myelogenous leukemia with a normal karyotype. The New England journal of medicine, 352, 254-66. [00145] FALINI, B., NICOLETTI, , BOLLI, N., MARTELLI, M . P., LISO, A., GORELLO, P., MANDELLI, F., MECUCCI, C . & MARTELLI, M . F. 2007. Translocations and mutations involving the nucleophosmin (NPMl) gene in lymphomas and leukemias. Haematol ogica, 92, 519-32. [00146] GAL, H., AMARIGLIO, N., TRAKHTENBROT, L., JACOB-HIRSH, J., MARGALIT, O., AVIGDOR, A., NAGLER, A., TAVOR, S., EIN-DOR, L., LAPIDOT, T., DOMANY, E., RECHAVI, G . & GIVOL, D . 2006. Gene expression profiles of AML derived stem cells; similarity to hematopoietic stem cells. Leukemia, 20, 2147-54.

[00147] GILL, S., TASIAN, S. K., RUELLA, M., SHESTOVA, O., LI, Y., PORTER, D .

L., CARROLL, M., DANET-DESNOYERS, G., SCHOLLER, J., GRUPP, S. A., JUNE, C . H . & KALOS, M . 2014. Preclinical targeting of human acute myeloid leukemia and myeloablation using chimeric antigen receptor-modified T cells. Blood, 123, 2343-54. [00148] GREINER, J., ONO, Y., HOFMANN, S., SCHMITT, A., MEHRING, E., GOTZ, M., GUILLAUME, P., DOHNER, K., MYTILINEOS, J., DOHNER, H . & SCHMITT, M . 2012. Mutated regions of nucleophosmin 1 elicit both CD4(+) and CD8(+) T-cell responses in patients with acute myeloid leukemia. Blood, 120, 1282-9. [00149] GREINER, J., SCHNEIDER, V., SCHMITT, M., GOTZ, , DOHNER, K.,

WIESNETH, M., DOHNER, H . & HOFMANN, S. 2013. Immune responses against the mutated region of cytoplasmatic NPM1 might contribute to the favorable clinical outcome of AML patients with PM l mutations (NPMlmut). Blood, 122, 1087-8.

[00150] HORTON, S. J . & HUNTLY, B . J . 2012. Recent advances in acute myeloid leukemia stem cell biology. Haematologica, 97, 966-74.

[00151] JIN, L., LEE, E . , RAMSHAW, H . S., BUSFIELD, S. J., PEOPPL, A . G , WILKINSON, L., GUTHRIDGE, M . A., THOMAS, D., BARRY, E . F., BOYD, A., GEARING, D . P., VAIRO, G , LOPEZ, A . F., DICK, J . E . & LOCK, R . B . 2009. Monoclonal antibody -mediated targeting of CD 123, IL-3 receptor alpha chain, eliminates human acute myeloid leukemic stem cells. Cell Stem Cell, 5, 31-42. [00152] KIYOI, H., NAOE, T., NAKANO, Y., YOKOTA, S., MINAMI, S., MIYAWAKI, S., ASOU, N., KURIYAMA, K., JINNAI, L, SHIMAZAKI, C , AKIYAMA, H., SAITO, K., OH, H., MOTOJI, T., OMOTO, E., SAITO, H., OHNO, R . & UEDA, R . 1999. Prognostic implication of FLT3 and N-RAS gene mutations in acute myeloid leukemia. Blood, 93, 3074- 80. [00153] KLINGER, M., BRANDL, C , ZUGMAIER, G , HIJAZI, Y., BARGOU, R . C , TOPP, M . S., GOKBUGET, N., NEUMANN, S., GOEBELER, M., VIARDOT, A., STELLJES, M., BRUGGEMANN, M., HOELZER, D., DEGENHARD, E., NAGORSEN, D., BAEUERLE, P. A., WOLF, A . & KUFER, P. 2012. Immunopharmacologic response of patients with B-lineage acute lymphoblastic leukemia to continuous infusion of T cell- engaging CD19/CD3-bispecific BiTE antibody blinatumomab. Blood, 119, 6226-33. [00154] LAPIDOT, T., SIRARD, C , VORMOOR, J., MURDOCH, B., HOANG, T., CACERES-CORTES, J., MINDEN, M., PATERSON, B., CALIGIURI, M . A . & DICK, J . E . 1994. A cell initiating human acute myeloid leukaemia after transplantation into SCID mice. Nature, 367, 645-8. [00155] MARTELLI, M . P., PETTIROSSI, V., THIEDE, C , BONIFACIO, E., MEZZASOMA, F., CECCHINI, D., PACINI, R., TABARRINI, A., CIURNELLI, R., GIONFRIDDO, L, MANES, N., ROSSI, R., GIUNCHI, L., OELSCHLAGEL, U., BRUNETTI, L., GEMEI, M., DELIA, M., SPECCHIA, G., LISO, A., DI IAN , M., DI RAIMONDO, F., FALZETTI, F., DEL VECCHIO, L., MARTELLI, M . F. & FALINI, B . 2010. CD34+ cells from AML with mutated NPMl harbor cytoplasmic mutated nucleophosmin and generate leukemia in immunocompromised mice. Blood, 116, 3907-22.

[00156] MCCORMACK, E., BRUSERUD, O . & GJERTSEN, B . T. 2005. Animal models of acute myelogenous leukaemia - development, application and future perspectives. Leukemia, 19, 687-706.

[00157] MUPO, A., CELANI, L., DOVEY, O., COOPER, J . L., GROVE, C , RAD, R.,

SPORTOLETTI, P., FALINI, B., BRADLEY, A . & VASSILIOU, G . S. 2013. A powerful molecular synergy between mutant Nucleophosmin and Flt3-ITD drives acute myeloid leukemia in mice. Leukemia, 27, 1917-20.

[00158] PAIETTA, E . 2012. Minimal residual disease in acute myeloid leukemia: coming of age. Hematology Am Soc Hematol Educ Program, 2012, 35-42.

[00159] ROWE, J . M . & LOWENBERG, B . 2013. Gemtuzumab ozogamicin in acute myeloid leukemia: a remarkable saga about an active drug. Blood, 121, 4838-41.

[00160] SEUNG, E . & TAGER, A . M . 2013. Humoral immunity in humanized mice: a work in progress. J Infect Dis, 208 Suppl 2, SI55-9.

[00161] SPORTOLETTI, P., VARASANO, E., ROSSI, R., MUPO, A., TIACCI, E., VASSILIOU, G , MARTELLI, M . P. & FALINI, B . 2015. Mouse models of NPMl -mutated acute myeloid leukemia: biological and clinical implications. Leukemia, 29, 269-78.

[00162] VASSILIOU, G . S., COOPER, J . L., RAD, R., LI, J., RICE, S., UREN, A., RAD, L., ELLIS, P., ANDREWS, R., BANERJEE, R., GROVE, C , WANG, W., LR7, P.,

WRIGHT, P., ARENDS, M . & BRADLEY, A . 201 1. Mutant nucleophosmin and cooperating pathways drive leukemia initiation and progression in mice. Nature genetics, 43, 470-5.

[00163] VERHAAK, R . G , GOUDSWAARD, C . S., VAN PUTTEN, W., BIJL, M . A., SANDERS, M . A., HUGENS, W., UITTERLINDEN, A . G , ERPELINCK, C . A., DELWEL, R., LOWENBERG, B . & VALK, P. J . 2005. Mutations in nucleophosmin (NPMl) in acute myeloid leukemia (AML): association with other gene abnormalities and previously established gene expression signatures and their favorable prognostic significance. Blood, 106, 3747-54.

[00164] WONG, R., PEPPER, C , BRENNAN, P., NAGORSEN, D., MAN, S. & FEGAN, C . 2013. Blinatumomab induces autologous T-cell killing of chronic lymphocytic leukemia cells. Haematologica, 98, 1930-8. [00165] ZELLER, K . L, HAGGERTY, T. J., BARRETT, J . F., GUO, Q., WONSEY, D . R . & DANG, C . V. 2001. Characterization of nucleophosmin (B23) as a Myc target by scanning chromatin immunoprecipitation. J Biol Chem, 276, 48285-91.

INCORPORATION BY REFERENCE AND EQUIVALENTS [00166] The teachings of all patents, published applications and references cited herein are incorporated by reference in their entirety. [00167] While this invention has been particularly shown and described with references to example embodiments thereof, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the invention encompassed by the appended claims. CLAIMS

What is claimed is:

1. A method of producing a non-human mammal that is a model for human NPMlc + acute myeloid leukemia with an autologous human immune system, the method comprising: a) introducing human hematopoietic stem cells (HSCs) genetically engineered to express mutant human NPMl into an immunodeficient non-human mammal, wherein the HSCs are not genetically engineered to express human FLT3-ITD; and b) maintaining the immunodeficient non-human mammal under conditions in which the non-human mammal's human blood lineage is reconstituted by the human HSCs, thereby producing a non-human mammal that is a model for human NPMlc + acute myeloid leukemia.

2 . The method of Claim 1, wherein mutant human NPMl is NPMlc mutation A, B, C, D, E or F.

3 . The method of Claim 1, wherein the mutant human NPMl is NPMlc mutation A .

4 . The method of Claim 1, wherein the mutant human NPMl is expressed in the non- human mammal in human blood lineage cells.

5. The method of any one of Claims 1-4, wherein the non-human mammal is a mouse.

6 . The method of any one of Claims 1-5, wherein the human hematopoietic stem cells genetically engineered to express mutant human NPMl are further genetically engineered to express a reporter protein.

7 . The method of Claim 6, wherein the reporter protein is a green fluorescent protein, red fluorescent protein, an antibiotic resistance protein, luciferase, a cell surface protein, or a combination thereof. 8. The method of any one of Claims 1-7, wherein the HSCs are transduced with a virus expressing mutant human NPMl under the control of a ubiquitous promoter.

9 . The method of any one of Claims 1-8, further comprising transducing human hematopoietic stem cells with a virus capable of expressing mutant human NPMl under the control of a ubiquitous promoter.

10. The method of Claim 8, wherein the ubiquitous promoter is the PGK promoter.

11. The method of Claim 10, wherein the virus is a lentivirus.

12. The method of Claim 11, wherein the lentivirus is VSV-G pseudotyped.

13. The method of any one of Claims 1-12, further comprising introducing human hematopoietic stem cells that have not been genetically engineered to express mutant human NPMl into the immunodeficient non-human mammal, and further maintaining the non-human mammal under conditions in which the non-human mammal's blood is reconstituted by human hematopoietic stem cells that do not express mutant human NPMl.

14. A non-human mammal that is a model for human NPMlc + acute myeloid leukemia, the non-human mammal produced by the methods of any of the preceding claims.

15. A non-human mammal that is a model for human NPMlc + acute myeloid leukemia, the non-human mammal comprising human hematopoietic stem cells genetically engineered to express mutant human NPMl, but not genetically engineered to express human FLT3-ITD.

16. A lentiviral vector for use in producing a non-human mammal that is a model for human acute myeloid leukemia, the lentiviral vector characterized in that there is one or more of: i) deletion of U6 promoter, and ii) deletion of anti-repressor element.

17. A method of identifying one or more agents that can be used to treat human NPMlc + acute myeloid leukemia, the method comprising: a) administering the one or more agents to a non-human mammal, wherein the non-human mammal comprises human hematopoietic stem cells genetically engineered to express mutant human PM 1, but not genetically engineered to express human FLT3-ITD; and b) determining the toxicity or therapeutic efficacy of the agent.

18. The method of Claim 17, wherein the agent is an antibody or small molecule.

19. The method of Claim 17, wherein determining the toxicity comprises monitoring one or more of body weight of the non-human mammal and human cytokine levels of the non-human mammal, wherein the human cytokine is selected from the group consisting of interleukin-6, interferon gamma, and TNF-alpha.

20. The method of Claim 17, wherein determining the therapeutic efficacy comprises monitoring the presence of leukemic cells in the blood or bone marrow of the non- human mammal.

21. The method of Claim 20, wherein monitoring the presence of leukemic cells comprises detecting green fluorescent protein expression by flow cytometry of cells from the blood or bone marrow of the non-human mammal that is a model for human PM l c+ acute myeloid leukemia.

22. The method of any one of Claims 17-21, wherein the agent is an agonist or antagonist of CD 123, CD47, PD-L1, or PD-1.

23. The method of Claim 17-22, wherein the agent is a bi-specific Fab conjugate that binds CD3 and CD 123.

INTERNATIONAL SEARCH REPORT International application No.

PCT/US 16/52003

A . CLASSIFICATION O F SUBJECT MATTER IPC(8) - A01K 67/00; C12N 15/00; G01N 33/00 (2016.01 ) CPC - AU1K 67/0271; A0 1 67/0278; A01K 2227/105; C12N 15/867; C12N 15/63; A01K 2267/03 According to International Patent Classification (IPC) or to both national classification and IPC

B . FIELDS SEARCHED

Minimum documentation searched (classification system followed by classification symbols) IPC(8) - A0 1 67/00; C12N 15/00; G01N 33/00 (2016.01); USPC - 800/9; 435/320.1 ; 435/455; 800/3 CPC - A01K 67/0271 ; A01K 67/0278; A01K 2227/105; C12N 15/867; C12N 15/63; A01K 2267/03

Documentation searched other than minimum documentation to the extent that such documents are included in the fields searched IPC(8) - A01K 67/00; C12N 15/00; G01N 33/00 (2016.01); USPC - 800/9; 435/320.1; 435/455; 800/3 CPC - A01K 67/0271; A01K 67/0278; A01K 2227/105; C12N 15/867; C12N 15/63; A01K 2267/03 - see keyword below

Electronic data base consulted during the international search (name of data base and, where practicable, search terms used) PubWEST(USPT,PGPB,EPAB,JPAB); PatBase; Medline, Google: SCID, Nucleophosmin, NPM1, NPMIc, mutation, type A , B, C , D, non -human mammal, mouse, rat, model, acute myeloid leukemia, AML, autologous, human, expressing, hematopoietic stem cells, HSC, genetic, engineer, mutant, immunodeficient, FLT3-ITD; blood, lineage, reconstitute, humanized, l, knock

C . DOCUMENTS CONSIDERED T O B E RELEVANT

Category* Citation of document, with indication, where appropriate, of the relevant passages Relevant to claim No.

VASSILIOU et al., Mutant nucleophosmin and cooperating pathways drive leukemia initiation 1-5 and progression in mice. Nat Genet. 201 1, Vol. 43(5), p. 470-5. Abstract; pg 470, col 2 , para 1, and lower para; pg 471 , Fig 1b-d; pg 472, col 2 , up para, and Fig 2a; pg 473, col 2 , lower para, Fig 3, and Fig 4f; and pg 474, col 1, last para

US 2015/0007357 A 1 (MASSACHUSETTS INSTITUTE O F TECHNOLOGY) 0 1 January 2015 1-5 (01.01.2015), para [0003], [0005), [0006], [0035], [0041], a d [0053]

US 2009/0232793 A 1 (LAPIDOT et al.) 17 September 2009 (17.09.2009), Abstract, para [0001], 1-5 [0039], [0059], [0068], [0081], and [0088]

Levis, FLT3/ITD AML and the law of unintended consequences. Blood. 201 1, Vol. 117(26), p. 1-5 6987-90. Entire documentation, especially Abstract

SCHNITTGER et al., Nucleophosmin gene mutations are predictors of favorable prognosis in 1-5 acute myelogenous leukemia with a normal karyotype. Blood. 2005, Vol. 106(12), p. 3733-9. Entire documentation, especially Abstract; and pg 3734, col 2 , last para

US 2008/0299560 A 1 (FALINI et al.) 04 December 2008 (04.12.2008), Abstract, para [0182] 1-5

□ Further documents are listed in the continuation of Box C .

* Special categories of cited documents: "T" later document published after the international filing date or priority "A" document defining the general state of the art which is not considered date and not in conflict with the application but cited to understand to be of particular relevance the principle or theory underlying the invention "E" earlier application or patent but published on or after the international "X" document of particular relevance; the claimed invention cannot be filing date considered novel or cannot be considered to involve an inventive "L" document which may throw doubts on priority claim(s) or which is step when the document is taken alone cited to establish the publication date of another citation or other "Y" document of particular relevance; the claimed invention cannot be special reason (as specified) considered to involve an inventive step when the document is "O" document referring to an oral disclosure, use, exhibition or other combined with one or more other such documents, such combination means being obvious to a person skilled in the art "P" document published prior to the international filing date but later than "&" document member of the same patent family the priority date claimed Date of the actual completion of the international search Date of mailing of the international search report 09 December 20 6 0 1 F E B 2017

Name and mailing address of the ISA/US Authorized officer- Mail Stup PCT, Attn: ISA/US, Commissioner for Patents Lee W . Young P.O. Box 1450, Alexandria, Virginia 22313-1450 Facsimile N n 571-273-8300

Form PCT/ISA/210 (second sheet) (January 2015) INTERNATIONAL SEARCH REPORT International application No.

PCT/US 16/52003 .

Box No. II Observations where certain claims were found unsearchable (Continuation of item 2 of first sheet)

This international search report has not been established in respect of certain claims under Article 17(2)(a) for the following reasons:

1. □ Claims Nos.: because they relate to subject matter not required to be searched by this Authority, namely:

□ Claims Nos.: because they relate to parts of the international application that do not comply with the prescribed requirements to such an extent that no meaningful international search can be carried out, specifically:

3. Claims Nos.: 6-14, a _ _ because they are dependent claims and are not drafted in accordance with the second and third sentences of Rule 6.4(a).

Box No. Ill Observations where unity of invention is lacking (Continuation of item 3 of first sheet)

This International Searching Authority found multiple inventions in this international application, as follows: This application contains the following inventions or groups of inventions which are not so linked as to form a single general inventive concept under PCT Rule 13.1 . In order for all inventions to be examined, the appropriate additional examination fees must be paid.

Group I, Claims 1-5, directed to a method of producing a non-human mammal model.

Group II, claim 15, directed to a non-human mammal model.

Group III, claim 16, directed to a lentiviral vector.

Group IV, claims 17-22, directed to a method of identifying one or more agents.

...... """"Continued in the extra sheet"*""'"""'""""''"* *****

□ As all required additional search fees were timely paid by the applicant, this international search report covers all searchable claims.

□ As all searchable claims could be searched without effort justifying additional fees, this Authority did not invite payment of additional fees.

□ As only some of the required additional search fees were timely paid by the applicant, this international search report covers only those claims for which fees were paid, specifically claims Nos.:

4. No required additional search fees were timely paid by the applicant. Consequently, this international search report is restricted to the invention first mentioned in the claims; it is covered by claims Nos.: 1-5

Remark on Protest The additional search fees were accompanied by the applicant's protest and, where applicable, the payment of a protest fee. I I The additional search fees were accompanied by the applicant's protest but the applicable protest fee was not paid within the time limit specified in the invitation. No protest accompanied the payment of additional search fees.

Form PCT/ISA/210 (continuation of first sheet (2)) (January 2015) INTERNATIONAL SEARCH REPORT International application No.

PCT/US 16/52003

Continuation of: Box No III (unity of invention is lacking)

The inventions listed as Groups l-IV do not relate to a single general inventive concept under PCT Rule 13.1 because, under PCT Rule 13.2, they lack the same or corresponding special technical features for the following reasons:

Special Technical Feature Groups l-ll and IV are related as a product (Group II) and a method of producing the product (Group I), and a method of using the product (Group IV).

Group includes the special technical feature of producing a non-human mammal comprising: a) introducing human hematopoietic stem cells (HSCs) (HSCs, shared by Groups l-ll and IV) into an immunodeficient non-human mammal (non-human mammal, shared by Groups l-IV); b) maintaining the immunodeficient non-human mammal under conditions in which the non-human mammal's human blood lineage is reconstituted by the human HSCs, not required by Groups ll-IV.

Group l-ll, IV include the special technical feature of human hematopoietic stem cells genetically engineered to express mutant human NPM1, not required by Group III.

Group III includes the special technical feature of a lentiviral vector characterized in that there is one or more of: i) deletion ofU6 promoter, and ii) deletion of anti-repressor element., not required by Groups l-ll and IV.

Group IV includes the special technical feature of identifying one or more agents comprising b) determining the toxicity or therapeutic efficacy of the agent, not required by Groups l-lll.

Common Technical Features The inventions of Groups l-IV share the technical feature of a non-human mammal that is a model for human acute myeloid leukemia; and -the Inventions of Groups l-ll and IV further share the technical feature of a non-human mammal that is a model for human NPM1c+ (Nucleophosmin mutant) acute myeloid leukemia, the non-human mammal comprising human hematopoietic stem cells genetically engineered to express mutant human NPM1, but not genetically engineered to express human FLT3-ITD (internal tandem duplications in FMS like kinase 3) (Claim 15).

However, these shared technical features do not represent a contribution over prior art as being anticipated by an article entitled 'Mutant nucleophosmin and cooperating pathways drive leukemia initiation and progression in mice' by VASSILIOU et al. (hereinafter 'Vassiliou'; Nat Genet. 201 1, Vol. 43(5), p. 470-5), or as being obvious over Vassiliou, in view of US 201 5/0007357 A 1 to MASSACHUSETTS INSTITUTE OF TECHNOLOGY (hereinafter 'ΜΙΤ') as follows:

Vassiliou discloses a non-human mammal that is a model for human acute myeloid leukemia (Abstract - 'Acute myeloid leukemia (AML) ... characterized by somatic mutations in NPM1, the gene for Nucleophosmin ... termed NPM1c... One third of mice developed delayed- onset AML ... rapid-onset AML in 80% of Npm1c+ mice'; pg 470, col 2, para 1 - 'we generated a conditional knock-in mouse model of the commonest form of NPM1c mutation, type A 1. .. the human (NPMIcA) and "humanized" mouse (NpmlcA) type A mutant proteins'; pg 474, col 1, last para - 'Npmlc are AML-initiating mutations... human NPMIci AML ).

Vassiliou further discloses a non-human mammal that is a model for human NPM1c+ (Nucleophosmin mutant) acute myeloid leukemia (Abstract; pg 470, col ?. para 1; pg 474, col 1, last para; All quotations as above), -the non-human mammal comprising hematopoietic stem cells genetically engineered to express mutant human NPM1 (Abstract - 'Acute myeloid leukemia (AML) ... characterized by somatic mutations in NPM1, the gene for Nucleophosmin ... termed NPM1c ...activation of a humanized Npmlc knock-in allele in murine hemopoietic stem cells ... One third of mice developed delayed-onset AML... Npm1c+ mice', wherein 'a humanized Npmlc knock-in allele in murine hemopoietic stem cells' is resulted from 'hematopoietic stem cells genetically engineered to express mutant human NPMV; pg 470, col 2, para 1 - 'we generated a conditional knock-in mouse model of the commonest form of NPM c mutation, type A 1. .. the human (NPMIcA) and "humanized" mouse (NpmlcA) type A mutant proteins... NpmlcA, after Cre-loxP recombination (Fig. 1b)...Npm1flox-cA/+ embryonic stem cells expressed the NpmlcA mutant mRNA and protein (Fig. 1c,d)... established the Npm1flox-cA/+ allele in mice'; pg 471, Fig 1b-d; pg 470, col 2, lower para - 'Cre-loxP recombination in >90% of bono marrow-derived hemopoietic colonies from Npm1cA/+ mice ... reflecting efficient recombination in hemopoietic stem cells (HSCs); NpmlcA protein was detectable in Npm1cA/+ hemopoietic tissues (Fig. 2a)'; pg 472, Fig 2a). Although Vassiliou does not expressively teach wherein the hematopoietic stem cells are not genetically engineered to express human FLT3-ITD (internal tandem duplications in FMS like kinase 3), this limitation is encompassed by the teaching of Vassiliou, because Vassiliou further discloses crossing the non-human mammal model for human NP 1c+ acute myeloid leukemia with non-FLT3 -ITD strains of non-human mammal to produce aggressive non-human mammal model for human NPM1c+ acute myeloid leukemia (AML) (pg 472, col 1, middle para - 'We crossed Npm1flox-cA/+, GrOnc, Mx1-Cre ... mouse lines ...to generate 125 Npm1flox-cA/+ ...GrOnc+; Mx1-Cre+... mice. All mutagenized mice developed aggressive leukemia and/or lymphoma'; pg 473, Fig 3; Abstract), and wherein a high percentage of non-human mammal model for human NPM1c+ AML showing Npm1c+ associated integrations in FLT3, which causes co-mutation of FLT3 (Abstract - 'Acute myeloid leukemia (AML).. .We identified such mutations using ... transposon, which caused rapid-onset AML in 80% of mice with Npmlc, associated with mutually exclusive integrations in...Flt3 ... in 55 of 70 leukemias'; pg 473, col 2, lower para - 'Other important CISs included Flt3 (Fig. 4f), a gene frequently co-mutated in human NPM1c+ AML'; pg 473, Fig 4f; pg 472, col 2, up para - 'We identified common insertion sites (CISs) for Npm1cA/+'), indicating 'wherein the hematopoietic stem cells are not genetically engineered to express human FLT3-ITD (internal tandem duplications in FMS like kinase 3)'. [Please also see an article entitled 'FLT3/ITD AML and the law of unintended consequences' by Levis; Blood. 201 1, Vol. 117(26), p. 6987-90: Abstract - 'Acute myeloid leukemia with a FLT3 internal tandem duplication (FLT3/ITD) mutation is an aggressive hematologic malignancy with a generally poor prognosis')...... -.o (jn e j j tne e eX(ra sneet ...... «.««*

Form PCT/ISA/210 (extra sheet) (January 201 5) INTERNATIONAL SEARCH REPORT International application No.

PCT/US 16/52003

Continuation of: The previous extra sheet - Box No III (unity of invention is lacking)

Vassiliou further discloses wherein the non-human mammal model for human NPM1c+ acute myeloid leukemia is a humanized mouse model (Abstract - 'Acute myeloid leukemia (AML) ... characterized by somatic mutations in NPM1 , the gene for Nucleophosmin ... termed NPM1c ...activation of a humanized Npmlc knock-in allele in murine hemopoietic stem cells ... One third of mice developed delayed-onset AML... Npm1c+ mice'; pg 470, col 2, para 1 - 'we generated a conditional knock-in mouse model of the commonest form of NPM1c mutation, type A1. .. the human (NPMIcA) and "humanized" mouse (NpmlcA) type A mutant proteins'). Vassiliou does not specifically teach wherein the hematopoietic stem cells are human hematopoietic stem cells (HSCs). MIT discloses a method for improving immune response of a humanized non-human mammal model that is a mouse model, the method comprising introducing human hematopoietic stem cells (HSCs) into the mouse (para [0006] - 'non-human mammal that has been engrafted with human hematopoietic stem cells (HSCs)'; para [0005] - 'immune responses of a humanized mouse model are improved by injecting human hematopoietic stem cells ... into a mouse'), wherein the human hematopoietic stem cells (HSCs) repopulate the hematopoietic system of the non-human mammal with human HSCs (para [0041] - 'HSCs (e.g., human HSCs) are self renewing stem cells that, when engrafted into a recipient, "repopulate" or "reconstitute" the hematopoietic system of the graft recipient (e.g., a non- human mammal; an immunodeficient non-human mammal) ... the human HSCs repopulate the hematopoietic system of the non-human mammal with human HSCs'; para [0006] - 'human hematopoietic stem cells (HSCs)') for facilitating determining drug toxicity when using in human (para [0035] - 'determining whether an (one or more) agent causes toxicity in a human. ... administering the agent to a non- human mammal that has been engrafted with human hematopoietic stem cells (HSCs) and administered one or more human cytokines; and determining whether the agent causes toxicity in the non-human mammal, wherein if the agent causes toxicity in the non-human mammal then the agent causes toxicity in a human'). It would have been obvious to one of ordinary skill in the art at the time the invention was made to combine the teachings of Vassiliou and MIT, to obtain a non-human mammal that is a model for human NPM1c+ (Nucleophosmin mutant) acute myeloid leukemia, the non- human mammal comprising hematopoietic stem cells genetically engineered to express mutant human NPM1, but not genetically engineered to express human FLT3-ITD, based on the teaching of Vassiliou, and further wherein the hematopoietic stem cells are human hematopoietic stem cells (HSCs), based on the combination of MIT and Vassiliou, in order to combine the methods available in the art to obtain a humanized non-human mammal model for human NPM1c+ acute myeloid leukemia for facilitating therapeutic agent screening with a desired result and without undue experimentation.

Without a shared special technical feature, the inventions lack unity with one another.

Groups I IV thcrofore lack unity under PCT Rule 3 because they do not share a same or corresponding special technical feature.

Continuation of item 4: Claims 6-14, and 23 are not drafted in accordance with the second and third sentences of Rule 6.4 (a). These claims are improper multiple dependent claims.

Note:

I) Claim 1 is objected as lacking a definition for the first appeared abbreviation "NPM1c" and "FLT3-ITD" limitations in claims. For the purposes of this ISR, the limitations "NPM1c+ " and "FL I 3-ITD" in claim 1 are rewritten as "NPM1c+ (Nucleophosmin mutant)" and "FLT3-ITD (internal tandem duplications in FMS like kinase 3)", respectively, based on the Specification (Specification: [0026] - 'mutation of Nucleophosmin (NPM1c)'; para [0004] - 'Mutant NPM1 is also referred to as NPM1c because of its predominantly cytoplasmic localization'; para [0028] - 'internal tandem duplications in FMS like kinase 3 (FLT3-ITD)').

Form PCT/ISA/210 (extra sheet) (January 2015)