Identification of PP2A Complexes and Pathways Involved in Cell Transformation

Cancer Tumor and Stem Cell Biology Research

Anna A. Sablina1,2, Melissa Hector1, Nathalie Colpaert2, and William C. Hahn1,3

Abstract The simian virus 40 small t (SV40ST) oncoprotein interacts with protein phosphatase 2A (PP2A), an abundantly expressed family of serine–threonine phosphatases. This interaction is essential for the transformation of human cells by SV40, and several PP2A subunits have been implicated as tumor suppressor genes. However, the pathways controlled by specific PP2A complexes involved in cell transformation remain incompletely understood. Using a comprehensive loss-of-function approach, we identified 4 PP2A regulatory subunits [B56a, B56g, PR72/PR130, and PTPA (protein phosphatase 2A activator)], which when suppressed replaced the expression of SV40ST in human cell transformation. We found that manipulation of complexes containing PP2A B56a, B56g, and PR72/PR130 activates the pathways regulated by c-Myc, Wnt, and PI3K (phosphoinositide 3-kinase)/Akt in a manner that depends on their specific phosphatase activity. In contrast, suppression of PTPA disrupts the assembly of PP2A heterotrimeric complexes, which leads to the activation of these same oncogenic pathways. These observations delineate the PP2A family members and pathways perturbed by SV40ST during human cell transformation. Cancer Res; 70(24); 10474–84. 2010 AACR.

Introduction cells (2, 3). The SV40 ER encodes 2 oncoproteins, the SV40 large T (SV40LT) and small t (SV40ST) antigens. SV40LT binds The aberrant activation of cellular signaling cascades con- and inactivates the tumor suppressor proteins retinoblastoma tributes directly to human diseases. In particular, mutations and p53 (reviewed in ref. 3). that lead to constitutively active kinases are well-character- SV40ST binds to and inhibits the activity of the serine– ized drivers of cancer development, and small molecule kinase threonine protein phosphatase 2A (PP2A) family (4, 5). Spe- inhibitors are now used as primary therapy for particular cifically, SV40ST mutants harboring amino acid substitutions cancers (1). Moreover, inactivating mutations in phosphatases that ablate the ability of SV40ST to bind PP2A also eliminate such as SHP2 contribute directly to malignant transformation. the ability of such mutants to transform rat and human cells Although it is clear that phosphatases antagonize the action of (4, 6). Conversely, an SV40ST mutant that contains only the kinases, the role of phosphatases in most human cancers PP2A-inactivation domain retains the ability to induce trans- remains undefined. formation (4). The study of transformation in human cell culture models PP2A is also a major cellular binding partner for several has facilitated the identification of pathways related to cancer other viral oncoproteins such as polyoma small and middle t development. We previously showed that expression of the antigens and the adenoviral E4orf4 protein (reviewed in ref. 7), telomerase catalytic subunit (hTERT), the simian virus 40 suggesting that like other targets of viral oncoproteins, PP2A early region (SV40 ER), and an oncogenic allele of H-RAS plays a important role in tumor suppression. Indeed, inacti- confers a tumorigenic phenotype to several types of human vating alterations of PP2A subunits have been found in human cancers (8–11), and suppression of these same PP2A components contributes to cell transformation (12, 13). PP2A accounts for the majority of serine–threonine phos- 1 Authors' Affiliations: Department of Medical Oncology, Dana-Farber Cancer phatase activity in mammalian cells and has been implicated Institute, Department of Medicine, Brigham and Women's Hospital and Harvard Medical School, Boston, Massachusetts; 2VIB Institute, Center of Human in the regulation of a wide diversity of signaling pathways Genetics, KULeuven, Leuven, Belgium; and 3Broad Institute of Harvard and (reviewed in ref. 7). It refers to a family of phosphatases that MIT, Cambridge, Massachusetts contain a common catalytic C subunit, whose activity is Note: Supplementary data for this article are available at Cancer Research regulated by a diverse set of regulatory proteins. PP2A com- Online (http://cancerres.aacrjournals.org/). plexes usually contain an active core dimer composed of a Corresponding Author: William C. Hahn, Dana-Farber Cancer Institute, catalytic C subunit (PP2A C/PPP2 C) and a scaffolding A 44 Binney Street, Dana 1538, Boston, MA 02115. Phone: 617-632-2641. E-mail: [email protected]; or Anna A. Sablina, CME Depart- subunit (PR65/PPP2R1). In mammals, 2 distinct genes encode ment, KULeuven, O&N I Herestraat 49, Bus 602, Leuven, Belgium 3000. closely related versions of both the A and C subunits of PP2A. Phone: 321-633-0790. E-mail: [email protected] The AC dimer recruits a third regulatory B subunit that doi: 10.1158/0008-5472.CAN-10-2855 dictates the substrate specificity and localization of the

10474 Cancer Res; 70(24) December 15, 2010

Table 1. Suppression of PP2A subunits by shRNA

Hairpin Gene Official name Gene ID Targeted sequence Suppression,%

PPP2CA-1 PP2A Ca PPP2CA NM_002715 TGGAACTTGACGATACTCTAA 88 8 PPP2CA-2 PP2A Ca PPP2CA NM_002715 CACACAAGTTTATGGTTTCTA 44 4 PPP2CA-3 PP2A Ca PPP2CA NM_002715 GAGGGATATAACTGGTGCCAT 15 3 PPP2CB-1 PP2A Cb PPP2CB NM_004156 TGTCTGCGAAAGTATGGGAAT 62 5 PPP2CB-3 PP2A Cb PPP2CB NM_004156 AGGTTCTTCTTGGGAGTATGT 81 7 PPP2R2A-1 B55a PPP2R2A NM_002717 GTAGATGATGATGTAGCAGAA 85 8 PPP2R2A-2 B55a PPP2R2A NM_002717 GCAAGTGGCAAGCGAAAGAAA 89 6 PPP2R2D-1 B55d PPP2R2D NM_018461 GTCCTTCTTCTCAGAAATAAT 88 6 PPP2R2D-2 B55d PPP2R2D NM_018461 GCTCTGCTCTCTCTATGAGAA 69 4 PPP2R5A-1 B56a PPP2R5A NM_006243 CAGAGTGGTAACAGATGGGTA 62 5 PPP2R5A-2 B56a PPP2R5A NM_006243 GCTAACATCTTCCGTACACTT 73 6 PPP2R5B-1 B56b PPP2R5B NM_006244 GTTCACAGTAATCATGGTCTA 67 5 PPP2R5B-2 B56b PPP2R5B NM_006244 CCGCATGATCTCAGTGAATAT 80 6 PPP2R5C-1 B56g PPP2R5C NM_002719 CCAGAAGTAGTCCATATGTTT 86 5 PPP2R5C-2 B56g PPP2R5C NM_002719 TCCAGAAGTTACGTCAGTGTT 70 6 PPP2R5D-1 B56d PPP2R5D NM_006245 GAGTTCTTCTTACGTTTCCTT 96 5 PPP2R5D-2 B56d PPP2R5D NM_006245 TGCACTCTACAGGAACTCCAA 82 6 PPP2R5E-1 B56e PPP2R5E NM_006246 CCTCCTAGTGACAGCAATGAA 91 5 PPP2R5E-2 B56e PPP2R5E NM_006246 CCTCTGGATAACTTGACTGTA 82 5 PPP2R3B-1 PR48 PPP2R3B NM_013239 CGAGCATTTCTACGTCATCTA 53 4 PPP2R3B-2 PR48 PPP2R3B NM_013239 CGTCCACAAGTTCGTCGCCAT 50 5 PPP2R3A-1 PR72/130 PPP2R3A NM_002718 CCACACCTTCACACATGGAAT 51 5 PPP2R3A-2 PR72/130 PPP2R3A NM_002718 GCAGGATTATTGAAAGGATAT 61 5 STRN3-1 PR93 STRN3 NM_014574 CCTGTTACAATAACTGCTCAT 67 4 STRN3-2 PR93 STRN3 NM_014574 GCTGGCACTTTAGTTGGTCAT 87 5 STRN-1 PR110 STRN NM_014574 GCGGTGAAGATCGAGATACAA 63 6 STRN-2 PR110 STRN NM_014574 GCAAGGGATATACAAGCATTT 84 5 PTPA-1 PR53 PPP2R4 NM_178001 CCGTTTGATGAGAGGCTGTTT 92 5 PTPA-2 PR53 PPP2R4 NM_178001 GATCCACACAGTTCCAGACAT 84 7

NOTE: Suppression levels of subunits were analyzed using qRT-PCR as described in the Material and Methods section. Data shown as mean SD of 3 independent experiments.

PP2A heterotrimeric complex. Four unrelated families of B showed that suppression of the PP2A B56g subunit could subunits have identified to date: B/B55/PR55/PPP2R2, B0/B56/ partially replace SV40ST and induce cell transformation (17). PR61/PPP2R5, B/PR72/PPP2R3, and Striatin (14). At least 100 However, the degree of cell transformation induced by PP2A different PP2A heterotrimeric complexes are formed through B56g suppression was quantitatively less than what we combinatorial association of these subunits, and several lines observed when we expressed SV40ST, suggesting that other of evidence suggest that particular PP2A holoenzyme com- PP2A subunits are involved in malignant transformation. Here plexes mediate specific physiologic functions. we created and used a short hairpin RNA (shRNA) library The phosphotyrosine phosphatase (PTPase) activator targeting all known PP2A subunits to identify those subunits (PTPA/PPP2R4) was initially described as a B regulatory that are involved in human cell transformation. subunit because of its ability to interact with the AC dimer. However, unlike other B subunits, which recruit the core Materials and Methods enzyme to targeted PP2A substrates, PTPA may function as a chaperone that facilitates incorporation of divalent cations Plasmids, cell lines, infections to the PP2A active site (15). pWZL-Blast c-MycT58A was the gift of Dr. Rosalie Sears The diversity of PP2A complexes suggests that dysfunction (Oregon Health and Sciences University). pBABE-puro b-cate- of several distinct PP2A complexes may affect specific path- ninS33Y, pBabe-hygro dominant-negative TCF (dnTCF), and ways and, in turn, contribute independently to transforma- pBabe-GFP myr-Akt (mAkt) have been described (18, 19). The tion. In consonance with this idea, recent structural studies pLKO.1-puro shGFP and pLKO.1-puro vectors containing revealed that SV40ST competes for the binding site on AC shRNAs targeting specific PP2A subunits (Table 1) were dimer with multiple regulatory B subunits (16). We previously provided by the RNAi Consortium (20).

www.aacrjournals.org Cancer Res; 70(24) December 15, 2010 10475

Cells were cultured in minimal Eagle medium alpha sup- cells were injected subcutaneously into female BALB/ plemented with 10% heat-inactivated fetal calf serum (IFS). All AnNTac-Foxn1nu/nu immunodeficient mice (2). The number transfections were conducted using Fugene 6 (Roche), and of tumors formed was determined 40 days after injection. retroviral and lentiviral infections were carried out as described (20). To generate stable cell lines, cells were selected Proliferation assays using 2 mg/mL of puromycin for 3 days and 15 mg/mL of A total of 1 104 cells were plated in triplicate. The number blastocidin for 10 days, or sorted using BD FACSAria cell of viable cells was determined using a Z2 particle count and sorter. size analyzer (Beckman-Coulter). For population doubling determinations, a seeding density of 1 104 cells in a 10- Immunoblotting and immunoprecipitation cm plate was used, and triplicate plates were counted every 4 Cells were suspended in a lysis buffer [50 mmol/L Tris–HCl, days. pH 7.5, 150 mmol/L NaCl, 1 mmol/L EDTA, protease inhibitor cocktail (Roche), and 0.5% NP-40] and cleared of insoluble Results material by centrifugation. Soluble proteins (100 mg) were subjected to SDS-PAGE followed by immunoblotting. Identification of PP2A complexes involved in control of For immunoprecipitation, cells were lysed in a buffer con- cell transformation taining 50 mmol/L Tris-HCl, pH 7.5, 150 mmol/L NaCl, We and others previously found that SV40ST cooperates 1mmol/L EDTA, protease inhibitor cocktail, and 0.3% CHAPS. with SV40LT, hTERT, and H-Ras-V12 to transform a wide Cell lysates (2 mg) were incubated with a PP2A C (BD range of human cells (reviewed in ref. 3). The effect of SV40ST Biosciences) antibody overnight at 4C, followed by the addi- on cell transformation was only partially recapitulated by tion of protein G Sepharose beads (Roche) overnight at 4C. suppression of PP2A regulatory subunit B56g, suggesting that The beads were washed 3 times with lysis buffer and eluted other PP2A regulatory subunits might also be involved in with 2 SDS sample buffer, followed by SDS-PAGE and control of cell transformation. To determine whether other immunoblotting. PP2A complexes are involved in cell transformation induced The antibodies used included PP2A Aa (6F9) (Covance), by SV40ST, we assessed the consequences of suppressing the PP2A C (BD Biosciences) and methyl-PP2A C (2A10; Santa PP2A catalytic subunits Ca and Cb in immortal, nontumori- Cruz Biotech), B56b (Santa Cruz Biotech), PR93 (S68; Cell genic HEK cells expressing SV40LT, hTERT, and H-Ras-V12 Signaling), FLAG (M2; Sigma-Aldrich), b-actin (Sigma- (HEK TER cells). By using several different shRNAs targeting Aldrich), HA (12C5; Boehringer Mannheim), active b-catenin PP2A Ca or Cb subunits, we generated stable cell lines (8E7) and total b-catenin (5H10; Millipore), polyclonal phos- expressing a range of expression of the Ca or Cb proteins. pho-Akt (Ser473) and Akt1 (Cell Signaling), c-Myc (D84C12), Suppression of the less abundant Cb subunit by 50% to 80% and XP rabbit mAb (Cell Signaling). Affinity-purified polyclo- failed to change the proliferation rate of HEK TER cells and did nal antibodies were raised against B55a, B56g, and SV40ST not affect their ability to grow in anchorage-independent (AI) peptides as described (17). manner and to form tumors in immunodeficient mice (Fig. 1A; Supplementary Fig. 1). This observation suggests that inhibi- Quantitative RT-PCR tion of PP2A Cb-specific complexes do not contribute to For RT-PCR, total RNA was isolated using RNeasy (Qiagen) transformation in this assay. and cDNA synthesis was done using the Advantage RT-PCR kit In contrast, HEK TER cells expressing very low levels of Ca (Clontech). A list of primers used for quantitative RT-PCR proliferated poorly (Supplementary Fig. 1) and failed to grow (qRT-PCR) is presented in Supplementary Figure 2. Real-time in an AI manner or to form tumors in immunodeficient hosts PCR reactions were conducted in an ABI Prism 7700 sequence (Fig. 1A). This phenotype is consistent with prior reports that detection system (Applied Biosystems), using SYBR green PCR showed that deletion of Ca expression in yeast or mammalian master mix (Applied Biosystems). cells leads to apoptosis (21, 22). However, HEK TER cells in which we partially suppressed PP2A Ca (50%) exhibited the Luciferase assays ability to form AI colonies and to form tumors similar to that Luciferase assays were done using the Dual luciferase observed after the introduction of SV40ST (Fig. 1A). These system (Promega). One hundred nanograms of TOP-Glow observations are consistent with notion that inhibition of or FOP-Glow luciferase vector was transfected in the presence PP2A by SV40ST is necessary for SV40ER-mediated cell trans- of 5 ng of CMV–Wnt1 and 20 ng of CMV–Renilla, or 100 ng of formation (17). We noted that HEK TER cells in which PP2A pGL2–E2F2 was co-transfected with 20 ng of CMV–Renilla. Ca was suppressed to 20% of wild-type levels showed an The firefly luciferase activity was normalized to the Renilla intermediate-transforming phenotype. The correlation luciferase activity. between levels of PP2A suppression and the transforming phenotypes suggests that other PP2A complexes in addition to Anchorage-independent growth and tumor formation PP2A B56g-specific complexes contribute independently to For soft agar assays, 105 cells were plated in triplicate into cell transformation. 0.4% Noble agar supplemented with 10% IFS. Four weeks after To identify PP2A regulatory B subunits in addition to B56g seeding, colonies were visualized and counted under micro- that are involved in cell transformation, we conducted a loss- scope (magnification 10). For tumorigenicity assays, 2 106 of-function screen by using lentivirally delivered shRNAs

10476 Cancer Res; 70(24) December 15, 2010 Cancer Research

A 250 HEK TER

200

150

100

Colony number 50

0 shGFP SV40ST shCα-1 shCα-2 shCα-3 shCβ-1 shCβ-2 Figure 1. shRNA screen to identify Suppression 0 0 88% 44% 15% 62% 81% PP2A subunits involved in cell Tumors 0/9 6/6 0/6 7/9 2/9 0/0 0/0 transformation. A, AI growth and tumorigenicity of cell lines in which B PP2A Ca or Cb was suppressed or 40 overexpressing SV40ST. The number of tumors formed per 35 injection site is shown. B, AI growth and tumor formation of HEK TER cells expressing 30 shRNAs targeting PP2A B subunits. Results are shown as 25 mean SD for 3 independent experiments. Dotted line indicates position of 2 SD from the mean of 20 all samples. PP2A subunit suppression was assessed by Colony number 15 qRT-PCR. Mean±SD 10

0 -1 -2 -1 -2 γ -2 ε ε δ -2 β β α -2 shGFP shB56 γ -1 shB56 shB56 shB56 shB56 δ -1 shB56 δ -2 shB55 δ -1 shB55 shB56 shB56 shB55 α -1 shB55 α -2 shB56 α -1 shB56 shPR48-1 shPR48-2 shPR93-1 shPR93-2 shPTPA-1 shPTPA-2 shPR110-1 shPR110-2 shPR72/130-1 shPR72/130-2

Suppression 0 85% 89% 88% 69% 62% 73% 67% 80% 86% 70% 96% 82% 91% 82% 53% 50% 51% 61% 67% 87% 63% 84% 80% 95%

targeting each of the known PP2A regulatory subunits. We consequences of suppressing each of these PP2A B subunits introduced 5 shRNAs targeting each of the known PP2A B on AI growth. subunits into HEK TER cells and determined the degree of We found that in addition to B56g, individually suppressing gene suppression induced by each shRNA by qRT-PCR the expression of PR72/PR130, B56a, or PTPA permitted HEK (Fig. 1B; Supplementary Fig. 2) and by immunoblotting (Sup- TER cells to grow in an AI manner (Fig. 1B). The expression of plementary Fig. 3). Consistent with prior reports (23), we 2 distinct shRNAs specific to each of these B subunits results found that except for PP2A B55g and B55b subunits (which in statistically significant (P < 0.05) increases in AI colonies are mostly expressed in the brain), each of the PP2A B (Fig. 1B). Because we used 2 shRNAs targeting different subunits is expressed in these cells. For each of the PP2A B sequences in the same gene, it is unlikely that the observed subunits, we identified at least 2 different shRNAs that sup- effects are due to off-targets induced by these shRNAs. press each PP2A B subunit by at least 50% (Table 1). We These observations implicate the PP2A regulatory subunits selected these 2 B subunit-specific shRNAs to create HEK TER B56a, B56g, PR72/PR130, and PTPA in human cell transfor- cell lines that stably express each of these shRNAs to assess the mation.

www.aacrjournals.org Cancer Res; 70(24) December 15, 2010 10477

Sablina et al.

-2

-1

-2

-1

α α

A 2

SV40ST

shPTPA-2

shPTPA-1

shPR72/130-2

shPR72/130-1

shB56

shGFP

shC α

SV40 ST SV40 shGFP

Phospo-Akt

Total Akt Figure 2. Inhibition of PP2A activates the PI3K/Akt and c-Myc signaling pathways. A, immunoblot analysis of phospho- Akt and Akt1 expression in cells

B expressing control vector, 2

- SV40ST, or shRNAs specific for

α the indicated PP2A subunits. HEK

TER cells were serum starved for

shC SV40 ST SV40 shGFP 24 hours and then stimulated with c-Myc 10% serum for 15 minutes. B and C, expression of c-Myc in the HEK TER cells pretreated with MG132 GAPDH (10 mmol/L) for 12 hours. 1 5.32 4.57 Transcriptional activation activity

Relative c-Myc activity c-Myc Relative of c-Myc was assessed by its - ability to activate the E2F2 promoter [E2F2(-Ebox)-Luc]. *, P < 0.006; **, P < 0.031. Mean C SD for 3 independent experiments

is shown.

-2

-1

-2

-1

SV40 ST SV40

shPTPA-2 shPTPA-2

shPTPA-1

shPR72/130-2

shPR72/130-1

shB56

shB56 shGFP

1 1.92 2.37 1.01 1.06 2.65 2.71 3.21 3.68 4.16

Involvement of the PI3K/Akt, Wnt, and c-Myc pathways expression of c-Myc protein and a small but reproducible in SV40ST-induced transformation increase in c-Myc–induced transactivation of the E2F2 pro- The PP2A subunits, B56a, B56g, and PR72/PR130 have been moter (31), which is dependent on the presence of c-Myc– implicated in the regulation of the PI3K (phosphoinositide 3- binding sites (E-box elements; ref. 28) in the cells expressing kinases)/Akt, Wnt, and c-Myc pathways (12, 17, 24–27), sug- SV40ST or in which PP2A Ca was suppressed (Fig. 2B). We gesting that they are involved in transformation induced by found that suppression of B56a, PR72/PR130, or PTPA led to a suppression of specific PP2A complexes. Thus, we analyzed 2-fold increase in the steady-state levels of c-Myc protein activity of Akt, Wnt, and c-Myc pathways in HEK TER cells (Fig. 2C). In contrast, suppression of B56g was not accom- after suppression of specific PP2A subunits. panied with any change of c-Myc expression levels (Fig. 2C). Consistent with previous reports (28–30), we found that Moreover, we observed an increase in levels of the depho- expression of SV40ST and suppression of either PP2A Ca or sphorylated (Ser37 and Thr41), active form of b-catenin after B56g resulted in elevated levels of Akt phosphorylation overexpression of SV40ST or suppression of PP2A Ca (Ser473). We also observed a similar increase of phosphory- (Fig. 3A). HEK TER cells in which PP2A Ca was partially lated Akt in cells in which we suppressed PTPA expression suppressed also showed increased TOP/FOP luciferase (Fig. 2A). reporter activity as well as statistically significant increased We also corroborated the observation that SV40ST overexpression of b-catenin–driven genes, such as CCDN1 and expression or suppression of PP2A Ca resulted in increased AXIN (Fig. 3B). As previously reported (27), we found that

10478 Cancer Res; 70(24) December 15, 2010 Cancer Research

A B 5 Cyclin D1 Axin

-2

SV40ST shC shGFP 3 Active β-cat 2 Total β-cat 1

0 Figure 3. Suppression of PP2A shCα-2 shCα-2 shCα-2 activates the Wnt pathway. A, expression of unphosphorylated and total C b-catenin (b-cat) in cells 9 expressing shGFP, SV40ST, or PP2A Ca-specific shRNA. 8 Relative TOP/FOP activity and expression of b-catenin target 7 genes are shown. *, P < 0.012; **, P < 0.004. B and C, relative TOP/ 6 FOP activity in HEK TER cells expressing shGFP, SV40ST, or 5 shRNAs targeting the indicated PP2A subunits. Mean SD for 4 3 independent experiments is shown. 3

-2

-1

-2

-1

shGFP

shB56

shPTPA-2

shPTPA-1

shPR72/130-2 shPR72/130-1

suppression of PP2A B56g induced b-catenin–dependent Manipulation of Akt, b-catenin, and c-Myc substitutes transcription (Fig. 3C). Suppression of PTPA also induced for SV40ST to induce transformation TOP/FOP luciferase reporter activity. In contrast, we To study whether regulation of Akt, b-catenin, and c-Myc observed a decrease in b-catenin activity after suppression activity by specific PP2A complexes contributes to SV40ST- of PR72/130 (Fig. 3C). mediated transformation, we used both loss-of-function and These observations indicate that suppression of specific gain-of-function approaches. Specifically, we suppressed the PP2A complexes resulted in upregulation of the cancer- expression of Akt, b-catenin, and c-Myc in HEK TER cell related signaling pathways PI3K/Akt, Wnt, and c-Myc. Deple- transformed by SV40ST (HEK TERST cells). We found that tion of specific PP2A B regulatory subunits resulted in activa- partial suppression of Akt, c-Myc, or b-catenin by specific tion of a subset of these signaling pathways, whereas shRNAs did not significantly affect proliferation (Supplemen- inhibition of both PP2A Ca and PTPA resulted in activation tary Fig. 5) but did result in approximately 30% fewer AI of all 3 pathways. Consistent with these observations, we colonies in cells dependent on SV40ST for transformation found that suppression of B56a, B56g, or PR72/PR130 resulted (Fig. 4A). Moreover, overexpression of a dominantly interfer- in a small decrease in PP2A-associated phosphatase activity, ing TCF mutant (dnTCF) partially inhibited the ability of HEK whereas depletion of both PP2A Ca and PTPA inhibited TERST cells to grow in AI manner (Fig. 4A). The suppression of PP2A phosphatase activity more dramatically (Supplementary the SV40ST-transforming phenotype after inhibition of PI3K/ Fig. 4). Akt, c-Myc, or Wnt signaling pathways confirmed that these

www.aacrjournals.org Cancer Res; 70(24) December 15, 2010 10479

shGFP shc-Myc-1 shc-Myc-2

β-Catenin Suppression 0 35% 23%

B C

Control c-Myc-T58A Control c-Myc-T58A +mAkt +mAkt S33Y S33Y S33Y S33Y -Catenin -Catenin -Catenin -Catenin β β β β

S33Y Colony number Colony

V β-CateninS33Y mAkt β-CateninS33Y SV40ST mAkt Tumors 0/9 0/9 0/9 0/9 0/9 0/9 0/9 3/9 6/6

Figure 4. Cooperation between b-catenin, c-Myc, and Akt in cell transformation. A, AI growth of the HEK TERST cell lines expressing dnTCF or shRNAs specific for CTNNB1, Akt1, or Myc. Suppression of b-catenin and Akt1 was confirmed by immunoblotting. Inhibition of Myc was detected by qRT-PCR (bottom). B, combinational expression of c-MycT58A, b-cateninS33Y, and mAkt in HEK TER cells. C, effect of a pairwise expression of the indicated genes on AI growth and tumorigenicity. Mean SD for 3 independent experiments and the number of tumors formed per injection site are shown.

oncogenic pathways contribute to SV40ST-induced transfor- In contrast, the stabilized c-MycT58A mutant cooperated mation. with activated Akt and b-catenin to increase cell prolifera- To complement these loss-of-function studies, we overex- tion to the same level as was found when we expressed pressed pairwise combinations of constitutively active forms of SV40ST (Supplementary Fig. 6). Coexpression of c-MycT58A Akt (myristoylated Akt; ref. 33), b-catenin (b-cateninS33Y with myristoylated Akt and b-cateninS33Y conferred the mutant; ref. 34), and a degradation-resistant c-Myc mutant abilitytogrowinanAImanner(Fig.4C).Indeed,we (c-MycT58A mutant; ref. 28) in immortalized but not tumori- observed that both the size and number of AI colonies genic HEK TER cells and assessed whether such cell lines were were similar to that observed for SV40ST-expressing cells now capable of AI and tumorigenic growth (Fig. 4B). We found (Supplementary Fig. 7). Moreover, perturbation of all of that HEK TER expressing the stabilized and therefore activated these pathways was necessary to induce the formation of mutants of b-catenin, Akt, or c-Myc formed few AI colonies. tumors in immunodeficient mice (Fig. 4C). These observa- Coexpression of activated Akt and b-catenin resulted in tions show that simultaneously activating the PI3K/Akt, increased cell proliferation and an enhanced capacity to grow b-catenin, and c-Myc pathways cooperate to induce tumor in AI fashion but did not allow such cells to form tumors in formation similar to what we observed when PP2A Aa was immunodeficient mice (Supplementary Fig. 6; Fig. 4C). suppressed.

10480 Cancer Res; 70(24) December 15, 2010 Cancer Research

A B

-2

-1

-2

-1

α α

-2

-3

-1

-3

shGFP

shCα

shC

shC IP: PP2A C

shPTPA-2

shPTPA-1

shPR72/130-2

shPR72/130-1

shB56

shB56 shGFP PP2A C (Cα/Cβ) Methyl-PP2A C 1 1.34 0.89 1.61 1.56 1.51 1.37 0.21 0.15 PP2A A PP2A A α B55 WB:PP2A C B56β B56γ C HEK TER shPP2A Cα-2 PR93 450

400 Actin 350

300

250

200

150 Colony number Colony 100

0 V wt T304D T304A Y307F Y307D ΔL309 Flag-PP2A Cα L309

Figure 5. Loss of PTPA induces cell transformation by affecting PP2A C methylation. A, expression of the indicated PP2A subunits in cells in which Ca or Cb was suppressed by the indicated shRNA. B, methylation levels of PP2A Ca and Cb and formation of AC dimers in cells expressing the indicated shRNAs. Methylation status of PP2A C was detected by anti–methyl-PP2A C antibody. C, effects of expressing wild-type (wt) PP2A Ca, phosphorylation-deficient (T304A and Y307F), phosphorylation-mimicking (T304D and Y307D), and methylation-deficient (DL309) PP2A Ca mutants on AI growth. Flag-tagged wild-type PP2A Ca and the PP2A Ca mutants were introduced to HEK TER cells expressing shRNA specific for PP2A Ca. Expression of exogenous PP2A Ca was confirmed by immunoblotting by using anti-Flag antibody. Mean SD for 3 independent experiments is shown.

Suppression of PTPA induces cell transformation reduces yeast PP2A stability and alters its substrate specificity through dysregulation of PP2A holoenzyme assembly (15, 38). Mammalian PTPA can complement a mutant of the We assessed the consequences of suppressing the PP2A yeast PTPA genes Rrd1 and Rrd2, suggesting that the mam- catalytic subunits Ca and Cb on the composition of PP2A malian and yeast PTPA orthologues share functional domains complexes in HEK TER cells. Suppression of PP2A Ca resulted (15). When we analyzed cells in which we had suppressed in a substantial reduction of the steady-state levels of the PP2A PTPA expression, we found that the loss of PTPA dramatically B55a, B56b, B56g, and PR93 regulatory subunits and the PP2A abolished methylation of PP2A catalytic subunit. Because A subunits (Fig. 5A). These observations corroborate prior methylation of PP2A C could also be affected by its phosphor- work that showed that the PP2A regulatory and structural ylation at Y307, we tested whether PTPA affects PP2A C subunits exhibit limited stability when not bound to a cata- phosphorylation and found no change in PP2A C phosphor- lytic PP2A C subunit (12, 35), and suggest that the loss of PP2A ylation in cells in which PTPA expression was suppressed Ca induces cell transformation through disruption of multiple (Supplementary Fig. 8). In contrast, we observed a diminished heterotrimeric PP2A complexes. ability of PP2A C to bind to the PP2A A subunit (Fig. 5B) and In contrast, suppressing the expression of the PP2A Cb found decreased PP2A A structural subunit expression in cells subunit resulted in only a small decrease of the steady-state in which PTPA expression was suppressed (Supplementary levels of these PP2A subunits (Fig. 5A), confirming that PP2A Fig. 8), consistent with the notion that PP2A A subunits are complexes containing Cb represent a minor fraction of the unstable when not bound to the PP2A C subunit. These total PP2A complexes in the cells (36, 37). observations suggest that PTPA suppression affects the for- Previous reports revealed that Rrd1 and Rrd2, the PTPA mation of heterotrimeric PP2A complexes. orthologues in yeast, affect the methylation of the PP2A Specifically, these observations suggest that suppression of catalytic subunit and control the formation of PP2A hetero- PTPA induces cell transformation through the regulation of trimeric complexes (15, 38). Specifically, deletion of Rrd1 PP2A C methylation. To test whether methylation of PP2A C

www.aacrjournals.org Cancer Res; 70(24) December 15, 2010 10481

affected the tumor-suppressive properties of PP2A, we gen- as PTPA, induced a transformed phenotype, suggesting that erated a methylation-deficient DL309 PP2A Ca mutant (5). We these specific regulatory subunits contribute to cell transfor- also tested phosphorylation site mutants of PP2A Ca (T304A, mation. Consistent with this idea, these same subunits have T304D, Y307A, and Y307F), which have been shown to affect been implicated in the regulation of PI3K/Akt, Wnt, and c-Myc PP2A methylation. Specifically, the PP2A Ca phosphorylation- signaling. Specifically, PP2A holoenzymes containing the B56a deficient (T304A and Y307F) and phosphorylation-mimicking regulatory subunit associate with and directly dephosphor- (T304D) mutants have been found to be methylated, whereas ylate c-Myc at Ser62, a residue previously implicated in the PP2A Ca phosphorylation-mimicking (Y307D) mutants targeting c-Myc to proteosome degradation (28, 32, 42). More- fail to exhibit methylation (39, 40). over, loss of B56a or PR72/PR130 expression results in c-Myc We introduced the wild-type or mutant PP2A Ca into HEK overexpression, elevated levels of c-Myc Ser62 phosphoryla- TER cells in which we had suppressed the endogenous PP2A tion, and increased c-Myc function (24). Ca and analyzed AI growth of these cell lines. We found that We note that overexpression of the c-MycT58A mutant has wild-type PP2A Ca and the T304A, Y307F, and T304D mutants been reported to replace SV40ST in cell transformation (28). suppressed the transforming phenotype induced by partial We (43) and others (44) have reported that the combination of suppression of PP2A Ca. In contrast, expression of the PP2A expressing hTERT and extended propagation of cells in cul- Ca methylation-deficient DL309 or Y307D mutants failed to ture led to amplifications of endogenous c-Myc. Herein, we inhibit the transformed phenotype (Fig. 5C). These results used highly efficient retroviral infections to create cell lines suggest that the methylation of PP2A Ca is crucial for tumor- and did not use cells that had been in culture for more than 30 suppressive properties of PP2A and that PTPA subunit con- population doublings. tributes to control of cell transformation through regulating Loss of B56g has been shown to activate the Akt pathway; the methylation status of PP2A C. however, it remains unclear whether Akt1 is a direct target of the PP2A B56g-specific complex (17, 45). B56g may also Discussion contribute to the regulation of Wnt pathway through regulation of APC. By binding to APC, PP2A B56g inhibits formation DNA tumor viruses express dominant acting oncoproteins of APC–Axin complexes leading to destabilization of b-catenin that exert their effects by binding to and deregulating (27). As a result, overexpression of B56g reduces the abun- cellular targets. In nearly all cases, the targets of viral dance of b-catenin and inhibits transcription of b-catenin oncoproteins have been subsequently shown to play impor- target genes (27). tant roles in spontaneously arising human cancers. Although The PR72 and PR130 isoforms, which share the same C PP2A is the primary host–binding partner of SV40ST, the terminus, have been shown to regulate activity of Naked biochemical complexity of the PP2A family and the multi- cuticle, which is a Wnt antagonist. PR72 acts as a negative tude of signaling pathways regulated by this abundant family regulator of the Wnt signaling cascade through its interaction of phosphatases have complicated efforts to establish the with Naked cuticle. On the other hand, PR130 modulates Wnt molecular mechanisms employed by SV40ST to induce cell signal transduction by restricting the ability of Naked cuticle transformation. to function as a Wnt inhibitor (25, 26). As previously reported Prior work showed that SV40ST displaces multiple PP2A (46), we found that PR130 isoform is expressed at much higher regulatory B subunits from the AC core dimer (16, 17, 41), levels than PR72 in HEK TER cells and shRNAs specific for suggesting that more than 1 PP2A specific complexes is PR72/PR130 subunit disproportionally affected the expression involved in cell transformation. Indeed, we found that partial of PR130 isoform (data not shown). Specifically, we used 2 suppression of the PP2A Ca catalytic subunit is accompanied independent shRNAs targeting PR72/130 subunit, of which by the degradation of multiple PP2A subunits and nearly shPR72/130-1 targets a sequence present only in PR130 iso- completely recapitulates the transformation phenotype form whereas shPR72/130-2 targets both PR72 and PR130. induced by the expression of SV40ST. Moreover, a number Because both shRNAs induced the same phenotypes, the of other reports have shown that perturbation of several observed results were specific for the PR130 isoform. distinct PP2A complexes leads to the same phenotype. As In contrast to the other PP2A regulatory B subunits identi- an example, at least 3 different regulatory PP2A subunits, fied in our screen, PTPA disrupts PP2A function through a B56g, PR72, and PR130, are involved in regulation of the distinct mechanism. The recent elucidation of the PP2A different components of the Wnt signaling pathway (25–27). holoenzyme structure showed that the highly conserved C- In addition, other PP2A subunits may contribute to cell terminal tail of the PP2A C subunit resides at a critical transformation in a manner that is distinct from that induced interface between the PP2A A structural subunit and the B by SV40ST. For example, we found that depletion of the PP2A subunit B56g (14). As such, the recruitment of a B subunit to Ab structural subunit induced transformation through activa- the core enzyme is tightly regulated by the methylation and tion of the small GTPase RalA. Because SV40ST cannot bind phosphorylation patterns of the C-terminal tail. The formation PP2A Ab–specific complexes, this mechanism of PP2A- of the holoenzyme complex and the activation of PP2A C are mediated transformation is SV40ST independent (13). also restrained by a series of interlocking steps involving the Here we have identified several PP2A-specific complexes dual action of the phosphatase methylesterase PME-1 and involved in control of cell transformation. Suppression of at PTPA. The mechanism by which PTPA induces C subunit least 3 different B subunits, B56a, B56g, and PR72/130, as well activity remains to be determined, but the PP2A A–PTPA

10482 Cancer Res; 70(24) December 15, 2010 Cancer Research

complex may function partly by inhibiting the methylesterase As previously reported (7), we found that PP2A is implicated activity of PME-1 (47). Consistent with this notion, we found in the regulation of a number of major signaling pathways, that suppression of PTPA resulted in a marked decrease in including Wnt, PI3K/Akt, and c-Myc. However, we note that PP2A C methylation. direct substrates that modulate these signaling pathways have We found that methylation of PP2A C is crucial for PP2A yet to be identified for the specific PP2A complexes. Further tumor-suppressive activity. The highly conserved C-terminal studies are necessary to dissect the mechanisms by which 304TPDYFL309 tail of PP2A C is also phosphorylated at Y307 specific PP2A complexes affect these oncogenic pathways. and T304, and phosphorylation of these residues affects the However, the systematic identification of PP2A B subunits methylation of PP2A Ca (39, 40). Indeed, the methylation- involved in control of cell transformation defines the PP2A- deficient DL309 and Y307D PP2A Ca mutants failed to dependent pathways regulated by SV40ST and provides insight reverse the tumorigenic phenotype induced by PP2A Ca into how such pathways are perturbed in cell transformation. suppression. This finding is consistent with the observation that phosphorylation at Y307 dramatically inhibits PP2A Disclosure of Potential Conflicts of Interest activity (48). PTPA suppression induced the strongest transforming phenotype among the B subunits tested in our No potential conflicts of interest were disclosed. screen, and overexpression of mouse PTPA induces apoptosis in HCT116 colon carcinoma cells (49). These observa- Grant Support tions implicate PTPA as a potential tumor suppressor that Supported in part by grants from the U.S. National Cancer Institute P01 acts by modulating the assembly of PP2A heterotrimers CA050661 (W.C. Hahn) and 1K99 CA125974-01A2 (A.A. Sablina). through methylation of PP2A catalytic subunit. Indeed, a The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in recent report showed that suppression of the PP2A methy- accordance with 18 U.S.C. Section 1734 solely to indicate this fact. lesterase PME-1 affects both cell proliferation and AI growth andoverexpressionofPME-1correlatedwiththestageof Received 08/05/2010; revised 10/06/2009; accepted 10/20/2010; published disease in gliomas (50). Online 12/15/2010.

References 1. Hanahan D, Weinberg RA. The hallmarks of cancer. Cell 2000;100: 15. Fellner T, Lackner DH, Hombauer H, et al. A novel and essential 57–70. mechanism determining specificity and activity of protein phospha- 2. Hahn WC, Counter CM, Lundberg AS, Beijersbergen RL, Brooks MW, tase 2A (PP2A) in vivo. Genes Dev 2003;17:2138–50. Weinberg RA. Creation of human tumour cells with defined genetic 16. Cho US, Morrone S, Sablina AA, Arroyo JD, Hahn WC, Xu W. elements. Nature 1999;400:464–8. Structural basis of PP2A inhibition by small t antigen. PLoS Biol 3. Zhao JJ, Roberts TM, Hahn WC. Functional genetics and experi- 2007;5:e202. mental models of human cancer. Trends Mol Med 2004;10:344–50. 17. Chen W, Possemato R, Campbell KT, Plattner CA, Pallas DC, Hahn 4. Hahn WC, Dessain SK, Brooks MW, et al. Enumeration of the simian WC. Identification of specific PP2A complexes involved in human cell virus 40 early region elements necessary for human cell transforma- transformation. Cancer Cell 2004;5:127–36. tion. Mol Cell Biol 2002;22:2111–23. 18. Boehm JS, Zhao JJ, Yao J, et al. Integrative genomic approaches 5. Yu J, Boyapati A, Rundell K. Critical role for SV40 small-t antigen in identify IKBKE as a breast cancer oncogene. Cell 2007;129:1065– human cell transformation. Virology 2001;290:192–8. 79. 6. Mungre S, Enderle K, Turk B, et al. Mutations which affect the 19. Firestein R, Bass AJ, Kim SY, et al. CDK8 is a colorectal cancer inhibition of protein phosphatase 2A by simian virus 40 small-t antigen oncogene that regulates beta-catenin activity. Nature 2008;455: in vitro decrease viral transformation. J Virol 1994;68:1675–81. 547–51. 7. Eichhorn PJ, Creyghton MP, Bernards R. Protein phosphatase 2A 20. Moffat J, Grueneberg DA, Yang X, et al. A lentiviral RNAi library for regulatory subunits and cancer. Biochim Biophys Acta 2008;1795:1– human and mouse genes applied to an arrayed viral high-content 15. screen. Cell 2006;124:1283–98. 8. Calin GA, di Iasio MG, Caprini E, et al. Low frequency of alterations of 21. Evans DR, Myles T, Hofsteenge J, Hemmings BA. Functional expres- the alpha (PPP2R1A) and beta (PPP2R1B) isoforms of the subunit A of sion of human PP2Ac in yeast permits the identification of novel C- the serine–threonine phosphatase 2A in human neoplasms. Onco- terminal and dominant-negative mutant forms. J Biol Chem 1999; gene 2000;19:1191–5. 274:24038–46. 9. Ruediger R, Pham HT, Walter G. Alterations in protein phosphatase 2A 22. Gotz J, Probst A, Ehler E, Hemmings B, Kues W. Delayed embryonic subunit interaction in human carcinomas of the lung and colon with lethality in mice lacking protein phosphatase 2A catalytic subunit mutations in the A beta subunit gene. Oncogene 2001;20:1892–9. Calpha. Proc Natl Acad Sci USA 1998;95:12370–5. 10. Takagi Y, Futamura M, Yamaguchi K, Aoki S, Takahashi T, Saji S. 23. Hu P, Yu L, Zhang M, et al. Molecular cloning and mapping of Alterations of the PPP2R1B gene located at 11q23 in human color- the brain-abundant B1gamma subunit of protein phosphatase 2A, ectal cancers. Gut 2000;47:268–71. PPP2R2C, to human chromosome 4p16. Genomics 2000;67:83–6. 11. Wang SS, Esplin ED, Li JL, et al. Alterations of the PPP2R1B gene in 24. Arnold HK, Sears RC. Protein phosphatase 2A regulatory subunit human lung and colon cancer. Science 1998;282:284–7. B56alpha associates with c-myc and negatively regulates c-myc 12. Chen W, Arroyo JD, Timmons JC, Possemato R, Hahn WC. Cancer- accumulation. Mol Cell Biol 2006;26:2832–44. associated PP2A Aalpha subunits induce functional haploinsuffi- 25. Creyghton MP, Roel G, Eichhorn PJ, et al. PR72, a novel regulator of ciency and tumorigenicity. Cancer Res 2005;65:8183–92. Wnt signaling required for Naked cuticle function. Genes Dev 13. Sablina AA, Chen W, Arroyo JD, et al. The tumor suppressor PP2A 2005;19:376–86. Abeta regulates the RalA GTPase. Cell 2007;129:969–82. 26. Creyghton MP, Roel G, Eichhorn PJ, Vredeveld LC, Destree O, 14. Mumby M. The 3D structure of protein phosphatase 2A: new insights Bernards R. PR130 is a modulator of the Wnt-signaling cascade that into a ubiquitous regulator of cell signaling. ACS Chem Biol 2007;2: counters repression of the antagonist Naked cuticle. Proc Natl Acad 99–103. Sci U S A 2006;103:5397–402.

www.aacrjournals.org Cancer Res; 70(24) December 15, 2010 10483

27. Seeling JM, Miller JR, Gil R, Moon RT, White R, Virshup DM. Regula- subunit but not SG2NA, striatin, or polyomavirus middle tumor anti- tion of beta-catenin signaling by the B56 subunit of protein phos- gen. Mol Biol Cell 2001;12:185–99. phatase 2A. Science 1999;283:2089–91. 40. Ogris E, Gibson DM, Pallas DC. Protein phosphatase 2A subunit 28. Yeh E, Cunningham M, Arnold H, et al. A signalling pathway control- assembly: the catalytic subunit carboxy terminus is important for ling c-Myc degradation that impacts oncogenic transformation of binding cellular B subunit but not polyomavirus middle tumor antigen. human cells. Nat Cell Biol 2004;6:308–18. Oncogene 1997;15:911–7. 29. Yuan H, Veldman T, Rundell K, Schlegel R. Simian virus 40 small tumor 41. Sontag E, Fedorov S, Kamibayashi C, Robbins D, Cobb M, Mumby M. antigen activates AKT and telomerase and induces anchorage-inde- The interaction of SV40 small tumor antigen with protein phosphatase pendent growth of human epithelial cells. J Virol 2002;76:10685–91. 2A stimulates the map kinase pathway and induces cell proliferation. 30. Zhao JJ, Gjoerup OV, Subramanian RR, et al. Human mammary Cell 1993;75:887–97. epithelial cell transformation through the activation of phosphatidy- 42. Sears R, Leone G, DeGregori J, Nevins JR. Ras enhances Myc protein linositol 3-kinase. Cancer Cell 2003;3:483–95. stability. Mol Cell 1999;3:169–79. 31. Sears R, Ohtani K, Nevins JR. Identification of positively and nega- 43. Elenbaas B, Spirio L, Koerner F, et al. Human breast cancer cells tively acting elements regulating expression of the E2F2 gene in generated by oncogenic transformation of primary mammary epithe- response to cell growth signals. Mol Cell Biol 1997:17;5227–35. lial cells. Genes Dev 2001;15:50–65. 32. Arnold HK, Sears RC. A tumor suppressor role for PP2A-B56alpha 44. Wang J, Hannon GJ, Beach DH. Risky immortalization by telomerase. through negative regulation of c-Myc and other key oncoproteins. Nature 2000;405:755–6. Cancer Metastasis Rev 2008;27:147–58. 45. Chen Y, Xu Y, Bao Q, et al. Structural and biochemical insights into the 33. Kohn AD, Takeuchi F, Roth RA. Akt, a pleckstrin homology domain regulation of protein phosphatase 2A by small t antigen of SV40. Nat containing kinase, is activated primarily by phosphorylation. J Biol Struct Mol Biol 2007;14:527–34. Chem 1996;271:21920–6. 46. Zwaenepoel K, Goris J, Erneux C, Parker PJ, Janssens V. Protein 34. Morin PJ, Sparks AB, Korinek V, et al. Activation of beta-catenin-Tcf phosphatase 2A PR130/B’’alpha1 subunit binds to the SH2 domain- signaling in colon cancer by mutations in beta-catenin or APC. containing inositol polyphosphate 5-phosphatase 2 and prevents Science 1997;275:1787–90. epidermal growth factor (EGF)-induced EGF receptor degradation 35. Silverstein AM, Barrow CA, Davis AJ, Mumby MC. Actions of PP2A on sustaining EGF-mediated signaling. FASEB J 2010;24;538–47. the MAP kinase pathway and apoptosis are mediated by distinct 47. Longin S, Jordens J, Martens E, et al. An inactive protein phosphatase regulatory subunits. Proc Natl Acad Sci USA 2002;99:4221–6. 2A population is associated with methylesterase and can be re- 36. Hemmings BA, Adams-Pearson C, Maurer F, et al. alpha- and beta- activated by the phosphotyrosyl phosphatase activator. Biochem J forms of the 65-kDa subunit of protein phosphatase 2A have a simi- 2004;380:111–9. lar 39 amino acid repeating structure. Biochemistry 1990;29: 3166–73. 48. Chen J, Martin BL, Brautigan DL. Regulation of protein serine–threo- 37. Ory S, Zhou M, Conrads TP, Veenstra TD, Morrison DK. Protein nine phosphatase type-2A by tyrosine phosphorylation. Science phosphatase 2A positively regulates Ras signaling by dephosphor- 1992;257:1261–4. ylating KSR1 and Raf-1 on critical 14-3-3 binding sites. Curr Biol 2003; 49. Azam S, Drobetsky E, Ramotar D. Overexpression of the cis/trans 13:1356–64. isomerase PTPA triggers caspase 3-dependent apoptosis. Apoptosis 38. Hombauer H, Weismann D, Mudrak I, et al. Generation of active 2007;12:1243–55. protein phosphatase 2A is coupled to holoenzyme assembly. PLoS 50. Puustinen P, Junttila MR, Vanhatupa S, et al. PME-1 protects extra- Biol 2007,5:e155. cellular signal-regulated kinase pathway activity from protein phos- 39. Yu XX, Du X, Moreno CS, et al. Methylation of the protein phosphatase phatase 2A-mediated inactivation in human malignant glioma. Cancer 2A catalytic subunit is essential for association of Balpha regulatory Res 2009;69:2870–7.

10484 Cancer Res; 70(24) December 15, 2010 Cancer Research

Anna A. Sablina, Melissa Hector, Nathalie Colpaert, et al.

Cancer Res 2010;70:10474-10484.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/70/24/10474

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2010/12/13/70.24.10474.DC1

Cited articles This article cites 50 articles, 21 of which you can access for free at: http://cancerres.aacrjournals.org/content/70/24/10474.full#ref-list-1

Citing articles This article has been cited by 34 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/70/24/10474.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/70/24/10474. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.