1 Modulatory effect of selenium on cell-cycle regulatory genes in the
2 prostate adenocarcinoma cell line
3
4 Agnieszka Wanda Piastowska-Ciesielska1*, Małgorzata Gajewska2, Waldemar
5 Wagner3, Kamila Domińska1, Tomasz Ochędalski1
6
7 1Department of Comparative Endocrinology, Faculty of Biomedical Sciences and
8 Postgraduate Training, Medical University of Lodz, Poland
9 2Department of Physiological Sciences, Faculty of Veterinary Medicine, Warsaw University of
10 Life Sciences - SGGW, Poland.
11 3Laboratory of Cellular Immunology, Institute of Medical Biology, Polish Academy of
12 Sciences, Lodz, Poland.
13
14 * Corresponding author: Dr Agnieszka Wanda Piastowska-Ciesielska
15 Department of Comparative Endocrinology, Faculty of Biomedical Sciences and
16 Postgraduate Training, Medical University of Lodz
17 Zeligowskiego 7/9, Lodz 90-752, POLAND
19 Tel/fax +48 42 677 93 18
20
1
1 Summary
2 Epidemiological data indicate that selenium status is inversely connected with cancer
3 risk. Animal and human studies have demonstrated that most inorganic and organic
4 forms of selenium compounds have anticancer action. This work investigated the
5 impact of organic selenium on multiple signaling pathways involved in the inhibition of
6 prostate cancer cells viability. Prostate adenocarcinoma cells (PC-3) were incubated
7 with seleno-L-methionine (SeMet) at four concentrations, cell viability and apoptosis
8 was determined by the WST-1, BrdU assays and Tali image based cytometer. The
9 expression of chosen cell-cycle regulatory genes was determined by Real-time RT–
10 PCR analysis and confirmed at the protein level. SeMet treatment of PC-3 cells
11 resulted in an inhibition of cell proliferation in a dose- and time-dependent manner.
12 The inhibition of proliferation correlated with the up-regulation of gene expression
13 and the protein levels of CCNG1, CHEK1, CDKN1C and GADD45A, whereas SeMet
14 down-regulated the expression of CCNA1 and CDK6 genes. Therefore SeMet
15 inhibits the proliferative activity of prostate cancer cells by a direct influence on the
16 expression of genes involved in the regulation of cell cycle progression.
17
18 Key words: selenium; prostate; neoplasm; gene expression; cells viability
19
2
1 INTRODUCTION
2 Prostate cancer (PCa) is the second most commonly diagnosed cancer in the
3 Western countries and the second leading cause of cancer deaths in men in Poland
4 (Malvezzi et al. 2011). PCa expected mortality rates for 2011 vary between 12.6 and
5 8.1/100,000 men in Europe, reaching the highest values in Poland and the UK, and
6 the lowest in Italy (Malvezzi et al. 2011). Surgical treatment and radiation therapy are
7 successful for a local disease, but there is no effective treatment approach for
8 metastatic or refractory PCa (Wang et al. 2011). Chemotherapy can lengthen the
9 lives of men with highly advanced PCa, but it is also associated with dose restrictive
10 toxicity (Mahal et al. 2004). With advances in the understanding of molecular
11 pathways involved in prostate cancer progression, targeted therapies intended to
12 interfere with the way cancer cells grow and survive create new expectations in
13 prostate cancer therapeutics (Liu et al. 2010b). Trace mineral selenium is an
14 essential nutrient of fundamental importance to human biology (Liu et al. 2010a).
15 Some selenium compounds, when administered in supranutritional doses, produce
16 significant health benefits, such as improvement in the immune system and male
17 fertility (Mahn et al. 2009). Epidemiological data indicate that selenium status is
18 inversely connected with cancer risk, and the results of some, but not all, nutritional
19 studies show that high selenium intakes greatly reduce the risk of mammary,
20 prostate, lung, colon, and liver cancers (Zeng et al. 2009). Numerous case control
21 studies have verified a negative correlation between a low serum selenium
22 concentration and the risk of developing PCa (Nomura et al. 2000, Zhang et al. 2009,
23 Zeng et al. 2009, Brooks et al. 2001, Nomura et al. 1987).
3
1 Various in vitro studies have suggested that the possible mechanisms of the
2 antiproliferative effect of selenium formulations in PCa cells are caused by cell cycle
3 arrest and the induction of apoptosis. This work investigated the impact of organic
4 selenium on genes involved in the regulation of tumour cell proliferation.
5
6
7 MATERIALS AND METHODS
8 Cell cultures
9 The study was conducted on the PC-3 metastatic prostate adenocarcinoma cell line
10 obtained from the American Type Culture Collection (ATCC, LGC Standards,
11 Poland). The PC-3 cells are androgen-insensitive cells derived from a grade 4 human
12 prostate adenocarcinoma (Montejo et al. 2010), and are shown to posses high
13 metastatic potential (Simon et al. 2009). The cell cultures were incubated at 37°C
14 and 5% CO2 in a humidified incubator. They were maintained in an RPMI-1640 (Life
15 Technologies Corporation) with 10% fetal bovine serum (FBS) (Life Technologies
16 Corporation). The growth medium was changed three times a week and when the
17 cells reached 70% to 80% confluence, the cultures were split using 0.25% Trypsin
18 (Life Technologies Corporation).
19
20 Cell viability and cell proliferation assays
21 Cell viability was evaluated using the WST-1 (4-[3-(4-iodophenyl)-2-(4-nitrophenyl)-
22 2H-5-tetrazolio]-1,3-benzene disulfonate) assay (Roche Applied Science, Poland),
23 according to the manufactures’ instruction. WST-1 is a tetrazolium salt that is cleaved
24 to formazan by mitochondrial dehydrogenases in contact with metabolically active
4
1 cells. To test the effect of seleno-L-methionine (SeMet) (Sigma-Aldrich, Poland) on
2 cell viability, the PC-3 cells were plated in 96 well plates at a density of 1000
3 cells/well and allowed to adhere to the bottom of the wells overnight before the
4 beginning of treatment. In an initial phase of the study (data not shown), the cells
5 were exposed to increasing concentrations of SeMet for 12 to 72 h (1–200 µmol).
6 The chosen dosages of SetMet represent the levels according to the
7 recommendation of Peternac at al. (Peternac et al. 2008). SeMet was dissolved in
8 culture medium. The results of the preliminary experiment enabled us to choose four
9 concentrations of SeMet (10, 30, 50 and 100 µmol), which were used in the
10 presented study. The PC-3 cells were exposed to the increasing concentrations of
11 SeMet for 12, 24 and 36 hours. Simultaneously the viability of non-treated control
12 cells was assessed. At the end of the exposure period, the medium was replaced
13 with 100 μl of the (1:10 dilution) WST-1 in fresh medium in each well and incubated
14 for two hours. Absorbance was measured on an ELISA plate reader (BioTeck,
15 Germany) at 450 nm with reference at 655 nm. The effect of SeMet was expressed
16 as: (OD of treated cells/OD of non-treated cells)×100. IC50 (inhibition concentration
17 50%) was also calculated by plotting the log of percentage of inhibition values versus
18 the SeMet concentrations assayed (Montejo et al. 2010). The analysis was
19 performed in three independent experiments.
20 Cellular proliferation was measured using a colorimetric immunoassay based on
21 bromodeoxyuridine (BrdU) incorporation into the cellular DNA, following the
22 instructions recommended by the manufacturer (Roche Applied Science, Poland).
23 The experimental design was parallel to the experiments set for the WST-1 assay.
5
1 The cells were incubated with a BrdU labeling reagent for 4 h, followed by fixation in
2 a FixDenat solution for 30 min at room temperature. Then, the cells were incubated
3 with a 1:100 dilution of anti- BrdU-POD for 2h at room temperature. Finally, their
4 immune reaction was examined by adding the substrate solution, and the developed
5 color was measured at 450 and 650 nm in a microplate reader (BioTeck, Germany).
6 The effect of SeMet on cell proliferation was calculated as described previously (in
7 the WST-1 assay), and expressed as a percentage of cell proliferation measured in
8 the non-treated cells. The analysis was performed in three independent experiments.
9
10 Image based cytometer analysis for apoptosis determination
11 Annexin-V/propidium iodide double assay was performed using the Tali™ Apoptosis
12 kit (Life Technologies Corporation). Following treatment (as described previously),
13 cells were released from the 6 well plates with trypsin and centrifuged and the
14 supernatant was discarded. 1 × 106 cells were resuspended in 100 μL Annexin
15 binding buffer and stained with 5 μL of Annexin V Alexa Fluor® 488 according to the
16 manufacturer's instructions. 1 μL of Tali™ Propidium Iodide was added to each 100
17 μL sample and allowed to incubate with cells for 5 min at room temperature in the
18 dark. After this time 25 μL of the stained cells were loaded into a Tali™ Cellular
19 Analysis Slide and analysis using Tali™ Image Based Cytometer. The data were
20 analyzed using Tali™ data acquisition and analysis software (Life Technologies
21 Corporation).
22
23 Real-Time Reverse Transcription PCR
6
1 Total RNA was extracted from the control and SeMet-treated PC-3 cells using using
2 the Trizol® (Life Technologies Corporation). The isolated RNA samples were
3 dissolved in RNase-free water, and the RNA quantity was measured with the use of
4 NanoDrop (Thermo Fisher Scientific, USA). cDNA synthesis for Real-Time Reverse
5 Transcription PCR. Samples with an adequate amount of RNA were treated with
6 DNase I to eliminate DNA contamination, and then purified using an RNeasy
7 MiniElute Cleanup Kit (Qiagen, Poland). cDNA was synthesized from 10 µg of total
8 RNA at a volume of 100 µl using ImProm RT-IITM (Promega, Poland). Reverse
9 transcription was carried out under the following conditions: incubation at 25 °C for 5
10 min and at 42 °C for 60 min, and heating at 70 °C for 15 min. cDNA samples were
11 diluted with sterile deionized water to a total volume of 100 μl and 2 μl was added to
12 a PCR reaction.
13 Real-time RT–PCR was performed using a LightCycler (Roche Diagnostics,
14 Poland). We analyzed the relative expression level of six genes: CCNA1, CCNG1,
15 CHEK1, CDKN1C, CDK6 and GADD45A. Their expression levels were normalized to
16 GAPDH. The primers described in Table 1 were designed using Primer3 software
17 (http://frodo.wi. mit.edu/). All analyses were performed using a LightCycler FastStart
18 Master SYBR Green I kit (Roche Diagnostics, Poland).
19
20 Western blot analysis
21 We analyzed the levels of six proteins: cyclin A1 (CCNA1), cyclin G1 (CCNG1),
22 CHK1 checkpoint homolog (CHEK1), cyclin-dependent kinase inhibitor 1C
7
1 (CDKN1C), cyclin-dependent kinase 6 (CDK6), and growth arrest and DNA damage-
2 inducible alpha (GADD45A).
3 The cells were treated with SeMet for 24 or 36 hours. Next total protein extracts
4 were isolated from them using the RIPA protein extraction buffer consisting of 50 mM
5 Tris-HCl, 150 mM NaCl, 0.5% NaDoc, 0.1% NP-40, 0.1% SDS, and 2 mM EDTA,
6 supplemented with protease and phosphatase inhibitor cocktails (Sigma–Aldrich,
7 Poland). The lysates were centrifuged at 14,000 ×g and 4 °C for 20 min, and the
8 pellets were discarded. Protein concentrations were determined by the Bradford
9 method (Bio-Rad Laboratories, USA) according to the manufacturer’s protocol, using
10 bovine serum albumin as a reference protein for the standard curve. The protein
11 extracts were mixed with Laemmli buffer (bromophenol blue, 40% glycerol, 8–10%
12 SDS, 20% β-mercaptoethanol) and heated for 1 min at 100ºC. Next 30 µg protein per
13 lane was resolved by 12.5% SDS-PAGE (Bio-Rad Laboratories, Poland) and
14 transferred to PVDF membranes. Membranes were blocked with 5% non-fat
15 milk/TBST or 5% BSA/TBST for 1 hour at room temperature. After this time the
16 membranes were incubated overnight at 4 °C with an addition of selected primary
17 antibodies (Santa Cruz Biotechnology Inc., USA). The following primary antibodies
18 were used: anti-CCNG1 (sc-320), anti-CHEK1 (sc-81227), anti-CDKN1C (sc-1040),
19 anti-GADD45A (sc-797), anti-CCNA1 (sc-7252), anti-CDK6 (sc-69766), and anti-
20 GAPDH (sc-69778). After the overnight incubation, the membranes were washed
21 three times (3x15 min.) with TBST and incubated for one hour in a solution of
22 secondary antibodies conjugated with Alkaline Phosphatase (Sigma-Aldrich, Poland).
23 After incubation with secondary antibodies the membranes were washed three times
24 (3x15 minutes) in TBST buffer. The colour reaction was induced using Novex® AP
8
1 Chromogenic Substrate (BCIP⁄ NBT) (Life Technologies Corporation). Bands were
2 visualized on the membranes. Densitometric analysis of protein levels was performed
3 with ImageJ 1.34s software (Wayne Rasband, National Institutes of Health, USA.
4 http://rsb.info.nih.gov/ij/) and the results were expressed as optical density (OD). The
5 results were normalized for glyceraldehyde-3-phosphate dehydrogenase (GAPDH).
6
7 Statistical analysis
8 WST-1, BrdU and Western blot: The experimental results were shown as the mean ±
9 SEM. One-way analysis of variance (ANOVA) with Tukey´s post hoc comparisons
10 (GrafPad Prism Software) were calculated at the significance level 2α=0.05. Relative
11 expression levels of the genes were analyzed by the ΔΔCt method (LivakSchmittgen 2001).
12 An average of the gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was
13 used to obtain the ΔCt value for each gene concerned. The ΔΔCt value for each
14 gene was calculated as the difference between the ΔCt values of the treated and the
15 control groups. The fold-change for each gene was calculated by the 2–ΔΔCT
16 method.
17
18 RESULTS
19 Seleno-L-methionine inhibits cell viability and proliferation in dose- and time-
20 dependent manner
21 PC-3 cells were treated with different doses of SeMet for different time periods and
22 cell viability was assessed by the WST-1 assay. SeMet decreased cell viability in a
23 dose- and time-dependent manner. As shown in Fig. 1A, after 12 hours of incubation
9
1 the viability of PC-3 cells was significantly inhibited by 50 µmol SeMet (73%)
2 (statistically significant) and 100 µmol SeMet (64%) (statistically significant)
3 concentrations in comparison with 10 µmol SeMet (95%). After 24 h exposure of PC-
4 3 cells to the different concentrations of SeMet, further inhibition of their viability was
5 observed (Fig. 1B). A statistically significant reduction of PC-3 viability was observed
6 between cells treated with 10 µmol SeMet (97%) and 30 µmol SeMet (70%)
7 (statistically significant), and those treated with 50 µmol SeMet (52%) (statistically
8 significant) and 100 µmol SeMet (39%) (statistically significant). The next twelve
9 hours of exposure (36 h) of the prostate cancer cells to SeMet inhibited their viability
10 to 42% in the case of 50 µmol SeMet, and to 48% by 100 µmol SeMet (statistically
11 significant) when compared with the 10 and 30 µmol SeMet dosages (93%) (Fig. 1C).
12 There was no statistically significant difference between the effect of 50 and 100
13 µmol SeMet on the PC-3 cells in any of the experimental times (Fig. 1D). A significant
14 inhibitory effect of SeMet on cell viability was also observed between the 12-, 24- and
15 36-hour time periods in the case 50 and 100 µmol SeMet dosages (statistically
16 significant).
17 To determine whether the treatment of PC-3 cancer cells with SeMet induces
18 cytotoxic or cytostatic effects, we evaluated the proliferative activity of the cells after
19 12, 24 and 36 hours of incubation with 10, 30, 50 and 100 µmol SeMet (Fig. 2).
20 Exposure of the cells to SeMet for 12 h, 24 h and 36 h resulted in a reduction of their
21 proliferation in a concentration-dependent manner. The proliferation of the PC-3 cells
22 treated with 50 μmol and 100 µmol was lower than in those treated with 10 or 30
23 µmol SeMet in all the experimental time setups. Statistically significant differences
24 were observed between cells treated with 10 µmol SeMet (97%; 96%; 95%)
10
1 (statistically significant) and 50 µmol SeMet (62%; 48%; 47%) (statistically
2 significant), as well as 100 µmol SeMet (58%; 49%; 44%) (statistically significant) in
3 the 12, 24 and 36 h time setups, respectively. The 24 h treatment of the PC-3 cells
4 with SeMet resulted in statistically significant differences between 10 µmol SeMet
5 (97%) and 30 µmol SeMet (77%) (statistically significant) (Fig. 2B). Exposure for 36 h
6 resulted in statistically significant differences between 30 µmol SeMet (82%) and 50
7 µmol SeMet (47%), as well as 100 µmol SeMet (44%) (Fig. 2C) (statistically
8 significant). No statistically significant effect of SeMet on cell proliferation was
9 observed between the time setups for which different concentrations of the
10 compound were compared (Fig. 2D).
11 Effect of SeMet on apoptosis
12 We went to test whether SeMet treatment induced apoptosis in PC-3 cells, which
13 may cause the observed loss of viability. The percentages of apoptotic cells after
14 treatments with 10 μmol, 50 μmol and 100 μmol SeMet were assessed with the
15 Tali™ Apoptosis Kit – Annexin V Alexa Fluor® 488 and Propidium Iodide. Twenty-
16 four and thirty-six hours of SeMet treatment doesn’t induced apoptosis in a dose-
17 dependent manner in PC-3 cells. The percentages of total apoptotic cells after
18 twenty-four hours SeMet treatments were as follows: 0.01% (10 μmol), 0.03% (50
19 μmol) and 0.04% (100 μmol). The percentages of total apoptotic cells after thirty-six
20 hours SeMet treatments were as follows: 0.02% (10 μmol), 0.05% (50 μmol) and
21 0.05% (100 μmol). These data suggest that induction of apoptosis in PC-3 cells after
22 SeMet treatment couldn’t be a major mechanism of SeMet caused inhibition of cell
23 viability.
11
1
2 Effect of SeMet on Cell-Cycle Regulatory Genes
3 The obtained results showed that the higher concentrations of SeMet (50 µmol and
4 100 µmol) caused a significant reduction in the proliferative activity of the PC-3 cells.
5 During our study of the effect of organic selenium on prostate cancer cells, we
6 performed a microarray experiment (using Agilent 44 K Whole Human Genome Oligo
7 Microarrays) to compare the transcriptomic profiles of non-treated PC-3 cells with
8 those treated with SeMet (100 µmol, 24 h incubation) (unpublished data). The
9 microarray analysis revealed 36 differentially expressed genes between the
10 examined conditions, of which 22 were up-regulated and 14 down-regulated. Among
11 the genes showing significantly wide (fivefold) differences in expression between the
12 SeMet-treated and non-treated cells, we identified a group of genes directly involved
13 in cell cycle regulation and progression (CCNA1, CCNG1, CHEK1, CDKN1C, CDK6
14 and GADD45A). Since these results directly correlated with the observed negative
15 effect of SeMet on the proliferative activity and viability of PC-3 cells, we decided to
16 verify the expression of those genes on both, mRNA and protein levels, using real-
17 time reverse transcription PCR and Western blot analyses.
18 The effect of SeMet (100 µmol) on the mRNA expression of the CCNA1, CCNG1,
19 CHEK1, CDKN1C, CDK6 and GADD45A genes in the prostate cancer cells was
20 examined in two time setups (24 and 36 h), and the obtained results are shown in
21 Fig. 3 (A, B). SeMet altered the mRNA expression of all the genes when compared
22 with the control (non-treated) cells (statistically significant). The expression of four
23 genes involved in the cell-cycle checkpoint and arrest, namely CCNG1, CHEK1,
24 CDKN1C and GADD45A, was up-regulated, while the mRNA levels of the other two
12
1 investigated genes, CCNA1 and CDK6, were decreased by SeMet. The mRNA levels
2 of CCNG1, CHEK1, CDKN1C and GADD45A were higher after 24 h of treatment
3 than after 36h (3.8±0.2, 2.5±0.4, 2.5±0.5 and 2.6±0.4 times, and 2.8±0.2, 2.4±0.5,
4 2.5±0.4 and 2.5±0.6 times, respectively). The levels of CCNA1 and CDK6 mRNA
5 were lower –2.7±0.3 and –2.4±0.3 times after 36h of treatment compared with the
6 24h results (–2.8±0.5 and –2.5±0.3) (Fig. 3 A, B).
7 Immunoblotting assay showed that the total quantity of CHK1 checkpoint homolog
8 (CHEK1), cyclin-dependent kinase inhibitor 1C (CDKN1C), and the growth arrest and
9 DNA damage-inducible alpha (GADD45A) protein was greater in cells treated with
10 SeMet for 24h than for 36h. The total quantity of cyclin A1 (CCNA1), cyclin G1
11 (CCNG1), and cyclin-dependent kinase 6 (CDK6) protein was greater in cells treated
12 with SeMet for 36h than for 24h (Fig. 3E, F). The mean optical density (OD) values
13 for CCNG1, CHEK1, CDKN1C, GADD45A, CCNA1 αand CDK6 were normalized to
14 the OD values of GAPDH. A densitometric analysis showed that after 24h treatment
15 with SeMet the OD values for examined proteins amounted to 0.75±0.08 (CCNG1),
16 0.56±0.07 (CHEK1), 0.76±0.06 (CDKN1C), 0.69±0.05 (GADD45A), 0.32±0.06
17 (CCNA1) and 0.25±0.3 (CDK6), while the 36 h treatment resulted in the OD values of
18 0.80±0.09 (CCNG1), 0.46±0.07 (CHEK1), 0.66±0.06 (CDKN1C), 0.59±0.05
19 (GADD45A), 0.34±0.05 (CCNA1) and 0.32±0.2 (CDK6) (Fig. 3C, D). These results
20 confirmed the differences in gene expression obtained in the real time RT-PCR
21 analysis.
22
23 DISCUSSION
13
1 In the present study, we evaluated the effect of SeMet on human prostate cancer
2 cells PC-3. Here we show that the inhibition of proliferation of prostate cancer cells
3 by SeMet was associated with an up-regulation of the expression of the GADD45A,
4 CCNG1, CHEK1 and CDKN1C genes, and a down-regulation of CCNA1 and CDK6.
5 The processes of tumour growth and proliferation are thought to be basically
6 influenced by genes that control essential cellular functions. In normal cells, DNA
7 damage is recognized by such cellular mechanisms as nucleotide damage repair,
8 activation of checkpoints to arrest the cell cycle, and/or cell apoptosis, in order to
9 avoid the transmission of errors (Rajaraman et al. 2007). Programmed cell death is a
10 crucial mechanism for maintenance of cell homeostasis. During carcinogenesis,
11 there is an increased cell proliferation and development of agents’ resistance to
12 cytotoxic chemotherapeutics (Ramachandran et al. 2009). The molecular
13 mechanisms of this phenomenon are yet to be fully determined. These defects in
14 apoptotic pathways play a key role in tumorigenesis. The genes involved in cell cycle
15 control, apoptosis and DNA repair become inactivated in most cancers (Zeng et al.
16 2007). We analyzed the potential role of selenium in the induction of cell cycle arrest.
17 Our data showed that the decrease in cell proliferation in prostate cancer cells
18 treated with SeMet was dose- and time-dependent. Treatment of human prostate
19 cancer cells with 100 µmol SeMet for 24 and 36 hours up-regulated GADD45A,
20 CCNG1, CHEK1 and CDKN1C expression while decreasing CCNA1 and CDK6
21 expression. The present data show that GADD45A, CCNG1, CHEK1 and CDKN1C
22 protein levels also increased in time, while the CCNA1 and CDK6 proteins decreased
23 in a time-dependent manner after treatment with 100 µmol SeMet. These results
24 were similar to the observations reported in several others studies.
14
1 GADD45A plays an essential role in cellular response to DNA damage because it
2 is involved in DNA repair, cell cycle control, protection of genomic stability, and
3 programmed cell death (Ramachandran et al. 2007, Zerbini et al. 2004). GADD45A
4 blocks G2-M transition, thereby causing cell cycle arrest in response to DNA-
5 damaging agents. The role of GADD45A in G2-M catch is shown by its ability to
6 cooperate with Cdc2 kinase resulting in the inhibition of Cdc2/cyclin B1 complex
7 formation, which is necessary for G2-M switch during cell cycle progression.
8 Inhibition of growth by GADD45A is independent of p53 (Ramachandran et al. 2009).
9 As shown by Takekawa and Saito, GADD45A expression is critical for c-jun NH2-
10 terminal kinase activation and apoptosis in tumour cells (TakekawaSaito 1998).
11 Ramachandran et al. reported in their study that GADD45A was down-regulated in
12 prostate cancer compared with benign prostate tissues (Ramachandran et al. 2009).
13 In our observations, SeMet increased the expression of GADD45A at the mRNA and
14 protein levels. Dong et al. found that the expression of GADD153 (which also plays
15 an essential role in cell control and apoptosis) increased 8 times in premalignant
16 human breast cells after selenium treatment (Dong et al. 2003). They also observed
17 an effect of 6–14-fold induction in PC-3 cells. Li and colleagues showed that
18 treatment of cells with Taxotere anticancer agent derived from the needles of Taxus
19 baccata up-regulated GADD45A expression, resulting in the induction of apoptosis
20 (Li et al. 2004).
21 Another important element of cell cycle control is cyclins. Cyclin G1 has been
22 shown to play an important role in various biological processes together with
23 apoptosis (Kimura et al. 2001). This cyclin is one of the target genes of the
15
1 transcription factor p53 and is associated with cyclin-dependent kinase 5 (Cdk5) and
2 non-Cdk-serine/threonine kinase (GAK). In addition, because of its over-expression
3 in human tumour cells, it has been suggested that cyclin G1 acts as an oncogenic
4 protein (Seo et al. 2008, KimuraNojima 2002). However, the functional
5 consequences of cyclin G1 are still a subject of debate. For example, the
6 transcription of cyclin G1 is induced within a few hours of growth factor stimulation of
7 quiescent cells (Seo et al. 2008). In addition, retroviral vector-mediated gene
8 transfection of antisense cyclin G1 inhibits proliferation of human osteogenic
9 sarcoma cells, which suggests that this cyclin plays a key role in mammalian cell
10 growth regulation. On the other hand, Okamoto and Jensen suggest that cyclin G1
11 has a growth-inhibitory effect (OkamotoPrives 1999, Jensen et al. 1998). Seo at al.
12 conclude that a low level of cyclin G1 results in a lack of growth-inhibitory activity and
13 may even promote growth, whereas high levels of cyclin G1 suppress growth activity
14 (Seo et al. 2008). In our study the up-regulation of cyclin G1 could affect cell growth
15 inhibition. Cyclin A1 is another member of the cyclin family which is a cell-cycle
16 regulatory factor. It has been demonstrated to be required for the G2/M phase
17 transition in a meiotic division of cells by gene targeting, and it contributes to the
18 G1/S cell cycle progression in cell lines (Wegiel et al. 2008). A mammalian cyclin A1
19 is only expressed in several normal tissues including the testis, hematopoietic cells,
20 and the brain. In male germ cells, cyclin A1 is absolutely required for the meiotic
21 division (Wegiel et al. 2005). Elevated levels of cyclin A1 expression have been
22 detected and shown to be associated with the formation and progression of male
23 germ cell tumours (CGTs) (Wegiel et al. 2005). Increasing levels of cyclin A1
24 expression have been observed in various types of solid tumours, including
16
1 testicular, ovarian, and breast ones (Rivera et al. 2006, Schrader et al. 2002). Rivera,
2 Muller-Tidow and Schrader suggested that cyclin A1 had a cell-cycle-independent
3 function in carcinogenesis (Muller-Tidow et al. 2003, Schrader et al. 2002, Rivera et
4 al. 2006). The homeo-protein Six1 is functionally connected with cyclin A1 in breast
5 cancer cell lines, and interactions between Six1 and cyclin A1 are needed to promote
6 tumorigenic activity in breast cancer cells. Wegiel et al. showed that cyclin A1 was
7 highly expressed in advanced prostate cancer and its expression was associated
8 with tumour histology and VEGF expression (Wegiel et al. 2005). However, the
9 precise role of cyclin A1 in the pathogenesis of primary and metastatic prostate
10 cancer is largely unknown (Wegiel et al. 2008). Our results showed that SeMet
11 decreased the expression of this cyclin at the transcription as well as protein levels.
12 Dong et al. proposed a number of possible signalling pathways that might mediate
13 the outcome of cell cycle blockage by selenium (Dong et al. 2003). Selenium
14 treatment increases the expression of p21WAF1, which has dual functions in
15 regulating the activity of CDK/cyclin complexes. The results of our study revealed
16 that selenium caused a reduction in the expression of cdk6 cyclin-dependent kinase.
17 Although p21WAF1 is a potent inhibitor of cyclin E/A-dependent CDK1/2, it promotes
18 the assembly and nuclear translocation of cyclin D-CDK4/6 complexes, leading to an
19 increase in cyclin D-associated kinase activity. The down-regulation of CDK1, CDK2
20 and cyclin A by selenium has an amplified effect on this cascade of actions.
21 Complete phosphorylation/inactivation of pRB requires sequential actions of cyclin D-
22 CDK4/6 and cyclin E-CDK2 (Dong et al. 2003).
23 CDKN1C, a candidate tumour suppressor gene, has been implicated in the
17
1 modulation of cell cycle control, differentiation, apoptosis, and tumorigenesis. Zeng et
2 al. have shown that the mRNA level of cyclin-dependent kinase inhibitor p57KIP2
3 was 5.7 times higher than that of the control after the SeMet and METase treatment
4 (Zeng et al. 2009). These authors noted that the over-expression of CDKN1C in
5 prostate cancer cells significantly suppressed cell proliferation and arrested the cell
6 cycle at the G0-G1 stage by affecting the retinoblastoma protein pathway through
7 CDK4/cyclin D1 and CDK2 complexes (Zeng et al. 2009). This is consistent with the
8 finding that selenium inhibited cell growth and induced G1 cell arrest in HT1080 cells
9 (Zeng et al. 2006, Zeng et al. 2009). Also our observation could confirm these
10 findings.
11 In conclusion, the results of our study show that selenium exerts an inhibitory
12 effect on the proliferative activity of prostate cancer cells, having a direct influence on
13 the expression of genes responsible for cell cycle regulation and progression. This
14 observation indicates that selenium compounds may be considered potential
15 therapeutic agents that could find application in future cancer treatment. However,
16 the exact mechanisms of selenium action and the signalling pathways affected by
17 this microelement have first to be determined to estimate potential therapeutic doses
18 that would not be toxic to normal cells.
19
20 ACKNOWLEDGEMENTS
21 Authors have no conflict of interest to declare. This work was supported by the
22 Ministry of Science and Higher Education grant N404 1077 33 and the Medical
23 University of Lodz grant 502-03/0-078-04/502-04-008. We would like to thank Mr.
24 Rafał Kacprzak and Mr. Daniel Kacprzak for their support.
18
1 REFERENCE 2 3 Brooks JD, Metter EJ, Chan DW, Sokoll LJ, Landis P, Nelson WG, Muller D, Andres 4 R, Carter HB. Plasma selenium level before diagnosis and the risk of prostate 5 cancer development. J Urol 166: 2034-2038, 2001.
6 Dong Y, Zhang H, Hawthorn L, Ganther HE, Ip C. Delineation of the molecular basis 7 for selenium-induced growth arrest in human prostate cancer cells by 8 oligonucleotide array. Cancer Res 63: 52-59, 2003.
9 Jensen MR, Factor VM, Thorgeirsson SS. Regulation of cyclin G1 during murine 10 hepatic regeneration following Dipin-induced DNA damage. Hepatology 28: 537- 11 546, 1998.
12 Kimura SH, Nojima H. Cyclin G1 associates with MDM2 and regulates accumulation 13 and degradation of p53 protein. Genes Cells 7: 869-880, 2002.
14 Kimura SH, Ikawa M, Ito A, Okabe M, Nojima H. Cyclin G1 is involved in G2/M arrest 15 in response to DNA damage and in growth control after damage recovery. 16 Oncogene 20: 3290-3300, 2001.
17 Li Y, Li X, Hussain M, Sarkar FH. Regulation of microtubule, apoptosis, and cell 18 cycle-related genes by taxotere in prostate cancer cells analyzed by microarray. 19 Neoplasia 6: 158-167, 2004.
20 Liu H, Lu Q, Huang K. Selenium suppressed hydrogen peroxide-induced vascular 21 smooth muscle cells calcification through inhibiting oxidative stress and ERK 22 activation. J Cell Biochem 111: 1556-1564, 2010a.
23 Liu X, Gao R, Dong Y, Gao L, Zhao Y, Zhao L, Zhao X, Zhang H. Survivin gene 24 silencing sensitizes prostate cancer cells to selenium growth inhibition. BMC 25 Cancer 10: 418-432, 2010b.
26 Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time 27 quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25: 402-408, 28 2001.
29 Mahal K, Hernandez J, Basler JW, Thompson IM. What's new in the field of prostate 30 cancer chemoprevention? Curr Oncol Rep 6: 237-242, 2004.
31 Mahn AV, Toledo HM, Ruz MH. Organic and inorganic selenium compounds produce 32 different protein patterns in the blood plasma of rats. Biol Res 42: 163-173, 2009.
33 Malvezzi M, Arfe A, Bertuccio P, Levi F, La VC, Negri E. European cancer mortality 34 predictions for the year 2011. Ann Oncol 22: 947-956, 2011.
19
1 Montejo C, Barcia E, Negro S, Fernandez-Carballido A. Effective antiproliferative 2 effect of meloxicam on prostate cancer cells: development of a new controlled 3 release system. Int J Pharm 387: 223-229, 2010.
4 Muller-Tidow C, Diederichs S, Schrader MG, Vogt U, Miller K, Berdel WE, Serve H. 5 Cyclin A1 is highly expressed in aggressive testicular germ cell tumors. Cancer 6 Lett 190: 89-95, 2003.
7 Nomura A, Heilbrun LK, Morris JS, Stemmermann GN. Serum selenium and the risk 8 of cancer, by specific sites: case-control analysis of prospective data. J Natl 9 Cancer Inst 79: 103-108, 1987.
10 Nomura AM, Lee J, Stemmermann GN, Combs GF, Jr. Serum selenium and 11 subsequent risk of prostate cancer. Cancer Epidemiol Biomarkers Prev 9: 883- 12 887, 2000.
13 Okamoto K, Prives C. A role of cyclin G in the process of apoptosis. Oncogene 18: 14 4606-4615, 1999.
15 Peternac D, Klima I, Cecchini MG, Schwaninger R, Studer UE, Thalmann GN. 16 Agents used for chemoprevention of prostate cancer may influence PSA secretion 17 independently of cell growth in the LNCaP model of human prostate cancer 18 progression. Prostate 68: 1307-1318, 2008.
19 Rajaraman P, Wang SS, Rothman N, Brown MM, Black PM, Fine HA, Loeffler JS, 20 Selker RG, Shapiro WR, Chanock SJ, Inskip PD. Polymorphisms in apoptosis and 21 cell cycle control genes and risk of brain tumors in adults. Cancer Epidemiol 22 Biomarkers Prev 16: 1655-1661, 2007.
23 Ramachandran K, Navarro L, Gordian E, Das PM, Singal R. Methylation-mediated 24 silencing of genes is not altered by selenium treatment of prostate cancer cells. 25 Anticancer Res 27: 921-925, 2007.
26 Ramachandran K, Gopisetty G, Gordian E, Navarro L, Hader C, Reis IM, Schulz WA, 27 Singal R. Methylation-mediated repression of GADD45alpha in prostate cancer 28 and its role as a potential therapeutic target. Cancer Res 69: 1527-1535, 2009.
29 Rivera A, Mavila A, Bayless KJ, Davis GE, Maxwell SA. Cyclin A1 is a p53-induced 30 gene that mediates apoptosis, G2/M arrest, and mitotic catastrophe in renal, 31 ovarian, and lung carcinoma cells. Cell Mol Life Sci 63: 1425-1439, 2006.
32 Schrader M, Muller-Tidow C, Ravnik S, Muller M, Schulze W, Diederichs S, Serve H, 33 Miller K. Cyclin A1 and gametogenesis in fertile and infertile patients: a potential 34 new molecular diagnostic marker. Hum Reprod 17: 2338-2343, 2002.
35 Seo HR, Kim J, Bae S, Soh JW, Lee YS. Cdk5-mediated phosphorylation of c-Myc 36 on Ser-62 is essential in transcriptional activation of cyclin B1 by cyclin G1. J Biol 37 Chem 283: 15601-15610, 2008.
20
1 Simon DP, Vadakkadath MS, Wilson AC, Gallego MJ, Weinecke SL, Bruce E, Lyons 2 PF, Haasl RJ, Bowen RL, Atwood CS. Activin receptor signaling regulates 3 prostatic epithelial cell adhesion and viability. Neoplasia 11: 365-376, 2009.
4 Takekawa M, Saito H. A family of stress-inducible GADD45-like proteins mediate 5 activation of the stress-responsive MTK1/MEKK4 MAPKKK. Cell 95: 521-530, 6 1998.
7 Wang Q, Diao X, Sun J, Chen Z. Regulation of VEGF, MMP-9, and metastasis by 8 CXCR4 in a prostate cancer cell line. Cell Biol Int 35: 897-904, 2011.
9 Wegiel B, Bjartell A, Ekberg J, Gadaleanu V, Brunhoff C, Persson JL. A role for cyclin 10 A1 in mediating the autocrine expression of vascular endothelial growth factor in 11 prostate cancer. Oncogene 24: 6385-6393, 2005.
12 Wegiel B, Bjartell A, Tuomela J, Dizeyi N, Tinzl M, Helczynski L, Nilsson E, Otterbein 13 LE, Harkonen P, Persson JL. Multiple cellular mechanisms related to cyclin A1 in 14 prostate cancer invasion and metastasis. J Natl Cancer Inst 100: 1022-1036, 15 2008.
16 Zeng H, Briske-Anderson M, Idso JP, Hunt CD. The selenium metabolite 17 methylselenol inhibits the migration and invasion potential of HT1080 tumor cells. 18 J Nutr 136: 1528-1532, 2006.
19 Zeng H, Wu M, Botnen JH. Methylselenol, a selenium metabolite, induces cell cycle 20 arrest in G1 phase and apoptosis via the extracellular-regulated kinase 1/2 21 pathway and other cancer signaling genes. J Nutr 139: 1613-1618, 2009.
22 Zeng X, Liao AJ, Tang HL, Yi L, Xie N, Su Q. [Screening human gastric carcinoma- 23 associated antigens by serologic proteome analysis]. Ai Zheng 26: 1080-1084, 24 2007.
25 Zerbini LF, Wang Y, Czibere A, Correa RG, Cho JY, Ijiri K, Wei W, Joseph M, Gu X, 26 Grall F, Goldring MB, Zhou JR, Libermann TA. NF-kappa B-mediated repression 27 of growth arrest- and DNA-damage-inducible proteins 45alpha and gamma is 28 essential for cancer cell survival. Proc Natl Acad Sci U S A 101: 13618-13623, 29 2004.
30 Zhang Y, Coogan P, Palmer JR, Strom BL, Rosenberg L. Vitamin and mineral use 31 and risk of prostate cancer: the case-control surveillance study. Cancer Causes 32 Control 20: 691-698, 2009.
21
1 Table 1 List of primer sequences used in the study Product Gene Description Primer sequences (5’→3’) size (bp) AAGCAATGCACTGCAGCAAC CCNA1 Cyclin A1 150 ACTGCCCATTTGCAGTTAGC AGCTGAATGCCCTGTTGGAA CCNG1 Cyclin G1 102 TTGCAGTCATTCTGAGGCCA CHK1 checkpoint CAGAGGGGCAGGACACGGGA CHEK1 83 homolog (S. pombe) ACTTGAGGGCGTCACGCTGC Cyclin-dependent ATGCCAAAGGCACTCTCCAT CDKN1C kinase inhibitor 1C 141 AAAGCGCGAAGAGACTGCAA (p57, Kip2) Cyclin-dependent TTTCTGCCACACACTGCCTT CDK6 128 kinase 6 AAACAGGTGGTGCATGGGAA Growth arrest and DNA ATCCTGCGCGTCAGCAACCC GADD45A damage inducible, 118 TCACCAGCACGCAGTGCAGG alpha Glyceraldehyde-3- ACAGTCAGCCGCATCTTCTT GAPDH phosphate 91 ACCAAATCCGTTGACTCCGA dehydrogenase ACCAACTGGGACGACATGGAGAAA ACTB b-actin 192 TAGCACAGCCTGGATAGCAACGTA
22
1 2 Fig. 1. Effect of SeMet at concentrations of 10–100 µmol on the viability of PC-3 prostate 3 cancer cells during 12 h (A), 24 h (B) and 36 h (C), measured by WST-1 assay. D: 4 Compared diagram of changes in cell viability in all the time setups. Data represent the mean 5 values of three independent experiments ± SEM. * Statistically significant as compared with 6 the control. 7
23
1 2 Fig. 2. Effect of SeMet at concentrations of 10–100 µmol on PC-3 prostate cancer cells 3 proliferation during 12 h (A), 24 h (B) and 36 h (C), measured by BrdU assay. D: Compared 4 diagram of changes in cell viability in all the time setups. Data represent the mean values of 5 three independent experiments ± SEM. * Statistically significant as compared with the 6 control. 7
24
1 2 Fig. 3. SeMet effect on gene/protein expression. (A, B) Real-time RT–PCR bars represent 3 fold change between non-treated PC-3 cell and those after 24 h (A) and 36 h (B) of 4 incubation with 100 µmol SeMet. (C, D, E, F) Western blot analysis of the levels of chosen 5 proteins isolated from the PC-3 cells treated with 100 µmol SeMet for 24 h and 36 h. GAPDH 6 was used as a loading control. (C, D) Graphs representing the results of densitometric 7 analysis of the optical density of the bands obtained corresponding to protein levels observed 8 after 24 h (C) and 36 h (D) incubation with 100µmol SeMet. Data represent the mean values 9 of the ratio of non-treated to 24 h- and 36 h-treated cells from three independent experiments 10 ± SEM. (E,F) Western blot images of the analysed proteins: CCNG1, CHEK1, CDKN1C, 11 GADD45A, CCNA1 and CDK6, in the control (–) and SeMet-treated (+) PC-3 cells after 24 h 12 and 36 h incubation.
25