Physical Extraction and Fast Protein Liquid Chromatography for Purifying Flagella Filament from Uropathogenic Escherichia Coli for Immune Assay

Bacterial Flagella as Triggers of the Innate Immune System and IL-10 Production During Acute Urinary Tract Infection

Author Acharya, Dhruba

Published 2020

Thesis Type Thesis (PhD Doctorate)

School School of Medical Science

DOI https://doi.org/10.25904/1912/3786

Downloaded from http://hdl.handle.net/10072/391068

Griffith Research Online https://research-repository.griffith.edu.au

Bacterial Flagella as Triggers of the Innate Immune System and IL-10 Production During Acute Urinary Tract Infection

Dhruba Acharya

BSc. MLT, MSc. (Immunology)

School of Medical Sciences

Griffith University

Submitted in fulfilment of the requirements of degree of Doctor of Philosophy

June 2019

Abstract

Urinary Tract Infections (UTIs) are a huge public health problem affecting 150 million people each year worldwide. Expenditures aimed at the management of UTI account for approximately $3.5 billion USD in medical costs annually. More than 80% of all UTIs are caused by uropathogenic Escherichia coli (UPEC). Studies have shown key roles for virulence factors of UPEC, such as flagella, autotransporters, capsule, fimbriae, toxins, lipopolysaccharide (LPS), and siderophores, in UTI disease pathogenesis.

UPEC flagella contribute to the pathogenesis of UTI in several ways, such as through flagella-mediated motility, colonization, adhesion, and biofilm formation. The flagella filament is synthesized as a polymerized product of >20,000 protein monomers termed flagellin or FliC (encoded by the gene fliC). The contribution of flagella to innate immune stimulation is only partially defined, for example gaps exist in our understanding of how flagella engage host responses in the bladder during acute UTI. Extracellular FliC is recognized by Toll-Like Receptor 5 (TLR5), whereas intracellular FliC is recognized by Naip5 and Ipaf. Through MyD88-dependent and independent pathways, FliC causes upregulation of various proinflammatory, regulatory cytokines, and growth factors. A detailed understanding of how FliC from UPEC engages innate immunity in the bladder during UTI is lacking.

A major focus of this thesis was the regulatory cytokine, IL-10. IL-10 plays pleiotropic roles in defence against infection; depending on the illness and the causal pathogen. Frequently, IL-10 facilitates immune suppression to moderate inflammatory mechanisms that can damage the host. IL-10 is rapidly produced in the bladder in response to UPEC early during UTI. However, the mechanism of engagement of innate immunity by UPEC that leads to elicitation of IL-10 in the bladder is unknown. One facet in understanding the role of IL-10 in infectious disease is the elucidation of microbial products that elicit production of this key regulator of host innate immune responses.

The overarching aim of this thesis was to define the role of flagella (particularly FliC) in immune modulation during acute UTI. A plethora of methods have been previously described for the extraction and purification of FliC. However, there is limited literature utilizing highly purified, non-denatured FliC, offering any insight into host-pathogen interactions. In this study, UPEC CFT073, and a derivative strain containing four mutations in genes encoding fimbriae and pili (CFT073Δ4) were used to generate a deletion in the flagellar filament, fliC. This enabled the concurrent preparation of a iii suitable carrier control to be applied in downstream assays. The flhDC gene, which regulates flagella biosynthesis, was used in an IPTG inducible plasmid (pMG600) to overexpress flagella. Extraction and purification of FliC to homogeneity was performed using a sequential extraction method based on mechanical shearing, ultracentrifugation, size exclusion chromatography, protein concentration and endotoxin removal. Protein purity and integrity was assessed using SDS-PAGE, western blots with anti-flagellin antisera, and native-PAGE. This study established a new, carefully optimized method to extract and purify FliC from the reference UPEC strain CFT073 to be suitable for immune assays. The biological activity of FliC was assessed by measuring cytokine responses in both mouse macrophages (J774A.1) and human monocytes(U937). Macrophage and monocyte responses to purified FliC included significant levels of several cytokines, including TNF-α, IL-6, IL12, INF-γ, consistent with prior literature reports.

This thesis sought to identify the role of the major UPEC flagella filament protein, FliC, in triggering IL-10 synthesis in the bladder. Analysis of IL-10 induction in response to various UPEC CFT073 derivatives and purified FliC showed a role for FliC in the induction of IL-10 in both human and mouse cell cultures. The effect of FliC on other cytokines, chemokines, and growth factors indicated several pro-inflammatory, and cell recruitment/ migratory factors are also shown to be induced by host cells in response to this protein. This study also explored the FliC induced immune responses, including IL- 10 induction in the bladder in vivo. ELISA and multiplex assays revealed that FliC, when injected via transurethral catheterization, induced a rapid IL-10 response in the mouse bladder. Characterization of the genome-wide innate immunological context of FliC- induced cytokines in the bladder using RNA-sequencing also identified 1400-gene network of transcriptional and antibacterial defences, that were differently expressed compared to carrier control. Of the FliC-responsive bladder transcriptome, the changes in expression of il10 and other genes were dependent on TLR5, according to the -/- comparative analysis of TLR5-deficient mice (Tlr5 ). Exploration of the potential of

FliC, and its associated innate immune signature in the bladder, revealed a significant benefit for the control of infection in the mice that received purified FliC, prophylactically or therapeutically after transurethral UPEC infection.

Collectively, this thesis shows that detection of FliC through TLR5 triggers rapid IL-10 synthesis in the bladder, and FliC therefore represents a potential immune modulator for the treatment or prevention of UTI.

Statement of Originality

This work has not previously been submitted for a degree or diploma in any university. To the best of my knowledge and belief, the thesis contains no material previously published or written by another person except where due reference is made in the thesis itself.

Professional English language editing of this thesis was completed by a professional scientific editing company called Scribendi (www.scribendi.com). Thesis editing was done in accordance with the Griffith University HDR policy, ‘Guidelines for editing research thesis’.

______

Dhruba Acharya

Acknowledgement of Assistance

I am profoundly grateful to my primary supervisor, Professor Glen C. Ulett, for the continuous support during my PhD study. I appreciate his advice, motivation, enthusiasm, and guidance to develop and advance my research through different stages of this project. I would like to acknowledge my co-supervisor Dr. Matthew J. Sullivan for his constant guidance from bench to book. He has been a true mentor and a wonderful friend of mine throughout this degree.

I would like to express my deepest gratitude to Dr. Harry Sakellaris, without whom, I would not have started my career in Australia. Many thanks to Professor Mark Schembri, (The University of Queensland) for his intellectual advice to shape and plan my experiments. I appreciate his insightful contribution in manuscript writing.

To the fellow past and present members of my lab, Dr. Deepak S. Ipe, Dr. Kelvin Goh, Dean Gosling, Lahiru Katupitiya, Michelle Chamoun, and Darren Prince. They are all amazing colleagues and friends and I would like to thank them for creating an excellent environment around working stations.

Dr. Prabin Gyawali; Heartfelt thanks to you brother for being there in my highs and lows, thick and thin, and pleasure and setbacks. I am deeply indebted to these beautiful souls: Dr. Narayan Gyawali and family, Nirajan Shrestha, Sabina Shrestha, Bimbishar Bhattarai, Shikha Karki, Indra Shrestha, Chandani Shrestha, Manasvi and Shriyans Shrestha.

I would like to remember my father Late Shree Jhabindra Acharya. I take this opportunity to acknowledge my mother Saraswoti Devi Acharya and rest of “The Acharya’s”: Chandra Prakash Acharya, Bhawana Thapaliya Acharya, Emil and Milee Acharya, Narendra Acharya, Archana Pokharel Acharya, Nevan and Niyan Acharya.

“My soulmate Kabita Kuikel Acharya, this would not have been possible without your support, love and care. You are the best thing that has ever happened in my life and our shared DNA, Adhvik Acharya, the greatest gift of all”.

Finally, I would like to thank the Government of Australia and Griffith University for the scholarship, support and the people of Australia for giving us a home away from home.

Table of Contents

Abstract ...... iii

Statement of Originality ...... v

Acknowledgement of Assistance ...... vi

Table of Contents ...... vii

List of Figures ...... xi

List of Tables ...... xiii

Abbreviations ...... xiv

Acknowledgement of Published and Unpublished Papers Included in this Thesis xix

1 Chapter 1: General introduction ...... 1

1.1 Specific aims ...... 4

1.2 Hypotheses ...... 4

2 Chapter 2: Literature review ...... 5

2.1 Bacterium: Escherichia coli ...... 5

2.2 Uropathogenic E. coli ...... 5

2.3 Urinary tract infection ...... 6 2.3.1 Brief overview of UTI pathogenesis ...... 7 2.3.2 Host immune response to UPEC infection ...... 8

2.4 Flagella...... 9 2.4.1 Flagellar structure ...... 10 2.4.2 Flagellar Biogenesis ...... 12 2.4.3 Flagellar motility ...... 13 2.4.4 Flagellin variants in E. coli...... 14

2.5 Functions of bacterial flagella ...... 15 2.5.1 Motility ...... 15 2.5.2 Adhesion ...... 16 2.5.3 Biofilm formation ...... 17 2.5.4 Secretion ...... 18

2.6 Role of UPEC flagella in UTI ...... 19

2.7 Host immune response to flagella ...... 21

2.8 Interleukin-10 ...... 28 vii

2.8.1 Role of IL-10 in infectious disease pathogenesis ...... 29 2.8.2 Microbial triggers of IL-10...... 30

2.9 Protective role of flagellin ...... 32

2.10 Extraction and purification of flagellin ...... 34

3 Chapter 3 ...... 41

Extraction and purification of FliC from UPEC for immune assay ...... 41

3.1 Introduction ...... 42

3.2 Materials and Methods ...... 45 3.2.1 Bacterial strains and plasmid ...... 45 3.2.2 Construction of UPEC flagellar mutants ...... 46 3.2.3 Motility assays ...... 48 3.2.4 Flagella extraction using ultracentrifugation ...... 48 3.2.5 SDS-PAGE, Coomassie stain, and Western blot ...... 49 3.2.6 Mass spectrometry ...... 49 3.2.7 Fast Protein Liquid Chromatography (FPLC) ...... 49 3.2.8 Endotoxin removal and measurement ...... 52 3.2.9 Heat-induced monomerization of flagellar filament and stability testing ...... 52 3.2.10 Cell culture and immune stimulation assay ...... 52 3.2.11 Statistics ...... 53

3.3 Results...... 54 3.3.1 Generation of fliC deleted UPEC CFT073 ...... 54 3.3.2 Effect of flagella overexpression on protein extraction ...... 60 3.3.3 Purification of FliC and identification of co-purified proteins ...... 62 3.3.4 Post-purification of FliC to homogeneity using FPLC ...... 65 3.3.5 Endotoxin removal and measurement ...... 66 3.3.6 Heat induced flagellum disassembly ...... 68 3.3.7 Stability of FliC monomers ...... 68 3.3.8 Immunological activity of highly purified FliC ...... 71 3.3.9 Effect of endotoxin removal on macrophage responses to FliC ...... 74

3.4 Discussion ...... 75

4 Chapter 4 ...... 81

Role of FliC in IL-10 induction in mammalian cell culture and murine model of UTI ...... 81

4.1 Introduction ...... 82

4.2 Materials and Methods ...... 84 4.2.1 Bacterial strains and plasmids ...... 84 4.2.2 Murine model of UTI ...... 85 viii

4.2.3 Mammalian cell lines and media ...... 85 4.2.4 Splitting, counting and seeding cell lines ...... 86 4.2.5 Absorbance estimation of bacterial cell concentration in PBS ...... 87 4.2.6 Preparation of bacterial inoculum for infection assay ...... 88 4.2.7 Infection assays ...... 88 4.2.8 Enzyme-Linked Immunosorbent Assay (ELISA) ...... 89 4.2.9 Multiplex assay...... 89 4.2.10 Statistical analysis ...... 90

4.3 Results...... 90 4.3.1 Absorbance estimation of bacterial cell concentration in PBS ...... 90 4.3.2 In-vitro model of FliC mediated IL-10 induction using human cell co-culture model ...... 94 4.3.3 Optimization of infection assays and measurement of IL-10 ...... 95 4.3.4 Induction of IL-10 in human U937 monocyte cells infected with UPEC strains or purified FliC 97 4.3.5 Cytokine profile in response to FliC in mouse J774A.1 macrophage culture ...... 99 4.3.6 FliC induced IL-10 in a murine model of UTI ...... 101 4.3.7 Cytokine profiles of mice bladders in response to FliC ...... 103

4.4 Discussion ...... 105

5 Chapter 5 ...... 110

The bladder transcriptome of mice treated with UPEC flagellin...... 110

5.1 Introduction ...... 111

5.2 Materials and Methods ...... 112 5.2.1 Murine model of UTI ...... 112 5.2.2 Transurethral catheterisation ...... 112 5.2.3 Sample collection ...... 113 5.2.4 RNA sequencing and bioinformatics ...... 113 5.2.5 Data processing and statistics ...... 114 5.2.6 Ethical statement ...... 114

5.3 Results...... 115 5.3.1 Overview of the innate immune response of mouse bladder to FliC ...... 115 5.3.2 Activation of biological responses in mice bladder triggered by UPEC FliC ...... 121 5.3.3 UPEC FliC- TLR5 driven pro-inflammatory axis ...... 124

5.4 Discussion ...... 128

6 Chapter 6 ...... 131

Role of FliC in protection of UPEC mediated urinary tract infection ...... 131

6.1 Introduction ...... 132

6.2 Material and Methods ...... 133 ix

6.2.1 Bacterial inoculum preparation...... 133 6.2.2 Murine model of infection...... 134 6.2.3 Sample collection ...... 134 6.2.4 Bacterial counts ...... 134 6.2.5 Statistics ...... 135

6.3 Results...... 136 6.3.1 Prophylactic ability of FliC to protect mice against CFT073 challenge ...... 136 6.3.2 Therapeutic ability of FliC to protect mice against CFT073 challenge ...... 137

6.4 Discussion ...... 138

7 Chapter 7: General Discussion ...... 141

7.1.1 Future direction and conclusion...... 148

8 References ...... 150

Appendix 1 ...... 192

Appendix 2 ...... 212

Appendix 3 ...... 299

Appendix 4 …………………………………………………………………………...317

List of Figures

Figure 1: Schematic diagram of the structure of flagellum...... 11

Figure 2: Flagellar transcriptional hierarchy coupled to flagellar assembly...... 13

Figure 3: Signal transduction by FliC in mammalian cells...... 24

Figure 4: Schematic representation of the construction of fliC deletion using λ-red mediated homologous recombination employing a 3-way PCR strategy...... 47

Figure 5: Work flow schematic for extraction and chromatographical purification of FliC from UPEC CFT073...... 51

Figure 6: Construction of fliC deletion in CFT073Δ4...... 56

Figure 7: Soft agar motility assay...... 59

Figure 8: Effect of flagella overexpression on protein extraction...... 61

Figure 9: Protein profiles of fliC-enriched extracts from CFT0734 and CFT0734fliC...... 63

Figure 10: Optimization of western blot during confirmation of FliC...... 63

Figure 11: Chromatograms of fliC-enriched extract from CFT0734 and

CFT0734fliC...... 65

Figure 12: Post-purification of FliC using FPLC...... 66

Figure 13: Graphic method for calculation of endotoxin concentration...... 67

Figure 14: Heat-induced monomerization of purified FliC...... 69

Figure 15: Stability of FliC monomers in various times and temperatures...... 70

Figure 16: Cytokine response of macrophages to FliC purified to homogeneity from UPEC CFT0734...... 72

Figure 17: Cytokine response of mouse macrophages to FliC from UPEC CFT073∆4 73

Figure 18: Cytokine response of macrophages to FliC with and without endotoxin. .... 74

Figure 19: Standard absorbance estimation of bacterial cell concentration in PBS...... 92

Figure 20: Absorbance comparison of bacterial strains grown in liquid cultures and soft agar cultures at OD600 of 0.5...... 93

Figure 21: Uroepithelial and monocyte cell co-culture model and IL-10 measurement. 94

Figure 22: Optimisation of infection assays...... 96

Figure 23: UPEC mediated IL-10 response in human U937 monocyte cells...... 98

Figure 24: FliC mediated IL-10 response in human U937 monocyte cells...... 98

Figure 25: Cytokine profile of J774A.1 cell line challenged with FliC...... 100

Figure 26: FliC induces IL-10 production in the bladder...... 102

Figure 27: Cytokine profile of mice bladder in response to FliC...... 104

Figure 28: Bladder transcriptome in Wt mice in response to pure FliC from UPEC CFT0734...... 116

Figure 29: Top 20 up-regulated pathways identified as over-representated by RNA-Seq analyses...... 122

Figure 30: Top 20 down-regulated pathways identified as over-represented by RNA-Seq analyses...... 123

Figure 31: Volcano plot of bladder transcriptomes of Wt mice compared to Tlr5-/- mice treated with FliC...... 125

Figure 32: Broad comparison of altered gene in RNA-Seq analysis...... 126

Figure 33: Cellular context of TLR5 engagement by UPEC FliC in the bladder leading to early IL-10 induction...... 127

Figure 34: Prophylactic protection against CFT073 infection using FliC...... 136

Figure 35: Therapeutic protection against CFT073 infection using FliC...... 137

xii

List of Tables

Table 1: List of functions mediated by UPEC flagella during UTI...... 20

Table 2: FliC mediated host responses reported in previous studies...... 25

Table 3: Microbial triggers of IL-10...... 31

Table 4: Methods for extraction of purification of FliC as applied in previous studies. 38

Table 5: Molecular weight of FliC reported from various bacteria...... 39

Table 6: Bacterial strains used in this chapter...... 45

Table 7: Primers used to generate mutant strains in this chapter...... 46

Table 8: Extraction of FliC with and without IPTG in various UPEC strains...... 60

Table 9: Mass spectrometric analysis of FliC from E. coli with co-purified proteins. ... 64

Table 10: Bacterial strains used in this chapter...... 84

Table 11: Retrospective colony counts of bacterial inoculum...... 97

Table 12: Comparison of cytokines differentially expressed in RNA sequencing data and multiplex assays...... 117

Table 13: Genes upregulated in bladder transcriptome in response to FliC that are previously reported...... 119

Table 14: Genes differentially expressed (all down-regulated) in response to the FliC stimuli in the knockout mice...... 124

Table 15: Retrospective CFU count of bacterial inoculum used in this chapter...... 133

xiii

Abbreviations

°C Degree centigrade Ω Omega % Percentage µF Micro farad µg Micro gram µl Micro litter µm Micro meter Ab Antibody Ag Antigen Ag43 Antigen 43 ADU Arbitrary Densitometric Units APC Antigen presenting cell APEC Avian pathogenic E. coli ANOVA Analysis of Variance ATCC American type culture collection BCA Bicinchoninic Acid Assay BCIP 5-Bromo-4-chloro-3-indolyl phosphate BD Beta-defensin Bp Base pair BREC Bovine retinal capillary endothelial cell BSA Bovine serum albumin CAUTI Catheter-associated urinary tract infection CbpA Choline-binding protein A CCL Chemokine (C-C motif) ligand CCR CC chemokine receptor CD Cluster of differentiation c-DNA Complementary DNA CFU Colony forming unit CK Creatine kinase CNF1 Cytotoxin necrotizing factor 1 CsCl Caesium chloride

CO2 Carbon di-oxide Ctrl Control group

xiv

CV Column volume CXCL Chemokine (C-X-C motif) ligand CXCR CXC chemokine receptor DAEC Diffusely adherent E. coli DC Dendric cell DEAE Diethylaminoethyl DNA Deoxyribonucleic acid dNTP Deoxynucleotide triphosphates EAEC Enteroaggregative E. coli EDTA Ethylenediaminetetraacetic acid EIEC Enteroinvasive E. coli ELISA Enzyme linked immunosorbent assay EPEC Enteropathogenic E. coli ETEC Enterotoxigenic E. coli EU Endotoxin unit Ex-PEC Extraintestinal pathogenic E. coli FliC Flagellin FLP Flippase FRT Flippase recognition target FRET Fluorescence Resonance Energy Transfer G Genome GAGs Glycosaminoglycans GAPDH Glyceraldehyde 3-phosphate dehydrogenase GBS Group B Streptococcus G-CSF Granulocyte-colony stimulating factor Gfp Green fluorescent protein GM-CSF Granulocyte-macrophage colony-stimulating factor H Hour

H2O Water HBB Hook-basal body HBMEC Human Brain Microvascular Endothelial Cells HIV Human immunodeficiency virus HlyA Hyaluronic acid HRP Horse-reddish peroxidase

IBC Intracellular bacterial communities IFN Interferon Ig Immunoglobulin IL Interleukin IPD Invasive pneumococcal disease IPTG Isopropyl β-D-1-thiogalactopyranoside IQR Interquartile range IRAK Interleukin-1 receptor-associated kinase IRF Interferon regulatory factors JAK-STAT Janus Kinase – signal transducer and activator of transcription JNK c-Jun N-terminal kinases Kbp Kilo base pair KBr Potassium bromide kDa Kilo Dalton KEGG Kyoto encyclopaedia of genes and genomes KnR Kanamycin resistance KO Knock out L Litre LAL Limulus amebocyte lysate LB Luria-Bertani LBA Luria-Bertani agar LPS Lipo-polysaccharide LRR Leucine-rich repeat MALDI-TOF Matrix-assisted laser desorption ionization time-of-flight MAPK Mitogen-activated protein kinases MCP Monocyte chemoattractant protein MHC Major histocompatibility complex MOI Multiplicity of infection Min Minute MIP Macrophage Inflammatory Proteins Ml Mililitre mM Millimolar MMP Matrix metalloproteinase MNEC Meningitis-associated E. coli

xvi

MoMP Major outer membrane protein mRNA Messenger RNA MS Mass spectrophotometry MW Molecular weight MyD88 Myeloid differentiation primary response 88 NaCl Sodium chloride NBT Nitro blue tetrazolium chloride NF-κB Nuclear factor kappa-light-chain-enhancer of activated B cells Ng Nanogram NK Natural killer cells NLRC-4 NLR family CARD domain-containing protein 4 Nt Nucleotide OD Optical density OMP Outer membrane protein P Protein PAGE Polyacrylamide gel electrophoresis PAMP Pathogen associated molecular pattern PBS Phosphate buffer saline PBS-T PBS with Tween (0.05%) PCR Polymerase chain reaction PMN Polymorphonuclear PRR Pathogen recognition receptor PspA Pneumococcal surface protein A RANTES Regulated on activation, normal T cell expressed and secreted Rcf / × g Relative centrifugal force RNA Ribonucleic acid RNAP RNA polymerase Rpm Revolution per minute RPMI 1640 Roswell Park Memorial Institute medium RT Room temperature RT-PCR Real time polymerase chain reaction SD Standard deviation SDS Sodium dodecyl sulphate Sec Second

xvii

SEM Standard error of the mean SEM Scanning electron microscope SOC Super Optimal broth with Catabolite repression Spp. Species SPSS Statistical Package for the Social Sciences STAT Signal Transducer and Activator of Transcription proteins STEC Shiga toxin E. coli T3SS Type III secretory system T4SS Type IV secretory system TAE Tris-acetate-EDTA TAK TGF-β-activated kinase TBS Tris-buffer saline TCA Trichloroacetic acid TGF-β Transforming growth factor beta Th T-helper TIR Toll-interleukin 1 receptor TLR Toll like receptor TMB 3,3’,5,5’-Tetramethylbenzidine TMTC Too many to count Tnf-α Tumour necrosis factor alpha TRAF TNF receptor associated factor TT Tetanus toxoid UPEC Uropathogenic E. coli USA Unites State of America UTI Urinary tract infection UV Ultra violet V Volt VEGF Vascular endothelial growth factor Wt Wild-type

xviii

Acknowledgement of Published and Unpublished Papers Included in this Thesis

Included in this thesis are 2 published papers in Appendix 3 and Appendix 4, for which I am the first author.

Appendix 3:

D. Acharya, M. J. Sullivan, B. L. Duell, T. Eveno, M. A. Schembri, G. C. Ulett. 2019. Physical extraction and fast protein liquid chromatography for purifying flagella filament from uropathogenic Escherichia coli for immune assay. Frontiers in Cellular and Infection Microbiology. 2019 Apr 24;9:118. doi: 10.3389/fcimb.2019.00118. (PMID: 31069177)

Appendix 4:

D. Acharya, M. J. Sullivan, B. L. Duell, K. G. K. Goh, L. Katupitiya, D. Gosling, M. N. Chamoun, A. Kakkanat, D. Chattopadhyay, M. Crowley, D.

K. Crossman, M. A. Schembri, G. C. Ulett. Rapid bladder IL-10 synthesis in

response to uropathogenic Escherichia coli is part of a defence strategy that is triggered by the major bacterial flagella filament FliC and contingent on TLR5. mSphere. 2019 Nov 27;4(6). pii: e00545-19. doi: 10.1128/mSphere.00545-19.

Appropriate acknowledgements of those who contributed to the research but did not qualify as authors are included in each paper.

(Signed) ______(Date)______Name of Student: Dhruba Acharya

(Countersigned) ______(Date)______Supervisor: Professor Glen C. Ulett

xix

1 Chapter 1: General introduction

Escherichia coli is one of the best or most thoroughly studied free-living microorganisms that normally inhabits the intestinal tracts of humans and animals but can cause infection in various parts of the body. The set of strains diverged from the commensal cohort of E. coli that have ability to cause serious infections in the urinary tract is collectively termed uropathogenic E. coli (UPEC). Urinary tract infections (UTIs) are a huge public health problem affecting 150 million people each year worldwide, with 50% of women experiencing a UTI at least once in their lifetime (1). The etiological agents of UTIs are diverse, and it is estimated that more than 80% of all forms of this infection are caused by UPEC (2). UTIs range from localised as cystitis or urethritis to severe and systemic as uroseptic shock (1). This is a global menace that has caused significant morbidity and healthcare expenditure (3). Although the biochemical and immunological signals that contribute to the development of UTI have been studied, the immune response to UTI which confers the degree of severity of infections is only partially understood.

UPEC strains possess multiple virulence factors that contribute to pathogenicity. Fimbriae, pili, flagella, lipopolysaccharides (LPS), autotransporter proteins (Ag43, UpaH), cytotoxic necrotizing factor 1 (CNF1), the pore-forming toxin alpha hemolysin (HlyA) and siderophore systems are among the arsenal of virulence factors produced by UPEC strains during infection (4-6). The presence of urine, an ideal broth for bacterial growth and proliferation, and the ability of UPEC to colonize the epithelial cells in the urinary tract represent few crucial determinants of pathogenicity (7-9). However, the multifaceted array of host bladder responses to UPEC, including secretion of proinflammatory cytokines, chemokines, growth factors, and antimicrobial peptides represent useful tools to combat infections (10-12). A recent study has examined host responses to UPEC UTI in mice and established the first genome-wide innate response profile of mouse bladder to UPEC (13). The whole bladder transcriptomic profile has provided a fundamental understanding of the complex and dynamic host-microbe interactions in the context of UPEC mediated UTI (13). Uncovering the role of specific UPEC components, such as flagella, will contribute to understand bladder pathogenesis.

Flagella are expressed on the surface of UPEC, conferring motility and contributing to virulence (9). UPEC flagella have been associated with enhanced urinary tract colonization and invasion of host cells (14, 15). Although flagella mediated immune response has been studied in numerous bacterial infections, including Salmonella spp., Pseudomonas aeruginosa, Helicobacter pylori, Vibrio cholera, and Proteus mirabilis, 1 less is known about the role of UPEC flagella in bladder immune responses (16).

The flagella filament is synthesized as a polymerized product of more than 20,000 protein monomers (termed flagellin or FliC) that is encoded by the gene fliC, as reviewed elsewhere (17). In mammals, flagella are characteristically sensed through the Toll-Like Receptor 5 (TLR5) sensor, which recognizes FliC as monomers but not the flagella filaments, as discussed elsewhere (16, 18-20). In addition, detection of FliC by Naip5 and Ipaf within the intracellular environment (19), and by TLR11 (21, 22) has been described. However, a comprehensive picture of how UPEC FliC engages innate immunity in the bladder during UTI is lacking (9, 23-25). Previous studies have offered insight into the ways in which flagella proteins interact with host cells (19, 26-28). So, the role of UPEC flagella is relevant to host-pathogen interaction studies, such as immune assays that are designed to reflect naturally-occurring interactions between host cells and flagella.

The contribution of innate immune elements in the control of UTI is not well-defined. Various studies over recent years have demonstrated the key role of a regulatory cytokine interleukin-10 (IL-10) in UPEC mediated UTI and other uropathogens (29). IL-10 plays pleiotropic roles in defence against infection; depending on the illness and causative pathogen. Frequently, IL-10 facilitates immune suppression to moderate inflammatory mechanisms (13, 30). A recent study has identified IL-10 as a key element of the bladder response to UPEC UTI in mice, as well as in patients with acute UTI (13). The early expression of IL-10 appears to aid in the control of acute infection (13). A central element in understanding the role of IL-10 in infectious disease is the elucidation of microbial products that elicit production of this key regulator of innate immune responses. The specific components of other bacterial pathogens that trigger IL-10 production have been characterized to various degrees (31-35). One such specific microbial component that can trigger IL-10 is flagella. The role of flagella from Yersinia enterocolitica and Salmonella Dublin has been demonstrated as a potent inducer of IL-10 (36, 37). The role of

Antigenic variations among FliC from different pathogens are well-characterized to trigger distinct immune responses (38, 39). H1 produced by pyelonephritic strain CFT073, H4 produced by multidrug resistance (MDR) strain EC958, and H7 produced by cystitic strain UTI89 are among the few flagellar antigens from UPEC studied to understand their contribution in UTI (14, 15, 38). Although UPEC has shown significant contribution to IL-10 induction in-vitro and in-vivo (40), the contribution of UPEC flagella, independent of other virulence factors inducing a host IL-10 response, has yet to be investigated. Hence, the central hypothesis of this study is that UPEC flagella 2 contribute to the induction of IL-10 in acute UTI.

Cells of the host immune system are often targeted by microbes, or their specific virulence factors to avoid, or subvert immune defences. Certain facets of the interaction between pathogens and immune cells lie at the interface between the fields of immunology and cell biology. The study of such areas is of worthy in understanding general mechanisms of pathogenesis and may prove particularly relevant in manipulating the immune system to fight infection. This study aims to define the bladder responses against UPEC flagella UTI. Defining the mechanism of engagement of the immune system by FliC that enables the protective IL-10 response allows to exploit this mechanism to develop new infection control strategies. It is anticipated that knowledge gained from this work will elucidate novel functions of this virulence factor that will broaden our understanding of UPEC pathogenesis.

1.1 Specific aims

1. To establish a genetic background for studying the role of flagella in isolation from other UPEC surface associated virulence factors 2. To optimize and establish a protocol for the extraction and purification of flagellin (FliC) from UPEC for immune assays 3. To define the role of FliC in immune modulation in mammalian cell culture and a murine model of urinary tract infection 4. To establish a global transcriptional profile of the bladder during exposure to purified FliC, and explore the role of TLR5 in this transcriptional profile 5. To examine the potential protective role of FliC induced innate immune responses during UPEC mediated UTI

1.2 Hypotheses

1. UPEC flagella will induce production of IL-10 in an in vitro model of bladder. 2. The major component of UPEC flagella, FliC, will induce production of IL-10 in an in vitro model of bladder. 3. UPEC FliC will induce production of IL-10 in the bladder in vivo. 4. Transcriptional analysis of the bladder response to FliC will reveal the broader context of IL-10 in the overall innate immune response to FliC. 5. FliC can be used to protect the host against infection in the bladder based on prophylactic or therapeutic treatment approaches.

2 Chapter 2: Literature review

2.1 Bacterium: Escherichia coli

E. coli is the most common member of the genus Escherichia, discovered in the human colon in 1885 by a German physician Theodor Escherich, and named after him. It is a gram negative, facultative anaerobic, nonsporulating bacterium with rod shaped morphology of ~2.0 μm length and 0.25-1.0 μm diameter. The acquisition of specific virulence traits leads to a variety of strains causing a broad spectrum of diseases. Various pathotypes of E. coli cause clinical syndromes including intestinal and extraintestinal diseases (8). There are six well defined categories of intestinal pathogens: enteropathogenic E. coli (EPEC), enterotoxigenic E. coli (ETEC), enteroaggregative E. coli (EAEC), enteroinvasive E. coli (EIEC) and diffusely adherent E. coli (DAEC) (8, 41). Uropathogenic E. coli (UPEC), the causal agent of UTI, and meningitis-associated E. coli (MNEC), causing meningitis and sepsis, are collectively referred to as extraintestinal pathogenic E. coli (ExPEC) (8, 42, 43).

2.2 Uropathogenic E. coli

A set of strains diverged from the commensal cohort of E. coli that has ability to cause serious infections of the urinary tract. These pathogenic strains of E. coli are collectively termed as UPEC. The primary reservoir of these strains is within the human intestinal tract. UPEC use various modes of transmission to colonize the urinary tract, employing diverse repertoire of virulence factors; often leading to UTIs (44). The genomes of UPEC isolates (e.g. strain CFT073) are 6-13% larger than the genome of the commensal E. coli strain K12, and contain 8-22% more open reading frames (45). UPEC typically express an array of adhesins and iron acquisition system required for extraintestinal survival, and generally lack type III secretory systems (T3SS) (8, 46). Common adhesive organelles equipped in UPEC are type 1, P, S, and F1C pili encoded by the fim, pap, sfa, and foc operons respectively (47). Among type V secreted toxins, collectively termed as autotransporters, vacuolating autotransporter toxin (Vat) and secreted autotransporter toxin (Sat) are often expressed by UPEC isolates (48). However, no single feature accurately defines an ExPEC isolate as UPEC, despite the identification and characterization of numerous virulence factors and colonization strategies utilized by UPEC.

Three different antigens are described in UPEC isolate: O (somatic), K (capsular polysaccharide), and H (flagellar) antigens. The O antigen defines more than 176 5 serogroups among which O1, O2, O4, O6, O7, O8, O16, O18, O25 and O75 are common to UPEC (49). No clear evidence of the involvement of K antigen in UPEC pathogenesis has been noted (50). However, isolates bearing the K1 antigen often encode more virulence-associated factors than other ExPEC isolates (48). On the basis of surface structures of the flagellar filaments, 56 serogroups (H1 to H56) of E. coli are defined (51). H1 antigens produced by strain CFT073, H4 produced by strain EC958, and H7 produced by strain UTI89 represent three different flagellar types produced by three different UPEC strains. These are among the few examples of flagellar antigens studied in the context of UTI (14, 15, 38).

2.3 Urinary tract infection

A UTI is defined as a significant number of pathogenic organisms in the urinary system with symptoms; such as burning micturition (burning sensation when passing urine) and haematuria (presence of red blood cells in urine) (52). Urinary tract infections are a huge public health problem affecting 150 million people each year worldwide (53). The infections can cause various diseases ranging from simple cases such as cystitis to severe cases such as uroseptic shock. Urinary tract infections are classified anatomically as either lower (cystitis) or upper (pyelonephritis), and clinically as uncomplicated (no structural or neurological abnormalities) or complicated (43, 54). These infections are a significant cause of morbidity in infants (55), older men (56) and women of all ages (43). UTIs can also be stratified as healthcare-associated UTI (HAUTI) and community-associated UTI (CAUTI) (57). In both cases, the most common causative agent is UPEC (up to 80% of all cases), as reviewed elsewhere (43). The gold standard for the diagnosis of UTI is the detection of a pathogenic bacterium along with the presence of clinical symptoms (58). Identification of E. coli in urine with ≥105 colony-forming units per millilitre (CFU/ml) is a widely used standard criteria to define UTI. However, various algorithms have been developed in order to diagnose uncomplicated and complicated UTI in several studies (59). Burning sensation or discomfort when passing urine, foul smell of urine, detection of leucocytes and nitrite, microscopic detection of epithelial cells, and the presence of pus cells and erythrocytes in urine, are the major symptoms characterizing a UTI (59). Antibiotic therapy is the foremost choice of treatment against UTIs. With increasing rates of UTI caused by multidrug resistant (MDR) strains, the need for alternative therapeutic strategies has increased. Natural plant extracts have been suggested as potential alternative therapies (60); and site-directed probiotic therapy is another promising therapeutic alternative for the prevention of UTI in the post-antibiotic era (61). However, 6 these remain controversial as some studies have demonstrated no significant benefit for probiotic treatments compared with placebo or no treatment (62). While antibiotic therapy remains the main treatment strategy in recent years, alternative chemicals extracted from natural products, and the development of vaccines may produce an alternate approach to UTI treatment (63).

2.3.1 Brief overview of UTI pathogenesis

Bacterial pathogenicity is described in terms of various mechanisms such as the quantity of infectious bacteria, the route of entry into the host, and the outcomes of host-pathogen interactions (64). UTI pathogenesis is a complex process which is influenced by the biological properties of both host and microbe. In a healthy individual, the uropathogens may arise from rectal microbiota and colonize in the lower urinary tract via perineal, vaginal, and periurethral areas (1). This is known as the ascending route of UTI. However, there are few uncommon routes such as haematogenous and lymphatic routes from systemic infections (65).

UPEC have a capacity to resist the sheer forces of urination, thereby getting access to the lower urinary tract from rectal microbiota, where they strengthen their attachment (66). Protection of UPEC adherence to urothelium is mediated by anatomical barriers such as integral membrane proteins called uroplakins and mucins (67, 68). Similarly, an antimicrobial anti-adherence property is exhibited by the bladder mucosa which is highly coated with sulphated and anionic glycosaminoglycans (GAGs) (69). The antimicrobial peptides released by uroepithelial cells, such as uromodulin, defensin, cathelicidin, lactoferrin, hepcidin and ribonuclease 6 and 7, prevent adhesion of bacteria to mucosal lining (70). It is also reported that secretory immunoglobulin A, produced by local mucosal cells inhibit UPEC binding to urothelial cells (71).

Upon successful exploitation of bladder defence strategies by UPEC, they adhere to the bladder epithelium (also known as facet cells) and initiate colonization (9, 72). Type 1 pili or fimbriae are capped by the adhesin, FimH, which specifically binds to the uroplakin protein UP1a expressed on urothelial cells (73). FimH also plays a role in UPEC invasion of the urothelium (25). The initial encounter of UPEC to bladder cells triggers host immune activation; leading to synthesis of proinflammatory cytokines and chemokines, as reviewed elsewhere (74). Subsequently, the robust infiltration of neutrophils as a host response to cytokines and chemokines leads to pyuria (i.e. pus present in the urine); a hallmark of infection used in the clinical diagnosis of UTI (75).

A subset of bacterial cells is internalized into facet cells but are quickly expelled as a part of host response (25). However, UPEC may gain access to the bladder epithelial cell cytoplasm developing a clonal, biofilm-like mass known as intracellular bacterial communities (IBCs) (76). Although the superficial facet cells having IBCs are exfoliated followed by excretion in urine, some of these bacteria escape this host response and form quiescent intracellular reservoirs for recurrent infections (77).

UPEC strains possess multiple virulence factors that contribute to pathogenicity. For example, fimbriae, pili, flagella, lipopolysaccharides (LPS), autotransporter proteins (Ag43, UpaH), cytotoxic necrotizing factor 1 (CNF1), the pore-forming toxin alpha hemolysin (HlyA) and siderophore systems are among the arsenal of virulence factors produced by UPEC during infection (4-6). Bacterial adherence to the urinary tract and local colonization due to these virulence factors leads to the activation of host immune responses (explained in the next section). In strains that cause cystitis, infections are confined to the bladder (8). In the case of strains causing pyelonephritis, a poorly controlled host response, or the actions of various bacterial immune evasion mechanisms, may subsequently allow the bacteria to gain access to the kidneys via ureters, and finally to the bloodstream to cause urosepsis (43). The ultimate outcomes of human UPEC infection may lead to a range of conditions including acute, self-limiting infections such as asymptomatic bacteriuria to recurrent or chronic UTI (78, 79).

2.3.2 Host immune response to UPEC infection

The adherence of UPEC to host cells is critical for the establishment of UTI (47). Multiple virulence factors of UPEC are responsible for provoking host inflammation that can ultimately influence bacterial dissemination and persistence in the bladder (4, 80). Pattern recognition receptor protein (PRR) is the host immune component that recognizes the specific virulent structure of a microbe (81). The structure of microbial cells that is recognised by PRR is termed as pathogen-associated molecular pattern (PAMP) (82). Bladders contain resident immune cells ready to encounter invading uropathogens. In addition to antigen presenting cells, such as macrophages and dendritic cells, the bladder is well-equipped with αβ and γδ T cells, and mucosal-associated invariant T cells, as reviewed elsewhere (74). Expression of PRR in host immune cells, mainly toll-like receptors (TLR), is critical in the immune response to infection, as shown in murine bladder infections (83, 84). Bladder inflammation in response to UPEC is rapid, pathogen specific and diverse (13). TLR4, TLR5 and TLR11 are the receptors of bladder and 8 kidney epithelial cells that recognise virulence components of UPEC (act as PAMP) and stimulate signaling pathways (84-87).

FimH mediated binding and entry to bladder mucosa is well characterized as the initial mechanism; triggering a complex pathway leading to host immune activation (77, 88). The immune response of host against UPEC is initially characterized by production of number of pro-inflammatory mediators, including various cytokines and chemokines. Multiple factors such as antimicrobial peptides, Tamm-Horsfall protein, cytokines including IL-6, TNF-α, IL-1β, G-CSF, IL-17, IL-10 and chemokines CXCL1, CXCL2, CXCL3, CXCL8, CCL4 are detected as a consequences of UPEC-induced immune stimulation in the bladder, as described in various in vitro and murine models (11, 13, 85, 89-92). In response to UPEC, early synthesis of proinflammatory cytokines and chemokines, such as IL-6, TNF-α, IL-1β, and G-CSF mediate neutrophil recruitment to the site of infection (93). Macrophages, dendritic cells and gamma delta-T cells are other immune cells that contribute in response to UPEC infections (94-96). Several studies have demonstrated the humoral immune response to UPEC-mediated bladder infections. Bacterial iron acquisition proteins and FimH were shown to evoke modest antibody- mediated protection against UPEC infection in mammals (97-99). Bladder immune cells sense bacterial cell components other than iron acquisition proteins and FimH, such as lipopolysaccharides (LPS), lipoteichoic acid, and CpG DNA, which initiate an intracellular cell signaling cascade to activate variety of immune response genes, as reviewed elsewhere (100). More recently, flagella from gram-negative bacteria have been studied for their immune modulating abilities, as reviewed elsewhere (16).

2.4 Flagella

A flagellum is a whip-like appendage that protrudes from the cell surface of certain bacteria and eukaryotic cells (Figure 1). It facilitates cell motility and is thus known as locomotory organelle. Diverse bacterial flagellation patterns have been described that are characteristics for each bacterial species. Major flagellation patterns are: (i) monotrichous (single polar flagella), (ii) amphitrichous (single flagellum on each of two opposite ends), (iii) lophotrichous (multiple flagella at the same spot), and (iv) peritrichous (flagella projecting in all directions) (101). The number of flagella may vary depending on the environmental conditions and cell cycle (102). Flagella numbers have been shown to increase upon surface contact to facilitate swarming across surfaces and also to decrease upon colonization in specific organs (23). Flagellated motility is essential for the pathogenesis wide variety of bacterial species, including UPEC with peritrichous flagellar 9 pattern (103).

2.4.1 Flagellar structure

The structure of a typical flagellum comprises three parts: the basal body (reversible motor), the hook (universal joint) and the filament (helical propeller) (Figure 1B) (104, 105). They are composed of more than thirty unique structural proteins, ranging in copy number from several to tens of thousands (106). Flagella are typically 10 µm long, 20 nm in diameter, and the molecular masses of the major flagellar filament protein flagellin (FliC) vary among bacterial species, ranging from 28 to 80 kDa (17, 107). The flagellar basal body is composed of the C-ring (cytoplasm) located in cytoplasm, MS-ring (membrane/ supramembrane) located in the inner cell membrane, P-ring (peptidoglycan) located in peptidoglycan layer, and the L-ring (LPS) located in the outer membrane (104). The basal body of the flagellum includes the motor that powers rotation (108). This motor can be subdivided into two components: the stator and the rotor. The stationary component attached to the peptidoglycan layer is the stator, which is made up of two proteins, MotA and MotB. The rotor (consisting multiple copies of the FliG protein) is non-covalently attached to Mot proteins. This is responsible for the torque generation (109-111). The rod and hook are of specific length while the filament length is variable. The filament is long, thin cylindrical structure that is helical in shape. Each filament is made up of 11 protofilaments situated approximately parallel to the filament axis (Figure 1C) (112-114). It is a homopolymer-macromolecule, comprising more than 20,000 FliC protein monomers (115). FliC comprises four linearly connected domains; two filament core domains (D0 and D1) with alpha-helical structures located in lateral N- and C- terminals, and two hypervariable region domains (D3 and D4) exposed as folded beta- sheet structure located in the central region (Figure 1D) (105). At the tip of the growing filament is a capping structure, the filament cap (FliD) (116). FliC is secreted through the central channel of the filament to be assembled in a helical structure at the distal end (110).

Figure 1: Schematic diagram of the structure of flagellum. (A) E. coli has peritrichous flagella. (B) The flagellum is comprised of basal body, hook and filament. (C) Flagellar filament is made up of 11 protofilaments. (D) Protofilament is composed of a single protein, flagellin (FliC). Each FliC monomer has four domains, D0, D1, D2 and D3 and is made up of ~500 amino acids.

2.4.2 Flagellar Biogenesis

More than fifty genes are required during flagellar synthesis which are located in at least seventeen operons (102). The operons are divided into three hierarchical transcriptional classes: early, middle and late, as shown in Figure 2 (117). There are three promoters named as class 1, class 2, and class 3 (102). During flagellar biogenesis, the bacteria utilize hierarchical regulatory networks that involve transcriptional and post-translational mechanisms to control the ordered expression of flagellar structural components. Early genes are transcribed from a class 1 promoter in a single operon, flhDC, which is sensitive to environmental and cell state sensors (118). The flhDC is an early class operon, and is essential for the transcriptional initiation of all genes in the flagellar cascade, and as such is called the master operon (119). Class 2 promoters of the middle-class genes are directly activated by FlhDC and transcribed by RNA polymerase (RNAP) containing the primary σ-factor, σ70 (120). Middle class operons containing more than thirty genes encode components involved in the formation of the hook-basal body complex (HBB) (120). The fliA gene encodes a transcription factor σ28, which is required for class 3 promoters (120, 121). Late operons contain genes involved in filament formation and flagellar rotation (120). Flagellin is the monomer subunit of the filament encoded by the class 3 gene, fliC (109). In addition to the late operons, FliA has been predicted to drive transcription of genes involved in chemotaxis, aerotaxis, and cyclic-di-GMP regulation of motility (122). FlhDC has also been implicated in the regulation of non-flagellar genes such as those required for cell division and anaerobic metabolism (123, 124), but the supporting data are not conclusive (122). Flagellar assembly proceeds from HBB complex to the distal component filament in a temporally- and spatially-regulated fashion. The earliest events in assembly involve the integral membrane components of basal body. The rest of the components are assembled through a flagellum-specific type III secretory (FT3SS) pathway (110).

Figure 2: Flagellar transcriptional hierarchy coupled to flagellar assembly. [Reproduced, with permission from Chilcott and Hughes, 2000 (102)]

2.4.3 Flagellar motility

Prokaryotic locomotion is of three types: flagellar, spirochaetal, and gliding movement. Spirochaetal motility is described in few plants and marine pathogens, where the rotary propellers are not required for the movement (125). Spiroplasma spp. has internal cytoskeletal filaments, and on requirement assembled into series of ribbons for motility (126). Synechococcus, a marine bacterium, swim that involves the generation of travelling waves in the cell surface; however, the mechanism of this mysterious form of movement is unknown (127). Type IV pili involving ‘twitching motility’ and ‘gliding motility’ were proposed in 70s(128). Bacterial motility is mostly guided by flagella where the swimming motility is described in liquid media, and the swarming motility in solid and aqueous surfaces (129, 130). Swarming bacteria produce extracellular materials (wetting agents), such as surfactants and exopolysaccharides, to increase surface wetness, and thus facilitate movement (130). Bacteria that swarm are also capable of swimming. The swarming of Salmonella involves elongation of the cells and an increase in the number

13 of flagella, and the motility occurs even in the solid surfaces (110). P. aeruginosa strain PAO1 uses both flagella and type IV pili to swarm (131, 132). Flagellar differentiation also occurs with the change in environmental conditions. The polar flagella in Vibrio parahaemolyticus are produced continuously in liquid medium. However, lateral flagella (for swarming) are produced when V. parahaemolyticus is grown on solid media (133). While producing peritrichous flagella that need substantial energy, the cell division stops, suggesting decrease bacterial growth rate (134). It has been estimated that swimming cells use about 2% of their biosynthetic energy output to synthesize flagella, and to swim (110).

The expression of flagella is bistable within a population of Salmonella, resulting in flagellated and non-flagellated subpopulations (135). Salmonella senses various types of cell envelope stress, which subsequently trigger downregulation of motility and flagellar synthesis (136). Similarly, E. coli shows dimorphic transition, especially when they are grown on surface of solid and aqueous media, resulting filamentous, multinucleate, and hyper-flagellate cells (137). However, the transcriptome of uropathogenic isolate revealed downregulation of flagellar genes compared to the strains isolated from urine (23). Hence, the factors associated with dimorphism and the possible mechanism in E. coli are less understood. E. coli CFT073 is a motile organism with peritrichous flagella (15, 138). The major sub structures of flagella are filaments, which are polymers of flagellin subunits encoded by the fliC gene (109). Mutations in fliC result in loss of flagellation and swarming motility in E. coli (109, 137). It is assumed that swarming in E. coli K-12 is more sensitive to any mutation affecting cell surface properties, thus resulting in a relatively large number of swarming-defective mutants. Genome wide screening of genes required for swarming properties of E. coli K-12 cells suggest deployment of various cellular functions to facilitate migration over viscous surfaces (139). The confirmation of the deletion of fliC from UPEC strains were accomplished by exploiting the role of this gene in bacterial motility (9). The phenotypes the mutants and flagella overexpressed UPEC strains were performed using motility assay in soft agar plates (140).

2.4.4 Flagellin variants in E. coli

The principal method of identifying and classifying pathogenic strains of E. coli has been O:H serotyping based on the presence of the cell surface lipopolysaccharide (LPS) O antigen and the flagellar H antigen. The H antigen of E. coli is characterized by a FliC (141). E. coli strains are classified into H-serotypes on the basis of the sero-reactivity of the variable antigenic domains (D3 and D4) of FliC (142). Surface structures of the 14 flagellar filaments of E. coli serotypes H1 to H53 are encoded in the fliC locus. However, Ratiner et al. discovered that in some strains, other than fliC, flkA, fllA, and flmA, encoded the H antigen and thus the H types in E. coli are numbered from 1 to 56 (51). Based on ultrastructure, Lawn et al., classified fifty different flagella H serotypes into six morphotypes (Type A to Type F) (H13, H22 and H50 were removed from the scheme) (143). H1 produced by strain CFT073, H4 produced by strain EC958, and H7 produced by strain UTI89 are among the few flagellar antigens from UPEC studied to understand their contribution in UTI (14, 15, 38).

2.5 Functions of bacterial flagella

Flagella contribute to the virulence of pathogenic bacteria via different functions. In addition to motility, flagella play a role in chemotaxis, adhesion and invasion of host cells, secretion of virulence factors, and induction of immune responses. A brief overview of various functions of flagella in bacterial pathogenesis is explained in following subsections. The functions of UPEC flagella during UTI are explained in Section 2.6.

2.5.1 Motility

The flagellum is essentially constructed in an ‘inside-out’ fashion, with the basal body attached to the inner membrane while the hook attaches the filament to the basal body. The motility of bacteria usually comprises two distinct modes of operation; (i) run, in which flagella rotate in a unidirectional manner, and (ii) tumble, which changes the direction of the next run (144). A run lasts a few seconds during which the motor rotates the left-handed helical flagellar filament counter-clockwise. Multiple filaments form a bundle, which propels the cell forward. A tumble lasts for only a fraction of second and is caused by a quick reversal of the motor rotation. This reversal of rotation causes a switch to the right-handed filament conformation, which disrupts the flagella bundle, thereby punctuating a run with a tumble (18, 144). Bacterial motility has been well defined in various forms, such as swimming, swarming, gliding, twitching and floating, which are mostly generated by flagella and pili (125).

Motility related functions in the context of bacterial pathogenesis include the movement of bacteria to the site of infection, colonization or invasion, and post-infection dispersal. The role of flagella in bacterial pathogenesis in regard to its motility has been extensively studied in many gram-negative motile bacteria, including Salmonella spp., P. aeruginosa, Helicobacter pylori, Vibrio cholera, and Proteus mirabilis, as reviewed elsewhere (64, 103).

It was initially hypothesised that flagellum-mediated motility would play a crucial role in UTI pathogenesis caused by UPEC (145, 146). Using defined mutations of UPEC strains CFT073 and UTI89, the role of flagella in bacterial colonization and fitness as contributing factors during UTI was quickly established (9, 15). However, in both studies, neither flagella-mediated motility nor chemotaxis was required for UPEC colonisation in bladder or kidney. They instead proposed the possibility of flagella contributing to the overall UPEC fitness thereby enhancing UTI pathogenesis. Interestingly, the same group of researchers have since demonstrated the ability of UPEC to use flagella-mediated motility during UTI to ascend to the upper urinary tract (147). Flagella-dependent invasion due to motility has also been demonstrated in renal cells (14). Taken together, it is evident that flagella-mediated motility contributes to the overall pathogenesis of UPEC infection.

2.5.2 Adhesion

Bacterial adherence is the primary step in colonization and invasion during pathogenesis. The most common structural component of the flagellum that is involved in adhesion is the filament (148). Several studies support the role of flagella in facilitating bacterial adherence to epithelial cell surfaces. For example, non-flagellated strains of Listeria monocytogenes and Salmonella Enteritidis are less able to adhere to human intestinal epithelial cells (Caco-2) than their flagellated counterparts (149, 150). The involvement of flagella in the adherence of E. coli to eukaryotic epithelial cells has also been shown (151). Purified FliC from EPEC and ETEC adhered to human intestinal and cervical epithelial cells (HeLa) (148). The role of flagella has also been described in adherence to human brain microvascular endothelial cells (HBMECs) (152). Similarly, FliC from EHEC (O157:H7) and EPEC (O127:H6) has shown adhesive properties to both human and bovine intestinal cells (153, 154). The involvement of flagella in bacterial adherence was also demonstrated in P. aeruginosa, Aeromonas spp. and Campylobacter jejuni (155- 157).

However, several studies have suggested that flagellin is not required for adhesion to host cells. For example, the flagella of avian pathogenic E. coli (APEC) did not significantly affect adhesion to caeca of a day-old chicken model of infection (158). Similarly, a fliC mutant of STEC (O113:H21) colonized intestinal epithelial cells as efficiently as the wild type strain in a murine model of infection (159). These studies indicate that the role of flagellin in cell adhesion varies amongst different host cell types and bacterial species. Therefore, flagellum-mediated adherence needs to be studied in specific contexts with 16 respect to bacterial species and host cell types that are relevant to the disease condition or pathogenic process being investigated; i.e. uropathogenic strains of bacteria along with cells derived from the urinary tract would be most appropriately used for studies of UTI, whereas gastrointestinal strains along with cells of the gastrointestinal tract would be used for studies of enteric infections.

Although early studies showed flagella-mediated adherence of E. coli to solid surfaces (160), the role of flagella in host cell adherence during UPEC pathogenesis has been demonstrated more recently (161). Yamamoto et al., found that the flagella-mediated attachment of UPEC to human ileal epithelia was more efficient than attachment of the same species to the urinary epithelia (161). It has been proposed that type 1 fimbriae facilitate UPEC adherence to human bladder epithelia and flagella allow bacteria to ascend from bladder to kidney (77, 147, 162, 163). So even if the flagella don’t directly contribute to UPEC colonisation during murine bladder infections, the bacterial fitness attributed by flagella aids in efficient urinary tract colonization (15). However, Kakkanat et al., recently demonstrated a strong association between the flagella of MDR strain EC958 and adherence to human bladder epithelial cells which was independent of type 1 fimbriae (38).

FliC sequence variation (explained in Section 2.4.4) determines the nature of the interaction between flagella and host cells; which has been well demonstrated in the context of E. coli pathotypes (151, 153, 154). H7 from EHEC (O157:H7) showed more affinity to bovine colon mucins than H6 from the EPEC (O127:H6) isolate (153). Similarly, H6 from EPEC adhered to HeLa and Hep-2 cells (151), and H7 from EHEC mediates adherence to bovine intestinal epithelial cells (154). The full extent of functional diversity related to how FliC variation influences bacterial attachment to host cells is yet to be defined.

2.5.3 Biofilm formation

A biofilm is a complex structural assembly of microorganisms attached to a cell surface via extracellular polymeric substances (164, 165). Biofilms contain an extracellular matrix mainly composed of proteins, polysaccharides, and/or DNA (166, 167). Flagella, pili, fimbriae, curli fibres, and Antigen 43 have been described as the factors that mediate biofilm formation; as extensively reviewed elsewhere (168). Crucial steps in biofilm formation includes: (i) the introduction of bacteria to the surface mediated by motility, (ii) adherence to host cell mediated by bacterial surface appendages and secreted adhesins, (iii) irreversible attachment due to species-specific surface proteins, and (iv) 17 formation of extracellular matrix around the bacterial cells as a result of host cell response to bacterial cell attachment (168). Bacterial biofilm formations are well-studied in, but not limited to, E. coli, P. aeruginosa, L. monocytogenes, Enterococcus faecalis, Acinetobacter baumannii, and Bacillus subtilis (169-174).

The role of flagella in these bacterial biofilm formations is however controversial. Flagella mediated motility for initial surface attachment and subsequent biofilm formation was critical in the food-borne pathogen L. monocytogenes and P. aeruginosa PA14 (171, 175). However, studies have also reported no role for flagella in E. coli K-12 and P. aeruginosa PAO1 in biofilm formation (176, 177). Nevertheless, majority of the literature accepts the role of flagella-mediated motility; at least in the initial colonization of cell surfaces during biofilm formation (178). A recent study reported only a structural role for flagella during E. coli biofilm formation; with curli reported as a major contributing factor (179). Interestingly, flagella from E. coli was found to be important throughout all stages of biofilm development; from early attachment to matured biofilms (180).

UPEC have long been studied for their ability to generate biofilms (77, 178, 181). Primarily, the contribution of the amyloid-like bacterial protein, curli, and F9 fimbriae are reported in UPEC biofilm formation (167). Only a few studies have reported the role of flagella-mediated motility from UPEC in biofilm formation during UTI (15, 147, 163). A genomic study has revealed multiple genes in cystitis strain UTI89 that are involved in biofilm formation (182). The fliC gene was identified as one among three genes that contribute in UPEC biofilm formation (182). Similarly, the contribution of flagella during biofilm formation, particularly during initial pellicle formation, was reported in UPEC UTI89 (166).

Bacterial biofilm formation is therefore well-studied; particularly in the context of E. coli. Multiple cellular, environmental, and host factors contribute to biofilm formation. Although this property of bacterial pathogenesis is well characterized in UPEC isolates, the role of flagella, independent to other surface structures in biofilm formation during UPEC mediated UTI, are less studied.

2.5.4 Secretion

The bacterial flagellum is a special type III secretory system (T3SS) apparatus with dual functions, both in flagellum biogenesis and for secretion of virulent factors in several pathogens, as reviewed elsewhere (64, 183). The flagella-mediated type III secretory

18 system (FT3SS) was functionally assessed by detecting the non-structural flagellar protein, FlgM (anti sigma factor in flagellar biogenesis) expelled into a growth medium (184). This apparatus was also described in the secretion of virulence associated phospholipase, YplA of Y. enterocolitica, and some virulence determinants from B. thuringiensis (185, 186). Even in organisms lacking T3SS, flagellar apparatus plays a key role in virulence, as shown in C. jejuni (187). A modified FT3SS pathway of B. halodurans was reported in the secretion of a therapeutic peptide into the extracellular space (188). Similarly, E. coli FT3SS was shown to secret heterologous polypeptides into the growth medium (189). The FT3SS of S. Typhimurium was manipulated to export recombinant neuroactive peptides through the flagellum into the surrounding medium (190). Recently, by means of a modified FT3SS and a modular plasmid system in E. coli, secretion of a range of recombinant proteins into the extracellular media was reported (191). Since, UPEC generally lacks T3SS (192), the focused study of FT3SS may provide insight into the pathogenic mechanisms of this uropathogen; in particular, the role of FT3SS in the secretion of virulence factors.

2.6 Role of UPEC flagella in UTI

The role of UPEC flagella in the pathogenesis of UTI has been the subject of numerous studies over the past two decades. The most established function of UPEC flagella during UTI is flagella-mediated motility in bacterial cell migration, as reviewed elsewhere (106). UPEC from the rectal microbiota colonize in the perineal, vaginal, and periurethral areas. Subsequently, they gain access to urethra followed by migration to bladder. No role of flagella has been shown in UPEC colonization in urinary bladder independent of other virulence factors, such as type 1 fimbriae and pili (9, 15). Only a fitness advantage has been reported for wild-type UPEC strains; when compared against both flagella and chemotaxis mutants (9). UPEC adherence to mouse ileal epithelia and bladder epithelia were reported (161) (38). The interaction of UPEC with bladder epithelial defence system leads to cellular invasion and IBC formation, as explained in section 2.3.1. Subsequently, UPEC form biofilms. The formation of bacterial communities with biofilm-like properties were first documented for UPEC using murine model of infection (77). A plethora of virulence factors, such as fimbriae, pili, curli, and various toxins and adhesins were reported to contribute to biofilm formation, as reviewed elsewhere (63). However, a specific role of flagella, beside its structural presence and motility, has not been demonstrated in UPEC-mediated UTI. The maturation of biofilms and subsequent dispersal of UPEC leads to the ascending infection. The in vivo experiments on a CBA 19 mouse model of ascending UTI (transurethral challenges and co-challenges) with four different mutants of UPEC strain CFT073, suggested the possible contribution of flagella to the increase of pathogenesis during active infection (9). The dissemination of UPEC CFT073 was monitored during UTI in real time using a biphotonic imaging technique (147). This work has provided substantial evidences of UPEC using flagella-mediated motility during UTI to ascend to the upper urinary tract and disseminate within the host. The role of flagella during the UPEC ascent from bladder to kidney was demonstrated in other UPEC strains, such as CFT073 and NU149, in murine models of infection (162, 163). In order to understand the mechanism of renal colonization by UPEC, the adherence ability of UPEC AL511 to mouse collecting duct cells (mkpCCDcl4) were investigated. The flagellum filament assembly and motor proteins MotA and MotB were required for UPEC AL511 uptake into collecting duct cells; utilizing a β-actin-dependent mechanism (14). The adhesins Afa/Dr and type 1 pilus mediated invasion, and the role of cytotoxic necrotizing factor (CNF 1) produced by pyelonephritic strains of E. coli, are well characterized (193); however, the role of flagella in the UPEC infection of bladder cells is less clear (193). To sum up the above-mentioned functions of intact flagella during UPEC UTI, I have listed the major literature contributions in Table 1.

Table 1: List of functions mediated by UPEC flagella during UTI.

Functions of flagella Model/strain Reference

Bacterial fitness In-vivo/CFT073 (9)

Added efficiency in colonisation In vivo/UTI89 (15)

Adherence to bladder epithelium In-vitro/EC958 (38)

Biofilm formation In-vitro/UTI89 (166)

Ascend from bladder to kidney In-vivo/CFT073 (147, 162)

In vivo/NU149 (163)

Invasion by renal cells In-vitro/AL511 (14)

Most of the above-mentioned studies have shown that flagella-mediated motility is involved mainly in two steps of UTI pathogenesis; (i) movement of UPEC from perineal or vaginal area towards urethra and urinary bladder, and (ii) ascending of UPEC from

20 bladder to kidney. The studies also reported some non-specific interactions between flagella and host cells which were mostly related to the biophysical properties of flagella. However, the major role of UPEC flagella is their contribution to cytokine synthesis as a result of the host immune response to bacterial cells. This property is described in the following section.

2.7 Host immune response to flagella

In addition to the role of flagella in motility, adhesion, secretion, and biofilm formation, many studies have reported their role in the induction of both arms of the immune system- the innate and adaptive immune response, as reviewed elsewhere (16). Better clearance of flagellated strains in comparison to their non-flagellated derivatives demonstrate the potential ability of flagella to evoke host immune responses (194, 195). Earlier studies focused on the role of LPS and other surface structures and secreted proteins in the pathogenesis of gram-negative bacteria until the discovery of host TLR5 (26). Since then, the role of bacterial flagella in the induction of immune responses via the ligand TLR5 has been thoroughly characterized in various animal models (27, 196, 197).

The structure of TLR5 is organized into three domains: Leucine-rich repeat (LRR) involved in flagella recognition, a membrane-spanning motif, and toll-interleukin 1 receptor (TIR) involved in transmembrane communication (198). The major flagellar filament protein, FliC, is a potent immune stimulator, which is exclusively detected by TLR5 in extracellular environment (26, 199). This transmembrane receptor is expressed in monocytes, macrophages, neutrophils, natural killer (NK) cells, immature dendritic cells, and epithelial cells (199-203). TLR5 that lacks certain regions of either the LRR or Toll/Il-1R homology region are unable to induce immune responses; indicating that both of these domains of TLR5 are required to generate a signal in response to FliC (199). The TLR5 recognition site in FliC lies within the conserved D1 domain in the tertiary structure, whereas D0 was found to contribute to the activation of TLR5 but shwoed so significant effect on binding (196). The highly conserved concavity on TLR5 formed by β-sheets on one face of leucine-rich repeat (LRR) structure serves as the FliC recognition site (27, 84). Since this recognition site is often hidden inside a complex filamentous structure, only FliC monomers can be recognized by TLR5, not the polymers (26).

The recognition of FliC by TLR5 leads to both myeloid differentiation primary response 88 (MyD88)-dependent and independent signaling pathways (Figure 2). Upon activation with FliC, homodimers of TLR5 induce the MyD88-dependent signaling pathway

21 through mitogen-activated protein kinase (MAPK) and inhibitor of κB (IκB) pathways, leading to the induction of activator protein-1 (AP-1) and nuclear factor κB (NF-κB) respectively; subsequently upregulating the genes to produce pro-inflammatory cytokines such as tumour necrosis factor-alpha (TNF-α), IL-1, IL-6, and IL-8 (16, 26, 199, 204- 206). The recognition of FliC by heterodimer TLR5/TLR4 is MyD88-independent and occurs via the interferon response factor 3 (IRF3) pathway, which results in the production of interferon-beta (IFN-β) (207).

Salmonella translocates FliC into the host cell cytoplasm via T3SS (208). A different pathway has been described for such cytoplasmic FliC that is recognized by the mammalian cell cytosolic sensors NLR family apoptosis inhibitory protein 5 (Naip5) and Ipaf (205, 209). These are intracellular PRRs expressed in myeloid cells only (210). When FliC from Salmonella and Legionella pneumophila is delivered into the cytosol by T3SS and type IV secretion system (T4SS) respectively, Ipaf dependent caspase 1 is activated, leading to maturation of IL-1β and IL-18 and apoptosis (205, 211). This suggest that the activation of the Ipaf cascade occurs in bacteria that express both FliC and secretory systems; however, the TLR5 mediated cascade is induced by FliC only. Since UPEC do not harbour T3SS, it can be speculated that FliC from UPEC are only recognised by TLR5.

Interestingly, unlike the conventional pro-inflammatory axis as described by the majority of the studies during flagella-mediated host response via TLR5 interaction, C. jejuni flagella instead promote an anti-inflammatory axis via glycan-Siglec-10 engagement (212). However, this pathway is triggered mainly by pseudaminic acid coupled with C. jejuni flagellin. Similarly, activation of the innate immune system by periplasmic flagella from a spirochaete Treponema pallidum is triggered through TLR2 interaction (213). Recently, a study has shown recognition of FliC by TLR11 which is highly expressed in the epithelial cells in various organs such as the intestine, lungs, and skin (21, 22).

The FliC mediated inflammatory response is studied in a diverse range of bacterial species, including Salmonella spp., E. coli, H. pylori, and C. jejuni (84, 106, 214). The major cytokines and chemokines produced by host cells in response to FliC are listed in Table 2. Interestingly, the differences in flagella mediated immunogenicity among flagellar variants of S. Typhi was demonstrated recently (39). The transcriptome of THP- 1 cells infected with the S. Typhi derivatives was examined by DNA microarray analysis of the host mRNA populations. S. Typhi expressing Hd and Hj flagellin induced highly similar transcription patterns in host cells, with higher numbers of differentially expressed 22 genes, compared to the Hz66 or ∆fliC derivatives, suggesting the differences in the phenotypic properties of S. Typhi flagella variation could impact on the pathogenesis of S. Typhi (39). The differences in invasion and immunogenicity observed between FliC variants from S. Typhi suggests that FliC from other motile bacteria, including UPEC strains, might differ in immune modulating abilities.

Figure 3: Signal transduction by FliC in mammalian cells.

[Reproduced, with permission from Hajam et. al., (2017) (16)]

AP-1, Activator protein-1; IRF3, interferon response factor 3; IRAK, IL-1 receptor associated kinase; MAPK, mitogen-activated protein kinase; MyD88, myeloid differentiation factor 88; NF-κB, nuclear factor ‘kappa-light-chain-enhancer’ of activated B cells; TAK1, transforming growth factor-beta-activated kinase 1; TRAF6, TNF receptor associated factor 6

Table 2: FliC mediated host responses reported in previous studies. Microbe/Pathogen Experiment Key host responses References model/Cell line S. Typhi In vitro; PBMC TNF- α, IL-1β, IL-6, IL- (206) 10 S. Enteritidis In vitro; PBMC TNF- α (215) S. Typhimurium P. aeruginosa Y. enterocolitica E. coli Enteroaggregative E. In vitro; Caco-2 IL-8 (216) coli (EAEC) S. Enteritidis In vitro; PBMC, TNF- α (204) S. Typhimurium THP-1 P. aeruginosa L. monocytogenes In vivo/ In vitro; TNF- α (In vitro); IL-6 (26) CHO, RAW TT10 (In vivo) macrophages

S. Typhimurium In vitro; COS-7, IL-8 (199) 293, HeLa

S. Dublin In vivo/ In vitro; NO synthase (In vitro) (217) DLD-1, Caco- TNF-α, IL-6, IL12p40, 2BBe IL-10, MIP-1α (In vivo) S. Enteritidis In vitro; HeNC2, TNF-α, NO (218) GG2EE, THP-1 S. Enteritidis In vitro; Caco-2 hBD-2 (219) S. Typhimurium In vitro; Cac0-2, ccl20, il8 (220) T84 Enterohemorrhagic In vitro; Caco-2 IL-8 (221) E. coli (EHEC) S. Enteritidis In vitro; HeNC2, IFN-β (207) GG2EE S. Enteritidis In vivo TNF-α, IL-6, MIP-1α and (222) MIP-2 P. aeruginosa In vitro; CF15 IL-8 (223) S. Typhimurium In vivo cxcl1, cxcl2, ccl2, il6, tnfα (84) Y. In vivo (i.p) il22, il23a, il17c, il17f, (224) pseudotuberculosis il1b, il6, ccl20, csf3, cxcl10, cxcl2. mmp13 reg3g, reg3b, s100a9, lcn2, hamp S. Typhimurium In vivo (systemic) reg3a (225) S. Typhimurium In vivo (systemic) il23, il23p19, il12p40 (226) (upregulate) il6, il1b (downregulate) P. aeruginosa In vivo (p.a.) TNF-α, IL1-β (227) (decreased), IL-10 (increased)

S. Typhimurium In vivo (systemic) TNF-α, IL1-α, RANTES, (228) IL-6, G-CSF, KC S. Typhimurium In vivo (i.p) IL-6, IL-12, KC, tnf, il6, (229) Lung infection il1, il10, ifnγ, ccl3, ccl4, model cxcl1 S. Typhimurium In vivo (systemic) Il22, il17a, il17f (230) S. Typhimurium In vitro; MDM Cxcl-1, Cxcl-2 (231) S. Typhimurium In vitro; DC IL-4, IL-13 (198) P. aeruginosa In vitro; HCECs IL-6, IL-8 (232) Abbreviations, PBMC: Peripheral blood mononuclear cells; Caco-2: Human epithelial colorectal adenocarcinoma cells; THP1: Human monocyte cells; CHO: Chinese hamster ovary cells; RAW TT10: Mouse macrophages; COS-7: Simian fibroblast-like cells; HeLa: Human cervical carcinoma cells; DLD-1: Human colorectal adenocarcinoma cells; HeNC2: Murine macrophage cells; GG2EE: Murine macrophage cells; CF15: Cyctic fibrosis epithelial cells; MDM: Medullary collecting duct cells (Monocyte derived macrophage); HCEC: Human corneal epithelial cells

It is evident from the examined literature that the major structural protein of flagellar filament, FliC, is responsible for triggering the host immune cascade, not the whole intact flagella. However, only FliC in monomeric forms, not in polymeric or filamentous forms, can bind to host cell receptors. In mammals, flagella are characteristically sensed through TLR5 that recognizes FliC monomers but not flagella filaments, as described in previous studies (27, 84, 233). However, the mechanism of monomerization of flagella filaments to FliC in natural infection has not been studied in the context of UPEC UTI. This raised the question: would FliC monomers be produced in vivo? Exposure to FliC in Salmonella infections resulted high levels of serum anti-flagellin antibodies (234, 235). Similarly, FliC specific CD4+ T cells are revealed in lymphoid organs after oral Salmonella infection (236). Both evidences suggest that FliC monomers are exposed to TLR5-expressing host immune cells during natural infection. However, the mechanism by which monomeric FliC is made available to be recognised by TLR5 remains elusive. Secretion of virulence factors in several pathogens using FT3SS is explained in Section 2.5.4. More than 30 proteins, including FliC were secreted into culture media from S. Typhimurium using T3SS (237). It was proposed that FliC was secreted to the external environment by mistake. For example, FliC monomers were secreted to media in the absence of FliD, a cap protein which helps flagellin to polymerise into flagellar filaments (238). However, a novel mechanism of FliC monomer secretion through a host-dependent process was described in pathogenic Salmonella spp. (239). Lysophospholipid in the host cells sensed by Salmonella trigger secretion of FliC monomers de-novo (239). This suggests that FliC monomers could be produced in vivo during natural infection.

2.8 Interleukin-10

Interleukin 10 (IL-10) is a dimer composed of two 18.5 kDa proteins and is a founding member of ‘IL-10 family’ of cytokines (240). IL-10 is an anti-inflammatory cytokine that functions in different stages of the immune response; mitigating inflammation and preventing autoimmune diseases (241). Major cellular sources of IL-10 are monocyte/macrophages, dendritic cells, CD4+ and regulatory T cells (242, 243). Mast cells, NK cells, eosinophils, neutrophils and B-cells also produce IL-10 (244). However, production of IL-10 might not be the induction of single cell population. A recent study suggested that monocyte and uroepithelial cells together produce IL-10; implying synergistic effect on IL-10 production (40).

IL-10 is well-studied for its role in the regulation of inflammation, hence called a master regulator of innate immune system (30). Initially, it was described as cytokine synthesis inhibitory factor (CSIF) produced by Th2 cells that inhibited activation and cytokine production by Th1 cells (245). Later, it was shown that IL-10 inhibit a broad spectrum of activated macrophage/monocyte functions, as reviewed elsewhere (246). It inhibits MHC class II and co-stimulatory molecule B7-1/B7-2 expression on monocytes and macrophages; limiting the production of pro-inflammatory cytokines such as IL-1α , IL- 1β, IL-6, IL-12, IL-18 and TNF-α, and chemokines such as MCP-1, MCP-5, RANTES, IL-8, IP-10 and MIP-2 (244). IL-10 supresses both Th1 and Th2 responses as it sometimes acts as feedback inhibitor of T cell populations (247). IL-10 induces anti-inflammatory responses which are mediated through (i) IL-10 receptors, (ii) activation of signal transducer, and (iii) activator of transcription 3 (STAT 3) inhibition during the development of Th1 response (243, 246, 248). The effector functions of IL-10 are not limited to T cells, monocytes, and macrophages. It also activates other immune cells, including mast cells, cytotoxic T cells, NK cells and B-cells (243). In addition to its anti- inflammatory property which inhibits the production of various pro-inflammatory cytokines, IL-10 also moderates inflammation linked with strong Th1 responses (249). It inhibits phagocytosis and microbial killing through limiting the production of reactive oxygen and nitrogen intermediates in response to IFN-γ (250).

In myeloid cells, including macrophages and dendritic cells, IL-10 is produced following microbial product recognition by TLRs, and requires extracellular signal-related kinases 1 and 2 (ERK1/2) activation (251). Whereas, in lymphoid cells, the induction of IL-10 requires the signaling adaptor molecule MyD88 and TIR containing adaptor molecule-1 (243, 252). In addition, IL-10 is also induced from immune cells via TLR-independent 28 stimuli, including C-type lectin receptors and caspase recruitment domain family member 9 (CARD9) (253, 254).

2.8.1 Role of IL-10 in infectious disease pathogenesis

A pathogen can be benefited from regulating the inflammatory response, both in order to facilitate establishment of colonization and to avoid life-threatening host manifestations. When IL-10 overcontrol protective T cell responses, the infection is not resolved, and leads to chronicity. Whereas, the absence of IL-10 could enhance inflammation and leads to fatal host-mediated pathology. A successful infection control depends on a fine balance between inflammatory immune response and immunoregulatory mechanism that limits host cell damage. IL-10 has been shown to play a critical role to maintain this equilibrium in numerous infections.

The potential pathogenic role of IL-10 in HIV infection was demonstrated in late 90s, where increased serum IL-10 level was shown in infected individuals compared to healthy controls; suggesting the role of IL-10 in disease progression (255). Similarly, IL-10 was proposed to limit pathogen clearance during Mycobacterium tuberculosis infection by its inhibitory effect on macrophage activation and dendritic cell (DC) function (256). IL-10 has been shown to control immune responses by regulating inflammation caused by numerous bacteria, including Streptococcus pyogenes, Streptococcus agalactiae, Streptococcus pneumoniae, Staphylococcus aureus, and Helicobacter pylori (31-33, 35, 257).

The absence of IL-10 has been reported in pathogen clearance. IL-10 blockade enhanced immune cells functions leading to viral clearance (258, 259) (259). Similarly, microbial clearance in absence of IL-10 was shown in numerous other pathogens including L. monocytogenes, Lymphocytic choriomeningitis virus, Leishmania major and Leishmania donovani (260-263). Activation of Th1 cells lead to production of pro-inflammatory cytokines. In the absence of regulatory cytokines, such as IL-10, the onset of inflammation helps to clear pathogens. However, sometime absence of IL-10 lead to detrimental effects of inflammation. Lethal inflammatory responses to some parasitic infections, including Toxoplasma gondii, Tyrpanosoma cruzi, and Plasmodium chabaudi, in the absence of IL-10 were reported, as reviewed elsewhere (256). Instead, protective roles of IL-10 were reported in bacterial and parasitic infections (264, 265).

Recently, whole bladder transcriptome in mice infected with UPEC showed IL-10 signaling pathways, implying the role of IL-10 in innate immune response against UPEC

UTI (13). UPEC induces IL-10 during infection to monocyte and uroepithelial cells together suggesting the cooperative effects might influence the pathogenesis of UPEC UTI (40). A down regulation of inflammatory response in acute infection with UPEC was proposed via IL-10 production from monocytes and mast cells, that appears to control infection (13, 29).

2.8.2 Microbial triggers of IL-10

A central element in understanding the role of IL-10 in infectious disease is the elucidation of microbial products that elicit production of this key regulator of innate immune responses. A range of cellular components that trigger the induction of IL-10 are listed in Table 3. LPS mediated activation of IL-10 is probably the best-studied IL-10 trigger to-date (266). Streptococcal M protein is a potent epitope for IL-10 stimulation along with peptidoglycan-embedded lipopeptides and glycopolymers in S. aureus cell wall (31, 34). Similarly, Pneumolysin, pneumococcal surface protein A (PspA), and choline-binding protein A (CbpA), during invasive pneumococcal disease (IPD), were shown to be potent inducers of IL-10 (33). Group B Streptococcus (GBS) glycolytic enzyme glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is an extracellular virulence factor that induces production of the immunosuppressive cytokine IL-10 (32). The peptidoglycan-embedded molecules expressed in the S. aureus cell wall bind TLR2 on APC and downregulate superantigen-induced T cell activation by triggering a canonical NF-κB–dependent IL-10 response (35). Similarly, H. pylori SS1 and SD4 proteins were reported to induce IL-10 via the TLR4/MyD88 signaling pathway (257).

Major outer membrane protein (MOMP) of Chlamydia was also reported to trigger IL-10 production (267). However, while IL-10 was produced in response to whole bacterial cells, MOMP from C. pneumoniae did not induced IL-10 production. (268).

Furthermore, flagella from gram-negative motile bacteria have been revealed as a potent immune inducer (as explained in section 2.7). However, there are limited studies on flagella mediated IL-10 production. Live flagellated Salmonella induced Th1 activity while soluble FliC protein induced Th2 response; suggesting influence on IL-10 production in the host under distinct conditions (269). Similarly, flagella from S. Typhi triggered IL-10 secretion in various host cells, such as splenocytes and monocytes (37, 215). The flagella of Y. enterocolitica were also reported as a potent inducer of IL-10 in a recent study (36). The role of UPEC flagella in UTI has not been studied so far. A comprehensive study on the ability of IL-10 induction by FliC from wide range of motile bacteria, including UPEC, is required. 30

Table 3: Microbial triggers of IL-10. Microbe Cellular components References

gram-negative bacteria Lipopolysaccharide (LPS) (266)

Streptococcus pyogenes M protein (31, 34)

S. pneumoniae Pneumolysin, pneumococcal surface (33) protein A (PspA), and choline-binding protein A (CbpA)

Group B Streptococcus Glyceraldehyde-3-phosphate (32) (GBS) dehydrogenase (GAPDH)

S. Typhi Flagella (269)

C. trachomatis Major outer membrane protein (267)

2.9 Protective role of flagellin

The most fascinating paradigm of FliC is its potential contribution to prevent or treat microbial infection. FliC has been shown to locally activate innate immunity and thereby limit the infection (270). In a respiratory infection model, intranasal administration of FliC has improved S. pneumoniae clearance in the lungs and promoted increased survival from infection (271). FliC treatment was effective when administered either before, during, or after infection establishment in C57BL/6 and BALB/c mice, suggesting both prophylactic as well as therapeutic potentials of FliC in limiting the severity of respiratory infection (271). Similarly, intratracheal instillation of recombinant FliC from S. Enteritidis stimulated an innate immune response in the lungs of several strains of mice characterized by the infiltration of neutrophil and rapid production of pro-inflammatory cytokines (222). The intranasal pre-treatment of mice with FliC induced strong protection against intratracheal P. aeruginosa infection, which was attributable to markedly improved bacterial clearance and reduced dissemination (272).

In an intestinal infection model, systemic administration of FliC induced upregulation of the antimicrobial peptide, RegIIIg, protecting antibiotic treated mice against vancomycin- resistance Enterococcus (VRE) colonization (225). Similarly, intraperitoneal administration of FliC has protected mice against the intestinal infection of Y. pseudotuberculosis (224). Whereas, peritoneal administration of FliC extracted from P. aeruginosa protected mice from E. coli infection; suggesting its cross protective activity (227). Administration of FliC 2 h before mice were infected with lethal dose of S. Typhimurium, reduced the mortality rate by 40%; suggesting a protective role for FliC against intestinal pathogens (228). A prophylactic role of FliC in Salmonella infection is also reported recently (273). Compared to controls, mice pre-treated with FliC displayed delayed body weight loss and mortality upon oral and intraperitoneal infection with S. Typhimurium; indicating that FliC can confer protection against enteric and systemic infections (273). In a study to determine the effect of innate immune activation against C. difficile infection, purified Salmonella-derived flagellin protected the mice from C. difficile colitis by delaying both C. difficile growth and toxin production in the colon and cecum (274).

The possible protective role of FliC was demonstrated in vaginal infection (275). However, mixed responses were reported in UTI models. TLR5 are expressed in mice bladders (84). FliC mediated inflammatory responses in the bladder leading to limited bacterial replication could be a strategy in host defence against UPEC infection. But, 32 native P. mirabilis flagellin did not protect mice against an ascending UTI (276).

Neutrophil infiltration following the innate immune response to FliC, might lead to an early protection against microbial infection (224, 271, 277). Beside proinflammatory cytokines, FliC induced antimicrobial peptides were reported in the protection of lungs and corneal infections (232, 272). FliC-induced protection is independent of B and T lymphocytes (271). However, there is a strong correlation of FliC with adaptive immunity; suggesting FliC as a potential vaccine candidate (269, 278). Dendritic cells (DCs) are instrumental for adaptive immune responses (279). It was shown that FliC drives MyD88-dependent Th2-type immunity in mice leading to the secretion of IL-4 and IL-13 by DCs as well as IgG1 responses (198). The upregulation of Th2 cytokines, IL-4 and IL-13, and the lack of Th1-polarizing cytokine IL-12p70 production by flagellin- stimulated DCs inferred that flagellin-dependent Th2 commitment could also depend on Th1-suppressive mechanisms, including the secretion of IL-10 or TGF-β (198, 280). In an intranasal immunization mouse model, the coadministration of FliC with tetanus toxoid (TT) induced significantly enhanced TT-specific immunoglobulin A (IgA) responses in both mucosal and systemic compartments and IgG responses in the systemic compartment; suggesting the role of FliC as an adjuvant leading to protection against systemic challenge with tetanus toxin (281).

The protective role of FliC via the induction of IL-22 has been shown in few studies. IL- 22, a cytokine from the IL-10 family, leads to the induction of antimicrobial molecules including C-type lectin RegIIIγ and calgranulin S100A9 via activation of the signal transducer and activator of transcription factor 3 (STAT-3) pathway (225, 226). Th17 lymphocytes produce the IL-17 and IL-22 cytokines that stimulate mucosal antimicrobial defences and tissue repair (282-285). Systemic administration of FliC triggered immediate excessive production of IL-22 and Th-17 related cytokines (such as IL-17A and IL-17F) through the TLR-5 signaling cascade (230). FliC administration induces IL- 22 dependent protection against vancomycin-resistant E. faecalis infection and rotavirus infections (225, 286). However, IL-22 mediated protection against intestinal Y. tuberculosis infection, independent of FliC, was also shown recently (224). Therefore, the IL-22 mediated protection of FliC in microbial infection remains in question.

A recent review has summarised the possible applications of FliC as an adjuvant, antitumor and radioprotective agent (16). Interestingly, FliC has already been considered as potent vaccine candidate and is currently in human clinical trials (287, 288). FliC is significantly less toxic than agonists of many other TLRs such as LPS (289). Thus, FliC 33 and flagella may offer notable potential to be used as a treatment approach to infectious diseases, including UTI.

2.10 Extraction and purification of flagellin

FliC monomers are the principle protein component of flagella, and are applicable for studying host pathogen interactions (26, 27). Various methods for extraction and purification of FliC have been described in diverse biological systems (summarized in Table 4). Methods described to date include assorted combinations of mechanical shearing, ultracentrifugation, heterologous expression in laboratory E. coli strains, and precipitation-inducing chemical treatments; isolating and concentrating FliC in order to explore how it interacts at the host cell interface.

The physical and chemical characterization of flagella was originally performed using differential centrifugation techniques in the 1950s (290). Laborious steps of multiple centrifugations and washings did not yield pure protein. Ion exchange chromatography with diethylaminoethyl cellulose (DEAE) columns were subsequently introduced to meet the rigorous criteria of purity and reproducibility (290). A procedure was described in 1971 for the purification of bacterial flagella in the form of a filament-hook-basal body complex (intact flagella) which was free from detectable contamination (291). However, intact flagella were less effective in the majority of the experimental designs. A useful method for the purification of FliC was reported by Ibrahim et al., (1985) (292). Since then, relatively few advances have been made to obtain pure FliC, despite wide interest on these cellular components as potent immune modulators and possible adjuvant, antitumor and radioprotective agents.

A standard procedure for FliC extraction generally involves the propagation of bacteria in complex media, followed by detachment of flagella and extraction. The extracted flagella are then purified as FliC and subjected to confirmation. A brief description of various standard steps during extraction and purification of FliC from motile bacteria in general are explained in the following sections.

Step 1: Cultivation. Although the choice of culture media for cultivation of cells depends on the organism, it has been reported that proteinaceous media leads to the contamination of yielded protein (292). An overnight incubation with mild shaking till late log phage is recommended (291). Vigorous shaking may cause prior de-flagellation as these are very delicate surface organelles. Cell harvestation at proper time of growth is very important for best results. Thus, the general ingredients of culture media and growth techniques are

34 crucial for efficient bacterial cell harvestation.

Step 2: De-flagellation. The abscission of flagella from cell surface can be done using various methods, including chemical means, pH shock, and mechanical shear. Among them, mechanical shearing is a widely applied de-flagellation technique using an homogenizer, blender, mixture, or vortex (9, 290, 293-295). Mechanical shearing followed by repetitively passing through syringes has increased the purity of FliC (296). It is also evident that mechanical detachment of flagella may result in considerable disintegration of the whole cell leading to contamination with other cell wall proteins (297). De-flagellation using acid is another popular technique being applied in flagella extraction. Ibrahim et al., (1985) used acid denaturation for de-flagellation of Salmonella spp. which yielded fairly pure flagella (292). Similarly, Kalmokoff et al., (1988) has reported de-flagellation of Methanococcus spp. using 1% Triton X-100 for solubilisation of intact cells. An even better result was reported while treating with Triton X-114 to induce phage separation and the extraction of flagella from the aqueous phase (293). Recently, Craige et al., (2013) reported the use of dibucaine to induce flagellar abscission from Chlamydomonas (298). A method has also been described for extracting intact flagella or HBB complex. Spheroplast were formed first with lysozyme, ethylenediaminetetraacetic acid (EDTA), sucrose, and Tris buffer, followed by lysis and ammonium sulphate precipitation of flagella (291, 299, 300).

Step 3: Extraction: Although high speed centrifugation (60,000 × g/30 min) has been a widely applied technique for the extraction of flagella (269, 293, 299), ultracentrifugation (100,000 × g/90 min) yields better protein in terms of purity (290, 292, 301). Filtration prior to ultrafiltration increases the purity (216). Flagella has also been extracted by a protein precipitation technique using chemicals, such as acetone and trichloroacetic acid (TCA) (295, 302).

Step 4: Purification: It is the purification step where filamentous forms of flagella are converted into short polypeptide or even monomer structures. The concept of purification after the successful extraction of flagella was conceived during the work of Martinez, (1985) (290). Previous successful reports on the purification of virus using DEAE cellulose columns prompted them to use the property of ionic charges for the purification of FliC (290). Since then, various chromatographical techniques have been applied for purification. Ultrafiltration was done prior to column chromatography during purification of FliC from E. coli (216). Similarly, FliC was extracted and purified from S. Typhimurium using affinity chromatography (269). Hence, the use of chromatography is 35 a popular method of choice for protein purification. However, some researchers have also used chemical methods of FliC purification. CsCl and KBr gradient centrifugation was used to purify FliC from Bacillus spp., E. coli, S. Typhimurium, Methanococcus spp., and Aeromonas spp. (291, 293, 296, 299, 301).

Satisfactory advances have not been seen in the protocols that employ selective nucleic acid or endotoxin removal or protein fractionation. Ultrafiltration and ion exchange chromatography were used to remove endotoxin contaminants (303, 304). However, these techniques were not suitable for the purification of macromolecules, such as FliC. Triton X-114 phase separation efficiently removed endotoxins from recombinant proteins, such as CK-BB, CK-MM, CK-MB, and cardiac Troponin I (305). Recently, a sequential technique was reported to remove endotoxin from a FliC preparation (233). The combination of repeated extraction in 1% Triton X-114 and subsequent column clean up using commercial kit yielded low amounts of endotoxin from the FliC preparation (233). Other studies also used commercial column clean up kits to accomplish the removal of contaminating endotoxins (295). A technique that exploits the high binding affinity of polymyxin B for the lipid A moiety (found in most endotoxins) to remove them from solutions using chromatography on polymyxin B Sepharose 4B was reported in 80s (306); and subsequently used in research (236). However, the use of polymyxin B is generally associated with reduced protein yields (307). Recently, ion exchange chromatography coupled with tangential flow filtration was reported for the effective removal of endotoxins, nucleic acids, and residual host-cell proteins (308).

Step 5: Confirmation: Electron microscopy is the gold standard for FliC confirmation. Serology is another easy, reliable, and less expensive method of FliC confirmation, which does not require expensive instruments. Freshly prepared, as well as commercially available, antisera are used to confirm FliC. Sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) is another widely applied technique to confirm FliC preparations. SDS-PAGE followed by coomassie staining detect FliC with a specific band size in agarose gel. Interestingly, different molecular sizes of FliC are reported from different bacteria (listed in Table 5). Although FliC confirmation using gel and staining is the most popular method, recent advances have been made using expensive techniques. FliC was confirmed by peptide mass fingerprinting using standard in-gel de-staining, reduction, alkylation and trypsinolysis procedures, and matrix-assisted laser desorption time-of-flight (MALDI-TOF) mass spectrometry (309).

Confirmation of the removal of endotoxin from the FliC preparation can be assessed using 36 commercial kits. EndoLisa kit (Hyglos GmbH), Endosafe PTS chromogenic Limulus amebocyte lysate assay (Charles River, MA) are among the many kits applied in recent researches (233, 308). Very few have addressed nucleic acid contamination on their FliC preparations. For example, a recent study has applied quanti-iT Picogreen DS DNA assay kit (Life Technologies, Carlsbad) to measure nucleic acid contamination (308). Although endotoxin is the major source of contamination for immunological assays in FliC preparations, contamination by nucleic acids and other surface proteins should also be considered while assessing FliC purifications.

Highly diverse biological properties of the predicted thousands of distinct types of flagella in bacteria (310) highlights the importance of careful examination of the roles of flagella and flagellin in experimental systems. There remains a need for an improvement in our current understanding of flagella biology, including, in particular, advances in the tools used to examine the interactions between flagella and cells of the immune system.

Table 4: Methods for extraction of purification of FliC as applied in previous studies.

Principle Details of Method Biological considerations Reference

Physical, Mechanical shearing of Multiple column elutions with (290) chromatography flagella, NaCl, insufficient data to ultracentrifugation, establish purity of FliC purification by ion exchange chromatography Chemical, Spheroplasts with Potential for isolating intact (291) spheroblast lysozyme and EDTA, flagella, chemically harsh production lysis with Triton X-100, conditions may affect protein precipitation with integrity, purity not addressed (NH₄)₂SO₄, differential centrifugation, and CsCl gradient centrifugation Chemical, Acid denaturation of Protein denaturation, purity (292) precipitation flagella, assessed only by microscopy, ultracentrifugation, endotoxin levels not reported (NH₄)₂SO₄ precipitation Detergent, Phase transition Detergent effects on protein (293) chromatography separation with Triton X- integrity, low yield, abundant 114, purification with contaminating protein column chromatography Physical, Mechanical shearing, Purity not addressed (301) centrifugation ultracentrifugation, KBr gradient centrifugation Mechanical shearing, Endotoxin levels not reported, (27) multiple rounds of sensitivity to detect extraneous

ultracentrifugation protein contamination unclear Physical, Mechanical shearing, Chemical precipitation effects (295) precipitation acetone precipitation, heat on protein integrity, unclearly treatment for FliC defined yield monomer Sequential Sequential cation- and Acid treatment to achieve (308) chromatography anion-exchange FliC monomers may affect chromatography, protein integrity, fermenter tangential flow-filtration use suitable for large scale

Table 5: Molecular weight of FliC reported from various bacteria. Source of FliC Mol. Wt. (kDa) Reference

S. Typhimurium ST1 (phase 2) 58 (299)

S. Typhimurium SJW1103 (phase 1) 53 (299)

S. Typhimurium 50 (311)

S. Dublin 55 (217)

Salmonella spp. 47 (295)

Salmonella serotypes 47.7 to 58.4 (292)

S. Enteritidis 52 (311)

B. subtilis 40 (300)

A. hydrophila 45 (296)

C. difficile W1194 39 (294)

M. voltae 33 and 31 (293)

E. coli BL21 ~70 (16)

EAEC 042 (044:H18) 65 (216)

UPEC CFT073 (H1) 60.9 (9, 147)

E. coli O157 (H7) ~60 (36, 233)

UPEC UTI89 (H7) 65 (15)

UTI is the most common infectious disease in women, yet compared to other tissues, little is known about mechanisms of the immune response in the bladder. Thus, a comprehensive examination of the bacterial components that trigger host defense mechanisms is very important to the field. A thorough understanding of the previous literature led me to believe that FliC represents a potential treatment agent against infectious diseases, including UTI. This study has hypothesized that UPEC FliC could induce early IL-10 production and aid in the control of UTI. Thus, I aimed to extract and purify FliC from UPEC and develop a comprehensive understanding of immune modulating properties of this protein in the context of acute UTI using both in vitro and in vivo models.

3 Chapter 3 Extraction and purification of FliC from UPEC for immune assay

My contributions to this chapter include:

• Conceived the experiments • Designed the experiments • Performed the assays • Analysed and interpreted the results • Prepared figures and tables • Writing and revision of chapter

Sections of this chapter are included in a published paper (Appendix 3).

D. Acharya, M. J. Sullivan, B. L. Duell, T. Eveno, M. A. Schembri, G. C. Ulett. 2019. Physical extraction and fast protein liquid chromatography for purifying flagella filament from uropathogenic Escherichia coli for immune assay. Front Cell Infect Microbiol. 2019 Apr 24;9:118. doi: 10.3389/fcimb.2019.00118. (PMID: 31069177)

The contributions of author’s to this publication were:

• Conceived the experiments (DA, BLD, MAS, GCU) • Designed the experiments (DA, BLD, MAS, GCU) • Performed the assays (DA, MJS, BLD, TE) • Analysed and interpreted the results (DA, MJS, BLD, MAS, GCU) • Prepared figures and tables (DA, BLD, MJS, GCU) • Writing and revision of manuscript (DA, MJS, BLD, MAS, GCU)

(Signed) ______(Date)______

Dhruba Acharya

(Countersigned) ______(Date)______

Supervisor: Professor Glen C. Ulett

3.1 Introduction

Flagella are surface exposed complex organelles that are traditionally known for their role in bacterial motility. Expression of flagella on bacteria allows cells to move in search of more favourable environments, such as nutrient rich conditions or along a chemotactic gradient (312). Flagella are expressed on the surface of a wide range of bacteria. The E. coli reference strain CFT073 is a motile organism with peritrichous flagella (15, 138). The major structural component of flagella is the filament that affords helical propeller properties to bacterial cells, and is the principle component recognized by the immune system; as reviewed elsewhere (16, 106). The filament is a polymerized product of more than 20,000 protein monomers, termed flagellin or FliC, mostly encoded by the fliC gene (17). Mutations in fliC result in loss of flagellation and swarming motility in E. coli (109, 137).

As an organelle, a flagellum comprises over thirty unique proteins that range in relative abundance from a few to tens of thousands (104-106). The structure of the flagellin monomer FliC was originally described in the context of supercoiling and different packing interactions (313). FliC comprises four linearly connected domains; two cores (D0 and D1) with alpha-helical structures in lateral N- and C- terminals, and two hypervariable (D3 and D4) that are exposed as folded beta-sheets in the central region. On the basis of the flagellar filament structure, 56 serogroups of E. coli are defined (H1 to H56) (142, 314). H1-type flagella are produced by the commonly studied uropathogenic E. coli (UPEC) reference strain, CFT073; whereas multidrug resistant and globally disseminated ST131 strains of UPEC produce H4 flagella, and the UPEC reference cystitis strain, UTI89, produces H7 flagella. Studies examining the biology of UPEC flagella have contributed a great deal to our understanding of its roles in UTI and disease pathogenesis (9, 14, 15, 38, 147, 166).

In addition to providing motility, flagella contribute to bacterial virulence and host- pathogen interactions via adhesive properties and by triggering immune responses; as reviewed elsewhere (64, 183). For example, strains of E. coli associated with meningitis are attenuated for adherence to brain microvascular endothelial cells when the bacteria lack flagella (152). The H6 and H7 flagella of EHEC and EPEC exhibit adhesive properties (151, 153, 154), and the H48 flagella from ETEC adheres to human Caco-2 cells (148). Together, these observations signify a role for flagella in host colonization. However, few non-motile strains of E. coli are reported to be associated with UTI (315, 316). In UPEC, flagella-mediated motility has been associated with the ascension of 42 bacteria from the bladder to the kidneys, where host-pathogen interactions leading to inflammation can prompt pyelonephritis (147). Other studies have also reported that UPEC flagella can promote urinary tract colonization and the invasion of host cells (14, 15) as well as biofilm formation (64, 166).

There is also evidence supporting more nuanced roles for flagella in E. coli disease pathogenesis, including findings of no major contribution of flagella-mediated motility in urinary tract colonization (9), and no role for avian pathogenic or shiga toxin-producing E. coli flagellin in adhesion to Hep-2 cells (158) or epithelial cells (159). These observations are reflective of the highly diverse biological properties of the predicted thousands of distinct types of flagella in bacteria (310) and highlight the importance of careful examination of the roles of flagella and flagellin in experimental systems. Finally, the nature of bacterial flagella as a potent immune activator of innate and adaptive immunity via the TLR host protein, TLR5, has been described; as reviewed elsewhere (16, 18-20). In this context, innate immune responses to flagella can direct the development of flagellin-specific adaptive immune responses which can modulate the production of flagella in the gut microbiome to help maintain mucosal barrier integrity (317). Thus, there remains a need for improvement in our current understanding of flagella biology, including, in particular, advances in the tools used to examine the interactions between flagella and cells of the immune system.

In studying FliC as the principle component of flagella, various methods for extraction and purification of the protein have been described in diverse biological systems, and these are summarized in Table 4 (Section 2.10). Methods described to date include assorted combinations of mechanical shearing, ultracentrifugation, heterologous expression in laboratory E. coli strains, and precipitation-inducing chemical treatments to isolate and concentrate FliC in order to explore how it interacts at the host cell interface (Table 4). However, these purification methods have provided little insight into the biology of highly purified, native forms of FliC because of inherent limitations in the methods used, which can adversely affect protein integrity and/or lead to extraneous protein or endotoxin contamination, which can effect downstream (especially immune) assays (307, 318, 319). Additionally, there have been few methodological advances to improve extraction and purification methods for FliC in recent years. A single method that yields pure FliC, free from endotoxin contamination and limiting processes of purification such as protein denaturation, would be valuable for studying the activities of FliC in host-pathogen interactions.

In this chapter, I sought to establish an optimized protocol for extraction and purification of FliC from UPEC to homogeneity; with particular reference to its application in downstream immune assays.

3.2 Materials and Methods

3.2.1 Bacterial strains and plasmid

The UPEC reference strain, CFT073 was used in this study. Additionally, a multiple gene- deficient derivative of wild-type (Wt) CFT073 carrying combined mutations in the 4 genes that encode type 1 fimbriae (fim), F1C/S fimbriae (foc), and pyelonephritis- associated pili (pap1 and pap2), designated CFT0734 was used (320). This strain lacks four major proteins located on the extracellular surface of UPEC, such that their removal is predicted to improve the purity of flagellin, FliC, based on purification methods described in this thesis.

Bacteria were grown at 37°C in lysogeny broth (LB) and on LB agar (1.5% agar unless otherwise stated) with antibiotic selection (kanamycin, 50 µg/mL) and IPTG induction (20 mM), as needed. A summary of the bacterial strains used in this chapter is listed in Table 6.

Table 6: Bacterial strains used in this chapter.

Strain Characteristics Reference

CFT073 CFT073 O6:H1 (ATCC 700928) (138) GU2639 CFT073fliC; KnR This work GU2139 CFT073/pflhDC); KnR This work GU2132 GU2639 + pMG600 (pflhDC); KnR This work CFT0734 CFT073 fim foc pap1 pap2 (320) GU2642 CFT0734fliC This work GU2647 CFT0734/pflhDC; KnR This work GU2648 GU2642 + pMG600 (pflhDC); KnR (for This work Carrier control) GU2627 pKD46 in MG1655 K12 E. coli; AmpR Lab stock GU2636 pKD46 in CFT0734; AmpR This work GU2638 CFT0734fliC::KnR This work Plasmid Relevant characteristics Source

pMG600 flhDC operon from Serratia in pVLT33; CmR (321) pKD4 Template plasmid for kan gene amplification (322) pKD46 -Red recombinase expression plasmid (322) pCP20 FLP synthesis under thermal control (322)

3.2.2 Construction of UPEC flagellar mutants

CFT073 wild-type (Wt) and CFT0734 were used to generate respective fliC-deficient derivative strains (devoid of flagellar filament) using a 3-way PCR overlap extension method, followed by λ-red mediated recombination (322). A schematic of the protocol used for fliC deletion is illustrated in Figure 4). All primers were designed using software Vector NTI Advance 11.5.3 (Table 7) and sourced from Sigma Aldrich (St. Louis, USA). The polymerase chain reaction (PCR) master mix contained 10 mM dNTPs, 10 µM each of forward and reverse primers, 5X Phusion HF buffer, and the enzyme Phusion polymerase (New England Biolab) unless otherwise stated. Electrophoresis was performed using 0.8 to 1.2% agarose gel unless stated otherwise (Bio-Rad, USA). Amplified PCR fragments were purified from gels using the QIAquick PCR purification kit as per manufacturer’s instruction (QIAGEN, USA). Electrocompetent cells were prepared using a protocol described elsewhere (323). All gene deletions were confirmed by PCR and sequencing. CFT073 containing IPTG-inducible pMG600 carrying flhDC were used as hyperflagellated strains.

Table 7: Primers used to generate mutant strains in this chapter.

Primer Sequence (5’ → 3’) * Application Amplicon fliC-Kan-Up-F1 GGGTGACGCTGATGGTGTAT 5’ region of 574 bp fliC fliC-Kan-Up-R2 CGAAGCAGCTCCAGCCTACACAT GTGCCATGATTCGTTATCC fliC-Kan-Down- CTAAGGAGGATATTCATATGTAA 3’ region of 575 bp F1 TCGCCGTAACCTGATTAACT fliC fliC-Kan-Down- TGCGAAGTTCATCCAGCATA R1 pKD4-KanR-F1 TGTGTAGGCTGGAGCTGCTTCG pKD4 KnR 1478 bp cassette pKD4-KanR-R1 CATATGAATATCCTCCTTAG pKD4 KnR cassette fliC-chk-F1 GTGAGTTTGCTGTCGCTGGT Sequencing 3071 bp (Wt) fliC-chk-R1 CTATTGCCTGTGCCACTTCA Sequencing 1339 bp (fliC)

Figure 4: Schematic representation of the construction of fliC deletion using λ-red mediated homologous recombination employing a 3-way PCR strategy. Primers 1 and 2 amplify upstream of chromosomal CFT073Δ4 DNA, whereas primers 5 and 6 amplify a downstream fragment of the same genome. Primers 3 and 4 amplify an FRT-KnR from pKD4. These three PCR amplified fragments were combined by 3-way PCR strategy. Electroporation of this fragment to pKD46 containing bacterial cells led to λ-red mediated homologous recombination. The transformants were selected. The FRT containing KnR was removed by using the temperature sensitive FLP helper plasmid (pCP20).

3.2.3 Motility assays

Overnight cultures were prepared in LB broth (with appropriate antibiotics where necessary) and each strain spotted on to the centre of a fresh 0.25% LB agar plate (n=3), supplemented with the appropriate inducer (20 mM IPTG) and/or antibiotic (kanamycin 50 µg/ml). Plates were incubated at 37°C for 9 h. The rate of motility was determined by measuring the diameter of the motility zone over time. Data are shown as the mean diameter (mm) of movement ± SEM for at least 3 independent experiments.

3.2.4 Flagella extraction using ultracentrifugation

The physical extraction of flagella was performed using the protocol described by Tahoun et al., (2015) (233) with minor modifications to achieve a higher degree of FliC purity. Briefly, bacterial cultures were grown overnight in 250 ml LB at 37°C with slow shaking (60 rpm) and were harvested by centrifugation at 4,100 × g for 30 min at 4°C. Bacterial pellets were resuspended in 20 ml PBS. To physically shear the flagella, the bacteria were agitated in 2.0 ml Safe-Lock Microcentrifuge Tubes (Eppendorf) containing two stainless steel ball bearings (5 mm) using a Tissue Lyzer II (QIAGEN, Netherlands) (5 × cycles of 30 sec at 30 Hz/30 sec on ice). The sheared bacterial suspensions were centrifuged at 15,000 × g for 10 min at 4°C to pellet the bacteria, and the supernatants, containing the sheared flagella, were passed through a 0.45 m nitrocellulose filter (Millipore) to remove any remaining bacteria. Bacteria-free solutions containing the sheared flagella were centrifuged at 135,000 × g for 90 min (Beckman coulter L-90K) at 4°C. The pellets were resuspended in 250 µl PBS, frozen (-20°C), and quantitated (Thermo Scientific Pierce BCA Protein Assay Kit #23227, USA).

I also applied the protocol for purification of bacterial flagellin as reported by Smith et al., (2003) (27) to compare protein yield and purity with that generated based on the protocol described in the current study. Briefly, bacterial cells were grown overnight in 250 ml LB medium (supplemented with 100 μg/ml of ampicillin and 20 mM IPTG) and were pelleted by centrifugation at 10,000 × g for 10 min at 4°C. Cell pellets were washed once in PBS, resuspended in 100 ml PBS, and sheared for 2 min at high speed in a Waring blender. The sheared suspension was centrifuged at 8,000 × g for 10 min, and the supernatant was centrifuged at 100,000 × g for 90 min (Beckman coulter L-90K) at 4°C. The pellets of flagellin filaments were resuspended in 20 ml PBS at 4°C overnight and centrifuged at 100,000 × g for 1 h. This washing step was repeated twice. The final pellets were resuspended in 250 µl PBS, frozen (-20°C), and quantitated (Thermo Scientific Pierce BCA Protein Assay Kit #23227, USA). 48

3.2.5 SDS-PAGE, Coomassie stain, and Western blot

The purity of FliC preparations was assessed by SDS-PAGE, Coomassie staining and western blots. Protein samples (between 1.0-12.5 g per lane, unless otherwise stated), were separated in 12% SDS-PAGE gels run at 200 V for 40 min. For Coomassie staining, gels were stained with brilliant blue solution for 1 h and de-stained (1% acetic acid) overnight for visualization using a Chemidoc XRS (Bio-Rad). For western blot, the gels were transferred to 0.45 µm nitrocellulose membranes (Bio-Rad #162-0115, USA) for 1 h at 100 V with cooling, and blocked with 5% skim milk in PBS-T. The membranes were incubated with a 1/100 dilution of polyclonal rabbit anti-flagella H-pool-E (H48+others) antibody (Staten Serum Institute, Denmark) for 1 h and washed three times in PBS-T for 5 min. The secondary antibody was a 1:500 dilution of goat anti-rabbit IgG HRP- conjugate (Santa Cruz Biotech #sc-2030, USA) for 1 h, subsequently washed four times in PBS-T (5 min). Blots were developed using 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) (Sigma). The reactions were stopped by the addition of water prior to image capture using a flatbed scanner Chemidoc XRS.

3.2.6 Mass spectrometry

Mass spectrophotometry (MS) was performed to identify several extraneous unknown proteins found to be present in initial FliC preparations. The MS was carried out using protein samples derived from CFT0734 or its fliC-deficient derivative. Proteins (2.5 µg) were resolved by SDS-PAGE, stained with Coomassie blue and de-stained (1% acetic acid) overnight. Proteins bands were isolated in 1% acetic acid and were analyzed at the Translational Research Institute (University of Queensland), Proteomics Core Facility, Brisbane.

3.2.7 Fast Protein Liquid Chromatography (FPLC)

Post-purification of FliC extracts was undertaken by size exclusion chromatography on an ÄKTA Pure protein purification system (GE Lifesciences). I used the Superdex 200 Increase 10/300 GL column with a 24 ml bed volume (GE Lifesciences) equilibrated with 1.5 column volume (CV) of PBS buffer at 0.4 ml per min. Prior to application, the FliC extracts were resuspended in 250 μl of PBS, heated at 60C (10 min) to generate monomers, cooled on ice for 2 min, and applied to the column using a 500 μl sample loop pre-filled with PBS. The 1.2 CV elution flow through was collected in 1 ml fractions using a Frac F9-R fraction collector (GE Lifesciences). The fractions were monitored for protein content by measuring the UV absorbance at both 215 nm and 280 nm throughout

49 the elution. The protein containing fraction(s) were subsequently concentrated approximately 8-fold using Amicon Ultra-4 10K Centrifugal Filters (Merck Millipore) (for example, 3 mL pool of fraction 13 samples from three preparations concentrated to 400 μl). The samples were stored at 80°C or were used directly in procedures, including endotoxin removal, protein estimation, SDS-PAGE, or in vitro stimulation assays. All

FLPC procedures were undertaken at 4°C. A workflow of the protocol used for FliC extraction and purification is illustrated in Figure 5.

Figure 5: Work flow schematic for extraction and chromatographical purification of FliC from UPEC CFT073. The protocol’s sequential steps of Culture and harvest (1), Deflagellation (2), Extraction (3), Purification (4), Decontamination (5), and Confirmation (6) are shown alongside schematics of the major elements comprising each step. Analytic tools used for quality control and validation of the FliC extracts, including MS are shown below the protocol sequential steps.

3.2.8 Endotoxin removal and measurement

FliC extracts were treated to remove residual endotoxin using High Capacity Endotoxin Removal Resin Columns (Pierce, 88274), according to the manufacturer’s instructions (Thermo Scientific). Briefly, the columns were regenerated with 3.5 ml 0.2N NaOH overnight; and after washes with 2M NaCl, ultrapure water, and endotoxin free buffer, the FliC extracts were added, and incubated at 4°C for 16 h. The proteins were recovered by centrifugation at 500 × g for 1 min. Endotoxin levels in purified protein samples were measured using the ToxinSensor Chromogenic LAL Assay (Genscript, USA), according to the manufacturer’s instructions. Briefly, 100 µl volumes of samples were applied to endotoxin-free tubes after pH adjustment (pH 6-8) and were mixed with 100 µl of LAL reagent. The tubes were incubated for 15 min at 4°C in the dark. The substrate and colour stabilizers were added, and absorbance at 545 nm was measured. Endotoxin concentration was reported in EU/g.

3.2.9 Heat-induced monomerization of flagellar filament and stability testing

De-polymerization of flagellar filaments into FliC monomers was assessed by heating proteins (4.5 µg) at temperatures ranging between 30°C and 90°C for 10-15 min. Following heat treatment, proteins were mixed with native gel loading buffer containing 1M Tris (pH 6.8), glycerol and bromophenol blue, and were separated in 10% native gels run at 100 V for 1.5 h. The native gels were stained with Coomassie blue and de-stained (1% acetic acid) overnight. Gels from three independent experiments were imaged using a Chemidoc XRS and relative quantitation of protein bands was achieved using ImageJ software (1.6.0_24). Data are reported as mean arbitrary densitometric units (ADU)

SEM. The tendency of FliC monomers to remain stable (or self-re-polymerize) following heat-induced monomerization was tested by incubating monomers at temperatures between 4°C and 37°C for 2 h, 24 h and 48 h. The proteins were then subsequently examined and compared with untreated FliC monomers using native gels.

3.2.10 Cell culture and immune stimulation assay

Mouse J774A.1 macrophages (ATCC#TIB-67) were grown at 37°C with 5% CO2 in complete RPMI (cRPMI) media, consisting of RPMI1640 (No Glutamine) (#21870-076, Life Technologies, USA Life Technologies, USA) with 25 mM HEPES, 2 mM L- glutamine, 10% heat-inactivated fetal bovine serum (FBS), 100 mM non-essential amino acids, 1 mM sodium pyruvate, 100 U/ml penicillin, and 100 mg/ml streptomycin. Approximately 1 x 105 cells in 200 l cRPMI were seeded into the wells of a 96-well

52 tissue-culture treated microtiter plate, and stimulated with up to 1 g of purified FliC (50 l challenge volume consisting of protein [in PBS elution buffer] diluted with cRPMI) for 5 h. Control groups were treated with the equivalent volume of PBS elution buffer prepared from the corresponding FPLC fraction generated using fliC-deficient E. coli.

Additional comparisons were made of cells treated with purified FliC at the pre- and post- endotoxin removal stages of the protocol to determine the effect of the endotoxin removal. This study also compared the responses of macrophages to amounts of FliC ranging between 0.05-1 g. Cell culture supernatants from quadruplicate wells were collected, clarified at 1,000 × g for 10 min at 4°C, and stored at -80°C for subsequent cytokine assay. Experiments were performed in four independent assays. The cytokine concentrations in cell culture supernatants were measured using a multi-target Bio-Plex Assay (Bio-plex Pro Mouse cytokine 23-plex Assay; Bio-Rad), which was performed according to the manufacturer’s instructions.

3.2.11 Statistics

Numbers of CFU in suspension cultures are reported as mean ± SEM and were compared using students t-test. Kruskal-Wallis ANOVA and Dunn's multiple comparisons were used to analyse the cytokine levels in macrophage stimulation assays because some data did not satisfy Gaussian distribution and/or normality assumptions. The statistical analyses were performed using Graph Pad Prism v8.0 and SPSS Statistical software package v21. Statistical significance was accepted at p ≤ 0.05.

3.3 Results

3.3.1 Generation of fliC deleted UPEC CFT073

The fliC deletion was performed in two UPEC backgrounds; namely (i) Wild-type CFT073 (GU2061), and (ii) CFT073Δ4 (GU2597). This result section has only shown fliC deletion in CFT073Δ4. A similar approach was applied to generate fliC deletion of the Wild-type CFT073 and UTI89 strains (Appendix 1).

Plasmid pKD46 and pKD4 were confirmed by restriction digestion (Figure 6A). Three different PCR products were amplified using the standard protocol for the Phusion polymerase. The two chromosomal upstream (575 bp) and downstream (574 bp) fragments of fliC were amplified from E. coli CFT073Δ4 using primers fliC-Kan-Up-F1 and fliC-Kan-Up-R2 for upstream, and fliC-Kan-Down-F1 and fliC-Kan-Down-R1 for downstream regions respectively (Figure 6B). Plasmid DNA of pKD4 was used as template to amplify FRT containing kanamycin resistant cassette (KnR-FRT fragment) using primers pKD4-KanR-F1 and pKD4-KanR-R1. Using the optimized condition (annealing at 55°C), PCR amplification was scaled up using four separate identical 50 µl PCR reactions to generate a sufficient quantity of amplicon DNA for the 1498 bp KnR- FRT fragment; which was later gel-excised and quantified (Figure 6C).

Approximately equal concentrations of these three PCR products (~50 ng each) were used in an overlapping extension PCR master mix of 50 µl with primers fliC-Kan-Up-F1 and fliC-Kan-Down-R1. The overlapping extension reaction was optimized for annealing temperature, with a range of temperatures from 55-72°C, demonstrating an optimal annealing temperature of 70.4°C. These conditions were scaled up to seven identical 50 µl reactions to form fliC-KnR cassettes, which were separated on an agarose gel for gel excision (Figure 6D).

CFT073Δ4 (GU2597) were electroporated with 150 ng pKD46. The transformants were selected in LBAAmp100 plates, and were designated GU2636 (i.e. CFT073Δ4 containing pKD46). Approximately 1 µg of purified fliC-KnR fragment was electroporated to 80 µl electrocompetent cells of GU2636. After 24 h of incubation, the transformants with R probable fliC replaced with fliC-Kn fragment were selected in LBAKm50 plates. The screening of the replacement of fliC with fliC-KnR from four different transformed colonies was completed using PCR with primers fliC-chk-F1 and fliC-chk-R1, using an optimized annealing temperature of 68.8°C (Figure 6E). CFT073Δ4ΔfliC::KnR was designated as GU2638.

Competent cells of strain GU2638 were electroporated with ~200 ng pCP20. After incubating overnight at 30°C, the transformants were recovered and selected in LBA plates (did not grow in LBAAmp100 and LBAKm50 plates suggesting loss of pKD46 and pCP20). Four colonies were PCR screened using primers fliC-chk-F1 and fliC-chk-R1 and compared fliC locus between the kanamycin sensitive isolates (four transformants), the parental strain CFT073Δ4 (GU2597), and the strain containing fliC-KnR (GU2638) (Figure 6F). PCR amplicons were resolved in 0.6% agarose gel, were gel extracted, and sent for sequencing at AGRF Brisbane for confirmation. The fliC deleted strain of CFT073Δ4 (GU2597) was designated as CFT073Δ4ΔfliC (GU2642).

3.3.1.1 Generation of flagella overexpression in UPEC strains pMG600 from laboratory stocks (CFT073/pflhDC; GU2139) were electroporated in two UPEC backgrounds; namely (i) CFT073Δ4 (GU2597), and (ii) CFT073 Wt (GU2061); following standard protocol (323). Plasmid DNA of pMG600 was extracted using QIAprep Spin Miniprep Kit according to manufacturer’s instruction (QIAGEN, USA). One microgram (~8 µl) of pMG600 DNA was electroporated to 50 µl of electrocompetent cells from both strains and incubated for 24 h at 37°C. The transformants were selected in LBAKn50 plates. GU2597 carrying pMG600 was designated GU2647 (CFT073Δ4/pflhDC), and GU2061 carrying pMG600 was designated GU2139 (CFT073/pflhDC).

Figure 6: Construction of fliC deletion in CFT073Δ4. (A) Confirmation of pKD46 and pKD4 by restriction digestion. Plasmid pKD46 DNA was digested with uncut (Lane 1), NcoI (Lane 2; 6329 bp), EcoRI (Lane 3; 4.8 and 1.5 kbp) and both NcoI and EcoRI (Lane 4; 4.1, 1.5 and 0.066 kb) for 2 h at 37°C and resolved in 0.8% agarose gel at 120 V for 1 h. Plasmid pKD4 DNA was digested with uncut (Lane 5), PstI (Lane 6; 3.2 kb), NcoI (Lane 7; 2.8 kb), and both PstI and NcoI (Lane 8; 2.5 kb) for 2 h at 37°C and resolved in 0.8% agarose gel. Marker (Lane M) is 1kb+ DNA ladder

(Invitrogen). (B) PCR amplification of upstream and downstream regions of fliC. Agarose gel showing 573 bp upstream (Lane 1) and 574 bp downstream (Lane 2) regions of either side of fliC. (C) PCR amplification of the KnR-FRT fragment. Four identical reactions (Lane1-4) to scale up the amplification product of KnR-FRT fragment (1.47 kb). (D) Generation of fliC-KnR fragment using 3-way PCR method. Seven identical reactions to scale up the PCR product of the fliC-KnR fragment amplified from the KnR-FRT cassette; both upstream and downstream regions of fliC (2.5kb) (Lane 1 to 7). (E) Screening of fliC deletion by fliC-KnR fragment. Four different colonies (Lane 1-4) were PCR amplified and resolved in agarose gel (2.7 kb). (F) Final screening of fliC deletion after elimination of KnR. PCR amplification of CFT073Δ4 (Lane 1; 3.07 kb), CFT073Δ4ΔfliC::KnR (Lane 2; 2.7 kb), and CFT073Δ4ΔfliC from 4 different colonies (Lane 3-6; 1.4 kb). (F) Confirmation of fliC deletion by sequencing. Linear representation of nucleotide sequence from UPEC CFT073 genome. The sequence from CFT073Δ4ΔfliC strain was blasted against UPEC CFT073 genome. Green arrows show location of priming sites. Red sequences are nucleotide remained after FLP mediated excision of kanamycin gene. “Scars” are shown in black lined boxes.

3.3.1.2 Confirmation of flagella overexpression

CFT073 Wt and CFT073Δ4 strains, along with their respective fliC deleted and flagella overexpressed derivatives, were subjected to soft agar motility assays (Figure 7A). CFT073 Wt (GU2061) and CFT073Δ4 (GU2597) showed enhanced motility from 4 h post incubation with a similar increment in the motility zone until 7 h (20 mm) (Figure 7B). However, differences were noted at 9 h (35 mm by CFT073 Wt Vs 25 mm by CFT073Δ4) (statistically insignificant; ANOVA). Deletion in genes that encodes fimbriae and pili, such as fim, foc, pap1, and pap2 did not significantly alter the efficiency of motility compared to the wildtype strain until at least 9 h of incubation (Figure 7B).

CFT073ΔfliC (GU2639) and CFT073Δ4ΔfliC (GU2642) showed motility zone of approximately 2 mm (diameter) throughout the defined incubation period (9 h) (Figure 7A and 7B). This diameter was likely the growth of inocula rather than swarming motility. The deletion of fliC completely ceased the motility in CFT073 Wt and CFT073Δ4 strains.

CFT073/pflhDC (GU2139) and CFT073Δ4/pflhDC (GU2647) strains demonstrated enhancement of motility after only an hour of incubation (data not shown) and reached a significant level, compared to their respective parental strains, after 4 h post incubation (p = 0.02, ANOVA). They almost cover the whole plate (measured 90 mm diameter zone) in 9 h (Figure 7A). However, no significant difference was noted among these two strains (CFT073/pflhDC Vs CFT073Δ4/pflhDC). Overexpression of the flagellar gene by incorporating plasmid containing flhDC operon enhanced the rate of motility indicating the higher expression of flagella production.

Figure 7: Soft agar motility assay. (A) Motility plates comparing the swarming phenotype of UPEC strains. Approximately, 2 µl of stationary phase cultures (1x107 cell) were spotted on to the centre of a fresh 0.25% LB agar plate (n=3) for each strain. After 9 h of incubation at 37°C, CFT073 parent strains (CFT073 Wt and CFT073Δ4) showed limited bacterial growth (left panel), the fliC deleted strains (CFT073fliC and CFT0734fliC) showed absolutely no growth (middle panel) and the flagella overexpressed strains (CFT073/pflhDC and CFT073Δ4/pflhDC) showed excessive growth (right panel). The results from a single experiment, representative of three independent experiments, are shown. (B) Motility phenotypes of E. coli CFT073 Wt, aflagellate and hyperflagellated strains. The rate of motility is expressed as the mean diameter of the swimming zone at 4 h to 9 h of incubation at 37°C on 0.25% LB agar plates for each strain (± SEM; n=3).

3.3.2 Effect of flagella overexpression on protein extraction

For a large-scale FliC extraction, flhDC containing plasmid pMG600 was transformed in four strains: CFT073 Wt, CFT073ΔfliC, CFT073Δ4, CFT073Δ4ΔfliC, and induced with IPTG while cultivation. This study has investigated if the incorporation of pMG600 yielded different amounts of flagellar expression, if the absence of pMG600 would generate any significant detectable expression of flagella. Using various strains of E. coli CFT073, I performed this experiment both with and without IPTG induction. Only E. coli CFT073/pflhDC and E. coli CFT073∆4/pflhDC yielded significant amounts of FliC (molecular weight of 60 kDa) while induced with IPTG (20 mM) (Table 8). All the strains that do not contain pMG600 (with or without IPTG induction) did not yielded any form of proteins as shown in Coomassie stained gel image (Figure 8A and Figure 8B).

Table 8: Extraction of FliC with and without IPTG in various UPEC strains. S.N. Strain code Strain name Concentration IPTG induction 1. GU2061 CFT073 Wt <0.025mg/ml 2. GU2639 CFT073ΔfliC <0.025mg/ml 3. GU2597 CFT073Δ4 <0.025mg/ml 4. GU2642 CFT073Δ4ΔfliC <0.025mg/ml Without 5. GU2139 CFT073/pflhDC <0.025mg/ml 6. GU2132 CFT073ΔfliC/pflhDC <0.025mg/ml 7. GU2647 CFT073Δ4/pflhDC <0.025mg/ml 8. GU2648 CFT073Δ4ΔfliC/pflhDC <0.025mg/ml 9. GU2061 CFT073 Wt <0.025mg/ml 10. GU2639 CFT073ΔfliC <0.025mg/ml 11. GU2597 CFT073Δ4 <0.025mg/ml 12. GU2642 CFT073Δ4ΔfliC <0.025mg/ml With 13. GU2139 CFT073/pflhDC 2mg/ml 14. GU2132 CFT073ΔfliC/pflhDC <0.025mg/ml 15. GU2647 CFT073Δ4/pflhDC 2mg/ml 16. GU2648 CFT073Δ4ΔfliC/pflhDC <0.025mg/ml

Figure 8: Effect of flagella overexpression on protein extraction. SDS-PAGE Coomassie stained gel of flagellar preparation from various strains with IPTG induction (A) and without IPTG induction (B). Flagellar preparations from CFT073/pflhDC (Lane 1), CFT073ΔfliC/pflhDC (Lane 2), CFT073∆4/pflhDC (Lane 3), CFT073∆4∆fliC/pflhDC (Lane 4), CFT073 Wt (Lane 5), CFT073ΔfliC (Lane 6), CFT073∆4 (Lane 7) and CFT073∆4ΔfliC (Lane 8) were resolved in 12% SDS-PAGE followed by coomassie staining for 1 h and de-stained overnight. CFT073∆4/pflhDC in gel B (Induced; control) (Lane 9) was used as control along with marker (Lane M).

3.3.3 Purification of FliC and identification of co-purified proteins

For FliC to be suitable for immunological assays I sought to attain a higher degree of purity and undertook a genetic approach to minimize extraneous protein contaminants. To achieve this, I used a multiple mutant strain of CFT073, designated CFT0734 (320), that contains deletions in genes encoding major surface fimbriae, including type 1, F1C and P fimbriae; this was used for the FliC extraction alongside its derivative CFT0734fliC to generate carrier control for further assays.

Physical extraction of flagella from CFT0734 improved the relative purity of the FliC extracts to ~95% according to densitometric analysis of SDS-PAGE gels (Figure 9A). The presence of FliC in the extraction products were confirmed with western blot assay after a series of optimizations (Figure 10). It was vital in these assays to analyze higher amounts of proteins in the gels (up to 10 g) than would typically be analyzed in order to achieve a higher level of sensitivity for the detection of trace protein contamination. I gel- purified the remaining contaminated bands and identified these proteins using mass spectrometry (MS) to assess their potential importance in modifying host-pathogen interactions in downstream assays. MS analysis identified these proteins as major outer membrane proteins OmpA and OmpC, and surface-localized fimbrillin and fimbrial protein (Table 9). Compared to the FliC purification protocol described by Smith et al.,(2003) (27), a higher yield of protein and contamination with fimbrillin but less extraneous higher molecular weight species were observed using current protocol (Figure 9B). I, therefore, sought additional methods to separate these contaminants from FliC, post-purification.

Figure 9: Protein profiles of fliC-enriched extracts from CFT0734 and CFT0734fliC. (A) Coomassie stained SDS-PAGE gel of FliC protein preparations (5 g) enriched for flagella from CFT073/pflhDC (Lane 1), CFT073fliC/pflhDC (Lane 2), CFT0734/pflhDC (Lane 3), and CFT0734fliC/pflhDC (Lane 4); bands labelled a-e were gel extracted and subsequently analysed by mass spectrophotometry to identify proteins and are listed in Table 3. (B) Coomassie stained SDS-PAGE gel of protein samples (10 g) prepared using the protocol for purification of bacterial flagellin described by (27) (Lane 1) compared to the protocol used in the current study (Lane 2). Differences in relative amounts of fimbrillin and extraneous higher molecular weight species are shown in the gel. M: Marker.

Figure 10: Optimization of western blot during confirmation of FliC. The transferred FliC protein in a membrane was incubated with both primary and secondary antibodies. The membrane was developed in BCIP/NBT solution for 10 min (A), 2 min (B) and 1min(C). FliC (Lane 1 of A, B and C) was developed along with nonspecific proteins when exposed for a longer time. FliC was absent in the fliC deleted strain (Lane 2 of A, B and C) although nonspecific proteins showed up when developed for a longer time.

Table 9: Mass spectrometric analysis of FliC from E. coli with co-purified proteins.

Gel Distinct Distinct % Total Protein Protein Gene No. Peptides Summed AA Protein MW Name (E. coli) MS/MS Cove Spectral (Da) Search rage Intensity score A 21 302.13 36.5 3.28e+011 51294.1 FliC fliC B 13 147.11 34.3 2.96e+010 37314.2 Outer ompA Membrane Protein A C 19 231.86 43.2 2.17e+010 41224.4 Outer ompC Membrane Protein C D 19 328.33 81.2 6.53e+011 19423.4 Fimbrillin matA E 10 164.13 76.5 1.31e+011 19298.3 Fimbrial matB protein

3.3.4 Post-purification of FliC to homogeneity using FPLC

To generate highly pure FliC, protein extracts purified as above using physical processes of shearing, filtration and ultracentrifugation were subsequently separated by size exclusion chromatography using an ÄKTA Pure protein purification system with a Superdex 200 Increase 10/300 GL column. The fractions were analyzed by UV absorbance at 215 nm and 280 nm during elution and were collected. Protein containing fraction(s) were subsequently concentrated using Ultra Spin columns and analyzed by SDS-PAGE. FliC eluted in fraction 13 with a single peak, as illustrated in the chromatogram (Figure 11A and 11B) and gel image (Figure 12). Standard UV absorbance settings of 280 nm (used for monitoring proteins in eluted fractions) did not detect FliC due to an absence of tryptophan (and few tyrosine residues) in the protein, necessitating the application of the alternative 215 nm wavelength to monitor FliC.

Figure 11: Chromatograms of fliC-enriched extract from CFT0734 and CFT0734fliC. (A) Chromatogram of FliC extracted from CFT0734/pflhDC. The protein solution was applied in FPLC and UV was measured at 215 nm. The FliC peak was seen in fraction 13 (B) Chromatogram of FliC extracted from CFT0734fliC/pflhDC. The FliC peak was not detected in fraction 13.

Figure 12: Post-purification of FliC using FPLC. SDS-PAGE gel of protein (5 g) in fraction 13 generated from CFT0734/pflhDC (Lane 1) and CFT0734fliC/pflhDC (Lane 2) following protein concentration by centrifugal filters. FliC with molecular weight of approximately 60 kDa was observed. M: Marker.

3.3.5 Endotoxin removal and measurement

Importantly, these experiments demonstrated that FLPC achieved essentially complete removal of all extraneous protein contaminants from the CFT0734 FliC extracts (Figure

12). The post-purification process was concluded by applying the FliC preparations to endotoxin removal columns as explained in materials and methods Section 3.2.8. The endotoxin measurement was performed using the ToxinSensor Chromogenic LAL Assay (Genscript) as explained in Section 3.2.8. A standard curve was obtained using the diluted standards provided with the kit (Figure 13). The endotoxin level of the test sample was calculated extrapolating against a standard curve (Figure 13). The final endotoxin concentration after removal was 0.16 EU/ml, whereas, pre-endotoxin removal was above 12,500 EU/ml. Thus, the efficiency of the method for endotoxin removal was calculated as 99.99999488%. The concentration was converted into EU/g of protein. This resulted in average levels of endotoxin in the final preparations of 0.0050.002 EU/g; well-below the levels reported in previous immune stimulation studies of purified FliC [max. 0.125

EU/g; (295), 0.025 EU/g (324)] and FliA [(0.011 EU/g; (325)]. Without performing

66 this endotoxin removal step, the FliC preparations routinely exhibited concentrations of contaminating endotoxin above 1 EU/g. Together, these data combined with our findings on physical extraction methods establish FLPC-based post-purification and endotoxin removal as an excellent method for the post-purification of UPEC FliC to homogeneity; ideally suited for downstream immunological assays.

Figure 13: Graphic method for calculation of endotoxin concentration. A standard curve was obtained using known standard concentrations (1, 0.5, 0.25, and

0.01 EU/ml). The endotoxin concentration of test specimen was calculated using OD545 of 0.12, which is 0.16 EU/ml. This standard curve represents a single experiment.

3.3.6 Heat induced flagellum disassembly

The flagellar filament is made up of 11 protofilaments, each comprised of FliC monomers stabilized as homopolymers by subunit hydrophobic interactions (114). Variation in the stability of flagella filaments between species (326) prompted us to characterize the heat stability of CFT073 FliC homopolymers with a goal of generating FliC monomers so the purified proteins would be ideally suitable for host-pathogen interaction assays.

Experiments performed with temperature gradients demonstrated that a treatment of 60C for 10 min generated FliC monomers at an efficiency approaching 90% (Figure 14). Temperatures above 60C resulted in minor increases in efficiency of monomerization whereas at temperatures below 50C there was minimal monomerization (below 90%). Therefore, 60C was chosen as optimal to enable efficient generation of FliC monomers but limit the possible effects of heat on protein structure.

3.3.7 Stability of FliC monomers

I then examined the tendency for monomerized FliC to self-polymerize following this heat treatment. For this, flagellar filaments were incubated at either room temperature (RT), 60°C, or 90°C; and the proteins were then stored at either 4°C, RT, or 37°C for 2 h, 24 h or 48 h as explained in materials and methods (Section 3.2.9). Native gel analysis of proteins treated in this manner showed no appreciable re-polymerisation of FliC monomers into filaments after monomers were incubated and stored at 4°C. In contrast, FliC stored at RT or 37°C for 24 h or more, exhibited some degree of re-polymerisation (Figure 15). I conclude from these data that UPEC FliC monomers are relatively stable as monomers for at least 2 h following de-polymerization at 60C for 10 min but incubation of monomers at higher temperatures and/or for longer periods of time leads to some degree of self-re-polymerisation.

Figure 14: Heat-induced monomerization of purified FliC. Native PAGE gel showing dissociation of FliC from polymeric filaments to FliC monomers (A) and relative densitometric quantification of monomers [Arbitrarty Densitometric Unit (ADU)] at each temperature tested (B).

Figure 15: Stability of FliC monomers in various times and temperatures. Approximately 5 µg FliC (10 µl), diluted in native gel buffer were incubated at room temperature (RT), 60°C or 90°C. The proteins were then stored at 4°C, RT or 37°C for 2 h (A), 24 h (B) and 48 h (C) and subsequently resolved in native gels. When stored at 4°C no appreciable re-polymerisation into flagella filaments was evident. In contrast, FliC stored at RT or 37°C for 24 h or more, exhibited some re-polymerisation apparent as two major bands (instead of a single band) in images (B) and (C).

3.3.8 Immunological activity of highly purified FliC

To assess the immunological activity of FliC purified to homogeneity, I next applied pure FliC to macrophage stimulation assays in vitro. Exposure of murine J774A.1 macrophage to 1 g of FliC for 5 h led to significantly increased production of TNF-, IL-1, IL-6,

KC, IL-12(p40) and IL-12(p70) (Figure 16). I generated a suitable carrier control for these experiments by preparing extracts from a fliC derivative of CFT0734 (GU2642), which were processed in an identical manner to the FliC preparation above. The amount of carrier control was normalized to the FliC sample according to volume, not the amount of protein; as the carrier control derived from the fliC-deficient UPEC mutant contains no FliC. The volume of carrier control and FliC were both normalized to 50 ul (with the FliC sample containing 1 µg of FliC protein). Similarly, the same number of UPEC of both of these two strains (Wt and fliC deleted) were used to generate the carrier control and the FliC from the very beginning, at the culture stage and centrifuge stage. Thus, the samples were also normalized according to the number of bacteria. In comparison to stimulation with FliC, there were no significant levels of any of these cytokines in cultures of macrophages that were exposed to either the carrier control (i.e. extracts from GU2642) or culture media only control (Figure 16). I did not observe significant levels of other cytokines that have not previously been associated with flagella, such as G-CSF and GM- CSF (Figure 17), and did not detect significant levels of IFN- that has previously been associated with cellular responses to flagella (206). Taken together, these findings show that macrophage proinflammatory cytokine responses observed in this study are directly attributable to FliC and are consistent with prior reports of immune stimulation properties of flagella.

Figure 16: Cytokine response of macrophages to FliC purified to homogeneity from UPEC CFT0734. J774A.1 macrophages were stimulated with 1 g of FliC for 5 h and supernatants were used to measure the levels of TNF-, IL-1, IL-6, KC (chosen as a functional equivalent of human IL-8), IL-12(p40) and IL-12(p70). FliC induced higher concentrations of these cytokines compared to the carrier control (prepared from GU2642 using identical purification procedures) or Media only control.

Figure 17: Cytokine response of mouse macrophages to FliC from UPEC CFT073∆4

J774A.1 macrophages were stimulated with 1 g of FliC for 5 h and supernatants were used to measure the levels of G-CSF, GM-CSF and IFN-γ. FliC induced higher concentrations of these cytokines compared to Carrier control (prepared from GU2642 using identical purification procedures) or Media only control.

3.3.9 Effect of endotoxin removal on macrophage responses to FliC

Investigation of the effect of endotoxin removal on macrophage responses demonstrated higher levels of several cytokines in cultures that were stimulated with purified FliC that was not treated for endotoxin removal (‘pre-’) compared to FliC that was treated for endotoxin removal (‘post-’) according to the protocol explained in (Section 4.2.8). Comparison of the responses of macrophages to different amounts of FliC showed that amounts of FliC less than 1 g also triggered significant production of several cytokines; for example, 0.05 g FliC induced significant production of TNF- and IL-6 compared to control cultures that were treated with the carrier control alone (Figure 18).

Figure 18: Cytokine response of macrophages to FliC with and without endotoxin. J774A.1 macrophages were stimulated with 0.05-1 g of FliC that had not been treated for endotoxin removal (‘pre-’) versus treated for endotoxin removal (‘post-’) for 5 h and supernatants were used to measure the levels of TNF- and IL-6.

3.4 Discussion

Flagellin has been studied as a trigger of immune defences in various hosts, including humans, animals, and plants (206, 217, 327). In the context of host-pathogen interaction experiments, FliC applied to in vivo or in vitro models ideally should be highly purified by techniques that avoid protein denaturation or degradation and endotoxin contamination which can make interpreting experimental data difficult or impossible. It is likely that many studies have analysed FliC preparations that are partially degraded, misfolded, or contaminated with endotoxin or extraneous proteins as a result of the limitations of extraction and purification methods. This is especially important for immune assays where experimental models are intended to provide insights into natural infection and therefore must parallel the natural interactive processes and native forms of protein as closely as possible. Despite notable increases in the numbers of studies of FliC as an immune modulator in recent years, few advances in the methods used for FliC purification have been reported in the last four decades (292). In this chapter, I establish a method to purify FliC from UPEC which offers the advantages of rapid time to purification (one- day), a high yield for purification of bacterial flagellin, and generation of a FliC purified to homogeneity suited to immune assays.

This study applied a multiple gene-deficient derivative of Wt CFT073 (designated CFT0734) for FliC extraction (320). This strain lacks four major proteins located on the extracellular surface of UPEC, such that their removal is predicted to improve the purity of FliC. A fliC-deficient strain, CFT0734fliC, was generated to enable the concurrent preparation of a suitable carrier control to be applied in downstream assays. An established technique based on λ-red recombination was applied, where recombination required a phage λ-red recombinase synthesised under the control of an inducible promoter on an easily curable low copy number plasmid pKD46 (carries the λ red genes behind the araBAD promoter and is temperature sensitive) (322). However, multiple attempts to delete fliC in CFT073Δ4 following this protocol were not successful (detail procedure in appendix 1). Although I could not figure out the exact reason behind this, probably the use of only ~36 nt homologous extension on either side of fliC were not enough for recombination. I therefore decided to follow a modified protocol where I could increase the nucleotide number of homologous extensions to enhance the probability of recombination. Generation of mutants using the overlap extension method is a well- established technique (328). The method involves using larger regions of homology either side of the target-gene, amplified separately by PCR, and then fused to the kanamycin

75 resistance cassette (KnR) by overlapping extension PCR. This approach allows for far- larger regions of homology to facilitate recombination, improving success rates in generating the desired mutations. Three PCR amplified products were combined by an overlap extension method for subsequent replacement of the fliC gene (328, 329). I used 500 nt flanking regions on either side of fliC to facilitate knock-out (KO) and replacement of fliC with fliC KnR-FRT of the same locus. A relatively high efficiency of recombination was observed by this method. Increasing the size of the flanking regions from 36 nt to almost 500 nt could account for the successful fliC deletion in the later attempts. Using standard thermocycler conditions to combine three PCR products (upstream region of fliC, downstream region of fliC, and FRT containing KnR cassette) were unsuccessful. A modified approach, where the thermocycling conditions involved separate phases that utilized lower ramping rates and incremental increases of extension times, was applied. This modified protocol allowed me to successfully combine the three PCR products (mentioned above) using the overlap extension method (329).

Bacterial motility mostly is guided by flagella where the swimming motility is described in liquid media and the swarming motility on both solid and aqueous surfaces (129, 130). It is understood that the swarming bacteria produce extracellular materials (wetting agents), such as surfactants and exopolysaccharides, to increase surface wetness and thus facilitate movement (130). Mutations in fliC result in loss of flagellation and thereby swarming motility in E. coli (109, 137). The confirmation of the deletion of fliC from the strains I engineered, was accomplished by exploiting the role of fliC in bacterial motility as explained in previous study (9, 140). The swarming motility tests in this study revealed that UPEC CFT073 in fliC mutant lost the ability to swarm completely. Another exciting result in this study was similar growth rates observed between CFT073 Wt and CFT073Δ4 strain. This suggest that the deletion of major surface structural protein did not alter the swarming ability of this strain. However, the divergence at 9 h of incubation suggest the possibility of growth difference between these two strains, and longer incubations in future experiments may elucidate this.

The initial approach of extracting flagellar filaments from UPEC by physical shearing methods, followed by filtration and ultracentrifugation, yielded FliC as the predominant protein. Several extraneous minor proteins were also present in these FliC extracts and identification of these as having a potential to impact host-pathogen interaction studies dictated a further purification approach. This study approached to further-purify FliC using FPLC-mediated size exclusion chromatography, followed by concentration of the

76 protein, and subsequent removal of residual endotoxin. Prior studies have applied chromatographic approaches for isolation of flagellin, such as ion exchange (290) and sequential cation/anion exchange (308). However, to my knowledge, the current study is the first to exploit size exclusion (gel filtration) chromatography to purify bacterial flagellin. In the context of protein purification for downstream immune assays, size exclusion offers benefits, including a lack of covalent binding of the protein to the exchanger, and no requirement for organic solvents or pH changes for elution; which may adversely affect protein integrity (330) and were therefore avoided in this study. Several studies from the 1970’s demonstrated that chemically modified flagellin exhibits altered immunogenic properties (331-333). Chromatographically purified proteins are typically highly purified and can be free from endotoxin contamination (303, 304). Polymyxin-B, Triton X-114, and tangential flow filtration are other methods described in the literature to remove endotoxin (233, 236, 311). Limulus Amoebocyte Lysate test (LAL) is the most popular detection technique for endotoxin (sensitivity up to 1 pg/ml) (334). Although biosensors based on endotoxin-sensing components are promising alternatives for endotoxin detection (higher sensitivity and specificity), they are complex and expensive (334). The HEK-Blue™ LPS Detection Kit containing human HEK cells is another highly sensitive assay based on the ability of TLR4 to recognize structurally different LPS from gram-negative bacteria and in particular lipid A, the toxic moiety of LPS (335). The data in this study shows that the endotoxin removal approach using LAL assay is very efficient at removing endotoxin from FliC preparations. It is notable, however, that in this study, endotoxin removal subsequent to FPLC was essential because appreciable endotoxin was eluted with protein fractions and caused the production of much higher levels of multiple cytokines (e.g. TNF-, IL-6) in macrophages compared to cytokine responses of macrophages exposed to FliC in the absence of contaminating endotoxin. This stage in the protocol led to substantial loss of protein; however, effective removal of endotoxin to levels considered acceptable for immunological assays circumvented the responses to endotoxin and enabled the study of highly purified FliC. This study does not ignore that the increased level of cytokines against FliC, even after endotoxin removal, could be due to residual endotoxin contamination. However, the results of these assays reflecting a response to FliC rather than contaminating endotoxin are based on two reasons. Firstly, the method used for the removal of endotoxin from purified protein was extremely efficient; this was determined as 99.99999488% efficient, based on the use of extensive LAL assays and measures of pre- and post-endotoxin removal samples. The LAL assay is the standard approach for detecting and measuring endotoxin in biological samples 77

(336). Thus, the protocol used in my study is extremely efficient at endotoxin removal. Secondly, I used a carrier control in all of these host response assays. The carrier control I used in all of these experiments was prepared from FliC-deficient UPEC using the same extraction and purification protocol compared to that used for purifying FliC from UPEC, meaning that an appropriate and necessary control was included for comparison in all of these assays; notably, the level of endotoxin in the carrier control preparations used for host response analysis were similar. Compared to the existing literature, I consider the FliC used in the current study to be among the most highly purified and useful reported to date in the context of immunological research.

To my knowledge, the current study is the first study to describe the heat stability of flagellar filaments purified from UPEC. In avoiding acid and other chemical denaturation steps for FliC purification, this study identified 60C as an ideal temperature with which to monomerize UPEC flagellar filaments. This treatment would avoid possible denaturation due to acid (330) and higher temperatures that can cause irreversible denaturation (337). The major finding that UPEC FliC monomers are stable as monomers for at least 2 h following de-polymerization is important to validate the use of FliC as monomers in downstream cell stimulation assays; in such assays, time periods of < 2 h are realistic in a logistic workflow sense. The finding that incubation of UPEC FliC monomers at higher temperatures and for longer periods of time leads to some degree of self-re-polymerisation will require future work to elucidate the nature of this polymerization. Comparing to other bacteria, the filaments of Salmonella Typhimurium and Vibrio cholerae are completely disassociated into monomers by heating at 80C for 15 min; the former but not the latter is disassociated by lower temperatures as low as 50C (326). In another study, Salmonella flagella were depolymerized at temperatures as low as 37C with mild acid treatment, whereas Lactobacillus agilis flagella were reported to require 57C and a stronger acid treatment to achieve monomers. It is also possible that fliC allelic variants may react differently in these kinds of dissociation assays. Jointly, however, these data can be used to infer that flagellar filaments of some bacteria are more resistant to thermal and/or acidic conditions than others (338).

In many previous studies, bacterial flagella filaments are typically depolymerized into monomers either by heating at 60C for 10 min or by acid treatment (pH <2.5). Self- polymerization through the addition of short filaments as seeds can occur and lead to re- polymerization of filament; however, precipitation, such as with ammonium sulphate has been used by many studies to achieve efficient isolation of flagella filaments (339). 78

Analysis of some heat treatment protocols has led to suggestions that acid treatment for monomerization may be preferred for the maintenance of structural identity (308); however, acidic conditions (pH 3.6-4.4) as reported for the generation of FliC monomers (326) can also cause protein denaturation (340). I sought to identify the most mild heat treatment at which UPEC flagella filaments could be dissociated into monomers for immune assays given that TLR5 recognizes FliC in the context of monomers but not flagellar filament (27); the requirement for dissociation of flagellar filament into FliC monomers for cellular recognition might involve phagocytic acidification of the local cellular environment and/or cellular translocation of whole bacteria predicted to lead to depolymerization and thus afford recognition by TLR5.

In applying highly purified CFT073 FliC to a host-pathogen interaction assay, I exposed mouse macrophages to the protein. Several proinflammatory cytokines, including TNF- , IL-1, IL-6, KC and IL-12 were induced in response to the purified FliC in a manner consistent with previous literature (26, 206, 217, 218, 226). I also observed significant responses to lower doses of FliC (e.g. 0.05 µg); a finding consistent with prior studies that have reported activation of innate immune responses, including NF-, TLR5, and host antimicrobial peptides following exposure to this level of FliC (27). I have noted that the use of a fliC mutant in these assays reflects a crucial control to conclude that the proinflammatory responses induced by FliC are not an artefact secondary to LPS contamination, which is an important consideration in studies of this type (217). In the broader context of bacterial pathogenesis, Salmonella flagella, which occur with two antigenically distinct forms of flagellin, FliC and FljB (341), induce proinflammatory responses that encompass TNF-, IL-1 and IL-6 in both human and mouse cells (204, 215, 218) and that appear to be independent of different flagellin variants (342). Listeria flagella also induce TNF-α in mouse macrophages and systemic IL-6 in vivo (26). These cytokines are key parts of disease pathogenesis during infection and our observations of UPEC FliC are fundamentally consistent with previous reports of innate immune responses to flagella. Mechanistically, it is well established that FliC is a TLR5 agonist, and through recognition by this receptor, FliC activates varied immune responses; this mechanism is the basis of novel approaches to disease treatment and prevention such as a potential target for vaccine adjuvant and anti-tumor strategies (16, 26, 204, 206, 215).

A recent study identified flagellin functioning via the TLR5/NF- pathway as a key UPEC virulence factor responsible for increased production of host-defense peptides, such as BD2, which mediate protection of urogenital tissues from infection (275).

In summary, this study developed a new method for the physical extraction and chromatographical purification of flagella filament from UPEC. The purification of flagellin using this approach will be particularly suited for immunological assays. Future studies of UPEC FliC purified to homogeneity using the methods described herein will provide new insight into the biology of this bacterial structure and will be especially useful to give a more complete understanding of the immunological implications of exposure to UPEC flagella in the context of infection and disease.

4 Chapter 4 Role of FliC in IL-10 induction in mammalian cell culture and murine model of UTI

My contributions to this chapter include:

• Conceived the experiments • Designed the experiments • Performed the assays • Analysed and interpreted the results • Prepared figures and tables • Writing and revision of chapter and related manuscript

Sections of this chapter are included in a published paper (Appendix 4).

D. Acharya, M. J. Sullivan, B. L. Duell, K. G. K. Goh, L. Katupitiya, D. Gosling, M. N. Chamoun, A. Kakkanat, D. Chattopadhyay, M. Crowley, D.

K. Crossman, M. A. Schembri, G. C. Ulett. Rapid bladder IL-10 synthesis in

response to uropathogenic Escherichia coli is part of a defence strategy that is

triggered by the major bacterial flagella filament FliC and contingent on TLR5. mSphere. 2019 Nov 27;4(6). pii: e00545-19. doi: 10.1128/mSphere.00545-19.

The contributions of author’s to this publication were:

• Conceived the experiments (DA, BLD, MAS, GCU) • Designed the experiments (DA, BLD, MAS, GCU) • Performed the assays (DA, MJS, BLD, KGKG, LK, DG, MNC, AK, DC, MC, DKC, GCU) • Analysed and interpreted the results (DA, MJS, BLD, KGKG, MAS, GCU) • Prepared figures and tables (DA, MJS, BLD, KGKG, GCU) • Writing and revision of manuscript (DA, MJS, BLD, KGKG, LK, DG, MNC, DC, MC, DKC, GCU)

(Signed) ______(Date)______

Dhruba Acharya

(Countersigned) ______(Date)______

Supervisor: Professor Glen C. Ulett

4.1 Introduction

UPEC mostly originate in rectal microbiota and gain access to the urinary tract via the urethra, into the bladder (54). This is known as the ascending route of urinary tract infection (UTI); however, there are other less common routes of infection, such as hematogenous and lymphatic routes, which can lead to UTI (54). UPEC adherence, and colonization in the bladder epithelium, are the critical steps that ultimately lead to UTI. UPEC possess multiple virulence factors that contribute to pathogenesis (4). The urinary bladder elicits immune responses to UPEC upon their arrival, prompting secretion of cytokines, chemokines, and growth factors (8). The progress of infection is determined by the host’s immune responses, and the pathogen’s ability to evade immune mechanisms.

Flagellin (FliC), the major flagellar filament protein, is a potent immune stimulator, which is possibly detected only by TLR5 in the extracellular environment (26). A different pathway has been described, upon recognition of cytoplasmic flagellin, through the mammalian cell cytosolic sensors Naip5 and Ipaf (19, 205). FliC triggers proinflammatory cytokines such as TNF-α, IL-1β, IL-6, and IL-12, in a wide range of immune cells, including monocytes, macrophages, and dendritic cells (204, 206, 217). FliC from gram-negative bacteria has been characterized using in vitro and in vivo models to mimic the complex environment of natural infection.

IL-10 is an anti-inflammatory cytokine that functions in different stages and arms of immune responses, preventing inflammation and autoimmune diseases (241). Pathogens are known to target host anti-inflammatory cascades via IL-10 secretion as a means of regulating immune responses (256, 257, 259, 264, 265). Major functions of IL-10 include induction of anti-inflammatory responses mediated through IL-10 receptors and the activation of signal transducer and activator transcription 3 (STAT 3), inhibition of the development of Th1 responses, suppression of Th2 cells, and activation of mast cells, cytotoxic T-cells, natural killer cells (NK cells), and B-cells (243). A recent study revealed an early defensive role of IL-10 in the control of UPEC UTI (242). An emerging paradigm has suggested that UPEC can modulate host IL-10 production (13). The principle cellular sources of IL-10 are monocytes/macrophages, dendritic cells, CD4+, and regulatory T cells (242, 243). Mast cells, NK cells, eosinophils, neutrophils, and B- cells can also produce IL-10 (244). The production of IL-10 may not reflect the induction of a single cell population. A recent study suggested that monocytes and uroepithelial cells in combination produce strong IL-10 responses, implying synergistic effects of IL- 82

10 production in some circumstances (40).

Broadly, the potential pathogenic role of IL-10 in HIV infection was demonstrated in the late 90s (255). Since then, the involvement of this cytokine in the modulation of immune response has been studied in various infection models, including tuberculosis, leishmaniasis, and GBS infection (32, 256, 343). Such studies have shown the role of flagella in microbial disease pathogenesis, including UTI, where it promotes colonization and ascent to the upper urinary tract (9, 147); however, the role of UPEC flagellin in the alteration of the innate immune response, and especially in IL-10 induction during acute UTI, has yet to be defined.

The aim of this chapter was to determine the ability of flagella and FliC to induce early production of IL-10, using mammalian cell cultures and murine models of UPEC UTI.

4.2 Materials and Methods

4.2.1 Bacterial strains and plasmids

The UPEC reference strain, CFT073 (GU2061), and a multiple gene-deficient derivative of UPEC CFT073 (GU2597), carrying combined mutations in the four genes that encode type 1 pili (fim), F1C/S fimbriae (foc), pyelonephritis-associated pili (pap1 and pap2), and designated CFT0734 (320), were used in this study. In addition, a fliC deficient UPEC CFT073 strain (GU2639) and a derivative of CFT0734, also deficient in fliC (GU2642), were generated using λ-red recombinase with a kanamycin resistance gene inserted for selection. Wt CFT073 (GU2139) and CFT0734 (GU2647) strains containing IPTG-inducible pMG600 carrying flhDC, were used as hyperflagellated strains. Bacteria were grown at 37°C in Luria-Bertani broth (LB) and on LB agar, with antibiotic selection (kanamycin, 50µg/mL) and IPTG induction (20mM), as needed. UPEC strains used in this chapter are listed in Table 10.

Table 10: Bacterial strains used in this chapter.

Strain Characteristics Reference CFT073 Reference UPEC strain, O6:H1 (ATCC 700928) (138) GU2139 CFT073 + pMG600 (pflhDC); KnR This work GU2639 fliC-derivative of CFT073; KnR This work CFT0734 CFT073 with deletions fim foc pap1 pap2 (320) GU2647 CFT0734 + pMG600 (pflhDC); KnR This work GU2642 CFT0734fliC; fliC-derivative of CFT0734 This work

4.2.2 Murine model of UTI

A murine model of UTI utilizing female C57Bl/6 mice (8–10 weeks old) was used [The Jackson Laboratory, (USA), and the Animal Resources Centre (Canning Vale, WA)]. They were housed in groups of five and independent experiments were repeated at least twice. All the animal experiments were conducted in accordance with procedures authorized by the Animal Ethics Committee of Griffith University (permits: Griffith Approval MSC/01/18/AEC).

4.2.2.1 Transurethral catheterization

Two groups of mice (n=5 per group) were challenged with either 30 µg of purified FliC diluted in 50 μl of PBS, or 50 μl of carrier control, per mouse, extracted in an identical manner from a fliC deleted derivative of the CFT073Δ4 strain (GU2642), via transurethral catheterization, as described previously (344). FliC was heated for 10 min at 60°C in order to generate monomers before instillation. Briefly, the mice were anesthetized by inhalation of isoflurane. The peritoneal area was sterilized by swabbing with 10% povidine-iodine solution, which was subsequently removed with PBS. The mice were catheterized using sterile polyethylene catheters, and FliC in PBS was instilled at a slow infusion rate of 5 µl/s transurethrally. The catheters were then removed, and the mice were returned to their respective cages.

4.2.2.2 Sample collection

The mice were euthanized by CO2 asphyxiation followed by cervical dislocation, and their bladders were isolated 2 h post inoculation. The bladders were collected in sterile microfuge tubes (Eppendorf) containing 120 µl of PBS with a protease inhibitor cocktail (cOmplete Ultra/ Mini, Roche, Castle Hill, NSW, Australia). The tissue samples were homogenized in 2.0 ml safe-lock microcentrifuge tubes (Eppendorf) containing two stainless steel ball bearings (5mm) using Tissue Lyzer II (QIAGEN, Netherlands) (3 x cycles of 30 sec at 30 Hz, followed by 30 sec on ice). The homogenized bladders were centrifuged at 10,000 × g for 5 min at 4°C. The clarified supernatants (2 separate aliquots of 60 µl) were carefully transferred to a 96-well plate and immediately stored at -80°C for further analysis.

4.2.3 Mammalian cell lines and media

Human immortalized 5637 uroepithelial cells (ATCC HTB-9), U937 monocytes (ATCC

CRL-1593.2), and mouse J774A.1 macrophages (ATCC#TIB-67) were used in this study.

The cells were grown at 37°C with 5% CO2 in complete RPMI media (cRPMI), 85 containing RPMI 1640 (with no glutamine) (#21870-076, Life Technologies, USA) with 10% heat inactivated FBS, 25 mM of HEPES, 2 mM of L-glutamine, 100 mM of non- essential amino acids, 1 mM of sodium pyruvate, 100 of U/ml penicillin, and 100 mg/ml of streptomycin. The cell lines were confirmed as mycoplasma-free using commercial PCR (Takara Bio Inc. Japan), and were routinely used in experimental assays with passage numbers below 25.

4.2.4 Splitting, counting and seeding cell lines

The cells were revived from liquid nitrogen stock following the standard protocol. Briefly, the cells were taken out of liquid nitrogen and thawed at 37°C, then transferred to a T25 cell culture flask. Gently, 5 ml of pre-warmed and CO2 pre-equilibrated cRPMI was added to prevent osmotic shock. The cell suspension was transferred to a 15 ml flask and centrifuged for 5 min at 300 × g, and the medium was replaced with cRPMI to remove the dimethylsulfoxide (DMSO) present in the stock. The supernatant was poured off and the pellet was resuspended in 5 ml of basal RPMI (bRPMI 1640 with no supplements). The cells were centrifuged at 300 × g for 5 min and the pellet was resuspended in 5 ml of pre-warmed and CO2 pre-equilibrated cRPMI. The cells were incubated at 37°C with 5%

CO2 for two to five days. The cells were routinely monitored and sub-cultured in 5 ml and 15 ml flasks using the standard protocol. Briefly, for the 5637 cells, the old medium was removed from the T25 flask and 5 ml of bRPMI was used to remove the serum, which can inhibit trypsin activity. The cells were gently rinsed twice with bRPMI and 1 ml 0.05% trypsin was added to detach cells from the flask’s surface. The flask was incubated for 10 min at 37°C until the adhered cells were seen to float under a microscope (40x). To neutralize the trypsin, 4 ml of cRPMI was added immediately and gently mixed using pipette. The cells were split into different ratios as per the requirement (1:3, 1:5, etc.). For the mouse J774A.1 macrophages, approximately 1 ml of 2.5% trypsin was used for detachment from the cell culture plates, whereas, for the U937 cells, there was no need to use trypsin for cell detachment, since these non-adherent cells do not attach to the flask’s surface. Briefly, the cells were centrifuged at 300 × g for 5 min and mixed with 5 ml of bRPMI. The cells were washed with bRPMI twice and the final pellet was resuspended in cRPMI and split into different ratios with fresh cRPMI. More than 90% confluency, observed under a microscope, was the major determining factor for cell splitting, together with the change in media color towards yellow, suggesting the alteration in pH. Cell counting was performed using a Neubauer hemocytometer. Briefly, 100 µl of the cells were combined with an equal volume of trypan blue and mixed well. Approximately, 10

µl was loaded into the hemocytometer. The cells were counted in the four corners (1 mm2) of the chamber and calculated using the standard formula. The required number of cells were prepared and seeded in their respective wells. The remaining wells were loaded with media only, or with PBS, before subjecting them to incubation.

4.2.5 Absorbance estimation of bacterial cell concentration in PBS

Two to three colonies were added to 10 ml of LB broth (containing antibiotics when necessary) and incubated overnight (18–22 h) at 37°C, with shaking at 200 rpm. The cells were centrifuged at 8,000 × g for 10 min at 4oC and resuspended in 10 ml of PBS (pH 7.4). The solution was centrifuged again at 8,000 × g for 10 min at 4°C and the pellet was resuspended in 5 ml of PBS. The pellet was then resuspended in 1.2 ml of PBS. The bacterial suspension was transferred into a 1.5 ml microfuge tube and placed in ice immediately.

Absorbances were standardised using three separate approaches. (1) Overnight liquid culture plating serial dilutions, (2) overnight liquid culture plating at OD600 0.5, and (3) overnight soft agar culture plating at OD600 0.5. Initially, using 200 µl of the cell solution, 2-fold serial dilutions were performed in a 96-well plate, from A1 to H1 for each strain. The absorbances of the diluted wells were measured at 600 nm in a spectrophotometer (Spectronic 200, Thermo Scientific), and compared with the blank well containing PBS with no bacteria. Enumeration of bacterial cell counts were performed using plate count method. The cells from each well were serially diluted 10-fold and plated with 5 µl cell suspensions in triplicate from 10-5 to 10-8 on LB plates. The plates were incubated at 37°C overnight and the colonies were counted to give colony forming units per ml (CFU/ml). The concentration (CFU/ml) against absorbance value for each diluted cell suspension was examined.

In the second experiment, the cells grown in overnight liquid cultures from each strain were adjusted to OD600 of 0.5. The concentrations were measured by plating method as explained above.

In the final experiment, absorbance estimations of bacterial cell concentrations grown on soft agar were also performed. Soft agar plates were prepared using 0.25% LB agar, on which 10 µl aliquots (from overnight LB broth cultures) were spotted onto the center of the agar. The plates were incubated overnight at 37°C and subsequently, bacteria were excised from the surface of the agar plate and homogenized using gentle pipetting in 500 µl of PBS. The cell suspensions were centrifuged at 1,000 × g for 5 min at 4°C, and

87 supernatants containing bacteria were collected from the upper layer to separate them from the agar. The cells from each strain were adjusted to an OD600 of 0.5 using a spectrophotometer. The concentrations were measured by plating method as explained above.

4.2.6 Preparation of bacterial inoculum for infection assay

To prepare UPEC strains for infection assays, a strategy was devised to produce bacteria expressing flagella. To achieve this, cells were pre-grown on semi-solid agar as per the motility assays described in Chapter 3. All the strains were grown overnight in 10 ml of LB broth (with appropriate antibiotics) at 37°C, with shaking at 200 rpm. The cultures were harvested and washed three times with PBS. The final pellet was diluted to an OD600 of 0.5 that gives approximately 3.5 x 108 CFU/ml. Following overnight storage of the 0.25% LBA in a bottle at 60°C, soft agar plates with appropriate antibiotics were prepared and air dried for 20 min. Approximately, 10 µl (1 x 107 CFUs) of aliquots from previously prepared inoculum were spotted onto the center of the agar plate. The plates were incubated overnight at 37°C and subsequently, cells (containing a fair amount of agar) were excised from the surface of the semi-solid agar plates into 500 µl of PBS and homogenized with gentle repeated pipetting. Bacterial suspensions were centrifuged at 1,000 × g for 5 min at 4°C, and supernatants containing bacteria were collected from the upper layer to separate them from the agar and diluted into bRPMI for the infection assays. Retrospective colony counts on the LB agar plates (1.5%) were routinely performed to determine the accuracy of the multiplicity of infection (MOI) estimates.

4.2.7 Infection assays

The co-culture and monoculture of various mammalian cell types were used in this study for the infection assays. The co-culture model was based on a recent study that investigated host pathogen interactions during UPEC-mediated UTI (40). U937 monocytes and 5637 uroepithelial cells were prepared for seeding following the standard protocol as explained above. For a co-culture assay, 1 x 105 uroepithelial cells per 100 µl and 5 x 104 monocytes per 100 µl were seeded in all the allocated wells in a 96-well plate.

The plate was incubated overnight (16–20 h) at 37°C, with 5% CO2. The next day, the cells were infected with all the bacterial strains at a final concentration of 3 x 107 CFUs diluted in 50 µl of bRPMI to give a MOI of 200 bacteria per human cell, or 2 µg and 1 µg of purified, monomerized FliC diluted in bRPMI in the allocated wells. Four technical replicate wells were incubated for 5 h and four wells were incubated for 8 h at 37°C, with

5% CO2, per group. After incubation, the supernatants from the infection assays were 88 clarified by centrifugation at 500 × g for 10 min at 4°C and transferred into a flat- bottomed uncoated 96-well plate, immediately sealed, and stored at -80°C until the cytokine quantification. Retrospective colony counts on the LB agar plates (1.5%) were performed on the bacterial inoculum to determine the accuracy of the MOI estimates.

For the monoculture assays, U937 monocytes at a concentration of 1 x 105 cells per 200 µl were seeded using the standard protocol. The overnight-incubated cells were challenged with various bacterial strains and FliC. The plates were incubated for only 5 h and the supernatant was stored at -80°C until samples were subjected to measure cytokine concentration. Similar monoculture experiments were performed with J774A.1 mouse macrophages, whereby monolayers were challenged with FliC and compared to the carrier control. Supernatants were stored at -80°C and subjected to multi-plex assays.

4.2.8 Enzyme-Linked Immunosorbent Assay (ELISA)

Cytokine levels were measured in the culture supernatants using commercial ELISA kits. IL-10 was quantified using Human IL-10 DuoSet® ELISA kits (#Dy217B-05, R&D Systems, Abingdon, UK) for human cell culture supernatants and Mouse IL-10 DuoSet® ELISA kits (#Dy417-05, R&D Systems, Abingdon, UK) for mouse cell culture supernatants. DuoSet Ancillary Reagent Kit 2 (5 plates): (# DY008) was used for both the humans and mice samples. Briefly, polyester ELISA plates were pre-coated overnight with a capture antibody against antigens, incubated, and blocked in 300 µl of reagent diluent (1% BSA in PBS) for 2 h. The ELISA wells were washed three times between every interval with a wash buffer (0.05% Tween 20 in PBS), using an ELISA washer (Thermo Scientific). The standards were prepared according to the manufacturer’s instructions. Approximately, 100 µl of samples and standards were added to the respective wells and incubated for 1 h at room temperature. After washing as described above, 100 µl of biotin-conjugated secondary antibodies, diluted in reagent diluent, were added and incubated for 2 h at room temperature. Again, after washing, 100 µl of HRP- Streptavidin was added and incubated for 20 min at room temperature. Detection was performed using 100 µl of 3,3′,5,5′-Tetramethylbenzidine (TMB) chromogenic substrate, the reaction was terminated by adding 50 μl of 1 N sulfuric acid (H2SO4), and the results were read at 450 nm using an ELISA plate reader (Thermo Scientific, Loughborough, UK).

4.2.9 Multiplex assay

Bio-Plex Pro Mouse cytokine 23-plex assays (Biorad #m60009rdpd, USA) were used to

89 measure the cytokine profile induced by J774A.1 mouse macrophage cells and mice bladders challenged with FliC. Briefly, standards were prepared with serial dilution according to the manufacturer’s instructions, with minor modifications. For supernatants from the cell-culture infection assays, cRPMI (containing 10% FBS) was used as a diluent for the standards, whereas for the mouse bladder supernatants, PBS containing 0.1% BSA was used. Magnetic beads were diluted to 1x. The beads, along with the standards and samples, were incubated on a shaker at 850 ± 50 rpm for 30 min at room temperature. The detection antibody was applied and incubated on a shaker at 850±50 rpm for 30 min at room temperature, followed by streptavidin-PE for 10 min, and the reaction was stopped with an assay buffer. The plate was analyzed immediately, following the standard protocol, and the data were extracted and analysed using Graph Pad Prism v8.0.

4.2.10 Statistical analysis

Statistical analysis was performed using Graph Pad Prism v8.0. The groups were compared using ANOVA and Mann-Whitney U tests. Statistical significance was set at p ≤ 0.05.

4.3 Results

4.3.1 Absorbance estimation of bacterial cell concentration in PBS

To establish a reliable method for estimating and delivering defined numbers of UPEC, I initially quantified the CFU/mL of serial dilutions of overnight culture against the absorbance (OD600). This was done because, in this study, some of the UPEC strains lacked multiple (up to five mutations) large extracellular surface-associated proteins. This could significantly impact absorbance and light scatter in the spectroscopic analyses of the bacterial cells in solution. Graphs of absorbances against the serial dilutions of bacterial cells were prepared in Graph pad for each strain; following the protocol described in materials and methods (Section 4.2.5). The bacterial cell count (CFU/ml) against absorbance values for each of the diluted cells was calculated (Figure 19). The 11 OD600 ranged from 0.5 to more than 5 and the bacterial count reached upto 1 x 10 CFU/ml. Apparently, there was a linear relationship between absorbance and CFU/mL for absorbances between 0.1 and 1.0. The comparisons of CFU/mL with respective absorbances were not reliable; particularly with absorbance values less than 0.1, or more than 1.5. I therefore decided to perform an experiment to measure absorbances at an

OD600 0.5 only. No significant differences (ANOVA) in bacterial cell concentrations were observed among all six strains at OD600 of 0.5 (Figure 20A). All the UPEC strains yielded

8 approximately 3.5 x 10 CFU/ml at OD600 of 0.5.

To determine whether UPEC enriched for flagella expression (with pMG600) could make difference in cellular concentrations at specific absorbance, I used bacteria grown on soft agar to promote abundant flagella expression; as explained in Section 4.2.5. No significant differences in bacterial cell concentrations grown on soft agar were observed among all six strains at OD600 of 0.5 (Figure 20B).

Figure 19: Standard absorbance estimation of bacterial cell concentration in PBS.

The cellular concentrations were measured in various absorbances (OD600) with (A) CFT073 Wt (GU2061), (B) CFT073fliC (GU2639), (C) CFT073/pflhDC (GU2139), (D) CFT0734 (GU2597), (E) CFT0734fliC (GU2642) and (F) CFT0734/pflhDC (GU2647) using serial dilutions in PBS. Each data point represents a single dilution (from -2 to -16). The results from a single experiment, representative of three independent experiments are shown.

Figure 20: Absorbance comparison of bacterial strains grown in liquid cultures and soft agar cultures at OD600 of 0.5.

Concentrations of UPEC strains with an OD600 of 0.5 were measured. CFU/ml values were enumerated in GU2061 (CFT073 Wt), GU2639 (CFT073fliC), GU2139 (CFT073/pflhDC), GU2597 (CFT0734), GU2642 (CFT0734fliC), and GU2647 (CFT0734/pflhDC). Data were combined from three separate experiments; mean and SD are shown. Group comparisons were performed using ANOVA with significance set at *p ˂ 0.05.

4.3.2 In-vitro model of FliC mediated IL-10 induction using human cell co-culture model

A dual co-culture model of 5637 uroepithelial cells and U937 monocytes was used to analyze IL-10 production in vitro. Approximately, 1 x 105 uroepithelial cells and 5 x 104 monocytes were infected with 3 x 107 CFUs of different UPEC strains (MOI of 200), or challenged with 2 µg and 1 µg of FliC purified from CFT073∆4/pflhDC, or the equivalent volume of carrier control generated from CFT073∆4∆fliC/pflhDC as explained in materials and methods (Section 4.2.7). The challenged cells were incubated for 5 h, and IL-10 was measured in the clarified cell culture supernatants using commercial ELISA as explained in materials and methods (Section 4.2.8). These assays showed no significant differences between IL-10 concentrations for a range of infections and challenges. Most importantly, high background levels of IL-10 were detected in the control wells, which were not exposed to exogenous bacteria or proteins (media control, Figure 22). Hence, a series of experiments were designed in order to optimize the assays.

Figure 21: Uroepithelial and monocyte cell co-culture model and IL-10 measurement. Approximately, 1 x 105 uroepithelial cells and 5 x 104 monocytes were infected with 3 x 107 CFUs of various UPEC strains, or challenged with 2 µg and 1 µg of FliC for 5 h. IL- 10 was measured in the supernatants using ELISA. Bars show mean ± SEM from two independent assays.

4.3.3 Optimization of infection assays and measurement of IL-10

To analyze the observed high background levels of IL-10 produced from uninfected cells in the co-culture model, I began by quantifying the levels of IL-10 secreted from 5637 uroepithelial cells and U937 monocytes, cultured separately to exclude differences arising from the co-culture model. Each cell line was seeded at three different densities (104, 105, and 106 cells/200 µl) and incubated for 24 h in 96-well cell culture plates according to the protocol explained in (Section 4.2.4). The culture supernatants from adherent cells (5637), and supernatants with suspended cells (U937), were transferred to another 96- well uncoated plate and clarified by centrifugation prior to measurement of the IL-10 concentration. All cultures containing only 5637 cells yielded low IL-10 levels in supernatants that were at or below the limit of detection. By contrast, U937 cells secreted IL-10 in a manner dependent on cell number (Figure 32A).

Since 5637 uroepithelial cells themselves did not secrete IL-10 (background), I decided to proceed with the optimization experiment using U937 monocytes only, in order to explore the source of the high background level observed in the previous experiment; thus, in this experiment, two sets of monocytes were seeded in parallel, with three different concentrations as described above (104, 105, and 106 cells/200 µl). The first set was not infected as described above, while the second set was infected with 1 x 107 CFUs of CFT073Δ4/pflhDC for 5 h. This enabled analysis of three different MOIs at 10:1, 100:1, and 1,000:1 bacterium to monocytes. At MOI 100:1 and 1,000:1, an increase in the IL-10 concentration was noted with U937 monocytes at 105 concentration (Figure 23B); so, I decided to conduct further experiments with this concentration of monocytes.

Figure 22: Optimisation of infection assays. (A) Uroepithelial and monocyte cells were seeded in increasing concentrations (104, 105, and 106) and incubated for 24 h. The cell culture supernatants were analyzed for IL-10 concentration. (B) Two sets of monocytes were seeded in increasing concentration (104, 105, and 106) and incubated for 24 h. One set was not infected, while other set was infected with 1 x 107 CFUs CFT073Δ4/pflhDC or treated with ‘media only’ control. After 5 h of incubation, the culture supernatants were measured for IL-10 concentration. The data presented are means and SEM (n=4). Sup: supernatant. The bar in red are optimal concentrations of cell lines applied in following experiments.

4.3.4 Induction of IL-10 in human U937 monocyte cells infected with UPEC strains or purified FliC

In this experiment, U937 monocytes were seeded at a final concentration of 1 x 105 cells and were infected with 1 x 107 CFUs of different UPEC strains for 5 h. The IL-10 was measured in the supernatants using ELISA. Retrospective colony counts on LB agar plates (1.5%) were performed on the bacterial inoculum to determine the accuracy of the MOI estimates. The counts are shown in Table 11 from three independent experiments.

The CFT073/pflhDC and CFT073Δ4/pflhDC UPEC strains, over-expressing FliC via pflhDC, induced higher levels of IL-10 than their respective fliC-deleted derivatives in U937 monocytes (Figure 23). The level of IL-10 induced by CFT073Δ4/pflhDC compared to CFT073Δ4 and CFT073Δ4∆fliC was statistically significant (p ˂ 0.05); however, that induced by CFT073/pflhDC compared to CFT073 Wt and CFT073∆fliC was not significant (Figure 23).

In a similar experiment, human U937 monocytes at a final concentration of 1 x 105 cells were challenged with different doses of FliC (2 µg and 1 µg) for 5 h. The IL-10 was measured in the supernatant using ELISA. Equivalent volumes of protein solution, extracted from a fliC-deleted derivative of CFT073Δ4 (CFT073Δ4ΔfliC) in an identical manner, was used as the carrier control in this experiment. Expression of IL-10 was detected incrementally with two different doses of FliC challenged to similar number of monocytes (p ˂ 0.05) (Figure 24). These data suggested that FliC induces IL-10 secretion in human monocytes.

Table 11: Retrospective colony counts of bacterial inoculum.

Strains Total cell number (CFU/ml) Standard deviation

CFT073 Wt (GU2061) 3.6 x 108 ±0.2 x 108

CFT073∆fliC (GU2639) 3.6 x 108 ±0.4 x 108

CFT073/pflhDC (GU2139) 2.9 x 108 ±0.1 x 108

CFT073Δ4 (GU2597) 3.7 x 108 ±0.2 x 108

CFT073Δ4ΔfliC (GU2642) 2.9 x 108 ±0.1 x 108

CFT073Δ4/pflhDC (GU2647) 3.3 x 108 ±0.2 x 108

Presented data were mean of triplicate with standard deviation (SD)

Figure 23: UPEC mediated IL-10 response in human U937 monocyte cells. U937 monocytes (1 x 105 cells) were infected with 3 x 107 CFUs of different UPEC strains for 5h. IL-10 was measured in the supernatants using ELISA. The data are average value of three independent experiments with two technical replicates, displayed with mean bars and SEM. The groups were compared by ordinary one-way ANOVA, with significance set at *p ˂ 0.05.

Figure 24: FliC mediated IL-10 response in human U937 monocyte cells. U937 monocytes (1 x 105 cells) were challenged with 2 µg and 1 µg of FliC and equal volume of carrier control for 5h. IL-10 was measured in the supernatants using ELISA. The data are average value of four independent experiments each with two technical replicates, displayed with mean and SEM. The groups were compared with Mann- Whitney test, with significance set at *p ˂ 0.05.

4.3.5 Cytokine profile in response to FliC in mouse J774A.1 macrophage culture

To assess the cytokine profile of mouse macrophages in response to FliC, J774A.1 cells were challenged with FliC for 5 h and the concentrations of proinflammatory cytokines, regulatory cytokines, chemokines, and growth factors were measured in the cell culture supernatants using a commercial 23-plex ELISA (Bioplex) as explained in Section 4.2.9. The protein extracted from CFT073Δ4ΔfliC/pflhDC (GU2648) in an identical manner to the FliC extraction from CFT073Δ4/pflhDC (GU2647) was used as a carrier control in these experiments. Exposure of 1 µg of FliC led to significantly increased production of pro-inflammatory cytokines, chemokines, and growth factors (Figure 25).

FliC induced significantly elevated levels of proinflammatory cytokines compared to the carrier control, including TNF-α, IFN-γ, IL-1α, IL-1β, IL-12(p40), IL-12(p70), IL-9 and IL-17 (Figure 26). Similarly, regulatory cytokines were significantly elevated, including IL-10, IL-4, IL-6, IL-3 and IL-13; however, the regulatory cytokines IL-5 and IL-2 were not increased significantly in response to FliC compared to the carrier control.

In addition, most of the chemotactic cytokines and growth factors were significantly elevated in response to FliC compared to the carrier control, including RANTES, MIP- 1α, MIP-1β, MCP-1, eotaxin and KC. The growth factors, G-CSF and GM-CSF were not detectable (below detection limit of the assay).

This study has also noted that the magnitude of these cytokine responses is different for the different cytokines. The difference probably reflects the nature of the cell types in the culture model. In other words, monocytes and epithelial cells usually exhibit stronger cytokine responses (following stimulation with microbes or microbial products) for some cytokines such as IL-10 compared to other cell types, such as B cells or T cells (242).

Figure 25: Cytokine profile of J774A.1 cell line challenged with FliC. Cell culture supernatants were assayed for pro-inflammatory cytokines, regulatory cytokines, chemotactic cytokines, and growth factors, using Bioplex Pro-mouse cytokine 23-plex assay. The data are displayed with median bars and show IQR (n=18 for each tests and control). The groups were compared with Mann-Whitney U test, with significance set at *p ˂ 0.05, **p ˂ 0.01, ***p ˂ 0.001, ****p ˂ 0.0001.

100

4.3.6 FliC induced IL-10 in a murine model of UTI

To explore the ability of FliC to induce IL-10 in vivo, I next applied a UTI mouse model. C57Bl/6 mice (n=5) were challenged with FliC (30 µg/50 µl) via transurethral catheterization as explained in the materials and methods (Section 4.2.2). After 2 h of inoculation, the bladders were removed and homogenized in PBS containing a protease inhibitor. The IL-10 levels were measured in the clarified supernatants using ELISA and multiplex assays. The bladder homogenates, after FliC challenging in the first two individual experiments (n=5 per group) were subjected to IL-10 measurements using ELISA, while the next two individual experiments were subjected to IL-10 measurements using multiplex assays.

An approximately three-fold increase in the IL-10 level was observed, using ELISA in bladder samples challenged with FliC in comparison to the carrier control (Figure 26A). The elevated level of IL-10 in mice bladder homogenates in response to FliC, compared to the carrier control, was significant (p ˂ 0.05).

In addition, bladder homogenates obtained from similar experiments and measured with multiplex assays exhibited a significant increase in the IL-10 level in response to FliC, compared to the carrier control (p ˂ 0.001) (Figure 26B).

101

Figure 26: FliC induces IL-10 production in the bladder. C57Bl/6 mice were challenged with FliC (30 µg/50 µl) via transurethral catheterization along with similar volume of the carrier control. Bladders were removed 2 h post inoculation and homogenized in PBS. IL-10 levels from first two individual experiments were measured in supernatant using ELISA (A), and next two individual experiments were measured in supernatant using Bioplex assay (B) (n = 5 per group). Data are combined from two separate experiments; median and IQR are shown. The groups were compared with Mann-Whitney U test, with significance set at *p ˂ 0.05.

102

4.3.7 Cytokine profiles of mice bladders in response to FliC

In order to define the broader response of FliC in mice models of UTI, I performed multiplex assays to measure the production of 23 cytokines, chemokines, and growth factors. C57Bl/6 mice (n=5) were challenged with FliC (30 µg/50 µl) via transurethral catheterization, as explained in materials and methods (Section 4.2.2). The protein extracted from the CFT073Δ4ΔfliC/pflhDC (GU2648) in an identical manner to the FliC extraction from CFT073Δ4/pflhDC (GU2647) was used as the carrier control in these experiments. The bladders were removed 2 h post inoculation and homogenized in PBS. Exposure of 30 µg (dissolved in 50µl of PBS) of FliC led to significantly increased production of pro-inflammatory cytokines, chemokines, and growth factors (Figure 27). The data illustrated the functional groupings: pro-inflammatory cytokines, regulatory cytokines, and chemokines and growth factors.

Interestingly, in the in vitro assays using mouse J774A.1 macrophages, I noted induction of TNF-α, IFN-γ, IL-12(p40), IL-12(p70), IL-9 and IL-17 (Figure 26); however in the mice model, FliC did not induce these factors (Figure 27). Only IL-1α and IL-1β were significantly elevated in response to FliC 2 h post inoculation, compared to an equivalent volume of carrier control (p ˂ 0.05). In addition, regulatory cytokines IL-10, IL-6, and IL-3 were elevated significantly (p ˂ 0.05), while no differences were noted with IL-4, IL-5, IL-2, and IL-13.

All the chemotactic cytokines and growth factors were significantly elevated in response to FliC compared to the carrier control, including RANTES, MIP-1α, MIP-1β, MCP-1, Eotaxin, KC, G-CSF, and GM-CSF (p ˂ 0.05) (Figure 27).

103

Figure 27: Cytokine profile of mice bladder in response to FliC. The supernatants from the bladder homogenates were assayed for pro-inflammatory cytokines, regulatory cytokines, chemotactic cytokines and growth factors using Pro- mouse cytokine 23-plex bioplex assay. The data are displayed with median bars and show IQR (n=10 per group; data are combination of two independent experiments). The groups were compared with Mann-Whitney U test, with significance set at *p ˂ 0.05, **p ˂ 0.01, ***p ˂ 0.001, ****p ˂ 0.0001.

104

4.4 Discussion

Flagella have been considered a virulence factor that contributes to the motility of bacterial cells and eventually leads to colonization, adhesion, and invasion of host cells (183). Recently, it has emerged as a potent immune activator, shaping both the innate and adaptive arms of immunity during microbial infections (16). FliC, a sub-unit constituent of flagella, represents established proinflammatory activity (217). However, studies of the role of FliC in immune regulation in the context of UTI have been limited to the analysis of FliC derived from S. Typhimurium (84, 231). Since it has been reported that FliC variations exhibit immune responses differently (38, 39), I have noted that the role of FliC from UPEC in immune regulation during acute UTI has never been studied. This chapter aimed to define the role of FliC in modulating the bladder’s innate immune system as part of a defense strategy utilizing IL-10, which has previously been shown to contribute to the control of UTI (13). I determined that FliC contributes to induction of pro-inflammatory cytokines, chemokines, growth factors and anti-inflammatory cytokines, including IL-10, using mammalian cell culture and murine models of UTI. The principal finding was that the detection of the major flagella filament of UPEC, FliC, within the bladder and in human monocytes causes a very rapid local response, resulting in IL-10 synthesis.

I characterized CFT073 and CFT073Δ4 with their respective fliC derivative mutants and the flagella overexpressing strains constructed in chapter 3. It was important to estimate the consistent and uniform inoculum concentration for individual strains in order to apply infection assays. A series of experiments contributed to a robust method of determining

CFU/ml quantities for each strain based upon the absorbance (OD600) of the UPEC strains studied. For either wild-type parental strains or their respective fliC-deleted and flhDC incorporated strains, a 0.5 absorbance at 600 nm resulted approximately 3.2 x 108 CFU/ml cells. This suggested that there was no difference in cellular concentration between these individual strains. I anticipated that the flagella overexpressed strains would yield high absorbance with a relatively low number of cells, due to the presence of a high number of flagella on their surfaces. It was observed that the cells inoculated at the centre of a soft agar plate were differentiated at the periphery of the colony into filamentous swarmer cells that were multinucleated, and they could have an approximately 50-fold increase of flagella per unit of cell surface (130, 137). In addition, more protein was extracted from swarmer cells compared to swimming cells (137). It has been estimated that swimming cells use about 2% of their biosynthetic energy output to synthesize flagella and to swim

105

(110). The growth rate in the hyperflagellated strains in this study was expected to be slower than in the wild-type strains; however, this did not affect final viable cell count following aerobic growth in liquid LB medium. This could be because of our experimental methodology where the cell growth occurred in liquid media with shaking instead of solid or semi solid media. Surprisingly, even after measuring the growth rate of the respective strains on semi-solid agar, I did not notice altered growth rates and cell number of hyperflagellated strains in comparison to the wild-type strain.

I next sought to examine IL-10 production in response to FliC in in vitro and in vivo assays. I first optimized the IL-10 production in response to UPEC and FliC using different human cell lines. It has already been established that the principle cellular sources of IL-10 are monocytes/macrophages, dendritic cells, and CD4+ and regulatory T cells (242, 243). Similarly, mast cells, natural killer (NK) cells, eosinophils, neutrophils and B-cells can produce IL-10 (244). Interestingly, it has been reported that monocytes and uroepithelial cells, when cultured together, produce far higher IL-10 levels than monocytes alone, implying a synergistic effect on IL-10 production and suggesting that this might not be due to induction by a single cell population (40). The study did not observe IL-10 production by epithelial cells alone in response to UPEC (40). Surprisingly, this study noted high levels of IL-10 produced from cells treated with a media control only. A series of experiments contributed to optimizing the cell concentration and inoculum concentration, and ELISA assay were conducted, but the cause of the high background concentration of IL-10 production in the media control remained unclear. I observed that monocytes secreted IL-10 in significant amounts while uroepithelial cells did not. In an experiment with incremental concentrations of monocytes, incremental concentrations of IL-10 were detected; however, absolutely no IL-10 was detected in a similar experiment performed on uroepithelial cells, and significant differences were not observed in an experiment performed with a dual cell co-culture model. Our results accorded with numerous previous studies in which the principle cellular sources of IL-10 were reported to be monocytes and macrophages. Notably, the uroepithelial cells alone were not able to induce il10 mRNA when infected with UPEC (13). Finally, I decided to use U937 monocytes only, instead of a co-culture model.

The bladder inflammation in response to UPEC is rapid, pathogen specific, and diverse (13). Multiple factors, such as antimicrobial peptides, Tamm-Horsfall protein, cytokines including IL-6, TNF-α, IL-1β, G-CSF, IL-17, and IL-10, and the chemokines CXCL1, CXCL2, CXCL3, CXCL8, and CCL4 are detected as a consequences of E. coli-induced

106 immune stimulation in the bladder, as described in various in vitro and murine models (11, 13, 85, 89-92). It was previously shown that co-cultures of bladder uroepithelial cells and monocytes produced IL-10 when challenged with UPEC (40). In order to determine whether flagella contributed to this response, I compared CFT073 Wt and CFT073Δ4 with their respective fliC-deleted and flagella overexpressed derivatives to establish their ability to induce IL-10 secretion from U937 monocytes. A significantly increased amount of IL-10 was detected in flagella overexpressed strains mediated infection compared to the fliC-deleted derivatives of CFT073Δ4. This suggested that flagella play a role in the induction of IL-10.

There could be a couple of explanations for the mechanism of IL-10 secretion from U937 monocytes infected with either the Wt CFT073 strain, a single fliC mutation, or the flagella overexpressed (pflhDC) strain. Since only FliC monomers are recognized by TLR5, the self-depolymerization or monomerization of shredded flagella during the infection process could have been recognized by TLR5, not the filamentous flagella on a bacterial surface. Such a possible phenomenon of self-depolymerization of FliC in natural infection process has been proposed recently (345). This recognition initiates immune signaling cascade through various pathways that secretes IL-10 and other cytokines. It is also possible that bacteria with flagella could be phagocytosed, and the cytosolic flagellin is recognized by the cytosolic sensor Naip5 and Ipaf, with the subsequent signaling cascade leading to the production of IL-10 (19); however, no study has yet been conducted to define the secretion of IL-10 from cytosolic flagellin. Probable self-depolymerisation of UPEC flagella can be investigated further by two experiments: (i) detection of FliC in culture media during cultivation of UPEC, and (ii) detection of FliC in cell culture supernatants while doing in vitro cell culture experiments using UPEC isolates. FliC monomers can be identified by using native gel and further confirmed by microscopy.

Besides flagella, other cellular components in UPEC are likely to contribute to IL-10 responses in the bladder. Our findings, based on stimulation assays and experiments using Wt E. coli and fliC-deficient strains in cell cultures, showed levels of IL-10 above the baseline in vitro. Interestingly, IL-10 levels were above the baseline stimulated with samples in which FliC was absent. Lipopolysaccharide and T3SS proteins are other bacterial factors associated with IL-10 induction (346). T3SS proteins could be shed from E. coli under certain conditions (237). I removed endotoxin from the treatments used in this study, and the use of pure FliC showed that this UPEC factor significantly contributes

107 to IL-10 bladder induction; however, it is likely that FliC (and flagella more broadly) is not the sole antigen of UPEC that triggers IL-10 production in host cells.

It has been thoroughly established that FliC activates various immune responses in in vitro and in vivo models, and many studies have considered the immune stimulating cascade in response to FliC. It is possibly detected only by TLR5 in an extracellular environment and the cytosolic sensors Naip5 and Ipaf in cytosol (19, 26). TLR5 induces a MyD88-dependent signaling pathway through Nf-κB activation, leading to the production of pro-inflammatory cytokines such as TNF-α, IL-1, IL-6, and IL-8 (26, 204, 205). FliC, delivered into the cytosol, induces Ipaf dependent caspase 1 activation, leading to maturation of IL-1β and IL-18 and apoptosis (205, 211). However, the variance of immune responses among flagellin types and microbial sources has been described (39). This suggested the need to characterize FliC from UPEC in the context of acute UTI. The cytokine profiles measured in this study in response to the FliC from UPEC, were mostly consistent with the previous literature. Elevated levels of pro-inflammatory, regulatory, and chemotactic cytokines in mouse macrophages in response to FliC, including TNF-α, IFN-γ, IL-1α, IL-1β, IL-12, IL-17, IL-4, IL-6, IL-10, IL-13, MIP-1α, MIP-1β and MCP-1 were previously reported.

In addition, I noted significant elevation of new cytokines that had not previously been described, including IL-3 and IL-9. IL-9 is a pleiotropic cytokine which has a direct or indirect effect on multiple cell types relating to immunity and inflammation, as reviewed elsewhere (347). IL-9 promotes T-cell growth and promotes Th2 cytokine production (348). It affects both B-cell development and functioning (349). IL-9 is also a well- characterized hematopoietic regulator (350). IL-9 has demonstrated pro-inflammatory activity in several mouse models of inflammation (351), and its protective function in some parasitic infections has been described (352). Similar to the activity of IL-4 and IL- 10 in conferring protection against microbial septic shock, IL-9 has shown the ability to protect mice from the lethal challenge of P. aeruginosa (353). This study has shown significant elevation of these three regulatory cytokines (IL-4, IL-10, and IL-9) in response to FliC in the mouse macrophage cell line; however, of these regulatory cytokines, only IL-10 was elevated in mice bladders challenged with FliC. The 5 h post challenge for the macrophage cell line (in vitro) and the 2 h post challenge in the mice experiments (in vivo), for the sample collection could be the reason for the non-uniform response. Cell culture experiments are most useful for identifying discrete biochemical pathways, while in vivo studies are used to identify the broad and general outcomes of

108 stimuli. The general immune responses observed in previous studies were not comparable with the in vivo observations; however, more time dependent assays (2 h to 48 h) are required to define the role of FliC in the induction of regulatory cytokines other than IL- 10 in mice bladders.

IL-3 is another pleiotropic cytokine and, along with IL-5 and GM-CSF, plays an important role in the differentiation and functioning of myeloid cells (354). IL-3 acts at an early stage of hematopoiesis and contributes to cell development (355). It is usually elevated in allergic reactions (356, 357). IL-3 contributes to the release of IL-4 and IL-6 from basophil (358). Hardly any studies have reported an association of IL-3 with microbial mediated inflammation; hence this is a novel report on the elevation of IL-3 in response to FliC from mice bladders and the J774A.1 macrophage cell line. The regulatory ability of IL-3, along with IL-4, IL-6, and IL-10, could play a critical role in the early control of acute UTI.

The role of IL-10 as a regulatory cytokine has been studied in various infectious disease models, including tuberculosis, HIV, listeriosis, and malarial parasites (256, 259, 264, 265). C. jejuni induces high IL-10 expression in hDC and murine BMDC (212). Whole bladder transcriptome in mice infected with UPEC shows IL-10 signaling pathways, implying the role of IL-10 in the innate immune response against UPEC UTI (13). In order to determine whether flagella contributed to this response, I extracted FliC monomers to purity and homogeneity from UPEC and determined their ability to induce IL-10 secretion from U937 monocytes and mice bladder homogenates. Although previous studies have shown the role of flagella from Salmonella in induction of IL-10, the lack of purity in protein extraction led to incomplete understanding of this response (37, 215). IL-10 production could not be detected until 24 h after stimulation of human PBMC with S. Typhi flagellin (206). This is the first report on FliC from UPEC-mediated early IL-10 induction that provides insight into the biology of this protein in the context of the regulation of UTI.

In conclusion, this study aimed to define the role of FliC from UPEC in immune modulation during UTI. The study was focused on identifying specific role of IL-10 induction in response to FliC. Proinflammatory cytokines, chemokines, and growth factors, as well as IL-10, were induced from human monocytes, mouse macrophages, and mice bladders in response to purified FliC. A more comprehensive study is required to support these results.

109

5 Chapter 5 The bladder transcriptome of mice treated with UPEC flagellin

My contributions to this chapter include:

Sections of this chapter are included in a published paper (Appendix 4).

• D. Acharya, M. J. Sullivan, B. L. Duell, K. G. K. Goh, L. Katupitiya, D. Gosling, M. N. Chamoun, A. Kakkanat, D. Chattopadhyay, M. Crowley, D.

K. Crossman, M. A. Schembri, G. C. Ulett. Rapid bladder IL-10 synthesis in

response to uropathogenic Escherichia coli is part of a defence strategy that is

triggered by the major bacterial flagella filament FliC and contingent on TLR5. mSphere. 2019 Nov 27;4(6). pii: e00545-19. doi: 10.1128/mSphere.00545-19.

The contributions of author’s to this publication were:

• Conceived the experiments (DA, BLD, MAS, GCU) • Designed the experiments (DA, BLD, MAS, GCU) • Performed the assays (DA, MJS, BLD, KGKG, LK, DG, MNC,AK, DC, MC, DKC, GCU) • Analysed and interpreted the results (DA, MJS, BLD, KGKG, MAS, GCU) • Prepared figures and tables (DA, MJS, BLD, KGKG, GCU) • Writing and revision of manuscript (DA, MJS, BLD, KGKG, LK, DG, MNC, DC, MC, DKC, GCU)

(Signed) ______(Date)______

Dhruba Acharya

(Countersigned) ______(Date)______

Supervisor: Professor Glen C. Ulett 110

5.1 Introduction

Urinary tract infections (UTIs), caused by uropathogenic E. coli (UPEC), are common infections; with 150 million cases each year worldwide leading to billions of dollars as health care expenditure (1, 78). Among the plethora of virulence factors described in UPEC pathogenesis, flagella contribute to host-pathogen interactions via motility, adhesion, colonization, and secretion; as reviewed elsewhere (4). Flagellin (FliC), a major filamentous protein of flagellum, is a key trigger of the immune response through both the innate and adaptive arms of the mammals; through host recognition via the TLR5 ligand (359). Flagellin variation has been described in E.coli (314). Among UPEC, several distinct types of flagellar antigens are described, including H1-type flagella produced by the commonly studied UPEC reference strain, CFT073, H4 flagella produced by multidrug resistant and globally disseminated ST131 strains of UPEC, and H7 flagella produced by UPEC reference cystitis strain, UTI89 (9, 15, 38).

The pathogenesis of acute UPEC UTI induces diverse cytokine responses, including proinflammatory and regulatory cytokines (4). Interleukin-10 (IL-10) is one such cytokine that is upregulated in the infected bladder within hours of experimental infection in mice (13). IL-10 plays pleiotropic roles in defence to infection, depending on the illness and causative pathogen. Frequently, IL-10 facilitates immune suppression to moderate inflammatory mechanisms that can damage the host (30, 242). A central element in understanding the role of IL-10 in infectious disease is the elucidation of microbial products that elicit production of this key regulator of innate immune responses. Bacterial virulence factors shown to induce the production of IL-10 in experimental disease models include M protein of S. pyogenes (31), peptidoglycan-embedded lipopeptides and cell wall glycopolymers of Staphylococcus (34), and the flagella of both Salmonella (206) and

Yersinia (36). However, the nature of the host responses depends on the genus or species from which the pathogen virulence factor is derived (360-366). In the previous chapter, I have identified FliC as a potent trigger of host cytokine responses, including IL-10, in both in vitro and in vivo experiments. A comprehensive picture of how UPEC FliC engages innate immunity in the bladder during UTI is lacking (9, 23-25) and there are no studies regarding the contribution of FliC to IL-10 responses in UTI.

Conventional RT-PCR which was initially perceived as a qualitative assay and later developed as a quantitative rapid and sensitive assay, has long been the method of choice for gene expression analysis (367). Two-step quantitative real-time RT-PCR (RT-qPCR), which is a combined method of traditional RT-PCR and fluorescence resonance energy 111 transfer (FRET) was recently described (368). DNA microarrays provide a powerful tool for the parallel analysis of many genes; where competitive hybridizations between different populations of mRNA expression is measured (369, 370). The development of RNA sequencing techniques has provided the opportunity to comprehensively and efficiently survey the transcription profile of microorganisms with well-defined genotypes (370). Some researchers have claimed that RNA-Seq has been arising as a powerful method for transcriptome analyses that will eventually make microarrays obsolete (371, 372). Nevertheless, sequencing based studies are uncovering a broad spectrum of genetic activity, providing a new understanding of gene functions.

Genome-wide gene expression studies of pathogens have been performed for several animal models of infection, including for L. monocytogenes, C. jejuni, V. cholerae, and E. coli infections in mice (373-376). The transcriptome of uropathogenic E. coli in human infection has been described (377). These studies have provided a broad view of virulence factors associated with infection pathogenesis. However, there are relatively fewer studies that describe the corresponding transcriptomic profile of the host providing insight into the immune response during infection (39). The host cellular response in transcriptomic level to flagellin variants of Salmonella Typhi has been described using the transcriptional profile of the host (39). Recently, a whole bladder transcriptomic profile was reported using the murine model of UPEC UTI; to provide better understanding of the nature of the innate immune response to UPEC in the bladder (13).

To define a more complete picture of the innate immune response of mouse bladder to

FliC, I performed RNA sequencing to map the complete set of transcriptional responses that are initiated concurrently with early IL-10 induction.

5.2 Materials and Methods

5.2.1 Murine model of UTI

The murine model of UTI utilizing female C57Bl/6 mice (8-10 weeks) or functionally TLR5 KO mice were used (B6.129S1-Tlr5tm1Flv/J; The Jackson Laboratory, USA; and Animal Resources Centre [Canning Vale, WA]). Independent experiments using groups of five mice were repeated at least twice.

5.2.2 Transurethral catheterisation

Mice from two groups (n=5 per group) were challenged with either 30 µg of purified FliC

112 diluted in 50 μl of PBS, or 50 μl of carrier control [extracted in an identical manner from a fliC deleted derivative of CFT073Δ4 strain (GU2642)] via transurethral catheterization, as described previously (344). FliC was heated for 10 min at 60°C in order to generate monomers before instillation. Briefly, the mice were anesthetized by inhalation of isoflurane. The peritoneal area was sterilized by swabbing with 10% povidine-iodine solution, which was subsequently removed with PBS. The mice were catheterized using a sterile polyethylene catheter, and FliC in PBS was instilled at a slow infusion rate of 5 µl/s transurethrally. The catheters were then removed, and the mice were returned to their respective cages.

5.2.3 Sample collection

Mice were euthanized by CO2 asphyxiation followed by cervical dislocation, and bladders were isolated 2 h post inoculation. Bladder tissue was collected at 2-3 hr post-inoculation, which is sufficient for IL-10 responses in UPEC-infected mice (13) and processed for RNA isolation. Briefly, the bladders were homogenized in TRIzol (Life Technologies, Mulgrave, VIC, Australia), according to the manufacturer’s instructions. RNase-free DNase-treated RNA that passed Bioanalyzer 2100 (Agilent) analysis was quantified and used for RNA sequencing.

5.2.4 RNA sequencing and bioinformatics

The mRNA sequencing was performed on RNA from C57BL/6 and TLR5 KO mice (n=5 per group) to define TLR5-dependent, FliC-regulated gene expression in the bladder (Illumina NextSeq 500, USA). Total RNA was subjected to 2 rounds of poly(A)+ selection and converted to cDNA. TruSeq library generation kits were used, as per the manufacturer’s instructions (Illumina, San Diego, California). Library construction consisted of random fragmentation of the poly(A) mRNA, followed by cDNA production using random primers. The ends of the cDNA were repaired and A-tailed, and adaptors were ligated for indexing (with up to 12 different barcodes per lane) during the sequencing runs. The cDNA libraries were quantitated using qPCR in a Roche LightCycler 480 with the Kapa Biosystems kit (Kapa Biosystems, Woburn, Massachusetts) prior to cluster generation. Clusters were generated to yield approximately 725K–825K clusters/mm2. Cluster density and quality was determined during the run after the first base addition parameters were assessed. I ran paired-end 2 × 75–bp sequencing runs to align the cDNA sequences to the reference genome. For data pre-processing and bioinformatics, STAR, version 2.5.3, was used to align the raw RNA sequencing fastq reads to the Gencode GRCm38 p4 Release M11 mouse reference 113 genome (378, 379). HTSeq-count (version 0.9.1) was used to estimate transcript abundances (379). DESeq2 was then used to normalized and test for differential expression and regulation. Genes that met certain criteria (i.e. fold change of  ±2.0, q value of <0.05 were accepted as significantly altered in expression (380). Raw and processed data were deposited in Gene Expression Omnibus (GEO; accession no. GSE132294). To review GEO accession GSE132294, go to https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE132294. And enter token: abyrkoighhqbzoh.

5.2.5 Data processing and statistics

For pathway analyses, Ensembl gene identifiers, together with fold-change and q-values, were uploaded into the InnateDB pathway analysis tool (381), and used to interrogate the REACTOME, KEGG and INOH databases. The datasets consisted of the subset of genes from the entire RNA-Seq datasets; only the differentially expressed genes ( ±2.0, q value of <0.05) from the comparisons of FliC vs Control (Wt mice) and FliC (Wt) vs FliC (Tlr5- /- mice). Data were processed using the pathway over-representation analysis tool and the recommended settings were used (hypergeometric algorithm with Benjamini Hochberg P-value correction method). The outputs were significantly overrepresented pathways and biological processes in each dataset, based upon the number of differentially expressed (up or down) genes in each category. The Toll-like Receptor Signaling Pathway from the KEGG database was chosen for further analysis of the interactions with FliC and TLR5- mediated signaling. Statistical analysis was performed using Graph Pad Prism v8.0 where necessary.

5.2.6 Ethical statement

This study was carried out in strict accordance with the national guidelines of the Australian National Health and Medical Research Council. The Institutional Animal Care and Use Committee of the University of Alabama at Birmingham and the Animal Ethics Committee of Griffith University reviewed and approved all animal experimentation protocols used in this study (permits: University of Alabama at Birmingham Animal Protocol IACUC-10089, and Griffith Approval MSC/01/18/AEC). The University of Alabama at Birmingham has an Animal Welfare Assurance on file with the Office of Laboratory Animal Welfare (Assurance A3255-01) and is registered as a Research Facility with the United States Department of Agriculture. The animal care and use program is accredited by the Association for Assessment and Accreditation of Laboratory

114

Animal Care (American Association for the Accreditation of Laboratory Animal Care International). Transurethral procedures were performed under isoflurane inhalation anaesthesia.

5.3 Results

5.3.1 Overview of the innate immune response of mouse bladder to FliC

Analysis of bladders of Wt mice exposed to FliC against the carrier control identified 1400 genes differentially expressed, as judged by those exhibiting ±2-fold changes in expression compared to the carrier control; with a q-value (adjusted p-value) of < 0.05 (Table S1 in Appendix 2). This list was used to generate a heat-map and volcano plot to demonstrate the breadth and depth of differential transcriptional responses (Figure 28A and 28B). Significant genes represented 831 that were upregulated and 569 downregulated (Figure 28B). Consistent with a role for IL-10 in mediating immune regulation in response to FliC, this study identified significant up-regulation of il10 (3.3- fold) in bladders exposed to FliC. In addition, upregulated genes in response to FliC included cd14 (23.7-fold), il6 (3.2-fold), tnf (15.5-fold), cxcl1 (67.4-fold), cxcl5 (63.7- fold), cxcl9 (3.9-fold), nos2 (54.4-fold), camp (35.2-fold), ccl2 (14.0-fold), ccl3 (11.5- fold) and ccl4 (9.6-fold) (Figure 28C). Strikingly, I also noted expression of tlr5 was down-regulated (-2.3-fold, q-value <0.001) in response to FliC.

In comparing the RNA-Seq expression changes to multiplex analyses of chemokine and cytokine quantities (Chapter 4), 21 of 23 genes showed similarly significant expression changes consistent with the patterns observed in multiplex assays. The complete list of genes similarly or differentially expressed are shown in Table 12. Surprisingly, tnf was highly upregulated in response to FliC but significant differences were not noted in multiplex assays. Similarly, eotaxin (ccl11) was not significantly upregulated in RNA- Seq analysis, while it was increased in the multiplex assays.

The bladders of Wt mice exposed to FliC or carrier control exhibited distinct global transcriptional signatures. Notably, many transcriptional responses detected by RNA sequencing exhibited consistency with previously reported immune components in response to FliC. In addition to the effects of UPEC FliC on IL-10 induction, the transcriptional mapping in this study identified many factors that have been associated with the host response to flagella in other experimental systems, such as proinflammatory cytokines, (tnfα, il1, il6, il12), regulatory cytokines (il10, il22), chemokines (ccl3, cxcl10, 115 ccl20, cxcl2, cxcl1), and antimicrobial peptides (reg3g, s100a8, lcn2, hamp) (Table 13). This illustrate a large degree of consistency in the overall response of the bladder to FliC compared to other systems.

Figure 28: Bladder transcriptome in Wt mice in response to pure FliC from UPEC CFT0734. (A) Heat-map of transcriptional changes in mouse bladder in response to 30 g pure FliC (in 50 l PBS) or equivalent volume of carrier control (2 h exposure). Colours indicate arbitrary expression values from low (blue) to high (red). (B) Volcano plot of the total number and the breadth of fold-change of transcriptional response of genes, including upregulated (red), down-regulated (green) and unchanged (black), in the bladder response to FliC. (C) Normalised transcript abundance (mean ± SEM) as judged by RNA-Seq of selected genes including il10 and associated cytokines for which protein quantities were also measured by ELISA and multiplex assays.

116

Table 12: Comparison of cytokines differentially expressed in RNA sequencing data and multiplex assays.

Cytokines Relevant functions Multiplex RNA-Seq Ref. (P) (G)

IL-1α Inflammatory cytokine; Increased Upregulated (382-384) promotion of fever and sepsis; activates TNF-α

IL-1β Inflammatory cytokine; involved Increased Upregulated (385-387) in apoptosis

IL-2 Regulate T-cell differentiation NS NA (388, 389) during immune response to infection

IL-3 Induces proliferation and NS NA (390) maturation of hematopoietic stem cells

IL-4 Switch into Th2 lineage of NS NS (391, 392) lymphocytes

IL-5 B-cell growth; maturation of NS NS (393, 394) eosinophils in the bone marrow

IL-6 Inflammatory cytokine; stimulate Increased Upregulated (395, 396) acute phase immune response

IL-9 Regulation of hematopoietic cells NS NA (397)

IL10 Anti-inflammatory cytokine; Increased Upregulated (13, 242) downregulate expression of Th1 cytokines

IL12(p40) Chemoattractant for macrophages NS NS (398) and dendritic cells

IL12(p70) Induce T-reg cells NS NS (399) Role in development of cell mediated immunity

IL-13 Regulate immune response by NS NA (400) switching into Th2 lineage

IL-17A Proinflammatory cytokine; NS NS (only (401) Induce chemokines and recruit IL17C immune cells. increased)

117

Eotaxin Chemoattractant for eosinophil Increased NS (402, 403)

G-CSF Stimulate bone marrow to Increased Upregulated (404, 405) produce granulocytes

GM-CSF Stimulate bone marrow to Increased Upregulated (406) produce macrophages and eosinophils

IFN-γ Macrophage activator NS NS (407) Induce MHC-II

KC Neutrophil chemoattractant Increased Upregulated (408, 409)

MCP-1 Lymphocyte and monocyte Increased Upregulated (410, 411) chemoattractant

MIP-1α Neutrophil chemoattractant Increased Upregulated (411)

MIP-1β NKT and monocytes Increased Upregulated (412, 413) chemoattractant

RANTES Leucocytes chemoattractant Increased Upregulated (414, 415)

TNF-α Inflammation NS Upregulated (416)

NS: Not significant; ND: Not detected; NA: Not available; P: Protein; G: Gene

118

Table 13: Genes upregulated in bladder transcriptome in response to FliC that are previously reported. Gene Function (s) Fold P value Protein (P)/ Reference changea Gene (G)

This study Previous studies Pro-inflammatory tnf cell signaling protein; activate 15.53 3.2E-34 P/G (26, 84, NF-κB and MAPK pathways 204, 206, 215, 217, 218, 222, 228, 361) il1a bind to IL-1R and activate 5.09 1.5E-11 P (228) TNF-α production il1b role in cell proliferation, 10.91 6.8-05 P/G (206, 224, differentiation and apoptosis 226)

il6 role in acute phage response 3.21 0.01 P/G (26, 84, and mediate fever 206, 217, 222, 224, 226) il12 T-cell stimulating factor for 1.45 ns P (417) production of IFN-γ and TNF- α il23a promote inflammation via IL- 2.0 ns G (224, 226, 17 and IL-6 417-419) il17c induce production of 29.76 8.9E-23 G (224, 420) inflammatory cytokines and chemokines il17f induce pro-inflammatory 4.46 ns G (224, 421) cytokine, anti-pathogenic peptide and chemokine secretion Anti-inflammatory/regulatory cytokines il10 downregulate expression of 3.26 0.005 P (206, 217, Th1 cells, MHC-II antigen 227, 361, 422) il12b regulate IL12 function; 1.45 ns P/G (217, 226, secreted by macrophage and 423) B-cells nos2 catalyzes production of NO 54.42 1.3E-70 P (217) from L-argenine il22 production of antimicrobial nd - G (224, 424) peptides ifnb antibacterial and antiviral -2.12 ns P (207, 425) activity Chemokines cxcl8 chemoattractant for nd - P/G (199, 216, granulocytes 220, 221, 223, 228, 361, 419) 119

ccl3 chemoattractant for PMN 11.47 6.4E-24 P (217, 222),

cxcl10 chemoattractant for 85.33 9.9E- G (224, 419) monocytes and macrophages 159

ccl20 chemoattractant for 980.27 2.5E-53 G (220, 224, lymphocyte 419) cxcl2 chemoattractant for PMN 78.43 1.3E-21 P/G (84, 222, 224, 419) cxcl1 chemoattractant for PMN 67.36 4.3E-17 G (84, 419)

ccl2 chemoattractant for 13.97 1.8E-08 G (84) monocytes and basophils cxcl5 epithelial-derived neutrophil- 63.70 1.5E-60 G (419) activating peptide 78 ccl5 chemoattractant for T cells, 2.60 0.0001 G (419) eosinophil and basophil Growth/remodelling factor csf3 stimulate granulocytes 15.31 1.8E-23 P/G (224, 228) development mmp13 breakdown extracellular 18.03 3.0E-28 G (224) matrix Antimicrobial peptides reg3g binds to bacteria and trigger 23.10 5.8E-05 G (224, 225, innate immune response 426) reg3b binds to peptidoglycan via a 11.51 ns G (224, 427, calcium dependent 428) carbohydrate-binding domain s100a7 Psoriasin; regulate cell cycle, - ns G (419) antimicrobial peptide s100a8 calgranulin A; neutrophil 75.38 2.4E-10 G (429, 430) chemotaxis s100a9 calgranulin B; neutrophil 67.82 6.5E-07 G (224, 429, chemotaxis 430) lcn2 antimicrobial peptide 91.25 1.5E-15 G (224, 431) (Lipocalin-2); binds to bacterial siderophores hamp antimicrobial peptide 50.23 3.4E-05 G (224, 432) (Hepcidin); inhibit iron transport ns: not significant; nd: not detected

120

5.3.2 Activation of biological responses in mice bladder triggered by UPEC FliC

Using the complete list of 1400 genes differentially expressed, a systems-biology approach using innateDB (433) was utilized to identify the top 20 canonical overrepresented pathways (Reactome), up-regulated in response to FliC. These are summarized in Figure 29 (Table S2 Appendix 2). The four most strongly activated pathways in FliC-treated mice compared to controls were Chemokine receptors bind chemokines, Immune system, Peptide ligand-binding receptors, and Cytokine signaling in immune system (Figure 29) confirming a central role for IL-10 in rapid immune response against FliC in bladder. In addition, the top 20 down-regulated pathways overrepresented in response to FliC include Potassium channels, Neuronal system, Voltage gated potassium channels and G alpha (i) signaling events (Figure 30).

121

Figure 29: Top 20 up-regulated pathways identified as over-representated by RNA-Seq analyses. Red bars show significance (P-value adjusted) and white numbers indicate proportion of genes up-regulated vs total number in each pathway, identified using InnateDB and Reactome databases.

122

Figure 30: Top 20 down-regulated pathways identified as over-represented by RNA-Seq analyses. Green bars show significance (P-value adjusted) and white numbers indicate proportion of genes down-regulated vs total number in each pathway, identified using InnateDB and Reactome databases.

123

5.3.3 UPEC FliC- TLR5 driven pro-inflammatory axis

To define the nature of FliC signaling through TLR5, the major receptor for bacterial flagella (26, 434), the bladder transcriptomes of TLR5-/- mice treated with FliC were analyzed, and compared to TLR5-/- mice treated with the carrier control. Consistent with a major role for TLR5 in FliC mediated signal transduction, this study identified only 5 genes differentially expressed (all down-regulated) in response to the FliC stimuli in the knockout mice. This represented a major reduction in the bladder transcriptional responses, dependent on TLR5. To further characterize the network of responses that arise from FliC exposure, the responses of FliC to Wt mice with Tlr5-/- mice were compared. This comparison enabled identification and delineation of responses that are dependent or independent of TLR5. A total of 1,849 genes differentially expressed in this comparison were noted, including 1,266 up-regulated and 583 down-regulated in Wt mice (±2-fold changes in expression; q-value of < 0.05; full list in Table S3 Appendix 2). The breadth of expression changes and significance can be seen in the volcano plot (Figure 31).

Table 14: Genes differentially expressed (all down-regulated) in response to the FliC stimuli in the knockout mice.

Genes Fold p-value Annotations change

0.03524743 retn 2.93 Resistin

gpd1 3.38 0.03524743 Glycerol-3-phosphate dehydrogenase 1 (soluble) alb 3.56 0.039114 Albumin

pnpla3 3.79 0.03524743 Patatin-like phospholipase domain containing 3 2010003k11rik 4.11 0.03524743 RIKEN cDNA 2010003K11 gene

124

Figure 31: Volcano plot of bladder transcriptomes of Wt mice compared to Tlr5-/- mice treated with FliC.

The plot shows the total number and the breadth of fold-change of transcriptional response of genes, including up-regulated (red), down-regulated (green) and unchanged (black), in the bladder response to FliC.

Strikingly, I noted that of 831 up-regulated genes, and of 569 down-regulated seen in the Wt comparison (Section 5.3.1), 78% (652 genes) were also up-regulated, and 28% (157 genes) were also down-regulated when comparing FliC-challenged Wt mice to Tlr5-/- mice (809 genes shared between both comparisons) (Figure 32). I reasoned that these genes, which included il10, were representative of a TLR5-dependent FliC transcriptional response (Figure 33). The remaining differentially expressed genes fell into two categories; (i) those that were likely independent of TLR5, but induced by FliC exposure, including 179 up-regulated and 412 down-regulated (591 in total); (ii) those that were likely changing due only because of TLR5-mutation, including 614 up-regulated and 426 down-regulated (1040 in total) (Figure 32).

125

Figure 32: Broad comparison of altered gene in RNA-Seq analysis.

Venn diagrams showing the number of up-regulated (top) and down-regulated genes shared (overlapping) or unique (separated) between comparisons of FliC vs carrier control in Wt mice (effect of FliC) and FliC-exposed mice in Wt vs Tlr5-/- mice (effect of TLR5).

Taken together, these data show that il10 transcriptional activation is part of rapid bladder defence strategy activated in response to FliC and that this response is largely dependent on TLR5, but also develops concurrently with a surprising and diverse repertoire of TLR5-independent antimicrobial responses. The cellular context of TLR5-dependent responses of mouse bladder to FliC is illustrated in Figure 33, which highlights the genes related to il10 that are significantly altered along with their involvement in TLR signaling pathways.

126

Figure 33: Cellular context of TLR5 engagement by UPEC FliC in the bladder leading to early IL-10 induction.

Gene transcriptional responses analysed using innateDB and overlayed on KEGG pathway 4620 Toll-Like Receptor Signaling. Colour key: green (downregulated); red (upregulated); yellow box (TLR5-independent); other diagram components as per KEGG definitions. The illustration highlights the likely signaling transduction mechanisms

(centre) that are engaged by FliC leading to rapid IL-10 synthesis in the bladder.

127

5.4 Discussion

In the previous chapter, I have reported that flagella, typically associated with motility and bacterial adherence, are sensed by the bladder innate immune system as part of a defence strategy utilizing IL-10, a cytokine previously shown to contribute to the control of UTI (13). The principal finding of this chapter is the detection of the major flagella filament of UPEC, FliC, within the bladder that causes a rapid local response resulting in IL-10 synthesis. The evidences also show that the bladder IL-10 response induced by FliC is TLR5 dependent. FliC-responsive bladder transcriptome by RNA sequencing provides comprehensive detail of the FliC-mediated bladder response.

FliC mediated innate immune responses, including rapid induction of IL-10 in this study align with the findings of prior studies on bacterial pathogens. For example, the flagella components of Salmonella and Yersinia have been shown to modify IL-10 production.

Salmonella flagella trigger IL-10 secretion in splenocytes (37), monocytes (206, 215), and serum (217), but the type of host response may depend on the nature of antigen presentation (269). The flagella of Yersinia have been shown to induce IL-10 in macrophages (36). Interestingly, however, as part of a Paracoccidioides vaccine construct, Salmonella FliC inhibited IL-10 production in the lungs of mice (435).

Biological processes including signaling and defense pathways, cytokine- and chemokine-mediated immunity, NF-κB signaling, granulocyte- and macrophage- mediated immunity, cell proliferation and differentiation, and apoptosis, are significantly modulated 2-8 h after FliC administration (230). Extracellular flagellin are recognized by

TLR5 (26), which communicates the detection of FliC to cell response networks; ultimately leading to the production of cytokines and chemokines. In an experiment to analyse the signaling cascade of TLR5 upon stimulation with FliC, phosphorylation of adapter proteins, such as IκBα, ERK, P38, and JNK, were completely abolished in Tlr5-/- DCs but not in Wt cells; suggesting FliC mediated signal transduction depends on TLR5 (229). The effects of flagella on the synthesis of cytokines such as IL-6 have been associated with TLR5 (26, 434). The role of TLR5 in innate immune responses has been shown in various bacterial infection models, including lung infection caused by P. aeruginosa (436). However, TLR5 signaling in response to FliC can vary depending on experimental conditions, such as specific tissue or cell location, as well as the specific pathogen of origin (26, 84, 437). In this chapter, I have provided an insight into the role of TLR5 in FliC-driven IL-10 responses in UPEC UTI. I suggest this is relevant to UPEC UTI in humans given that some individuals harbour a stop codon within the TLR5 ORF 128 that is predicted to ablate host responses to flagella (438) (438). TLR5-dependent flagellin fusion protein has been reported to mediate IL-10 secretion to prevent allergy (439). The results of this study are consistent with these observations. However, TLR5 is not the only PRR that recognizes FliC. Studies have shown TLR5 independent flagella mediated immune responses (18, 26). Homodimers of TLR5 upon activation with FliC, induce the MyD88 dependent signaling pathway through MAPK and IκB pathways, leading to the induction of AP-1 and Nf-κB respectively. Subsequently upregulate genes produce proinflammatory cytokines such as TNF-α, IL-1, IL-6, and IL-8 (16, 26, 199, 204-206). The recognition of FliC by heterodimer TLR5/TLR4 is MyD88-independent and occurs via the IRF3 pathway, which results in the production of IFN-β (207). A different pathway has been described for cytoplasmic flagellin that is detected through the mammalian cell cytosolic sensor Naip5 and Ipaf (205, 209). Notably, TLR11 also forms part of the defence response of bladder to UPEC (86). This study excluded TLR11 because of its absence from the human receptor repertoire.

I noted several other interesting components of innate immune responses beside IL-10. Previous studies have reported the induction of a range of proinflammatory cytokines (TNF-α, IL-1, IL-6, and IL-12), regulatory cytokines (IL-10, IL-22), chemokines (Ccl3, Cxcl10, Ccl20, Cxcl2, Cxcl1), and antimicrobial peptides (Reg3g, calgranulin, lipocalin- 2, hepcidin) in response to FliC; either at the mRNA level or protein level (26, 84, 206, 217, 224, 228). RNA sequencing identified many factors that were previously reported in the literature as flagella-triggered host responses. However, hundreds of novel factors were also reported using RNA sequencing. Almost 30 different cytokines, chemokines and growth factors were reported that were induced in response to FliC from diverse bacterial species (Table 13). To my understanding, there is no study that has reported a comprehensive cytokine profile from bladder cells in response to purified FliC from UPEC.

Although, FliC-mediated induction of G-CSF (csf3) was reported earlier (224), the significant upregulation of GM-CSF (csf2) in response to FliC is observed in our bladder transcriptional profile study. It is well-documented that GM-CSF is an important cytokine for the host against invading pathogens (440). However, little is known about the microbial components that induce the production of this cytokine; particularly in the context for UTI. The upregulation of GM-CSF in bladder transcription profile in response to purified FliC in this study suggest the active participation of this cytokine to combat UPEC infection. The artificial introduction of GM-CSF enhanced flagellar motility and

129 chemotactic genes in P. aeruginosa, suggesting that P. aeruginosa persister cells can possibly respond to GM-CSF host cytokine (440). The prominent role of GM-CSF in host pathogen interactions has been studied in wide range of bacteria, including Legionella pneumophilia and S. Typhimurium (441). GM-CSF can mediate inflammation regulating CCL17 production, providing insights into a pathway with potential therapeutic avenues for the treatment of inflammatory diseases (442).

Similarly, significant upregulation of matrix metalloproteinases (MMPs) are reported in this study. The MMPs constitute a family of proteases that are expressed in response to infections; as reviewed elsewhere (443). The bladder transcriptomic profile in this study has shown significant rapid upregulation of mmp7 (57 fold), mmp13 (18 fold), mmp8 (11 fold), and mmp3 (3 fold) in response to purified FliC. MMPs are well characterized in the literature, in the context of cell development, remodelling, and infections. For example, MMP7 was first discovered in the rat uterus (444). This protein is involved in the breakdown of the extracellular matrix in normal physiological processes, including both tissue remodelling and various disease processes (445). MMP7 regulates Cxcl1 influx leading to neutrophil infiltration (446). They also participate in the regulation of antimicrobial defensins (446). However, little is known about the microbial factors that induce MMP7 in infection models. Recently, it was reported that un-methylated bacterial DNA CpG motifs, and fungal β-glucans, both induced secretion of MMP7 by B-cells (447). TLR5-independent secretion of MMP7 in response to the TLR5 ligand was reported (447). Increased detection of mmp3 transcripts in Peyer's patches after infection with Salmonella and Yersinia suggest the probable involvement of MMP3 in bacterial colonization (448). Interestingly, it was reported that gastrointestinal infection with S. Typhimurium and E. coli induced MMP7 activated host α-defensins, suggesting that MMP7 could help kill bacteria (449). Bacterial infections were reported to involve an induction of other MMPs, including MMP2 (449). The production of MMP3, MMP8, and MMP9 by neutrophils is also of interest in the context of inflammation (450, 451). Unveiling the molecular mechanisms controlling MMP gene expression could elucidate a novel approach to identify new therapeutic targets.

The results of this study support the idea that IL-10 response to FliC occur concurrently with a diverse repertoire of antimicrobial products and innate immune mediators. The bladder transcriptome characterized in this chapter revealed a highly diverse range of host immune responses induced by UPEC FliC, including the predicted upregulation of IL-10 which contributes to the rapid host defence against UPEC infection.

130

6 Chapter 6 Role of FliC in protection of UPEC mediated urinary tract infection

My contributions to this chapter include:

Sections of this chapter are included in a published paper (Appendix 4).

D. Acharya, M. J. Sullivan, B. L. Duell, K. G. K. Goh, L. Katupitiya, D. Gosling, M. N. Chamoun, A. Kakkanat, D. Chattopadhyay, M. Crowley, D.

K. Crossman, M. A. Schembri, G. C. Ulett. Rapid bladder IL-10 synthesis in

response to uropathogenic Escherichia coli is part of a defence strategy that is

triggered by the major bacterial flagella filament FliC and contingent on TLR5. mSphere. 2019 Nov 27;4(6). pii: e00545-19. doi: 10.1128/mSphere.00545-19.

The contributions of author’s to this publication were:

(Signed) ______(Date)______

Dhruba Acharya

(Countersigned) ______(Date)______

Supervisor: Professor Glen C. Ulett

131

6.1 Introduction

Traditionally, flagella have been considered as a bacterial organelle that contribute to locomotion (105). Later, flagella were shown to play an important role in bacterial adhesion and colonization during infections (151, 153). Studies have strongly suggested the role of flagella in biofilm formation (64, 166, 171). Recently, flagella have emerged as a potent immune activator during microbial infection, as reviewed elsewhere (16). Flagellin (FliC), the major structural component of flagella, is now an established immune modulator, mostly studied for its contribution in producing proinflammatory mediators, such as cytokines, chemokines, costimulatory molecules, and growth factors (206, 215, 217).

The most fascinating paradigm of FliC is its potential contribution to prevent microbial infection. The intranasal administration of FliC has protected mice from pneumococcal infection (271). Systemic administration of FliC induced upregulation of antimicrobial peptide, RegIIIg, and protected antibiotic treated mice against vancomycin-resistance Enterococcus (VRE) colonization (225). The intraperitoneal administration of FliC has protected mice against intestinal infection of Y. pseudotuberculosis (224). Whereas, peritoneal administration of FliC extracted from P. aeruginosa protected mice from E. coli infection; suggesting its cross protective activity (227). Administration of FliC 2h before mice were infected with lethal dose of S. Typhimurium reduced the mortality rate by 40%, suggesting the protective role of FliC against intestinal pathogens (228). The therapeutic possibility of E.coli FliC to combat vaginal infections caused during UPEC mediated recurrent UTI was identified recently (275). However, native P. mirabilis FliC did not protect mice against an ascending UTI caused by P. mirabilis (276).

Diverse virulence factors have been described for uropathogenic E. coli (UPEC) during urinary tract infection (UTI) (4). Flagella have been considered as a compelling virulence factor of UPEC to establish UTI (9). However, little is known about the protective role of UPEC flagella against UTI. FliC induces early expression of proinflammatory genes in mice bladder (84). A whole mouse bladder transcriptomic profile against UPEC has revealed an early expression of a regulatory cytokine, IL-10 in a recent study; and suggest that early induction of IL-10 contributes to the control of UPEC UTI (13). This fascinating result enticed me to define the role of FliC from UPEC in IL-10 secretion during acute UTI. Using mammalian cell culture model, I have shown significant increase in secretion of IL-10 in response to FliC (Chapter 4). FliC challenged mice bladder transcriptomic profile has shown early upregulation of IL-10 through TLR5 (Chapter 5). I observed 132 upregulation of antimicrobial peptides including lipocalin2, calgranulin A, calgranulin B, and hepcidin (Chapter 5). Together these results suggest the potential possibilities of the application of FliC in prevention of UPEC UTI. I hypothesize that flagellin of UPEC contributes to early immune regulatory cascades via IL-10 induction.

In this chapter, I sought to identify the possible protective role of FliC during UPEC mediated UTI.

6.2 Material and Methods

6.2.1 Bacterial inoculum preparation

The UPEC reference strain, CFT073 was used. Working stocks were prepared as follows. The cells were streaked from a -80°C culture stock. Bacterial inocula were prepared from overnight cultures in LB broth (10 ml) at 37oC with shaking (200 rpm). The culture was centrifuged at 9000 × g for 6 min at 20°C and the pellet was resuspended in 10 ml of PBS. Similarly, cells were washed twice in PBS. The final pellet was resuspended in 10 ml of PBS. The cell suspension was monitored spectrophotometrically [Optical density at 600 nm (OD600)] and diluted to appropriate concentration. Initial 5-fold dilution of the cell 10 suspension yielded OD600 of ~1.0 (1 x 10 CFU/ml). The bacterial load was adjusted to ~5 x 108 CFU/ 50ul). Retrospective bacterial counts were performed for each inoculum by plating serial dilutions onto LBA plates (Table 15).

Table 15: Retrospective CFU count of bacterial inoculum used in this chapter.

Experiments Retrospective CFU counts

Experiment 1 (Prophylactic) 3.47 x 108 CFU/50 ul (per mouse)

Experiment 2 (Prophylactic) 3.27 x 108 CFU/50 ul (per mouse)

Experiment 1 (Therapeutic) 2.57 x 108 CFU/50 ul (per mouse)

Experiment 2 (Therapeutic) 3.33 x 108 CFU/50 ul (per mouse)

Experiment 3 (Therapeutic) 2.97 x 108 CFU/50 ul (per mouse)

133

6.2.2 Murine model of infection

The murine model of UTI utilizing female C57Bl/6 mice (8-10 weeks) were used (The Jackson Laboratory, USA; and Animal Resources Centre [Canning Vale, WA]). Mice were housed in groups of 5. All animal experiments were conducted in accordance with procedures authorized by the Animal Ethics Committee of Griffith University (permits: Griffith Approval MSC/01/18/AEC).

For prophylactic assays, two groups of mice (n=5 per group) were challenged with 30 µg of purified FliC in 50 μl of PBS, per mouse, or 50 μl of carrier control, extracted in an identical manner from a fliC deleted derivative of CFT073Δ4 strain (GU2642) via transurethral catheterization as described previously (344). FliC was heated for 10 min at 60°C in order to get monomers before instillation. Briefly, mice were anesthetized by inhalation of isoflurane. The peritoneal area was sterilized by swabbing with 10% povidine-iodine solution, which was subsequently removed by PBS. Mice were catheterized using sterile polyethylene catheter, and FliC in PBS was instilled at a slow infusion rate of 5 µl/s transurethrally. The catheter was removed, and mice were returned to the respective cages. After 2 h, mice were transurethrally infected with CFT073 (5 x 108 CFU/50µl). Mice were returned to the respective cages and incubated for 24 h. Two independent experiments were performed for prophylactic assays.

For therapeutic assays, two groups of mice (n=5 per group) were infected with CFT073 (5 x 108 CFU/50µl). Mice were incubated for 24 h. Next day, mice were challenged with 30 µg of purified FliC in 50 μl of PBS, per mouse, or 50 μl of carrier control, as explained above. Mice were incubated for next 24 h. Three independent experiments were performed for therapeutic assays.

6.2.3 Sample collection

Urines were collected in a small piece of parafilm and transferred to a sterile 1.5 mL Eppendorf. The collection volume was recorded. The mice were killed by overdose of isoflurane and dissected. The bladders and kidneys were collected in pre-weighted 2.0 mL Safe-Lock Microcentrifuge Tubes (Eppendorf) containing two stainless steel ball bearings (5 mm) with 180 µl protease inhibitor cocktail (cOmplete Ultra/ Mini, Roche, Castle Hill, NSW, Australia). Mice were placed in biohazard plastic bag for proper disposal.

6.2.4 Bacterial counts

Urines were diluted according to the collected volumes. Less than 5 µl urines were made 134 up to 10 µl adding PBS. For 5 µl urine, 5 µl of PBS was added and for (5-10) µl of urine, same volumes were added. Serial 10-fold dilutions were prepared in microtiter plate by adding 5 µl of urine to 45 µl of PBS, down to 10-4. Approximately, 5 µl of diluted urine were spotted onto LB agar plates in triplicate. The number of colonies were counted after 12-14 h of incubation in 37°C, and viable cells were measured as CFU per ml.

Samples containing bladders and kidneys were weighted again and recorded for final calculation. The samples were homogenized using a Tissue Lyzer II (QIAGEN, Netherlands) (2 × cycles of 26 sec at 30 Hz/30 sec). For kidney, 880 µl of PBS was added to make final volume of 1 ml. Serial 10-fold dilutions were prepared in microtiter plate by adding 10 µl of kidney homogenate to 90 µl of PBS, down to 10-1. Approximately, 5 µl of diluted homogenates were spotted onto LB agar plates in triplicate. Spread plates were performed for each sample with 100 µl homogenate. The number of colonies were counted after 12-14 h of incubation in 37°C and viable cells were measured as CFU per ml. The final counts were adjusted to ‘per 1 g of kidney’.

The bladder homogenates were centrifuged at 10,000 × g, 10 min, 4°C. Approximately, 60 µl supernatants in duplicates were transferred to flat-bottom, uncoated, 96-well plates, and stored at -80°C immediately for cytokine measurements. The remaining pellets were resuspended in 940 µl of PBS to make final volume of 1 ml. Serial 10-fold dilutions were prepared in microtiter plate by adding 10 µl of bladder homogenate to 90 µl of PBS, down to 10-3. Approximately, 5 µl of diluted homogenates were spotted onto LB agar plates in triplicate. The number of colonies were counted after 12-14 h of incubation in 37°C, and viable cells were measured as CFU per ml. The final counts were adjusted to ‘per 1 g of bladder’.

6.2.5 Statistics

Numbers of CFU in urine and tissue homogenates were reported as mean ± SEM and were compared using Mann-Whitney tests. The statistical analyses were performed using Graph Pad Prism v8.0. Statistical significance was accepted at p ≤ 0.05.

135

6.3 Results

6.3.1 Prophylactic ability of FliC to protect mice against CFT073 challenge

The capacity of flagellin to control CFT073 mediated UTI in murine model was assessed by comparing bacterial loads in bladder, kidney and urine in mice challenged with FliC to carrier control. To assess the prophylactic value of FliC administration, C57Bl/6 mice were challenged with either FliC or carrier control, and 2 h later, mice were infected with CFT073 transurethrally. After 24 h, the mice were sacrificed, and bacterial loads were measured in bladder, kidney and urine. FliC induced significant reduction of bacterial loads in the bladder (Figure 34A). Approximately, more than 80% reduction in bacterial loads were observed in bladder homogenates. However, no significant changes were noted in kidney (p= 0.9444) and urine (p= 0.8461) (Figure 34B and Figure 34C).

Figure 34: Prophylactic protection against CFT073 infection using FliC. Female C57Bl/6 mice were treated transurethrally with 25 µg FliC (diluted in 50 µl PBS) or same volume of carrier control. The mice were infected 2 h later with transurethral inoculation of 5 x 108 CFU CFT073 suspended in 50 µl PBS. Bacterial loads in mice (n=10 per group) were enumerated after 24 h of infection in bladder (A), kidney (B) and urine (C). CFU counts for individual mice are shown. Data were expressed as the mean ± IQR. Combined results from two independent experiments are shown. Data from FliC treated, and carrier control treated mice were compared in a Mann-Whitney test (p=˂0.05). 136

6.3.2 Therapeutic ability of FliC to protect mice against CFT073 challenge

To assess the therapeutic value of FliC administration, C57Bl/6 mice were infected with CFT073 transurethrally. After 24 h, mice were challenged with FliC or carrier control. After 24 h, mice were sacrificed, and bacterial loads were measured in bladder, kidney and urine. FliC induced significant reduction of bacterial loads in the bladder (Figure 35A). Approximately, 80 to 90% reduction in bacterial loads were observed in bladder homogenates. However, no significant changes were noted in kidney (p= 0.0764) and urine (p= 0.1030) (Figure 35B and Figure 35C).

Figure 35: Therapeutic protection against CFT073 infection using FliC. Female C57Bl/6 mice were infected transurethrally with 5 x 108 CFU CFT073 suspended in 50 µl PBS. After 24 h, mice were challenged with 25 µg FliC (diluted in 50 µl PBS) or same volume of carrier control transurethrally. Bacterial loads in mice (n=10) were enumerated after 24 h of infection in bladder (A), kidney (B) and urine (C). CFU counts for individual mice are shown. Data were expressed as the mean ± IQR. Combined results from three independent experiments are shown. Data from FliC treated, and carrier control treated mice were compared in a Mann-Whitney test (p=˂0.05).

137

6.4 Discussion

To explore the potential for the FliC-triggered innate immune response in mice urinary bladder to be used for infection control or disease prevention strategies, this study examined UPEC CFT073 colonization of bladder in mice that received 30 g FliC either 2 h prior to, or 24 h after infectious challenge. This study has shown that FliC can protect the severity of infection in bladder during acute UTI, both prophylactically and therapeutically.

Enumeration of bacterial load in bladder is a frequent approach to examine infection outcome (344, 452). This approach has been applied to examine the protective ability of FliC in various infection models. For example, in a respiratory infection model, coadministration of flagellin with S. pneumoniae challenge resulted in significant bacterial clearance in the lungs within the first 24 h after challenge compared with those for animals that received only S. pneumoniae. Flagellin challenged 12 h to 24 h before pneumococcal challenge and flagellin challenged 24 h after pneumococcal challenge showed significant reductions of bacterial loads in various organs, including kidneys and spleen; suggesting prophylactic as well as therapeutic effects of flagellin in pneumococcal pneumonia (271). Similarly, in an intestinal infection model, preexposing mice to flagellin protected oral infection of Y. tuberculosis. The systemic administration of flagellin significantly increased the survival rate after intestinal infection which was associated with low bacterial count in the gut and the spleen (224).

The reduction of bacterial load in bladder after challenging with FliC either 2 h prior to, or 24 h after infection in this study suggested that FliC has both prophylactic as well as therapeutic effect in controlling infection severity. However, no any difference in bacterial counts of kidney and urine was noted among FliC challenged mice compared to mice challenged with carrier control. The degree of variance among bladder, kidney, and the urine probably reflect biological variances in host and the virulence properties of UPEC. UPEC has distinct pathogenic strategies in different organ sites. For example, UPEC can form IBC in the bladder umbrella cells, not in kidney (453). Similarly, P pili from UPEC binds to kidney cells, but not in bladder cells (454). So, these biological factors could be the possible reasons of more variation in bladder compared to kidney and urine in this study. In order to minimise the variation in this model of infection, the sample size (mice number per group) can be increased in future experiments (455, 456). Use of collodion to coat the urethras of mice for a few hours after instillation of the bacterial inoculum could enhance the reliability of this correlation (84). However, there are other 138 considerations, such as ethical and model parallels human infection (does not occur in human), that were used as a basis to avoid this approach in the current work.

Few other approaches are described to define the protective ability of FliC in various infection models. For example, intratracheal instillation of recombinant FliC from S. Enteritidis stimulated an innate immune response in the lungs of several strains of mice characterised by the infiltration of neutrophil and rapid production of pro-inflammatory cytokines (222). The prophylactic role of FliC was demonstrated in Salmonella infection recently (273). Compared to controls, mice pre-treated with FliC displayed delayed body weight loss and mortality upon oral and intraperitoneal infection with S. Typhimurium; conferring protection against enteric and systemic infections (273). The administration of purified Salmonella-derived flagellin, a TLR5 agonist, protects mice from C. difficile colitis by delaying C. difficile growth and toxin production in the colon and cecum (274). Although preliminary, this study has shown that purified FliC inoculation into the bladder can lower the bacterial burden of UPEC upon infection.

FliC has been a potential candidate in vaccine development for several decades and recently studied exclusively for its adjuvant capacity, as reviewed elsewhere (457). FliC, as an adjuvant of influenza vaccines, has been tested in human clinical trials (288) (288). There are strong evidences suggesting the possibility of using FliC as an immunotherapeutic agent. For example, in an intranasal immunization mouse model, the coadministration of the FliC with tetanus toxoid (TT) induced significantly enhanced TT- specific immunoglobulin A (IgA) responses in both mucosal and systemic compartments, and the IgG responses in the systemic compartment; suggesting the role of flagellin as an adjuvant leading to protection against systemic challenge with tetanus toxin (281). The preliminary evidences reported in this study provide belief that FliC might be a useful component to be explored for the development of new UTI treatment approaches. FliC can be effective at very low doses and it has no detectable toxicity compared to other potential adjuvant bacterial components, such as LPS (458). The nature of flagellin, to be able to shape both the innate and adaptive arms of immunity as an immunomodulatory agent, has also led to interest in its use as an anti-tumor treatment (16).

Considering the large number of genes and cytokines altered from FliC inoculation (previous chapters), IL-10 and other immune components may be responsible for the observed protection from FliC. An excessive recruitment of neutrophils and cytokines related to neutrophil infiltration is a major mechanism of innate immune response to FliC leading to an early protection against microbial infection (224, 271). Flagellin induced 139 protection is independent of B and T lymphocytes (271). However, there is a strong correlation of FliC with adaptive immunity suggesting FliC as a potential vaccine candidate (269, 278). DCs are instrumental for adaptive immune responses (279). It was shown that flagellin drives MyD88-dependent Th2-type immunity in mice leading to the secretion of IL-4 and IL-13 by DCs, as well as IgG1 responses (198). In the same study, the upregulation of Th2 cytokines, IL-4 and IL-13, and lack of Th1-polarizing cytokine IL-12p70 production by flagellin-stimulated DCs, inferred that flagellin-dependent Th2 commitment could also depend on Th1-suppressive mechanisms, including secretion of both, IL-10 and TGF-β (280). The protective role of flagellin via induction of IL-22 has been shown in few studies. IL-22, a cytokine from the IL-10 family, leads to the induction of antimicrobial molecules including C-type lectin, RegIIIγ, and calgranulin S100A9, via activation of signal transducer and activator of transcription factor 3 (STAT-3) pathway (225, 226). Th17 lymphocytes produce the IL-17 and IL-22 cytokines that stimulate mucosal antimicrobial defences and tissue repair (282-285). Systemic administration of flagellin triggered immediate excessive production of IL-22 and Th-17 related cytokines such as IL-17A and IL-17F through TLR5 signaling cascade (230). The rapid upregulation of TLR5 dependent il10 in this study suggest the possible involvement of this axis in observed FliC protection. However, a mouse experiment should be conducted in double TLR5-/- and IL-10-/- mice to determine if this axis is responsible for the observed effect of FliC on bacterial loads in vivo.

This study has explored the potential of FliC-driven innate immune responses in bladder as a mechanism for infection control of UPEC. Although, the evidences seen in this study were not in the context of vaccine-driven adaptive immunity, this study simply defined proof-of-principle suggesting the potential candidate in future.

140

7 Chapter 7: General Discussion

Despite substantial characterization of UPEC colonization, adhesion, biofilm formation, and secretion during UTI, continued studies of the host immune system in the urinary tract are needed to better understand the pathogenesis of UTI. While most UTIs are self- limiting (54), and easily available antibiotics can be effective in the treatment of UTI (1, 78), the emergence of MDR strains, many of which contribute to recurrence of infections suggest the need to develop novel and alternative strategies to treat or manage UTI (54). This may include therapies targeting the immune system, for example. Defining the mechanism of how host innate immune responses occur as a result of UPEC infection can ultimately aid the development of new treatment approaches to UTI. Defining these mechanisms in the context of flagella was the overarching aim of this study. Importantly, defining specific UPEC components that trigger key innate host responses might identify new targets to manipulate infection pathogenesis. Thus, there is continued interest in improving our understanding of the nature of the immune responses in the urinary tract, and determining whether some of these responses could be targeted to combat UTIs. In this thesis, flagella of UPEC were studied as a specific virulence component to assess innate immune responses, including the regulatory cytokine IL-10 in bladder infection. The principal finding of this thesis is that detection of the major flagella filament of UPEC, FliC, within the bladder causes a very rapid local response resulting in IL-10 synthesis; further that this response induced by FliC is TLR5-dependent. High resolution mapping of the FliC-responsive bladder transcriptome by RNA sequencing provides new and comprehensive detail of how the bladder responds to UPEC FliC. Further general discussion of this work and how this aligns with the broader literature is described below.

It was important to choose appropriate in vitro and in vivo models in this work to mimic human UTI as closely as possible and thus, enable robust study of FliC and flagella in the context of the host immune system. The complexity of human bladder urothelium is based on a mixture of smaller, relatively undifferentiated basal and intermediate epithelial cells, and larger superficial facet cells along with many immune cells that change in population dynamics during the course of UTI. This always a challenge for researchers to pick an appropriate experimental model(s) that provides some parallels to human infection (456, 459). A substantial population of macrophages resides in the submucosa of urinary bladder and more cells are recruited to the site following infection (460). In this work, I used human and mouse macrophages for in vitro assays to investigate the ability of UPEC flagella and FliC to induce IL-10 production in an important type of defence cell known

141 to reside in the tissue. A co-culture model incorporating lymphocytes, monocytes, and uroepithelial cells demonstrated synergistic IL-10 production effects following infection with UPEC (40). Mixed-cell two-dimensional cell culture models can provide important insight into understanding infectious disease mechanisms and this previous study from our group has provided an important foundation for the use of monocytes and macrophages in this work (461). It is of note that a three-dimensional model, comprising biological, chemical, and biomechanical characteristics of microenvironments, that mimics host-pathogen interactions, has been proposed (462).

Small animal models are an invaluable study tool to understand human infections (463- 465). Mice have several advantages over other small animal models, such as cost effectiveness, ease of manipulation, and availability of reagents (466). Furthermore, mice provide a suitable and tractable model for cystitis and pyelonephritis caused by UPEC (84, 467). As related to the urinary tract, the mouse offers a suitable model system for mammalian UTI because the bladder structure and cellular composition in mice mimic those found in the human bladder. Using well-established models of experimental UTIs in which the bladders of female mice are challenged via transurethral catheterization, the molecular details of the pathogenesis of UPEC have been substantially characterized in the last decade, as reviewed elsewhere (468). For example, IBC formation of UPEC reported in murine models of infection have also been reported in the urine sediments from UTI patients (453, 469). Similarly, early induction of IL-10 in response to UPEC infection has been reported in mice and humans (13). Thus, the murine UTI model is a useful tool for advancing our understanding of UPEC pathogenesis in humans and was used as a relevant in vivo model in the current work.

There are two frequently used approaches for studying the role of a microbial component in the pathogenesis of human infectious disease. One approach is to use a wild-type strain of a pathogen and compare the host responses to a wild-type strain and its isogenic mutant that lacks the particular and singular component of interest. A second approach is to separate or purify the component of interest and analyse that the host responses to the purified component, in the absence of other microbial factors. The experimental introduction of genetic mutation(s) into a gene that encodes a component of interest, using molecular techniques, is a useful way of advancing our understanding of the host response to a particular microbial component. In order to address the first hypothesis of this study that UPEC flagella induce immune responses, including IL-10, in bladder infection, I used UPEC strains enriched for flagella expression to study IL-10 responses in human

142 monocytes; in these experiments, cultured human cells were exposed to soft-agar-grown UPEC harbouring flhDC to drive hyper-flagellated phenotypes, or UPEC deficient in fliC. I demonstrated significant increases in IL-10 levels induced by the hyperflagellated CFT073∆4 strain (CFT073∆4/pflhDC), compared to Wt (CFT073∆4) and a fliC-deficient derivative (CFT073∆fliC) (Chapter 4). Differences in environmental, growth and stress conditions, or ‘cross-talk’ mechanisms might affect flagella expression differently in distinct E. coli strains (470) and lead to distinct host immune responses. Therefore, an analysis of different UPEC strains in addition to CFT073∆4, as well as a combination of various in vitro challenge conditions are recommended in future experiments.

The mechanisms of flagella induced immune responses during active infection is not fully characterized. Since only monomers, not the filamentous forms of flagella are recognized by TLR5, according to a now well-established paradigm (26, 27), how intact flagella at the cell surface might influence IL-10 production is unclear. To my knowledge, no strong evidence has been described to explain how flagella in natural infection are converted to a monomeric form that is recognized by TLR5 to provoke subsequent host immune responses. However, possible mechanisms have been proposed in previous studies. For example, secretion of FliC monomers into culture media were reported in S. Typhimurium (237). Similarly, lysophospholipid in the host cells sensed by Salmonella triggered the secretion of FliC monomers de-novo (239). Furthermore, a recent study has proposed self-depolymerisation of flagella filaments to monomers and sensing by TLR5 during S. Typhimurium flagellar biogenesis (345). Another study suggests that FliC that fails to polymerize onto the growing tip of a flagellum would be released from the bacterium as a monomer (345). These studies provide collective evidences suggestive of different possible mechanism of flagella recognition during natural infection. This thesis does not make a case that FliC monomers are released from UPEC during the course of infection and this was not a primary goal of this work. However, a further experiment is recommended to explore possible self-depolymerization of flagella into FliC monomers and subsequent recognition by TLR5 during UPEC UTI (Chapter 4, Section 4.4).

A theme of this work is FliC can be extracted from UPEC and purified to homogeneity in order to carefully analyse host responses in the absence of other bacterial components. This theme built the second hypothesis that UPEC FliC alone can induce production of IL-10 in an in vitro model of bladder. Human monocytes (U937) and mouse macrophages (J774.A1) were shown to produce IL-10 in response to FliC (Chapter 3, Chapter 4). In aligning the findings of this study with prior studies on bacterial pathogens, several links

143 between IL-10 induction, cellular source, and flagella are of note. For example, flagella components of Salmonella and Yersinia have been shown to modify IL-10 production. Salmonella flagella trigger IL-10 secretion in splenocytes (37), monocytes (206), and serum (217). Flagella of Yersinia have been shown to induce IL-10 in macrophages (36). A recent study has reported key gender specific differences in IL-10 responses during viral infection (471). In this sense, the source of cell line (male or female) should be considered in future in vitro experiments, noting that UTIs occur mostly in females. The inclusion of other cell types with immunological relevance may give new insights into other relevant cellular responses to UTI. For example, a recent study, using a murine model, has reported the production of IL-10 from mast cells (29). Similarly, in order to more accurately model the complex environment of the bladder, more complex mixed cell cultures and 3-D models are recommended for further experiments (462).

In the broader literature, FliC has been extracted from diverse bacteria and characterized in the context of infection pathogenesis and immune responses, as shown in Table 2 (Section 2.7). This broad perspective highlights the potential value of FliC as a vaccine adjuvant and for immunotherapy; justifying the strong interest in this protein, as described elsewhere (16). This thesis has established new methodology comprising the construction of various UPEC mutants to enable the extraction and purification of FliC to homogeneity that will allow the potential value of FliC in the contexts of these areas of research to be further explored. The pyelonephritic strain of UPEC, CFT073 was chosen for this study because it is well-characterized and used by many research groups world-wide. Extensive protein analysis work in this thesis (Chapter 3) showed that use of UPEC CFT0734 for FliC extraction enabled purification of FliC to homogeneity. I was able to remove other bacterial cell surface contaminants, such as fimbriae and pili using this multiple gene- deficient strain. Subsequently, fimbrilin and outer membrane proteins were removed from the FliC preparations using size exclusion chromatography. LPS was also removed from the protein preparation using a very efficient column binding approach. I have measured the amount of endotoxin in FliC preparation (using LAL assay) at pre- and post- endotoxin removal stages to quantitatively assess the effectiveness of the method.

This study has shown that the endotoxin removal step has a major impact on macrophage recognition of FliC, and subsequent cytokine responses. My interpretation is that, in any approaches focussed on purification of FliC for host-pathogen interaction studies, endotoxin removal is essential to enable identification of immune responses to FliC. The current endotoxin measurement assays are often limited to LAL, an extract of blood cells

144 from a horseshoe crab that react with endotoxin. A major drawback of LAL test is overcoming assay inhibition (334). The HEK-Blue LPS Detection Kit containing human HEK cells could be a worthy approach to detect endotoxin, which is based on the ability of TLR4 to recognize structurally different LPS from gram-negative bacteria and in particular a toxic moiety, lipid A (335). However, the sensitivity of both assays, LAL and HEK-Blue are similar (0.01 EU/ml). The new method of flagella extraction established in this study enables excellent yield in terms of purity and quantity, is relatively rapid (1 day), and provides new opportunity to define the biology of flagella in an immunological context. The FliC purification method, developed in this thesis (297), could be applied to study FliC from other gram-negative bacteria, such as S. Typhi, Yersinia Spp., P. aeruginosa, and P. mirabilis.

The use of a carrier control in immune assays in this study was used to enable interpretation of responses to pure FliC (154). The use of the fliC-deficient CFT0734 strain (CFT0734fliC) in this work enabled the preparation of the most suitable carrier control for use in experimental models. This approach is arguably more superior to previous literature that typically reports the use of either media alone (26), PBS (26, 228, 273), or saline (271). The idea of using a multiple-gene deleted strain to remove contaminants during protein extraction (297) suggests this could be a useful approach to isolate a protein of interest from other bacterial strains for host-pathogen interaction studies.

One of the important characteristics of a protein for use in immunological studies is its stability, which should be taken into account when studying its biological function (472). In this work, a high degree of care was taken to maintain the integrity of FliC, such as (i) avoiding excessive use of chemicals, and (ii) avoiding high temperatures. Excessive use of chemicals and high temperatures can disrupt the structure of a protein (473, 474), which could bias results of immunological assays. Although heating FliC at 70oC for 15 min has been frequently applied as a protocol for monomerization, this study has identified 60oC as a lower and therefore more optimal temperature for monomerization (27, 233, 297, 326). As in the current work, monomer disassociation of filamentous flagellum can be studied using native gel where FliC monomers and filamentous flagella can be easily distinguished (326). However, the tendency for dissociation varies among FliC from different bacteria (326). Hence, this study applied the native gel technique to identify the optimal (lowest) temperature for FliC monomerization. This study does not prove that heating FliC at 60oC maintains the structural integrity of the protein. Protein

145 structure determination would be required for that. In aligning the previous works, I opted to assess FliC by Coomassie staining and western blot (27, 233, 434). This is a limitation of this study that more detailed structural measures were not applied to confirm the integrity of FliC. In terms of the purification approach developed for FliC in this study, further work is recommended to characterize the structure of FliC using various techniques, such as tryptophan fluorescence assay to assess the folding status of protein in solution, Circular Dichroism (CD) to determine the secondary structure of protein, Surface Plasmon Resonance (SPR) to study protein-protein interactions, and X-ray crystallography to determine protein structures (113, 114, 313, 475-477).

To investigate the third hypothesis of this study, which is in vivo relevance of observed FliC effects on host IL-10 induction, I used murine model of infection (Chapter 4). Only few studies have reported the FliC-mediated IL-10 production in vivo. For example, systemic instillation of FliC from S. Typhimurium and P. aeruginosa have shown the induction of IL-10 in serum (217, 227). Similarly, intranasal challenge of FliC caused significant increase of IL-10 in lung tissue (229). To my understanding, this is the first study to define the role of FliC from UPEC in induction of IL-10 in mice bladder infection. This thesis aimed to define the biological property of pure FliC from UPEC CFT073, of the ability to evoke production of IL-10 and other wider cytokine responses in the host. Several cytokines, including TNF-, IL-1, IL-6, KC and IL-12 were shown to be produced by human and animal cells in response to purified FliC. These findings are consistent with previous literature (26, 206, 217, 218, 226). It is of note that the immune responses to FliC reported in this thesis were examined at 5 h post-challenge in in vitro assays and only 2 h post-challenge in in vivo assays. As a reflection of different time points post-treatment and other differences in experimental models (such as cell types, UPEC strains, and methods of measurement), it is difficult to compare the cytokine profiles observed in this study with the host responses reported in previous literature. However, I make a note that the aim of this study was to explore early immune responses, and this study has sufficiently described the biological property of pure FliC from UPEC in immediate bladder infection, which makes a substantial new contribution to the field.

Interestingly, the data from this study support the notion that flagellin-mediated stimulation of cytokine synthesis (including IL-10) can occur in the absence of fully assembled flagellar filament (27).

In order to address the fourth hypothesis, this study established transcriptional mapping of the bladder response to FliC to define the multifaceted innate immune response that is

146 engaged in the bladder alongside IL-10 immediately upon detection of FliC (Chapter 5). The transcriptomic profile of the mice bladder in response to FliC reflects the in vivo and in vitro responses of innate immune elements, including IL-10. In analysing Wt and TLR5 knock-out mice, it was shown that IL-10 induction in the bladder as part of early defence against UPEC UTI requires functional TLR5. This study recognized, however, that some of the bladder responses observed in this study were TLR5-independent; as defined using comparisons of TLR5-deficient and WT mice, a large number of genes not previously associated with TLR-5 independent responses are defined by this study. This is an exciting and intriguing dataset, and further studies are needed to characterize the signaling mechanisms underlying UPEC FliC-mediated TLR5-dependent and TLR5-independent host immune responses as identified by this study. At this point, I strongly make a note that FliC triggered early induction of IL-10 in either in vitro or in vivo model, or at transcriptomic and protein level during acute UTI model. More importantly, the use of a fliC mutant and FliC carrier control in these assays reflected a crucial control to conclude that the proinflammatory responses induced by FliC are not an artefact secondary to LPS contamination (217).

The early induction of IL-10 and various antimicrobial peptides, including calgranulin, lipocalin 2, and hepcidin identified in a comprehensive transcriptomic profile of mouse bladder in response to FliC guided us to investigate the fifth hypothesis of this thesis, that is FliC can be used to protect the host against infection in the bladder based on prophylactic or therapeutic treatment approaches (Chapter 6). Mice that received prophylactic or therapeutic FliC had significantly lower UPEC counts in the bladder compared to control mice that received carrier alone. The enumeration of bacterial load in bladder as a measure of infection severity is a routinely-applied approach to examine infection outcome (344, 452). However, it provides a limited view of the infection, because it does not provide information on local pathology (inflammatory and tissue damage) and bacteria may reside in the bladder lumen, in IBC, or as small collections in intracellular vesicles during different stages of infection (478, 479). Use of visual examinations, such as SEM, immunofluorescence microscopy, and confocal microscopy to expand the data provided by microbiological culture methods can enhance extra understanding of bacterial localization (77, 478, 480). The metabolic activities in urine enable bacterial growth in the liquid phase, whereas similar bacterial growth cannot be seen in kidney. In the urinary tract, the frequently of urination (micturition) of individual mice may eventually lead to the variable bacterial growth in bladder, so in excreted urine.

147

The measurement of osmolarity and specific gravity to normalise the urine samples could better correlate the bacterial load in urine to bladder colonization (481). Beside enumeration of bacterial load in bladder, other approaches can be performed to better understand the pathology of bladder after exposure to FliC. For example, assessment of cellular infiltration using flow cytometer (222, 271), assessment of body weight (273), and detection of biomarkers (274), could explain the overall organ pathology, cell trafficking, and inflammation in response to FliC.

7.1.1 Future direction and conclusion

The completion of the work in this thesis highlights several areas that could be targeted for future research. Investigation of differences between UPEC strains in terms of IL-10 upregulation is one such area. IL-10 induction was reported after infection with CFT073, derived from a pyelonephritis infection (13). In contrast, IL-10 was not detected during a 2-week time course of infection with the cystitis isolate UTI89 (91). Virulence factors may explain the difference in cytokine expression observed among these studies as UPEC isolates from pyelonephritis express a different set of virulence genes as compared with cystitis strains (482). Similarly, different flagella H types (H1, H4, H7) induced IL-10 secretion in cell lines in vitro, although H4 flagella was identified as the most potent flagellin type able to induce this cytokine (38). All the above-mentioned studies suggest that FliC variance evoke distinct immune responses in host, and at least the evidences reported in those studies indicate differences in IL-10 production. The data generated in this thesis related to FliC from CFT073 (H1) dealing with the multitude of cytokine responses gives several avenues of future investigation. Hence, I recommend undertaking further study to characterize FliC from other UPEC strains such as UTI89 (H7) and EC958 (H4) in the context of IL-10 induction. This study has established host bladder immune responses to FliC at 2 h post challenge. Expanding the study to explore post FliC challenges at longer time (24 h and 48 h) will bring more comprehensive picture of broader host immune responses including innate and adaptive immunity. Exploration of adaptive immune responses to three different FliC types (H1, H4, H7) from three common UPEC strains (CFT073, EC958, UTI89) could shed light on cross protectivity as well.

This study has explored the potential of FliC-driven innate immune responses of the bladder as a mechanism for infection control of UPEC, not in the context of vaccine- driven adaptive immunity but simply to ascertain proof-of-principle that UPEC FliC might be useful for UTI prevention or control. It is of note that FliC from UPEC are being studied as a part of polyvalent vaccine unit in rats (483). Similarly, the nature of FliC to 148 shape both innate and adaptive arms of immunity has led to its use as an immunomodulatory anti-tumor agent (16). Although, the FliC or the immune response to it, might be incorporated into novel approaches either to treat or prevent UTI remains unclear; this study indicates for sure that FliC can be used to increase the hosts ability to control UPEC bladder infection. A future study is warranted to investigate the use of UPEC FliC as an adjuvant to promote the efficacy of experimental UPEC vaccines, as has been reported in some studies of other pathogens (270), or alternatively, as a immunomodulatory agent; such as approach was shown to activate TLR5 and induce the production of host-defence peptide, BD2 that may boost control of recurrent UPEC UTI (447). Future work could undertake larger trials for therapy and disease prevention based on FliC.

In conclusion, this study has developed a protein purification method which established a new approach to examine the protein in the context of host-pathogen interaction model systems. Future studies of UPEC FliC purified to homogeneity using the methods described herein will provide new insight into the biology of this bacterial virulence factor, and will be especially useful to give a more complete understanding of the immunological implications of exposure to UPEC flagella in the context of infection and disease. This study has identified novel roles for FliC in immune responses to UTI, and indicates that IL-10, as well as several pro-inflammatory cytokines and chemokines are induced in the immediate host response to FliC in a mechanism that depends on TLR5. Further studies into the pleiotropic effects of discrete flagella components, beyond FliC, in the bladder response to UPEC will offer more insight to the broad range of effects that this virulence factor exerts during UTI.

149

8 References

1. Foxman B. Epidemiology of urinary tract infections: incidence, morbidity, and economic costs. Am J Med. 2002;113 Suppl 1A:5S-13S.

2. Bacheller CD, Bernstein JM. Urinary tract infections. Med Clin North Am. 1997;81(3):719-30.

3. Foxman B. Urinary tract infection syndromes: occurrence, recurrence, bacteriology, risk factors, and disease burden. Infect Dis Clin North Am. 2014;28(1):1- 13.

4. Ulett GC, Totsika M, Schaale K, Carey AJ, Sweet MJ, Schembri MA. Uropathogenic Escherichia coli virulence and innate immune responses during urinary tract infection. Curr Opin Microbiol. 2013;16(1):100-7.

5. O'Hanley P, Lalonde G, Ji G. Alpha-hemolysin contributes to the pathogenicity of piliated digalactoside-binding Escherichia coli in the kidney: efficacy of an alpha- hemolysin vaccine in preventing renal injury in the BALB/c mouse model of pyelonephritis. Infect Immun. 1991;59(3):1153-61.

6. Russo TA, McFadden CD, Carlino-MacDonald UB, Beanan JM, Barnard TJ, Johnson JR. IroN functions as a siderophore receptor and is a urovirulence factor in an extraintestinal pathogenic isolate of Escherichia coli. Infect Immun. 2002;70(12):7156- 60.

7. Ipe DS, Ben Zakour NL, Sullivan MJ, Beatson SA, Ulett KB, Benjamin WHJ, et al. Discovery and characterization of human-urine utilization by asymptomatic- bacteriuria-causing Streptococcus agalactiae. Infect Immun. 2015;84(1):307-19.

8. Kaper JB, Nataro JP, Mobley HL. Pathogenic Escherichia coli. Nat Rev Microbiol. 2004;2(2):123-40.

9. Lane MC, Lockatell V, Monterosso G, Lamphier D, Weinert J, Hebel JR, et al. Role of motility in the colonization of uropathogenic Escherichia coli in the urinary tract. Infect Immun. 2005;73(11):7644-56.

10. Wu J, Miao Y, Abraham SN. The multiple antibacterial activities of the bladder epithelium. Ann Transl Med. 2017;5(2):35.

11. Sivick KE, Schaller MA, Smith SN, Mobley HL. The innate immune response to uropathogenic Escherichia coli involves IL-17A in a murine model of urinary tract infection. J Immunol. 2010;184(4):2065-75. 150

12. Billips BK, Schaeffer AJ, Klumpp DJ. Molecular basis of uropathogenic Escherichia coli evasion of the innate immune response in the bladder. Infect Immun. 2008;76(9):3891-900.

13. Duell BL, Carey AJ, Tan CK, Cui X, Webb RI, Totsika M, et al. Innate transcriptional networks activated in bladder in response to uropathogenic Escherichia coli drive diverse biological pathways and rapid synthesis of IL-10 for defense against bacterial urinary tract infection. J Immunol. 2012;188(2):781-92.

14. Pichon C, Hechard C, du Merle L, Chaudray C, Bonne I, Guadagnini S, et al. Uropathogenic Escherichia coli AL511 requires flagellum to enter renal collecting duct cells. Cell Microbiol. 2009;11(4):616-28.

15. Wright KJ, Seed PC, Hultgren SJ. Uropathogenic Escherichia coli flagella aid in efficient urinary tract colonization. Infect Immun. 2005;73(11):7657-68.

16. Hajam IA, Dar PA, Shahnawaz I, Jaume JC, Lee JH. Bacterial flagellin-a potent immunomodulatory agent. Exp Mol Med. 2017;49(9):e373.

17. Zhou M, Yang Y, Chen P, Hu H, Hardwidge PR, Zhu G. More than a locomotive organelle: flagella in Escherichia coli. Appl Microbiol Biotechnol. 2015;99(21):8883-90.

18. Ramos HC, Rumbo M, Sirard JC. Bacterial flagellins: mediators of pathogenicity and host immune responses in mucosa. Trends Microbiol. 2004;12(11):509-17.

19. Miao EA, Andersen-Nissen E, Warren SE, Aderem A. TLR5 and Ipaf: dual sensors of bacterial flagellin in the innate immune system. Seminars in Immunopathology. 2007;29(3):275-88.

20. Gewirtz AT. Flag in the crossroads: flagellin modulates innate and adaptive immunity. Curr Opin Gastroenterol. 2006;22(1):8-12.

21. Hatai H, Lepelley A, Zeng W, Hayden MS, Ghosh S. Toll-like receptor 11 (TLR11) interacts with flagellin and profilin through disparate mechanisms. PLoS ONE. 2016;11(2):e0148987.

22. Shi Z, Cai Z, Yu J, Zhang T, Zhao S, Smeds E, et al. Toll-like receptor 11 (TLR11) prevents Salmonella penetration into the murine Peyer patches. J Biol Chem. 2012;287(52):43417-23.

23. Snyder JA, Haugen BJ, Buckles EL, Lockatell CV, Johnson DE, Donnenberg MS, et al. Transcriptome of uropathogenic Escherichia coli during urinary tract infection. Infect Immun. 2004;72(11):6373-81. 151

24. Mulvey MA, Schilling JD, Martinez JJ, Hultgren SJ. Bad bugs and beleaguered bladders: interplay between uropathogenic Escherichia coli and innate host defenses. Proc Natl Acad Sci U S A. 2000;97(16):8829-35.

25. Martinez JJ, Mulvey MA, Schilling JD, Pinkner JS, Hultgren SJ. Type 1 pilus- mediated bacterial invasion of bladder epithelial cells. EMBO J. 2000;19(12):2803-12.

26. Hayashi F, Smith KD, Ozinsky A, Hawn TR, Yi EC, Goodlett DR, et al. The innate immune response to bacterial flagellin is mediated by Toll-like receptor 5. Nature. 2001;410(6832):1099-103.

27. Smith KD, Andersen-Nissen E, Hayashi F, Strobe K, Bergman MA, Barrett SL, et al. Toll-like receptor 5 recognizes a conserved site on flagellin required for protofilament formation and bacterial motility. Nat Immunol. 2003;4(12):1247-53.

28. Means TK, Hayashi F, Smith KD, Aderem A, Luster AD. The Toll-like receptor 5 stimulus bacterial flagellin induces maturation and chemokine production in human dendritic cells. J Immunol. 2003;170(10):5165-75.

29. Chan CY, St John AL, Abraham SN. Mast cell interleukin-10 drives localized tolerance in chronic bladder infection. Immunity. 2013;38(2):349-59.

30. Couper KN, Blount DG, Riley EM. IL-10: the master regulator of immunity to infection. J Immunol. 2008;180(9):5771-7.

31. Price JD, Schaumburg J, Sandin C, Atkinson JP, Lindahl G, Kemper C. Induction of a regulatory phenotype in human CD4+ T cells by streptococcal M protein. J Immunol. 2005;175(2):677-84.

32. Madureira P, Andrade EB, Gama B, Oliveira L, Moreira S, Ribeiro A, et al. Inhibition of IL-10 production by maternal antibodies against Group B Streptococcus GAPDH confers immunity to offspring by favoring neutrophil recruitment. PLoS Pathog. 2011;7(11):e1002363.

33. Ota MO, Oluwalana C, Howie SR, Gomez M, Ogunniyi AD, Mendy-Gomez AL, et al. Antibody and T-cell responses during acute and convalescent stages of invasive pneumococcal disease. Int J Infect Dis. 2011;15(4):e282-8.

34. Frodermann V, Chau TA, Sayedyahossein S, Toth JM, Heinrichs DE, Madrenas J. A modulatory interleukin-10 response to staphylococcal peptidoglycan prevents Th1/Th17 adaptive immunity to Staphylococcus aureus. J Infect Dis. 2011;204(2):253- 62. 152

35. Chau TA, McCully ML, Brintnell W, An G, Kasper KJ, Vines ED, et al. Toll-like receptor 2 ligands on the staphylococcal cell wall downregulate superantigen-induced T cell activation and prevent toxic shock syndrome. Nat Med. 2009;15(6):641-8.

36. McNally A, La Ragione RM, Best A, Manning G, Newell DG. An aflagellate mutant Yersinia enterocolitica biotype 1A strain displays altered invasion of epithelial cells, persistence in macrophages, and cytokine secretion profiles in vitro. Microbiology. 2007;153(Pt 5):1339-49.

37. Sbrogio-Almeida ME, Mosca T, Massis LM, Abrahamsohn IA, Ferreira LC. Host and bacterial factors affecting induction of immune responses to flagellin expressed by attenuated Salmonella vaccine strains. Infect Immun. 2004;72(5):2546-55.

38. Kakkanat A, Totsika M, Schaale K, Duell BL, Lo AW, Phan MD, et al. The role of H4 flagella in Escherichia coli ST131 virulence. Scientific Reports. 2015;5:16149.

39. Schreiber F, Kay S, Frankel G, Clare S, Goulding D, van de Vosse E, et al. The Hd, Hj, and Hz66 flagella variants of Salmonella enterica serovar Typhi modify host responses and cellular interactions. Scientific Reports. 2015;5:7947.

40. Duell BL, Carey AJ, Dando SJ, Schembri MA, Ulett GC. Human bladder uroepithelial cells synergize with monocytes to promote IL-10 synthesis and other cytokine responses to uropathogenic Escherichia coli. PLoS ONE. 2013;8(10):e78013.

41. Nataro JP, Kaper JB. Diarrheagenic Escherichia coli. Clin Microbiol Rev. 1998;11(1):142-201.

42. Dawson KG, Emerson JC, Burns JL. Fifteen years of experience with bacterial meningitis. Pediatr Infect Dis J. 1999;18(9):816-22.

43. Flores-Mireles AL, Walker JN, Caparon M, Hultgren SJ. Urinary tract infections: epidemiology, mechanisms of infection and treatment options. Nat Rev Microbiol. 2015;13(5):269-84.

44. Russo TA, Stapleton A, Wenderoth S, Hooton TM, Stamm WE. Chromosomal restriction fragment length polymorphism analysis of Escherichia coli strains causing recurrent urinary tract infections in young women. J Infect Dis. 1995;172(2):440-5.

45. Brzuszkiewicz E, Bruggemann H, Liesegang H, Emmerth M, Olschlager T, Nagy G, et al. How to become a uropathogen: comparative genomic analysis of extraintestinal pathogenic Escherichia coli strains. Proc Natl Acad Sci U S A. 2006;103(34):12879-84.

46. Welch RA, Burland V, Plunkett G, 3rd, Redford P, Roesch P, Rasko D, et al. 153

Extensive mosaic structure revealed by the complete genome sequence of uropathogenic Escherichia coli. Proc Natl Acad Sci U S A. 2002;99(26):17020-4.

47. Wiles TJ, Kulesus RR, Mulvey MA. Origins and virulence mechanisms of uropathogenic Escherichia coli. Exp Mol Pathol. 2008;85(1):11-9.

48. Ewers C, Li G, Wilking H, Kiessling S, Alt K, Antao EM, et al. Avian pathogenic, uropathogenic, and newborn meningitis-causing Escherichia coli: how closely related are they? Int J Med Microbiol. 2007;297(3):163-76.

49. Lloyd AL, Rasko DA, Mobley HL. Defining genomic islands and uropathogen- specific genes in uropathogenic Escherichia coli. J Bacteriol. 2007;189(9):3532-46.

50. Sarkar S, Ulett GC, Totsika M, Phan MD, Schembri MA. Role of capsule and O antigen in the virulence of uropathogenic Escherichia coli. PLoS ONE. 2014;9(4):e94786.

51. Ratiner YA. New flagellin-specifying genes in some Escherichia coli strains. J Bacteriol. 1998;180(4):979-84.

52. Stamm WE. Recent developments in the diagnosis and treatment of urinary tract infections. West J Med. 1982;137(3):213.

53. Stamm WE, Norrby SR. Urinary tract infections: disease panorama and challenges. J Infect Dis. 2001;183 Suppl 1:S1-4.

54. Foxman B. The epidemiology of urinary tract infection. Nature Reviews Urology. 2010;7(12):653-60.

55. Bhat RG, Katy TA, Place FC. Pediatric urinary tract infections. Emerg Med Clin North Am. 2011;29(3):637-53.

56. Rowe TA, Juthani-Mehta M. Diagnosis and management of urinary tract infection in older adults. Infect Dis Clin North Am. 2014;28(1):75-89.

57. Tandogdu Z, Wagenlehner FM. Global epidemiology of urinary tract infections. Curr Opin Infect Dis. 2016;29(1):73-9.

58. Wilson ML, Gaido L. Laboratory diagnosis of urinary tract infections in adult patients. Clin Infect Dis. 2004;38(8):1150-8.

59. Schmiemann G, Kniehl E, Gebhardt K, Matejczyk MM, Hummers-Pradier E. The diagnosis of urinary tract infection: a systematic review. Dtsch Arztebl Int. 2010;107(21):361-7.

154

60. Jepson RG, Craig JC. Cranberries for preventing urinary tract infections. Cochrane Database Syst Rev. 2008(1):CD001321.

61. Amdekar S, Singh V, Singh DD. Probiotic therapy: immunomodulating approach toward urinary tract infection. Curr Microbiol. 2011;63(5):484-90.

62. Schwenger EM, Tejani AM, Loewen PS. Probiotics for preventing urinary tract infections in adults and children. Cochrane Database Syst Rev. 2015;12(12):CD008772.

63. Terlizzi ME, Gribaudo G, Maffei ME. UroPathogenic Escherichia coli (UPEC) infections: virulence factors, bladder responses, antibiotic, and non-antibiotic antimicrobial strategies. Front Microbiol. 2017;8:1566.

64. Duan Q, Zhou M, Zhu L, Zhu G. Flagella and bacterial pathogenicity. J Basic Microbiol. 2013;53(1):1-8.

65. Smith SN, Hagan EC, Lane MC, Mobley HL. Dissemination and systemic colonization of uropathogenic Escherichia coli in a murine model of bacteremia. MBio. 2010;1(5).

66. Thomas WE, Trintchina E, Forero M, Vogel V, Sokurenko EV. Bacterial adhesion to target cells enhanced by shear force. Cell. 2002;109(7):913-23.

67. Wu XR, Kong XP, Pellicer A, Kreibich G, Sun TT. Uroplakins in urothelial biology, function, and disease. Kidney Int. 2009;75(11):1153-65.

68. Grist M, Chakraborty J. Identification of a mucin layer in the urinary bladder. Urology. 1994;44(1):26-33.

69. Hurst RE. Structure, function, and pathology of proteoglycans and glycosaminoglycans in the urinary tract. World J Urol. 1994;12(1):3-10.

70. Zasloff M. Antimicrobial peptides, innate immunity, and the normally sterile urinary tract. J Am Soc Nephrol. 2007;18(11):2810-6.

71. Svanborg-Eden C, Svennerholm AM. Secretory immunoglobulin A and G antibodies prevent adhesion of Escherichia coli to human urinary tract epithelial cells. Infect Immun. 1978;22(3):790-7.

72. Hannan TJ, Totsika M, Mansfield KJ, Moore KH, Schembri MA, Hultgren SJ. Host-pathogen checkpoints and population bottlenecks in persistent and intracellular uropathogenic Escherichia coli bladder infection. FEMS Microbiol Rev. 2012;36(3):616- 48.

155

73. Zhou G, Mo WJ, Sebbel P, Min G, Neubert TA, Glockshuber R, et al. Uroplakin Ia is the urothelial receptor for uropathogenic Escherichia coli: evidence from in vitro FimH binding. J Cell Sci. 2001;114(Pt 22):4095-103.

74. Ingersoll MA, Albert ML. From infection to immunotherapy: host immune responses to bacteria at the bladder mucosa. Mucosal Immunol. 2013;6(6):1041-53.

75. McGeachie J, Kennedy AC. Simplified quantitative methods for bacteriuria and pyuria. J Clin Pathol. 1963;16(1):32-8.

76. Anderson GG, Palermo JJ, Schilling JD, Roth R, Heuser J, Hultgren SJ. Intracellular bacterial biofilm-like pods in urinary tract infections. Science. 2003;301(5629):105-7.

77. Mulvey MA, Lopez-Boado YS, Wilson CL, Roth R, Parks WC, Heuser J, et al. Induction and evasion of host defenses by type 1-piliated uropathogenic Escherichia coli. Science. 1998;282(5393):1494-7.

78. Foxman B. Epidemiology of urinary tract infections: incidence, morbidity, and economic costs. Dis Mon. 2003;49(2):53-70.

79. Hannan TJ, Mysorekar IU, Hung CS, Isaacson-Schmid ML, Hultgren SJ. Early severe inflammatory responses to uropathogenic E. coli predispose to chronic and recurrent urinary tract infection. PLoS Pathog. 2010;6(8):e1001042.

80. Sivick KE, Mobley HL. Waging war against uropathogenic Escherichia coli: winning back the urinary tract. Infect Immun. 2010;78(2):568-85.

81. Doyle SL, O'Neill LA. Toll-like receptors: from the discovery of NFkappaB to new insights into transcriptional regulations in innate immunity. Biochem Pharmacol. 2006;72(9):1102-13.

82. Mahla RS, Reddy MC, Prasad DV, Kumar H. Sweeten PAMPs: role of sugar complexed PAMPs in innate immunity and vaccine biology. Front Immunol. 2013;4:248.

83. Schilling JD, Martin SM, Hung CS, Lorenz RG, Hultgren SJ. Toll-like receptor 4 on stromal and hematopoietic cells mediates innate resistance to uropathogenic Escherichia coli. Proc Natl Acad Sci U S A. 2003;100(7):4203-8.

84. Andersen-Nissen E, Hawn TR, Smith KD, Nachman A, Lampano AE, Uematsu S, et al. Cutting edge: Tlr5-/- mice are more susceptible to Escherichia coli urinary tract infection. J Immunol. 2007;178(8):4717-20.

156

85. Samuelsson P, Hang L, Wullt B, Irjala H, Svanborg C. Toll-like receptor 4 expression and cytokine responses in the human urinary tract mucosa. Infect Immun. 2004;72(6):3179-86.

86. Zhang D, Zhang G, Hayden MS, Greenblatt MB, Bussey C, Flavell RA, et al. A toll-like receptor that prevents infection by uropathogenic bacteria. Science. 2004;303(5663):1522-6.

87. Bien J, Sokolova O, Bozko P. Role of uropathogenic Escherichia coli virulence factors in development of urinary tract infection and kidney damage. Int J Nephrol. 2012;2012:681473.

88. Klumpp DJ, Rycyk MT, Chen MC, Thumbikat P, Sengupta S, Schaeffer AJ. Uropathogenic Escherichia coli induces extrinsic and intrinsic cascades to initiate urothelial apoptosis. Infect Immun. 2006;74(9):5106-13.

89. Chromek M, Slamova Z, Bergman P, Kovacs L, Podracka L, Ehren I, et al. The antimicrobial peptide cathelicidin protects the urinary tract against invasive bacterial infection. Nat Med. 2006;12(6):636-41.

90. Saemann MD, Weichhart T, Horl WH, Zlabinger GJ. Tamm-Horsfall protein: a multilayered defence molecule against urinary tract infection. Eur J Clin Invest. 2005;35(4):227-35.

91. Ingersoll MA, Kline KA, Nielsen HV, Hultgren SJ. G-CSF induction early in uropathogenic Escherichia coli infection of the urinary tract modulates host immunity. Cell Microbiol. 2008;10(12):2568-78.

92. Schilling JD, Martin SM, Hunstad DA, Patel KP, Mulvey MA, Justice SS, et al. CD14- and Toll-like receptor-dependent activation of bladder epithelial cells by lipopolysaccharide and type 1 piliated Escherichia coli. Infect Immun. 2003;71(3):1470- 80.

93. Haraoka M, Hang L, Frendeus B, Godaly G, Burdick M, Strieter R, et al. Neutrophil recruitment and resistance to urinary tract infection. J Infect Dis. 1999;180(4):1220-9.

94. Hirose T, Kumamoto Y, Matsukawa M, Yokoo A, Satoh T, Matsuura A. Study on local immune response in Escherichia coli-induced experimental urinary tract infection in mice infiltration of Ia-positive cells, macrophages, neutrophils, T cells and B cells. Kansenshogaku Zasshi. 1992;66(7):964-73.

157

95. Engel D, Dobrindt U, Tittel A, Peters P, Maurer J, Gutgemann I, et al. Tumor necrosis factor alpha- and inducible nitric oxide synthase-producing dendritic cells are rapidly recruited to the bladder in urinary tract infection but are dispensable for bacterial clearance. Infect Immun. 2006;74(11):6100-7.

96. Jones-Carson J, Balish E, Uehling DT. Susceptibility of immunodeficient gene- knockout mice to urinary tract infection. J Urol. 1999;161(1):338-41.

97. Langermann S, Palaszynski S, Barnhart M, Auguste G, Pinkner JS, Burlein J, et al. Prevention of mucosal Escherichia coli infection by FimH-adhesin-based systemic vaccination. Science. 1997;276(5312):607-11.

98. Alteri CJ, Hagan EC, Sivick KE, Smith SN, Mobley HL. Mucosal immunization with iron receptor antigens protects against urinary tract infection. PLoS Pathog. 2009;5(9):e1000586.

99. Uehling DT, James LJ, Hopkins WJ, Balish E. Immunization against urinary tract infection with a multi-valent vaginal vaccine. J Urol. 1991;146(1):223-6.

100. Akira S, Hemmi H. Recognition of pathogen-associated molecular patterns by TLR family. Immunol Lett. 2003;85(2):85-95.

101. Schuhmacher JS, Thormann KM, Bange G. How bacteria maintain location and number of flagella? FEMS Microbiol Rev. 2015;39(6):812-22.

102. Chilcott GS, Hughes KT. Coupling of flagellar gene expression to flagellar assembly in Salmonella enterica serovar typhimurium and Escherichia coli. Microbiol Mol Biol Rev. 2000;64(4):694-708.

103. Josenhans C, Suerbaum S. The role of motility as a virulence factor in bacteria. Int J Med Microbiol. 2002;291(8):605-14.

104. Minamino T, Imada K. The bacterial flagellar motor and its structural diversity. Trends Microbiol. 2015;23(5):267-74.

105. Terashima H, Kojima S, Homma M. Flagellar motility in bacteria structure and function of flagellar motor. Int Rev Cell Mol Biol. 2008;270:39-85.

106. Chaban B, Hughes HV, Beeby M. The flagellum in bacterial pathogens: For motility and a whole lot more. Semin Cell Dev Biol. 2015;46:91-103.

107. Winstanley C, Morgan JA. The bacterial flagellin gene as a biomarker for detection, population genetics and epidemiological analysis. Microbiology. 1997;143 ( Pt

158

10):3071-84.

108. Morimoto YV, Minamino T. Structure and function of the bi-directional bacterial flagellar motor. Biomolecules. 2014;4(1):217-34.

109. Macnab RM. Genetics and biogenesis of bacterial flagella. Annu Rev Genet. 1992;26:131-58.

110. Macnab RM. How bacteria assemble flagella. Annu Rev Microbiol. 2003;57:77- 100.

111. Lloyd SA, Tang H, Wang X, Billings S, Blair DF. Torque generation in the flagellar motor of Escherichia coli: evidence of a direct role for FliG but not for FliM or FliN. J Bacteriol. 1996;178(1):223-31.

112. Galkin VE, Yu X, Bielnicki J, Heuser J, Ewing CP, Guerry P, et al. Divergence of quaternary structures among bacterial flagellar filaments. Science. 2008;320(5874):382-5.

113. Namba K, Yamashita I, Vonderviszt F. Structure of the core and central channel of bacterial flagella. Nature. 1989;342(6250):648-54.

114. Yonekura K, Maki-Yonekura S, Namba K. Complete atomic model of the bacterial flagellar filament by electron cryomicroscopy. Nature. 2003;424(6949):643-50.

115. Minamino T, Namba K. Self-assembly and type III protein export of the bacterial flagellum. J Mol Microbiol Biotechnol. 2004;7(1-2):5-17.

116. Ikeda T, Asakura S, Kamiya R. "Cap" on the tip of Salmonella flagella. J Mol Biol. 1985;184(4):735-7.

117. Kutsukake K, Ohya Y, Iino T. Transcriptional analysis of the flagellar regulon of Salmonella Typhimurium. J Bacteriol. 1990;172(2):741-7.

118. Silverman M, Simon M. Characterization of Escherichia coli flagellar mutants that are insensitive to catabolite repression. J Bacteriol. 1974;120(3):1196-203.

119. Kutsukake K, Iino T, Komeda Y, Yamaguchi S. Functional homology of fla genes between Salmonella Typhimurium and Escherichia coli. Mol Gen Genet. 1980;178(1):59-67.

120. Liu X, Matsumura P. The FlhD/FlhC complex, a transcriptional activator of the Escherichia coli flagellar class II operons. J Bacteriol. 1994;176(23):7345-51.

121. Tomoyasu T, Takaya A, Isogai E, Yamamoto T. Turnover of FlhD and FlhC, 159 master regulator proteins for Salmonella flagellum biogenesis, by the ATP-dependent ClpXP protease. Mol Microbiol. 2003;48(2):443-52.

122. Fitzgerald DM, Bonocora RP, Wade JT. Comprehensive mapping of the Escherichia coli flagellar regulatory network. PLoS Genet. 2014;10(10):e1004649.

123. Stafford GP, Ogi T, Hughes C. Binding and transcriptional activation of non- flagellar genes by the Escherichia coli flagellar master regulator FlhD2C2. Microbiology. 2005;151(Pt 6):1779-88.

124. Pruss BM, Matsumura P. A regulator of the flagellar regulon of Escherichia coli, flhD, also affects cell division. J Bacteriol. 1996;178(3):668-74.

125. Jarrell KF, McBride MJ. The surprisingly diverse ways that prokaryotes move. Nat Rev Microbiol. 2008;6(6):466-76.

126. Wolgemuth CW, Charon NW, Goldstein SF, Goldstein RE. The flagellar cytoskeleton of the spirochetes. J Mol Microbiol Biotechnol. 2006;11(3-5):221-7.

127. Ehlers KM, Samuel AD, Berg HC, Montgomery R. Do cyanobacteria swim using traveling surface waves? Proc Natl Acad Sci U S A. 1996;93(16):8340-3.

128. Nudleman E, Kaiser D. Pulling together with type IV pili. J Mol Microbiol Biotechnol. 2004;7(1-2):52-62.

129. Kaiser D. Bacterial swarming: a re-examination of cell-movement patterns. Curr Biol. 2007;17(14):R561-70.

130. Harshey RM. Bacterial motility on a surface: many ways to a common goal. Annu Rev Microbiol. 2003;57:249-73.

131. Rashid MH, Kornberg A. Inorganic polyphosphate is needed for swimming, swarming, and twitching motilities of Pseudomonas aeruginosa. Proc Natl Acad Sci U S A. 2000;97(9):4885-90.

132. Kohler T, Curty LK, Barja F, van Delden C, Pechere JC. Swarming of Pseudomonas aeruginosa is dependent on cell-to-cell signaling and requires flagella and pili. J Bacteriol. 2000;182(21):5990-6.

133. McCarter L, Hilmen M, Silverman M. Flagellar dynamometer controls swarmer cell differentiation of V. parahaemolyticus. Cell. 1988;54(3):345-51.

134. Belas R, Simon M, Silverman M. Regulation of lateral flagella gene transcription in Vibrio parahaemolyticus. J Bacteriol. 1986;167(1):210-8.

160

135. Cummings LA, Wilkerson WD, Bergsbaken T, Cookson BT. In vivo, fliC expression by Salmonella enterica serovar Typhimurium is heterogeneous, regulated by ClpX, and anatomically restricted. Mol Microbiol. 2006;61(3):795-809.

136. Sporing I, Felgner S, Preusse M, Eckweiler D, Rohde M, Haussler S, et al. Regulation of flagellum biosynthesis in response to cell envelope stress in Salmonella enterica serovar Typhimurium. MBio. 2018;9(3).

137. Harshey RM, Matsuyama T. Dimorphic transition in Escherichia coli and Salmonella typhimurium: surface-induced differentiation into hyperflagellate swarmer cells. Proc Natl Acad Sci U S A. 1994;91(18):8631-5.

138. Mobley HL, Green DM, Trifillis AL, Johnson DE, Chippendale GR, Lockatell CV, et al. Pyelonephritogenic Escherichia coli and killing of cultured human renal proximal tubular epithelial cells: role of hemolysin in some strains. Infect Immun. 1990;58(5):1281-9.

139. Inoue T, Shingaki R, Hirose S, Waki K, Mori H, Fukui K. Genome-wide screening of genes required for swarming motility in Escherichia coli K-12. J Bacteriol. 2007;189(3):950-7.

140. Kakkanat A, Phan MD, Lo AW, Beatson SA, Schembri MA. Novel genes associated with enhanced motility of Escherichia coli ST131. PLoS ONE. 2017;12(5):e0176290.

141. Reid SD, Selander RK, Whittam TS. Sequence diversity of flagellin (fliC) alleles in pathogenic Escherichia coli. J Bacteriol. 1999;181(1):153-60.

142. Wang L, Rothemund D, Curd H, Reeves PR. Species-wide variation in the Escherichia coli flagellin (H-antigen) gene. J Bacteriol. 2003;185(9):2936-43.

143. Lawn AM, Orskov I, Orskov F. Morphological distinction between different H serotypes of Escherichia coli. J Gen Microbiol. 1977;101(1):111-9.

144. Jones CJ, Aizawa S. The bacterial flagellum and flagellar motor: structure, assembly and function. Adv Microb Physiol. 1991;32:109-72.

145. Emody L, Kerenyi M, Nagy G. Virulence factors of uropathogenic Escherichia coli. Int J Antimicrob Agents. 2003;22 Suppl 2:29-33.

146. Mobley HL, Island MD, Massad G. Virulence determinants of uropathogenic Escherichia coli and Proteus mirabilis. Kidney Int Suppl. 1994;47:S129-36.

161

147. Lane MC, Alteri CJ, Smith SN, Mobley HL. Expression of flagella is coincident with uropathogenic Escherichia coli ascension to the upper urinary tract. Proc Natl Acad Sci U S A. 2007;104(42):16669-74.

148. Roy K, Hilliard GM, Hamilton DJ, Luo J, Ostmann MM, Fleckenstein JM. Enterotoxigenic Escherichia coli EtpA mediates adhesion between flagella and host cells. Nature. 2009;457(7229):594-8.

149. Dons L, Eriksson E, Jin Y, Rottenberg ME, Kristensson K, Larsen CN, et al. Role of flagellin and the two-component CheA/CheY system of Listeria monocytogenes in host cell invasion and virulence. Infect Immun. 2004;72(6):3237-44.

150. van Asten FJ, Hendriks HG, Koninkx JF, van Dijk JE. Flagella-mediated bacterial motility accelerates but is not required for Salmonella serotype Enteritidis invasion of differentiated Caco-2 cells. Int J Med Microbiol. 2004;294(6):395-9.

151. Giron JA, Torres AG, Freer E, Kaper JB. The flagella of enteropathogenic Escherichia coli mediate adherence to epithelial cells. Mol Microbiol. 2002;44(2):361- 79.

152. Parthasarathy G, Yao Y, Kim KS. Flagella promote Escherichia coli K1 association with and invasion of human brain microvascular endothelial cells. Infect Immun. 2007;75(6):2937-45.

153. Erdem AL, Avelino F, Xicohtencatl-Cortes J, Giron JA. Host protein binding and adhesive properties of H6 and H7 flagella of attaching and effacing Escherichia coli. J Bacteriol. 2007;189(20):7426-35.

154. Mahajan A, Currie CG, Mackie S, Tree J, McAteer S, McKendrick I, et al. An investigation of the expression and adhesin function of H7 flagella in the interaction of Escherichia coli O157 : H7 with bovine intestinal epithelium. Cell Microbiol. 2009;11(1):121-37.

155. Arora SK, Ritchings BW, Almira EC, Lory S, Ramphal R. The Pseudomonas aeruginosa flagellar cap protein, FliD, is responsible for mucin adhesion. Infect Immun. 1998;66(3):1000-7.

156. Kirov SM, Castrisios M, Shaw JG. Aeromonas flagella (polar and lateral) are enterocyte adhesins that contribute to biofilm formation on surfaces. Infect Immun. 2004;72(4):1939-45.

157. McSweegan E, Walker RI. Identification and characterization of two 162

Campylobacter jejuni adhesins for cellular and mucous substrates. Infect Immun. 1986;53(1):141-8.

158. La Ragione RM, Sayers AR, Woodward MJ. The role of fimbriae and flagella in the colonization, invasion and persistence of Escherichia coli O78:K80 in the day-old- chick model. Epidemiol Infect. 2000;124(3):351-63.

159. Rogers TJ, Thorpe CM, Paton AW, Paton JC. Role of lipid rafts and flagellin in invasion of colonic epithelial cells by Shiga-toxigenic Escherichia coli O113:H21. Infect Immun. 2012;80(8):2858-67.

160. Meadows PS. The attachment of bacteria to solid surfaces. Arch Mikrobiol. 1971;75(4):374-81.

161. Yamamoto T, Fujita K, Yokota T. Adherence characteristics to human small intestinal mucosa of Escherichia coli isolated from patients with diarrhea or urinary tract infections. J Infect Dis. 1990;162(4):896-908.

162. Cooper LA, Simmons LA, Mobley HL. Involvement of mismatch repair in the reciprocal control of motility and adherence of uropathogenic Escherichia coli. Infect Immun. 2012;80(6):1969-79.

163. Schwan WR. Flagella allow uropathogenic Escherichia coli ascension into murine kidneys. Int J Med Microbiol. 2008;298(5-6):441-7.

164. Tolker-Nielsen T, Brinch UC, Ragas PC, Andersen JB, Jacobsen CS, Molin S. Development and dynamics of Pseudomonas sp. biofilms. J Bacteriol. 2000;182(22):6482-9.

165. Ulett GC, Mabbett AN, Fung KC, Webb RI, Schembri MA. The role of F9 fimbriae of uropathogenic Escherichia coli in biofilm formation. Microbiology. 2007;153(Pt 7):2321-31.

166. Hung C, Zhou Y, Pinkner JS, Dodson KW, Crowley JR, Heuser J, et al. Escherichia coli biofilms have an organized and complex extracellular matrix structure. MBio. 2013;4(5):e00645-13.

167. Subashchandrabose S, Mobley HL. Virulence and fitness determinants of uropathogenic Escherichia coli. Microbiol Spectr. 2015;3(4).

168. Kostakioti M, Hadjifrangiskou M, Hultgren SJ. Bacterial biofilms: development, dispersal, and therapeutic strategies in the dawn of the postantibiotic era. Cold Spring Harb Perspect Med. 2013;3(4):a010306. 163

169. Beloin C, Roux A, Ghigo JM. Escherichia coli biofilms. Curr Top Microbiol Immunol. 2008;322:249-89.

170. Rasamiravaka T, Labtani Q, Duez P, El Jaziri M. The formation of biofilms by Pseudomonas aeruginosa: a review of the natural and synthetic compounds interfering with control mechanisms. Biomed Res Int. 2015;2015:759348.

171. Lemon KP, Higgins DE, Kolter R. Flagellar motility is critical for Listeria monocytogenes biofilm formation. J Bacteriol. 2007;189(12):4418-24.

172. Zheng JX, Bai B, Lin ZW, Pu ZY, Yao WM, Chen Z, et al. Characterization of biofilm formation by Enterococcus faecalis isolates derived from urinary tract infections in China. J Med Microbiol. 2017.

173. Hyun J, Romero L, Riveron R, Flores C, Kanagavelu S, Chung KD, et al. Human intestinal epithelial cells express interleukin-10 through toll-like receptor 4-mediated epithelial-macrophage crosstalk. J Innate Immun. 2014.

174. Cairns LS, Hobley L, Stanley-Wall NR. Biofilm formation by Bacillus subtilis: new insights into regulatory strategies and assembly mechanisms. Mol Microbiol. 2014;93(4):587-98.

175. O'Toole GA, Kolter R. Flagellar and twitching motility are necessary for Pseudomonas aeruginosa biofilm development. Mol Microbiol. 1998;30(2):295-304.

176. Prigent-Combaret C, Prensier G, Le Thi TT, Vidal O, Lejeune P, Dorel C. Developmental pathway for biofilm formation in curli-producing Escherichia coli strains: role of flagella, curli and colanic acid. Environ Microbiol. 2000;2(4):450-64.

177. Klausen M, Heydorn A, Ragas P, Lambertsen L, Aaes-Jorgensen A, Molin S, et al. Biofilm formation by Pseudomonas aeruginosa wild type, flagella and type IV pili mutants. Mol Microbiol. 2003;48(6):1511-24.

178. Pratt LA, Kolter R. Genetic analysis of Escherichia coli biofilm formation: roles of flagella, motility, chemotaxis and type I pili. Mol Microbiol. 1998;30(2):285-93.

179. Serra DO, Richter AM, Klauck G, Mika F, Hengge R. Microanatomy at cellular resolution and spatial order of physiological differentiation in a bacterial biofilm. MBio. 2013;4(2):e00103-13.

180. Domka J, Lee J, Bansal T, Wood TK. Temporal gene-expression in Escherichia coli K-12 biofilms. Environ Microbiol. 2007;9(2):332-46.

164

181. Soto SM, Smithson A, Martinez JA, Horcajada JP, Mensa J, Vila J. Biofilm formation in uropathogenic Escherichia coli strains: relationship with prostatitis, urovirulence factors and antimicrobial resistance. J Urol. 2007;177(1):365-8.

182. Hadjifrangiskou M, Gu AP, Pinkner JS, Kostakioti M, Zhang EW, Greene SE, et al. Transposon mutagenesis identifies uropathogenic Escherichia coli biofilm factors. J Bacteriol. 2012;194(22):6195-205.

183. Haiko J, Westerlund-Wikstrom B. The role of the bacterial flagellum in adhesion and virulence. Biology (Basel). 2013;2(4):1242-67.

184. Hughes KT, Gillen KL, Semon MJ, Karlinsey JE. Sensing structural intermediates in bacterial flagellar assembly by export of a negative regulator. Science. 1993;262(5137):1277-80.

185. Young GM, Schmiel DH, Miller VL. A new pathway for the secretion of virulence factors by bacteria: the flagellar export apparatus functions as a protein-secretion system. Proc Natl Acad Sci U S A. 1999;96(11):6456-61.

186. Ghelardi E, Celandroni F, Salvetti S, Beecher DJ, Gominet M, Lereclus D, et al. Requirement of flhA for swarming differentiation, flagellin export, and secretion of virulence-associated proteins in Bacillus thuringiensis. J Bacteriol. 2002;184(23):6424- 33.

187. Konkel ME, Klena JD, Rivera-Amill V, Monteville MR, Biswas D, Raphael B, et al. Secretion of virulence proteins from Campylobacter jejuni is dependent on a functional flagellar export apparatus. J Bacteriol. 2004;186(11):3296-303.

188. Berger E, Crampton MC, Nxumalo NP, Louw ME. Extracellular secretion of a recombinant therapeutic peptide by Bacillus halodurans utilizing a modified flagellin type III secretion system. Microb Cell Fact. 2011;10:62.

189. Majander K, Anton L, Antikainen J, Lang H, Brummer M, Korhonen TK, et al. Extracellular secretion of polypeptides using a modified Escherichia coli flagellar secretion apparatus. Nat Biotechnol. 2005;23(4):475-81.

190. Singer HM, Erhardt M, Steiner AM, Zhang MM, Yoshikami D, Bulaj G, et al. Selective purification of recombinant neuroactive peptides using the flagellar type III secretion system. MBio. 2012;3(3).

191. Green CA, Kamble NS, Court EK, Bryant OJ, Hicks MG, Lennon C, et al. Engineering the flagellar type III secretion system: improving capacity for secretion of 165 recombinant protein. Microb Cell Fact. 2019;18(1):10.

192. Puhar A, Sansonetti PJ. Type III secretion system. Curr Biol. 2014;24(17):R784- 91.

193. Bower JM, Eto DS, Mulvey MA. Covert operations of uropathogenic Escherichia coli within the urinary tract. Traffic. 2005;6(1):18-31.

194. Lai MA, Quarles EK, Lopez-Yglesias AH, Zhao X, Hajjar AM, Smith KD. Innate immune detection of flagellin positively and negatively regulates Salmonella infection. PLoS ONE. 2013;8(8):e72047.

195. Lockman HA, Curtiss R, 3rd. Salmonella typhimurium mutants lacking flagella or motility remain virulent in BALB/c mice. Infect Immun. 1990;58(1):137-43.

196. Yoon SI, Kurnasov O, Natarajan V, Hong M, Gudkov AV, Osterman AL, et al. Structural basis of TLR5-flagellin recognition and signaling. Science. 2012;335(6070):859-64.

197. Song WS, Jeon YJ, Namgung B, Hong M, Yoon SI. A conserved TLR5 binding and activation hot spot on flagellin. Sci Rep. 2017;7:40878.

198. Didierlaurent A, Ferrero I, Otten LA, Dubois B, Reinhardt M, Carlsen H, et al. Flagellin promotes myeloid differentiation factor 88-dependent development of Th2-type response. J Immunol. 2004;172(11):6922-30.

199. Gewirtz AT, Navas TA, Lyons S, Godowski PJ, Madara JL. Cutting edge: bacterial flagellin activates basolaterally expressed TLR5 to induce epithelial proinflammatory gene expression. J Immunol. 2001;167(4):1882-5.

200. Sebastiani G, Leveque G, Lariviere L, Laroche L, Skamene E, Gros P, et al. Cloning and characterization of the murine toll-like receptor 5 (Tlr5) gene: sequence and mRNA expression studies in Salmonella-susceptible MOLF/Ei mice. Genomics. 2000;64(3):230-40.

201. Muzio M, Bosisio D, Polentarutti N, D'Amico G, Stoppacciaro A, Mancinelli R, et al. Differential expression and regulation of toll-like receptors (TLR) in human leukocytes: selective expression of TLR3 in dendritic cells. J Immunol. 2000;164(11):5998-6004.

202. Tsujimoto H, Uchida T, Efron PA, Scumpia PO, Verma A, Matsumoto T, et al. Flagellin enhances NK cell proliferation and activation directly and through dendritic cell-NK cell interactions. J Leukoc Biol. 2005;78(4):888-97. 166

203. Vicente-Suarez I, Brayer J, Villagra A, Cheng F, Sotomayor EM. TLR5 ligation by flagellin converts tolerogenic dendritic cells into activating antigen-presenting cells that preferentially induce T-helper 1 responses. Immunol Lett. 2009;125(2):114-8.

204. McDermott PF, Ciacci-Woolwine F, Snipes JA, Mizel SB. High-affinity interaction between gram-negative flagellin and a cell surface polypeptide results in human monocyte activation. Infect Immun. 2000;68(10):5525-9.

205. Steiner TS. How flagellin and toll-like receptor 5 contribute to enteric infection. Infect Immun. 2007;75(2):545-52.

206. Wyant TL, Tanner MK, Sztein MB. Salmonella typhi flagella are potent inducers of proinflammatory cytokine secretion by human monocytes. Infect Immun. 1999;67(7):3619-24.

207. Mizel SB, Honko AN, Moors MA, Smith PS, West AP. Induction of macrophage nitric oxide production by Gram-negative flagellin involves signaling via heteromeric Toll-like receptor 5/Toll-like receptor 4 complexes. J Immunol. 2003;170(12):6217-23.

208. Hueck CJ. Type III protein secretion systems in bacterial pathogens of animals and plants. Microbiol Mol Biol Rev. 1998;62(2):379-433.

209. Miao EA, Alpuche-Aranda CM, Dors M, Clark AE, Bader MW, Miller SI, et al. Cytoplasmic flagellin activates caspase-1 and secretion of interleukin 1beta via Ipaf. Nat Immunol. 2006;7(6):569-75.

210. Gutierrez O, Pipaon C, Fernandez-Luna JL. Ipaf is upregulated by tumor necrosis factor-alpha in human leukemia cells. FEBS Lett. 2004;568(1-3):79-82.

211. Ren T, Zamboni DS, Roy CR, Dietrich WF, Vance RE. Flagellin-deficient Legionella mutants evade caspase-1- and Naip5-mediated macrophage immunity. PLoS Pathog. 2006;2(3):e18.

212. Stephenson HN, Mills DC, Jones H, Milioris E, Copland A, Dorrell N, et al. Pseudaminic acid on Campylobacter jejuni flagella modulates dendritic cell IL-10 expression via Siglec-10 receptor: a novel flagellin-host interaction. J Infect Dis. 2014;210(9):1487-98.

213. Ruby J, Martin M, Passineau MJ, Godovikova V, Fenno JC, Wu H. Activation of the innate immune system by Treponema denticola periplasmic flagella through toll-like receptor 2. Infect Immun. 2018;86(1).

214. Watson RO, Galan JE. Signal transduction in Campylobacter jejuni-induced 167 cytokine production. Cell Microbiol. 2005;7(5):655-65.

215. Ciacci-Woolwine F, Kucera LS, Richardson SH, Iyer NP, Mizel SB. Salmonellae activate tumor necrosis factor alpha production in a human promonocytic cell line via a released polypeptide. Infect Immun. 1997;65(11):4624-33.

216. Steiner TS, Nataro JP, Poteet-Smith CE, Smith JA, Guerrant RL. Enteroaggregative Escherichia coli expresses a novel flagellin that causes IL-8 release from intestinal epithelial cells. J Clin Invest. 2000;105(12):1769-77.

217. Eaves-Pyles T, Murthy K, Liaudet L, Virag L, Ross G, Soriano FG, et al. Flagellin, a novel mediator of Salmonella-induced epithelial activation and systemic inflammation: I kappa B alpha degradation, induction of nitric oxide synthase, induction of proinflammatory mediators, and cardiovascular dysfunction. J Immunol. 2001;166(2):1248-60.

218. Moors MA, Li L, Mizel SB. Activation of interleukin-1 receptor-associated kinase by gram-negative flagellin. Infect Immun. 2001;69(7):4424-9.

219. Ogushi K, Wada A, Niidome T, Mori N, Oishi K, Nagatake T, et al. Salmonella enteritidis FliC (flagella filament protein) induces human beta-defensin-2 mRNA production by Caco-2 cells. J Biol Chem. 2001;276(32):30521-6.

220. Sierro F, Dubois B, Coste A, Kaiserlian D, Kraehenbuhl JP, Sirard JC. Flagellin stimulation of intestinal epithelial cells triggers CCL20-mediated migration of dendritic cells. Proc Natl Acad Sci U S A. 2001;98(24):13722-7.

221. Berin MC, Darfeuille-Michaud A, Egan LJ, Miyamoto Y, Kagnoff MF. Role of EHEC O157:H7 virulence factors in the activation of intestinal epithelial cell NF-kappaB and MAP kinase pathways and the upregulated expression of interleukin 8. Cell Microbiol. 2002;4(10):635-48.

222. Honko AN, Mizel SB. Mucosal administration of flagellin induces innate immunity in the mouse lung. Infect Immun. 2004;72(11):6676-9.

223. Hybiske K, Ichikawa JK, Huang V, Lory SJ, Machen TE. Cystic fibrosis airway epithelial cell polarity and bacterial flagellin determine host response to Pseudomonas aeruginosa. Cell Microbiol. 2004;6(1):49-63.

224. Porte R, Van Maele L, Munoz-Wolf N, Foligne B, Dumoutier L, Tabareau J, et al. Flagellin-mediated protection against intestinal Yersinia pseudotuberculosis infection does not require interleukin-22. Infect Immun. 2017;85(2). 168

225. Kinnebrew MA, Ubeda C, Zenewicz LA, Smith N, Flavell RA, Pamer EG. Bacterial flagellin stimulates Toll-like receptor 5-dependent defense against vancomycin- resistant Enterococcus infection. J Infect Dis. 2010;201(4):534-43.

226. Kinnebrew MA, Buffie CG, Diehl GE, Zenewicz LA, Leiner I, Hohl TM, et al. Interleukin 23 production by intestinal CD103(+)CD11b(+) dendritic cells in response to bacterial flagellin enhances mucosal innate immune defense. Immunity. 2012;36(2):276- 87.

227. Sabharwal N, Chhibber S, Harjai K. Divalent flagellin immunotherapy provides homologous and heterologous protection in experimental urinary tract infections in mice. Int J Med Microbiol. 2016;306(1):29-37.

228. Vijay-Kumar M, Aitken JD, Sanders CJ, Frias A, Sloane VM, Xu J, et al. Flagellin treatment protects against chemicals, bacteria, viruses, and radiation. J Immunol. 2008;180(12):8280-5.

229. Feuillet V, Medjane S, Mondor I, Demaria O, Pagni PP, Galan JE, et al. Involvement of Toll-like receptor 5 in the recognition of flagellated bacteria. Proc Natl Acad Sci U S A. 2006;103(33):12487-92.

230. Van Maele L, Carnoy C, Cayet D, Songhet P, Dumoutier L, Ferrero I, et al. TLR5 signaling stimulates the innate production of IL-17 and IL-22 by CD3(neg)CD127+ immune cells in spleen and mucosa. J Immunol. 2010;185(2):1177-85.

231. Bens M, Vimont S, Ben Mkaddem S, Chassin C, Goujon JM, Balloy V, et al. Flagellin/TLR5 signalling activates renal collecting duct cells and facilitates invasion and cellular translocation of uropathogenic Escherichia coli. Cell Microbiol. 2014;16(10):1503-17.

232. Gao N, Kumar A, Jyot J, Yu FS. Flagellin-induced corneal antimicrobial peptide production and wound repair involve a novel NF-kappaB-independent and EGFR- dependent pathway. PLoS ONE. 2010;5(2):e9351.

233. Tahoun A, Jensen K, Corripio-Miyar Y, McAteer SP, Corbishley A, Mahajan A, et al. Functional analysis of bovine TLR5 and association with IgA responses of cattle following systemic immunisation with H7 flagella. Vet Res. 2015;46:9.

234. Brown A, Hormaeche CE. The antibody response to salmonellae in mice and humans studied by immunoblots and ELISA. Microb Pathog. 1989;6(6):445-54.

235. Bergman MA, Cummings LA, Alaniz RC, Mayeda L, Fellnerova I, Cookson BT. 169

CD4+-T-cell responses generated during murine Salmonella enterica serovar Typhimurium infection are directed towards multiple epitopes within the natural antigen FliC. Infect Immun. 2005;73(11):7226-35.

236. McSorley SJ, Asch S, Costalonga M, Reinhardt RL, Jenkins MK. Tracking Salmonella-specific CD4 T cells in vivo reveals a local mucosal response to a disseminated infection. Immunity. 2002;16(3):365-77.

237. Komoriya K, Shibano N, Higano T, Azuma N, Yamaguchi S, Aizawa SI. Flagellar proteins and type III-exported virulence factors are the predominant proteins secreted into the culture media of Salmonella Typhimurium. Mol Microbiol. 1999;34(4):767-79.

238. Ikeda T, Oosawa K, Hotani H. Self-assembly of the filament capping protein, FliD, of bacterial flagella into an annular structure. J Mol Biol. 1996;259(4):679-86.

239. Subramanian N, Qadri A. Lysophospholipid sensing triggers secretion of flagellin from pathogenic salmonella. Nat Immunol. 2006;7(6):583-9.

240. Mosser DM, Zhang X. Interleukin-10: new perspectives on an old cytokine. Immunol Rev. 2008;226:205-18.

241. O'Garra A, Barrat FJ, Castro AG, Vicari A, Hawrylowicz C. Strategies for use of IL-10 or its antagonists in human disease. Immunol Rev. 2008;223:114-31.

242. Duell BL, Tan CK, Carey AJ, Wu F, Cripps AW, Ulett GC. Recent insights into microbial triggers of interleukin-10 production in the host and the impact on infectious disease pathogenesis. FEMS Immunol Med Microbiol. 2012;64(3):295-313.

243. Saraiva M, O'Garra A. The regulation of IL-10 production by immune cells. Nat Rev Immunol. 2010;10(3):170-81.

244. Moore KW, de Waal Malefyt R, Coffman RL, O'Garra A. Interleukin-10 and the interleukin-10 receptor. Annu Rev Immunol. 2001;19:683-765.

245. Fiorentino DF, Bond MW, Mosmann TR. Two types of mouse T helper cell. IV. Th2 clones secrete a factor that inhibits cytokine production by Th1 clones. J Exp Med. 1989;170(6):2081-95.

246. Moore KW, de Waal Malefyt R, Coffman RL, O'Garra A. Interleukin-10 and the interleukin-10 receptor. Annu Rev Immunol. 2001;19:683-765.

247. Cools N, Van Tendeloo VF, Smits EL, Lenjou M, Nijs G, Van Bockstaele DR, et al. Immunosuppression induced by immature dendritic cells is mediated by TGF-beta/IL-

170

10 double-positive CD4+ regulatory T cells. J Cell Mol Med. 2008;12(2):690-700.

248. Murray PJ. Understanding and exploiting the endogenous interleukin-10/STAT3- mediated anti-inflammatory response. Curr Opin Pharmacol. 2006;6(4):379-86.

249. Maloy KJ, Salaun L, Cahill R, Dougan G, Saunders NJ, Powrie F. CD4+CD25+ T(R) cells suppress innate immune pathology through cytokine-dependent mechanisms. J Exp Med. 2003;197(1):111-9.

250. Gazzinelli RT, Oswald IP, James SL, Sher A. IL-10 inhibits parasite killing and nitrogen oxide production by IFN-gamma-activated macrophages. J Immunol. 1992;148(6):1792-6.

251. Kaiser F, Cook D, Papoutsopoulou S, Rajsbaum R, Wu X, Yang HT, et al. TPL- 2 negatively regulates interferon-beta production in macrophages and myeloid dendritic cells. J Exp Med. 2009;206(9):1863-71.

252. Shaw TC, Thomas LH, Friedland JS. Regulation of IL-10 secretion after phagocytosis of Mycobacterium tuberculosis by human monocytic cells. Cytokine. 2000;12(5):483-6.

253. Rogers NC, Slack EC, Edwards AD, Nolte MA, Schulz O, Schweighoffer E, et al. Syk-dependent cytokine induction by Dectin-1 reveals a novel pattern recognition pathway for C type lectins. Immunity. 2005;22(4):507-17.

254. Dorhoi A, Desel C, Yeremeev V, Pradl L, Brinkmann V, Mollenkopf HJ, et al. The adaptor molecule CARD9 is essential for tuberculosis control. J Exp Med. 2010;207(4):777-92.

255. Stylianou E, Aukrust P, Kvale D, Muller F, Froland SS. IL-10 in HIV infection: increasing serum IL-10 levels with disease progression down-regulatory effect of potent anti-retroviral therapy. Clin Exp Immunol. 1999;116(1):115-20.

256. Redford PS, Murray PJ, O'Garra A. The role of IL-10 in immune regulation during M. tuberculosis infection. Mucosal Immunol. 2011;4(3):261-70.

257. Obonyo M, Sabet M, Cole SP, Ebmeyer J, Uematsu S, Akira S, et al. Deficiencies of myeloid differentiation factor 88, toll-like receptor 2 (TLR2), or TLR4 produce specific defects in macrophage cytokine secretion induced by Helicobacter pylori. Infect Immun. 2007;75(5):2408-14.

258. Day CL, Kaufmann DE, Kiepiela P, Brown JA, Moodley ES, Reddy S, et al. PD- 1 expression on HIV-specific T cells is associated with T-cell exhaustion and disease 171 progression. Nature. 2006;443(7109):350-4.

259. Kwon DS, Kaufmann DE. Protective and detrimental roles of IL-10 in HIV pathogenesis. Eur Cytokine Netw. 2010;21(3):208-14.

260. Silva RA, Appelberg R. Blocking the receptor for interleukin 10 protects mice from lethal listeriosis. Antimicrob Agents Chemother. 2001;45(4):1312-4.

261. Brooks DG, Lee AM, Elsaesser H, McGavern DB, Oldstone MB. IL-10 blockade facilitates DNA vaccine-induced T cell responses and enhances clearance of persistent virus infection. J Exp Med. 2008;205(3):533-41.

262. Belkaid Y, Hoffmann KF, Mendez S, Kamhawi S, Udey MC, Wynn TA, et al. The role of interleukin (IL)-10 in the persistence of Leishmania major in the skin after healing and the therapeutic potential of anti-IL-10 receptor antibody for sterile cure. J Exp Med. 2001;194(10):1497-506.

263. Murray HW, Lu CM, Mauze S, Freeman S, Moreira AL, Kaplan G, et al. Interleukin-10 (IL-10) in experimental visceral leishmaniasis and IL-10 receptor blockade as immunotherapy. Infect Immun. 2002;70(11):6284-93.

264. Kossodo S, Monso C, Juillard P, Velu T, Goldman M, Grau GE. Interleukin-10 modulates susceptibility in experimental cerebral malaria. Immunology. 1997;91(4):536- 40.

265. Lokken KL, Mooney JP, Butler BP, Xavier MN, Chau JY, Schaltenberg N, et al. Malaria parasite infection compromises control of concurrent systemic non-typhoidal Salmonella infection via IL-10-mediated alteration of myeloid cell function. PLoS Pathog. 2014;10(5):e1004049.

266. Wang SM, Lu IH, Lin YL, Lin YS, Wu JJ, Chuang WJ, et al. The severity of Streptococcus pyogenes infections in children is significantly associated with plasma levels of inflammatory cytokines. Diagn Microbiol Infect Dis. 2008;61(2):165-9.

267. Vats V, Agrawal T, Salhan S, Mittal A. Primary and secondary immune responses of mucosal and peripheral lymphocytes during Chlamydia trachomatis infection. FEMS Immunol Med Microbiol. 2007;49(2):280-7.

268. Mamata Y, Hakki A, Newton C, Burdash N, Klein TW, Friedman H. Differential effects of Chlamydia pneumoniae infection on cytokine levels in human T lymphocyte- and monocyte-derived cell cultures. Int J Med Microbiol. 2007;297(2):109-15.

269. Cunningham AF, Khan M, Ball J, Toellner KM, Serre K, Mohr E, et al. Responses 172 to the soluble flagellar protein FliC are Th2, while those to FliC on Salmonella are Th1. Eur J Immunol. 2004;34(11):2986-95.

270. Honko AN, Mizel SB. Effects of flagellin on innate and adaptive immunity. Immunol Res. 2005;33(1):83-101.

271. Munoz N, Van Maele L, Marques JM, Rial A, Sirard JC, Chabalgoity JA. Mucosal administration of flagellin protects mice from Streptococcus pneumoniae lung infection. Infect Immun. 2010;78(10):4226-33.

272. Yu FS, Cornicelli MD, Kovach MA, Newstead MW, Zeng X, Kumar A, et al. Flagellin stimulates protective lung mucosal immunity: role of cathelicidin-related antimicrobial peptide. J Immunol. 2010;185(2):1142-9.

273. Yeoh BS, Gewirtz AT, Vijay-Kumar M. Adaptive immunity induces tolerance to flagellin by attenuating TLR5 and NLRC4-mediated innate immune responses. Front Cell Infect Microbiol. 2019;9:29.

274. Jarchum I, Liu M, Lipuma L, Pamer EG. Toll-like receptor 5 stimulation protects mice from acute Clostridium difficile colitis. Infect Immun. 2011;79(4):1498-503.

275. Ali ASM, Mowbray C, Lanz M, Stanton A, Bowen S, Varley CL, et al. Targeting deficiencies in the TLR5 mediated vaginal response to treat female recurrent urinary tract infection. Sci Rep. 2017;7(1):11039.

276. Scavone P, Umpierrez A, Rial A, Chabalgoity JA, Zunino P. Native flagellin does not protect mice against an experimental Proteus mirabilis ascending urinary tract infection and neutralizes the protective effect of MrpA fimbrial protein. Antonie van Leeuwenhoek. 2014;105(6):1139-48.

277. Janot L, Sirard JC, Secher T, Noulin N, Fick L, Akira S, et al. Radioresistant cells expressing TLR5 control the respiratory epithelium's innate immune responses to flagellin. Eur J Immunol. 2009;39(6):1587-96.

278. Tarahomjoo S. Utilizing bacterial flagellins against infectious diseases and cancers. Antonie van Leeuwenhoek. 2014;105(2):275-88.

279. Moser M, Murphy KM. Dendritic cell regulation of TH1-TH2 development. Nat Immunol. 2000;1(3):199-205.

280. Trinchieri G. Interleukin-12 and the regulation of innate resistance and adaptive immunity. Nat Rev Immunol. 2003;3(2):133-46.

173

281. Lee SE, Kim SY, Jeong BC, Kim YR, Bae SJ, Ahn OS, et al. A bacterial flagellin, Vibrio vulnificus FlaB, has a strong mucosal adjuvant activity to induce protective immunity. Infect Immun. 2006;74(1):694-702.

282. Aujla SJ, Chan YR, Zheng M, Fei M, Askew DJ, Pociask DA, et al. IL-22 mediates mucosal host defense against gram-negative bacterial pneumonia. Nat Med. 2008;14(3):275-81.

283. Zheng Y, Valdez PA, Danilenko DM, Hu Y, Sa SM, Gong Q, et al. Interleukin- 22 mediates early host defense against attaching and effacing bacterial pathogens. Nat Med. 2008;14(3):282-9.

284. Conti HR, Shen F, Nayyar N, Stocum E, Sun JN, Lindemann MJ, et al. Th17 cells and IL-17 receptor signaling are essential for mucosal host defense against oral candidiasis. J Exp Med. 2009;206(2):299-311.

285. Korn T, Bettelli E, Oukka M, Kuchroo VK. IL-17 and Th17 Cells. Annu Rev Immunol. 2009;27:485-517.

286. Zhang B, Chassaing B, Shi Z, Uchiyama R, Zhang Z, Denning TL, et al. Viral infection. Prevention and cure of rotavirus infection via TLR5/NLRC4-mediated production of IL-22 and IL-18. Science. 2014;346(6211):861-5.

287. Liu G, Tarbet B, Song L, Reiserova L, Weaver B, Chen Y, et al. Immunogenicity and efficacy of flagellin-fused vaccine candidates targeting 2009 pandemic H1N1 influenza in mice. PLoS ONE. 2011;6(6):e20928.

288. Taylor DN, Treanor JJ, Strout C, Johnson C, Fitzgerald T, Kavita U, et al. Induction of a potent immune response in the elderly using the TLR-5 agonist, flagellin, with a recombinant hemagglutinin influenza-flagellin fusion vaccine (VAX125, STF2.HA1 SI). Vaccine. 2011;29(31):4897-902.

289. Burdelya LG, Brackett CM, Kojouharov B, Gitlin, II, Leonova KI, Gleiberman AS, et al. Central role of liver in anticancer and radioprotective activities of Toll-like receptor 5 agonist. Proc Natl Acad Sci U S A. 2013;110(20):E1857-66.

290. Martinez RJ. A method for the purification of bacterial flagella by ion exchange chromatography. J Gen Microbiol. 1963;33:115-20.

291. DePamphilis ML, Adler J. Purification of intact flagella from Escherichia coli and Bacillus subtilis. J Bacteriol. 1971;105(1):376-83.

292. Ibrahim GF, Fleet GH, Lyons MJ, Walker RA. Method for the isolation of highly 174 purified Salmonella flagellins. J Clin Microbiol. 1985;22(6):1040-4.

293. Kalmokoff ML, Jarrell KF, Koval SF. Isolation of flagella from the archaebacterium Methanococcus voltae by phase separation with Triton X-114. J Bacteriol. 1988;170(4):1752-8.

294. Delmee M, Avesani V, Delferriere N, Burtonboy G. Characterization of flagella of Clostridium difficile and their role in serogrouping reactions. J Clin Microbiol. 1990;28(10):2210-4.

295. Braga CJ, Massis LM, Alencar BC, Rodrigues MM, Sbrogio-Almeida ME, Ferreira LC. Cytotoxic T cell adjuvant effects of three Salmonella enterica flagellins. Braz J Microbiol. 2008;39(1):44-9.

296. Merino S, Wilhelms M, Tomas JM. Role of Aeromonas hydrophila flagella glycosylation in adhesion to Hep-2 cells, biofilm formation and immune stimulation. Int J Mol Sci. 2014;15(12):21935-46.

297. Acharya D, Sullivan MJ, Duell BL, Eveno T, Schembri MA, Ulett GC. Physical extraction and fast protein liquid chromatography for purifying flagella filament from uropathogenic Escherichia coli for immune assay. Front Cell Infect Microbiol. 2019;9:118.

298. Craige B, Brown JM, Witman GB. Isolation of Chlamydomonas flagella. Current Protocols in Cell Biology. 2013;Chapter 3:Unit 3 41 1-9.

299. Aizawa SI, Dean GE, Jones CJ, Macnab RM, Yamaguchi S. Purification and characterization of the flagellar hook-basal body complex of Salmonella typhimurium. J Bacteriol. 1985;161(3):836-49.

300. Kubori T, Okumura M, Kobayashi N, Nakamura D, Iwakura M, Aizawa SI. Purification and characterization of the flagellar hook-basal body complex of Bacillus subtilis. Mol Microbiol. 1997;24(2):399-410.

301. Gerhardt P. Methods for general and molecular bacteriology. Rev. ed. ed. Washington, D.C.: American Society for Microbiology; 1994 1994.

302. Ahmad I, Wigren E, Le Guyon S, Vekkeli S, Blanka A, El Mouali Y, et al. The EAL-like protein STM1697 regulates virulence phenotypes, motility and biofilm formation in Salmonella Typhimurium. Mol Microbiol. 2013;90(6):1216-32.

303. Sweadner KJ, Forte M, Nelsen LL. Filtration removal of endotoxin (pyrogens) in solution in different states of aggregation. Appl Environ Microbiol. 1977;34(4):382-5. 175

304. Morrison DC, Betz SJ, Jacobs DM. Isolation of a lipid A bound polypeptide responsible for "LPS-initiated" mitogenesis of C3H/HeJ spleen cells. J Exp Med. 1976;144(3):840-6.

305. Liu S, Tobias R, McClure S, Styba G, Shi Q, Jackowski G. Removal of endotoxin from recombinant protein preparations. Clin Biochem. 1997;30(6):455-63.

306. Issekutz AC. Removal of gram-negative endotoxin from solutions by affinity chromatography. J Immunol Methods. 1983;61(3):275-81.

307. Petsch D, Anspach FB. Endotoxin removal from protein solutions. J Biotechnol. 2000;76(2-3):97-119.

308. Simonsen KA, Anderson-Berry AL, Delair SF, Davies HD. Early-onset neonatal sepsis. Clin Microbiol Rev. 2014;27(1):21-47.

309. McNeilly TN, Mitchell MC, Nisbet AJ, McAteer S, Erridge C, Inglis NF, et al. IgA and IgG antibody responses following systemic immunization of cattle with native H7 flagellin differ in epitope recognition and capacity to neutralise TLR5 signalling. Vaccine. 2010;28(5):1412-21.

310. Pallen MJ, Matzke NJ. From The Origin of Species to the origin of bacterial flagella. Nat Rev Microbiol. 2006;4(10):784-90.

311. Simon R, Curtis B, Deumic V, Nicki J, Tennant SM, Pasetti MF, et al. A scalable method for biochemical purification of Salmonella flagellin. Protein Expr Purif. 2014;102:1-7.

312. Sourjik V, Wingreen NS. Responding to chemical gradients: bacterial chemotaxis. Curr Opin Cell Biol. 2012;24(2):262-8.

313. Samatey FA, Imada K, Nagashima S, Vonderviszt F, Kumasaka T, Yamamoto M, et al. Structure of the bacterial flagellar protofilament and implications for a switch for supercoiling. Nature. 2001;410(6826):331-7.

314. Orskov F, Orskov I. Escherichia coli serotyping and disease in man and animals. Can J Microbiol. 1992;38(7):699-704.

315. Green CP, Thomas VL. Hemagglutination of human type O erythrocytes, hemolysin production, and serogrouping of Escherichia coli isolates from patients with acute pyelonephritis, cystitis, and asymptomatic bacteriuria. Infect Immun. 1981;31(1):309-15.

176

316. Herrmann B, Burman LG. Pathogenesis of Escherichia coli cystitis and pyelonephritis: apparent lack of significance of bacterial motility and chemotaxis towards human urine. Infection. 1985;13(1):4-7.

317. Cullender TC, Chassaing B, Janzon A, Kumar K, Muller CE, Werner JJ, et al. Innate and adaptive immunity interact to quench microbiome flagellar motility in the gut. Cell Host Microbe. 2013;14(5):571-81.

318. Gorbet MB, Sefton MV. Endotoxin: the uninvited guest. Biomaterials. 2005;26(34):6811-7.

319. Schwarz H, Schmittner M, Duschl A, Horejs-Hoeck J. Residual endotoxin contaminations in recombinant proteins are sufficient to activate human CD1c+ dendritic cells. PLoS ONE. 2014;9(12):e113840.

320. Wurpel DJ, Totsika M, Allsopp LP, Hartley-Tassell LE, Day CJ, Peters KM, et al. F9 fimbriae of uropathogenic Escherichia coli are expressed at low temperature and recognise Galbeta1-3GlcNAc-containing glycans. PLoS ONE. 2014;9(3):e93177.

321. Givskov M, Eberl L, Christiansen G, Benedik MJ, Molin S. Induction of phospholipase- and flagellar synthesis in Serratia liquefaciens is controlled by expression of the flagellar master operon flhD. Mol Microbiol. 1995;15(3):445-54.

322. Datsenko KA, Wanner BL. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A. 2000;97(12):6640- 5.

323. Potter H. Transfection by electroporation. Curr Protoc Mol Biol. 2003;Chapter 9:Unit 9.3.

324. Metcalfe HJ, Best A, Kanellos T, La Ragione RM, Werling D. Flagellin expression enhances Salmonella accumulation in TLR5-positive macrophages. Dev Comp Immunol. 2010;34(8):797-804.

325. Schulke S, Waibler Z, Mende MS, Zoccatelli G, Vieths S, Toda M, et al. Fusion protein of TLR5-ligand and allergen potentiates activation and IL-10 secretion in murine myeloid DC. Mol Immunol. 2010;48(1-3):341-50.

326. Yoon SS, Mekalanos JJ. Decreased potency of the Vibrio cholerae sheathed flagellum to trigger host innate immunity. Infect Immun. 2008;76(3):1282-8.

327. Gomez-Gomez L, Boller T. FLS2: an LRR receptor-like kinase involved in the perception of the bacterial elicitor flagellin in Arabidopsis. Mol Cell. 2000;5(6):1003-11. 177

328. Heckman KL, Pease LR. Gene splicing and mutagenesis by PCR-driven overlap extension. Nat Protoc. 2007;2(4):924-32.

329. Sulavik MC, Houseweart C, Cramer C, Jiwani N, Murgolo N, Greene J, et al. Antibiotic susceptibility profiles of Escherichia coli strains lacking multidrug efflux pump genes. Antimicrob Agents Chemother. 2001;45(4):1126-36.

330. Chang KC, Cheng SJ, Chen YC, Huang HR, Liou JW. Nanoscopic analysis on pH induced morphological changes of flagella in Escherichia coli. Journal of Microbiology, Immunology and Infection. 2013;46(6):405-12.

331. Parish CR. Immune response to chemically modified flagellin. I. Induction of antibody tolerance to flagellin by acetoacetylated derivatives of the protein. J Exp Med. 1971;134(1):1-20.

332. Parish CR. Immune response to chemically modified flagellin. II. Evidence for a fundamental relationship between humoral and cell-mediated immunity. J Exp Med. 1971;134(1):21-47.

333. Venning MM. The effect of chemical modification of flagellin on its subsequent immunogenicity. Immunochemistry. 1975;12(5):365-72.

334. Su W, Ding X. Methods of Endotoxin Detection. J Lab Autom. 2015;20(4):354- 64.

335. Pyles B, Bailus BJ, O'Geen H, Segal DJ. Purified protein delivery to activate an epigenetically silenced allele in mouse brain. Methods Mol Biol. 2018;1767:227-39.

336. Wong J, Davies N, Jeraj H, Vilar E, Viljoen A, Farrington K. A comparative study of blood endotoxin detection in haemodialysis patients. J Inflamm (Lond). 2016;13:24.

337. Matsuura Y, Takehira M, Joti Y, Ogasahara K, Tanaka T, Ono N, et al. Thermodynamics of protein denaturation at temperatures over 100 degrees C: CutA1 mutant proteins substituted with hydrophobic and charged residues. Scientific Reports. 2015;5:15545.

338. Kajikawa A, Midorikawa E, Masuda K, Kondo K, Irisawa T, Igimi S, et al. Characterization of flagellins isolated from a highly motile strain of Lactobacillus agilis. BMC Microbiol. 2016;16:49.

339. Asakura S. Polymerization of flagellin and polymorphism of flagella. Adv Biophys. 1970;1:99-155.

178

340. Fink AL, Calciano LJ, Goto Y, Kurotsu T, Palleros DR. Classification of acid denaturation of proteins: intermediates and unfolded states. Biochemistry (Mosc). 1994;33(41):12504-11.

341. Eom JS, Seok Kim J, Im Jang J, Kim BH, Young Yoo S, Hyeon Choi J, et al. Enhancement of host immune responses by oral vaccination to Salmonella enterica serovar Typhimurium harboring both FliC and FljB flagella. PLoS ONE. 2013;8(9):e74850.

342. Horstmann JA, Zschieschang E, Truschel T, de Diego J, Lunelli M, Rohde M, et al. Flagellin phase-dependent swimming on epithelial cell surfaces contributes to productive Salmonella gut colonisation. Cell Microbiol. 2017;19(8).

343. Madureira P, Baptista M, Vieira M, Magalhaes V, Camelo A, Oliveira L, et al. Streptococcus agalactiae GAPDH is a virulence-associated immunomodulatory protein. J Immunol. 2007;178(3):1379-87.

344. Sullivan MJ, Leclercq SY, Ipe DS, Carey AJ, Smith JP, Voller N, et al. Effect of the Streptococcus agalactiae virulence regulator CovR on the pathogenesis of urinary tract infection. J Infect Dis. 2017;215(3):475-83.

345. Lu Y, Swartz JR. Functional properties of flagellin as a stimulator of innate immunity. Sci Rep. 2016;6:18379.

346. Nagamatsu K, Kuwae A, Konaka T, Nagai S, Yoshida S, Eguchi M, et al. Bordetella evades the host immune system by inducing IL-10 through a type III effector, BopN. J Exp Med. 2009;206(13):3073-88.

347. Goswami R, Kaplan MH. A brief history of IL-9. J Immunol. 2011;186(6):3283- 8.

348. Temann UA, Ray P, Flavell RA. Pulmonary overexpression of IL-9 induces Th2 cytokine expression, leading to immune pathology. J Clin Invest. 2002;109(1):29-39.

349. Vink A, Warnier G, Brombacher F, Renauld JC. Interleukin 9-induced in vivo expansion of the B-1 lymphocyte population. J Exp Med. 1999;189(9):1413-23.

350. Williams DE, Morrissey PJ, Mochizuki DY, de Vries P, Anderson D, Cosman D, et al. T-cell growth factor P40 promotes the proliferation of myeloid cell lines and enhances erythroid burst formation by normal murine bone marrow cells in vitro. Blood. 1990;76(5):906-11.

351. Temann UA, Geba GP, Rankin JA, Flavell RA. Expression of interleukin 9 in the 179 lungs of transgenic mice causes airway inflammation, mast cell hyperplasia, and bronchial hyperresponsiveness. J Exp Med. 1998;188(7):1307-20.

352. Faulkner H, Humphreys N, Renauld JC, Van Snick J, Grencis R. Interleukin-9 is involved in host protective immunity to intestinal nematode infection. Eur J Immunol. 1997;27(10):2536-40.

353. Grohmann U, Van Snick J, Campanile F, Silla S, Giampietri A, Vacca C, et al. IL-9 protects mice from gram-negative bacterial shock: suppression of TNF-alpha, IL- 12, and IFN-gamma, and induction of IL-10. J Immunol. 2000;164(8):4197-203.

354. Dougan M, Dranoff G, Dougan SK. GM-CSF, IL-3, and IL-5 family of cytokines: regulators of inflammation. Immunity. 2019;50(4):796-811.

355. Martinez-Moczygemba M, Huston DP. Biology of common beta receptor- signaling cytokines: IL-3, IL-5, and GM-CSF. J Allergy Clin Immunol. 2003;112(4):653- 65; quiz 66.

356. Hoskins A, Roberts JL, 2nd, Milne G, Choi L, Dworski R. Natural-source d-alpha- tocopheryl acetate inhibits oxidant stress and modulates atopic asthma in humans in vivo. Allergy. 2012;67(5):676-82.

357. Salter BM, Oliveria JP, Nusca G, Smith SG, Watson RM, Comeau M, et al. Thymic stromal lymphopoietin activation of basophils in patients with allergic asthma is IL-3 dependent. J Allergy Clin Immunol. 2015;136(6):1636-44.

358. Siracusa MC, Saenz SA, Hill DA, Kim BS, Headley MB, Doering TA, et al. TSLP promotes interleukin-3-independent basophil haematopoiesis and type 2 inflammation. Nature. 2011;477(7363):229-33.

359. Salazar-Gonzalez RM, McSorley SJ. Salmonella flagellin, a microbial target of the innate and adaptive immune system. Immunol Lett. 2005;101(2):117-22.

360. Chettri JK, Raida MK, Holten-Andersen L, Kania PW, Buchmann K. PAMP induced expression of immune relevant genes in head kidney leukocytes of rainbow trout (Oncorhynchus mykiss). Dev Comp Immunol. 2011;35(4):476-82.

361. Cruz-Cordova A, Rocha-Ramirez LM, Ochoa SA, Gonzalez-Pedrajo B, Espinosa N, Eslava C, et al. Flagella from five Cronobacter species induce pro-inflammatory cytokines in macrophage derivatives from human monocytes. PLoS ONE. 2012;7(12):e52091.

362. Gal-Mor O, Suez J, Elhadad D, Porwollik S, Leshem E, Valinsky L, et al. 180

Molecular and cellular characterization of a Salmonella enterica serovar Paratyphi A outbreak strain and the human immune response to infection. Clin Vaccine Immunol. 2012;19(2):146-56.

363. Lacave-Lapalun JV, Benderitter M, Linard C. Flagellin or lipopolysaccharide treatment modified macrophage populations after colorectal radiation of rats. J Pharmacol Exp Ther. 2013;346(1):75-85.

364. Vicente-Suarez I, Takahashi Y, Cheng F, Horna P, Wang HW, Wang HG, et al. Identification of a novel negative role of flagellin in regulating IL-10 production. Eur J Immunol. 2007;37(11):3164-75.

365. Yang X, Murani E, Ponsuksili S, Wimmers K. Association of TLR5 sequence variants and mRNA level with cytokine transcription in pigs. Immunogenetics. 2013;65(2):125-32.

366. Zgair AK. Flagellin administration protects respiratory tract from Burkholderia cepacia infection. J Microbiol Biotechnol. 2012;22(7):907-16.

367. Simpson D, Crosby RM, Skopek TR. A method for specific cloning and sequencing of human hprt cDNA for mutation analysis. Biochem Biophys Res Commun. 1988;151(1):487-92.

368. Wagner EM. Monitoring gene expression: quantitative real-time rt-PCR. Methods Mol Biol. 2013;1027:19-45.

369. Harrington CA, Rosenow C, Retief J. Monitoring gene expression using DNA microarrays. Curr Opin Microbiol. 2000;3(3):285-91.

370. Cho JC, Tiedje JM. Quantitative detection of microbial genes by using DNA microarrays. Appl Environ Microbiol. 2002;68(3):1425-30.

371. Shendure J, Ji H. Next-generation DNA sequencing. Nat Biotechnol. 2008;26(10):1135-45.

372. Ramskold D, Kavak E, Sandberg R. How to analyze gene expression using RNA- sequencing data. Methods Mol Biol. 2012;802:259-74.

373. Camejo A, Buchrieser C, Couve E, Carvalho F, Reis O, Ferreira P, et al. In vivo transcriptional profiling of Listeria monocytogenes and mutagenesis identify new virulence factors involved in infection. PLoS Pathog. 2009;5(5):e1000449.

374. Haugen BJ, Pellett S, Redford P, Hamilton HL, Roesch PL, Welch RA. In vivo

181 gene expression analysis identifies genes required for enhanced colonization of the mouse urinary tract by uropathogenic Escherichia coli strain CFT073 dsdA. Infect Immun. 2007;75(1):278-89.

375. Stintzi A, Marlow D, Palyada K, Naikare H, Panciera R, Whitworth L, et al. Use of genome-wide expression profiling and mutagenesis to study the intestinal lifestyle of Campylobacter jejuni. Infect Immun. 2005;73(3):1797-810.

376. Nielsen AT, Dolganov NA, Otto G, Miller MC, Wu CY, Schoolnik GK. RpoS controls the Vibrio cholerae mucosal escape response. PLoS Pathog. 2006;2(10):e109.

377. Hagan EC, Lloyd AL, Rasko DA, Faerber GJ, Mobley HL. Escherichia coli global gene expression in urine from women with urinary tract infection. PLoS Pathog. 2010;6(11):e1001187.

378. Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics. 2013;29(1):15-21.

379. Anders S, Pyl PT, Huber W. HTSeq--a Python framework to work with high- throughput sequencing data. Bioinformatics. 2015;31(2):166-9.

380. Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15(12):550.

381. Breuer K, Foroushani AK, Laird MR, Chen C, Sribnaia A, Lo R, et al. InnateDB: systems biology of innate immunity and beyond recent updates and continuing curation. Nucleic Acids Res. 2013;41(Database issue):D1228-33.

382. Hauser C, Saurat JH, Schmitt A, Jaunin F, Dayer JM. Interleukin 1 is present in normal human epidermis. J Immunol. 1986;136(9):3317-23.

383. March CJ, Mosley B, Larsen A, Cerretti DP, Braedt G, Price V, et al. Cloning, sequence and expression of two distinct human interleukin-1 complementary DNAs. Nature. 1985;315(6021):641-7.

384. Zola H, Flego L, Wong YT, Macardle PJ, Kenney JS. Direct demonstration of membrane IL-1 alpha on the surface of circulating B lymphocytes and monocytes. J Immunol. 1993;150(5):1755-62.

385. Dinarello CA. Biologic basis for interleukin-1 in disease. Blood. 1996;87(6):2095-147.

386. Lopez-Castejon G, Brough D. Understanding the mechanism of IL-1beta

182 secretion. Cytokine Growth Factor Rev. 2011;22(4):189-95.

387. Dinarello CA. Immunological and inflammatory functions of the interleukin-1 family. Annu Rev Immunol. 2009;27:519-50.

388. Liao W, Lin JX, Leonard WJ. IL-2 family cytokines: new insights into the complex roles of IL-2 as a broad regulator of T helper cell differentiation. Curr Opin Immunol. 2011;23(5):598-604.

389. Owen DL, Mahmud SA, Vang KB, Kelly RM, Blazar BR, Smith KA, et al. Identification of cellular sources of IL-2 needed for regulatory T Cell development and homeostasis. J Immunol. 2018;200(12):3926-33.

390. Mangi MH, Newland AC. Interleukin-3 in hematology and oncology: current state of knowledge and future directions. Cytokines Cell Mol Ther. 1999;5(2):87-95.

391. Nelms K, Keegan AD, Zamorano J, Ryan JJ, Paul WE. The IL-4 receptor: signaling mechanisms and biologic functions. Annu Rev Immunol. 1999;17:701-38.

392. Luzina IG, Keegan AD, Heller NM, Rook GA, Shea-Donohue T, Atamas SP. Regulation of inflammation by interleukin-4: a review of "alternatives". J Leukoc Biol. 2012;92(4):753-64.

393. Clutterbuck EJ, Hirst EM, Sanderson CJ. Human interleukin-5 (IL-5) regulates the production of eosinophils in human bone marrow cultures: comparison and interaction with IL-1, IL-3, IL-6, and GMCSF. Blood. 1989;73(6):1504-12.

394. Desreumaux P, Janin A, Colombel JF, Prin L, Plumas J, Emilie D, et al. Interleukin 5 messenger RNA expression by eosinophils in the intestinal mucosa of patients with coeliac disease. J Exp Med. 1992;175(1):293-6.

395. Tanaka T, Narazaki M, Kishimoto T. IL-6 in inflammation, immunity, and disease. Cold Spring Harb Perspect Biol. 2014;6(10):a016295.

396. Diehl S, Rincon M. The two faces of IL-6 on Th1/Th2 differentiation. Mol Immunol. 2002;39(9):531-6.

397. Rojas-Zuleta WG, Sanchez E. IL-9: Function, sources, and detection. Methods Mol Biol. 2017;1585:21-35.

398. Cooper AM, Khader SA. IL-12p40: an inherently agonistic cytokine. Trends Immunol. 2007;28(1):33-8.

399. Verma ND, Hall BM, Plain KM, Robinson CM, Boyd R, Tran GT, et al.

183

Interleukin-12 (IL-12p70) promotes induction of highly potent Th1-like CD4(+)CD25(+) T regulatory cells that inhibit allograft rejection in unmodified recipients. Front Immunol. 2014;5:190.

400. Rael EL, Lockey RF. Interleukin-13 signaling and its role in asthma. World Allergy Organ J. 2011;4(3):54-64.

401. Miossec P, Korn T, Kuchroo VK. Interleukin-17 and type 17 helper T cells. N Engl J Med. 2009;361(9):888-98.

402. Van Coillie E, Van Damme J, Opdenakker G. The MCP/eotaxin subfamily of CC chemokines. Cytokine Growth Factor Rev. 1999;10(1):61-86.

403. Pease JE, Williams TJ. Eotaxin and asthma. Curr Opin Pharmacol. 2001;1(3):248- 53.

404. Deotare U, Al-Dawsari G, Couban S, Lipton JH. G-CSF-primed bone marrow as a source of stem cells for allografting: revisiting the concept. Bone Marrow Transplant. 2015;50(9):1150-6.

405. Tay J, Levesque JP, Winkler IG. Cellular players of hematopoietic stem cell mobilization in the bone marrow niche. Int J Hematol. 2017;105(2):129-40.

406. Root RK, Dale DC. Granulocyte colony-stimulating factor and granulocyte- macrophage colony-stimulating factor: comparisons and potential for use in the treatment of infections in nonneutropenic patients. J Infect Dis. 1999;179 Suppl 2:S342-52.

407. Schroder K, Hertzog PJ, Ravasi T, Hume DA. Interferon-gamma: an overview of signals, mechanisms and functions. J Leukoc Biol. 2004;75(2):163-89.

408. Iida N, Grotendorst GR. Cloning and sequencing of a new gro transcript from activated human monocytes: expression in leukocytes and wound tissue. Mol Cell Biol. 1990;10(10):5596-9.

409. Moser B, Clark-Lewis I, Zwahlen R, Baggiolini M. Neutrophil-activating properties of the melanoma growth-stimulatory activity. J Exp Med. 1990;171(5):1797- 802.

410. Carr MW, Roth SJ, Luther E, Rose SS, Springer TA. Monocyte chemoattractant protein 1 acts as a T-lymphocyte chemoattractant. Proc Natl Acad Sci U S A. 1994;91(9):3652-6.

411. Xu LL, Warren MK, Rose WL, Gong W, Wang JM. Human recombinant

184 monocyte chemotactic protein and other C-C chemokines bind and induce directional migration of dendritic cells in vitro. J Leukoc Biol. 1996;60(3):365-71.

412. Bystry RS, Aluvihare V, Welch KA, Kallikourdis M, Betz AG. B cells and professional APCs recruit regulatory T cells via CCL4. Nat Immunol. 2001;2(12):1126- 32.

413. Cheng NL, Chen X, Kim J, Shi AH, Nguyen C, Wersto R, et al. MicroRNA-125b modulates inflammatory chemokine CCL4 expression in immune cells and its reduction causes CCL4 increase with age. Aging Cell. 2015;14(2):200-8.

414. Song A, Nikolcheva T, Krensky AM. Transcriptional regulation of RANTES expression in T lymphocytes. Immunol Rev. 2000;177:236-45.

415. Schall TJ, Jongstra J, Dyer BJ, Jorgensen J, Clayberger C, Davis MM, et al. A human T cell-specific molecule is a member of a new gene family. J Immunol. 1988;141(3):1018-25.

416. Olszewski MB, Groot AJ, Dastych J, Knol EF. TNF trafficking to human mast cell granules: mature chain-dependent endocytosis. J Immunol. 2007;178(9):5701-9.

417. Vicente-Suarez I, Takahashi Y, Cheng F, Horna P, Wang HW, Wang HG, et al. Identification of a novel negative role of flagellin in regulating IL-10 production. Eur J Immunol. 2007;37(11):3164-75.

418. Yen D, Cheung J, Scheerens H, Poulet F, McClanahan T, McKenzie B, et al. IL- 23 is essential for T cell-mediated colitis and promotes inflammation via IL-17 and IL-6. J Clin Invest. 2006;116(5):1310-6.

419. Garcia M, Morello E, Garnier J, Barrault C, Garnier M, Burucoa C, et al. Pseudomonas aeruginosa flagellum is critical for invasion, cutaneous persistence and induction of inflammatory response of skin epidermis. Virulence. 2018;9(1):1163-75.

420. Chang SH, Reynolds JM, Pappu BP, Chen G, Martinez GJ, Dong C. Interleukin- 17C promotes Th17 cell responses and autoimmune disease via interleukin-17 receptor E. Immunity. 2011;35(4):611-21.

421. Jin W, Dong C. IL-17 cytokines in immunity and inflammation. Emerg Microbes Infect. 2013;2(9):e60.

422. de Waal Malefyt R, Abrams J, Bennett B, Figdor CG, de Vries JE. Interleukin 10(IL-10) inhibits cytokine synthesis by human monocytes: an autoregulatory role of IL- 10 produced by monocytes. J Exp Med. 1991;174(5):1209-20. 185

423. Murphy TL, Cleveland MG, Kulesza P, Magram J, Murphy KM. Regulation of interleukin 12 p40 expression through an NF-kappa B half-site. Mol Cell Biol. 1995;15(10):5258-67.

424. Liang SC, Tan XY, Luxenberg DP, Karim R, Dunussi-Joannopoulos K, Collins M, et al. Interleukin (IL)-22 and IL-17 are coexpressed by Th17 cells and cooperatively enhance expression of antimicrobial peptides. J Exp Med. 2006;203(10):2271-9.

425. Bekisz J, Schmeisser H, Hernandez J, Goldman ND, Zoon KC. Human interferons alpha, beta and omega. Growth Factors. 2004;22(4):243-51.

426. Cash HL, Whitham CV, Behrendt CL, Hooper LV. Symbiotic bacteria direct expression of an intestinal bactericidal lectin. Science. 2006;313(5790):1126-30.

427. van Ampting MT, Loonen LM, Schonewille AJ, Konings I, Vink C, Iovanna J, et al. Intestinally secreted C-type lectin Reg3b attenuates salmonellosis but not listeriosis in mice. Infect Immun. 2012;80(3):1115-20.

428. Dessein R, Gironella M, Vignal C, Peyrin-Biroulet L, Sokol H, Secher T, et al. Toll-like receptor 2 is critical for induction of Reg3 beta expression and intestinal clearance of Yersinia pseudotuberculosis. Gut. 2009;58(6):771-6.

429. Abtin A, Eckhart L, Glaser R, Gmeiner R, Mildner M, Tschachler E. The antimicrobial heterodimer S100A8/S100A9 (calprotectin) is upregulated by bacterial flagellin in human epidermal keratinocytes. J Invest Dermatol. 2010;130(10):2423-30.

430. Ryckman C, Vandal K, Rouleau P, Talbot M, Tessier PA. Proinflammatory activities of S100: proteins S100A8, S100A9, and S100A8/A9 induce neutrophil chemotaxis and adhesion. J Immunol. 2003;170(6):3233-42.

431. Flo TH, Smith KD, Sato S, Rodriguez DJ, Holmes MA, Strong RK, et al. Lipocalin 2 mediates an innate immune response to bacterial infection by sequestrating iron. Nature. 2004;432(7019):917-21.

432. Rossi E. Hepcidin--the iron regulatory hormone. Clin Biochem Rev. 2005;26(3):47-9.

433. Lynn DJ, Winsor GL, Chan C, Richard N, Laird MR, Barsky A, et al. InnateDB: facilitating systems-level analyses of the mammalian innate immune response. Mol Syst Biol. 2008;4:218.

434. Andersen-Nissen E, Smith KD, Strobe KL, Barrett SL, Cookson BT, Logan SM, et al. Evasion of Toll-like receptor 5 by flagellated bacteria. Proc Natl Acad Sci U S A. 186

2005;102(26):9247-52.

435. Braga CJ, Rittner GM, Munoz Henao JE, Teixeira AF, Massis LM, Sbrogio- Almeida ME, et al. Paracoccidioides brasiliensis vaccine formulations based on the gp43-derived P10 sequence and the Salmonella enterica FliC flagellin. Infect Immun. 2009;77(4):1700-7.

436. Morris AE, Liggitt HD, Hawn TR, Skerrett SJ. Role of Toll-like receptor 5 in the innate immune response to acute P. aeruginosa pneumonia. Am J Physiol Lung Cell Mol Physiol. 2009;297(6):L1112-9.

437. Akira S, Uematsu S, Takeuchi O. Pathogen recognition and innate immunity. Cell. 2006;124(4):783-801.

438. Hawn TR, Verbon A, Lettinga KD, Zhao LP, Li SS, Laws RJ, et al. A common dominant TLR5 stop codon polymorphism abolishes flagellin signaling and is associated with susceptibility to legionnaires' disease. J Exp Med. 2003;198(10):1563-72.

439. Schulke S, Wolfheimer S, Gadermaier G, Wangorsch A, Siebeneicher S, Briza P, et al. Prevention of intestinal allergy in mice by rflaA:Ova is associated with enforced antigen processing and TLR5-dependent IL-10 secretion by mDC. PLoS ONE. 2014;9(2):e87822.

440. Nambiar JK, Ryan AA, Kong CU, Britton WJ, Triccas JA. Modulation of pulmonary DC function by vaccine-encoded GM-CSF enhances protective immunity against Mycobacterium tuberculosis infection. Eur J Immunol. 2010;40(1):153-61.

441. Yamamoto Y, Klein TW, Friedman H. Induction of cytokine granulocyte- macrophage colony-stimulating factor and chemokine macrophage inflammatory protein 2 mRNAs in macrophages by Legionella pneumophila or Salmonella typhimurium attachment requires different ligand-receptor systems. Infect Immun. 1996;64(8):3062-8.

442. Achuthan A, Cook AD, Lee MC, Saleh R, Khiew HW, Chang MW, et al. Granulocyte macrophage colony-stimulating factor induces CCL17 production via IRF4 to mediate inflammation. J Clin Invest. 2016;126(9):3453-66.

443. Vanlaere I, Libert C. Matrix metalloproteinases as drug targets in infections caused by gram-negative bacteria and in septic shock. Clin Microbiol Rev. 2009;22(2):224-39.

444. Woessner JF, Jr., Taplin CJ. Purification and properties of a small latent matrix metalloproteinase of the rat uterus. J Biol Chem. 1988;263(32):16918-25. 187

445. Parks WC, Wilson CL, Lopez-Boado YS. Matrix metalloproteinases as modulators of inflammation and innate immunity. Nat Rev Immunol. 2004;4(8):617-29.

446. Gill SE, Nadler ST, Li Q, Frevert CW, Park PW, Chen P, et al. Shedding of syndecan-1/CXCL1 complexes by matrix metalloproteinase 7 functions as an epithelial checkpoint of neutrophil activation. Am J Respir Cell Mol Biol. 2016;55(2):243-51.

447. Ali MF, Dasari H, Van Keulen VP, Cornec D, Vasmatzis G, Peikert T, et al. Microbial antigens stimulate metalloprotease-7 secretion in human B-lymphocytes using mTOR-dependent and independent pathways. Sci Rep. 2017;7(1):3869.

448. Handley SA, Miller VL. General and specific host responses to bacterial infection in Peyer's patches: a role for stromelysin-1 (matrix metalloproteinase-3) during Salmonella enterica infection. Mol Microbiol. 2007;64(1):94-110.

449. Wilson CL, Ouellette AJ, Satchell DP, Ayabe T, Lopez-Boado YS, Stratman JL, et al. Regulation of intestinal alpha-defensin activation by the metalloproteinase matrilysin in innate host defense. Science. 1999;286(5437):113-7.

450. Xu T, Zeng B, Li X. The role of neutrophil collagenase in endotoxic acute lung injury. J Huazhong Univ Sci Technolog Med Sci. 2004;24(2):196-8.

451. Mun-Bryce S, Lukes A, Wallace J, Lukes-Marx M, Rosenberg GA. Stromelysin- 1 and gelatinase A are upregulated before TNF-alpha in LPS-stimulated neuroinflammation. Brain Res. 2002;933(1):42-9.

452. Sundac L, Dando SJ, Sullivan MJ, Derrington P, Gerrard J, Ulett GC. Protein- based profiling of the immune response to uropathogenic Escherichia coli in adult patients immediately following hospital admission for acute cystitis. Pathogens and Disease. 2016;74(6).

453. Berry RE, Klumpp DJ, Schaeffer AJ. Urothelial cultures support intracellular bacterial community formation by uropathogenic Escherichia coli. Infect Immun. 2009;77(7):2762-72.

454. Szemiako K, Krawczyk B, Samet A, Sledzinska A, Nowicki B, Nowicki S, et al. A subset of two adherence systems, acute pro-inflammatory pap genes and invasion coding dra, fim, or sfa, increases the risk of Escherichia coli translocation to the bloodstream. Eur J Clin Microbiol Infect Dis. 2013;32(12):1579-82.

455. Hannan TJ, Hunstad DA. A murine model for Escherichia coli urinary tract infection. Methods Mol Biol. 2016;1333:159-75. 188

456. Hung CS, Dodson KW, Hultgren SJ. A murine model of urinary tract infection. Nat Protoc. 2009;4(8):1230-43.

457. Cui B, Liu X, Fang Y, Zhou P, Zhang Y, Wang Y. Flagellin as a vaccine adjuvant. Expert Rev Vaccines. 2018;17(4):335-49.

458. Mizel SB, Bates JT. Flagellin as an adjuvant: cellular mechanisms and potential. J Immunol. 2010;185(10):5677-82.

459. Jost SP, Gosling JA, Dixon JS. The morphology of normal human bladder urothelium. J Anat. 1989;167:103-15.

460. Abraham SN, Miao Y. The nature of immune responses to urinary tract infections. Nat Rev Immunol. 2015;15(10):655-63.

461. Duell BL, Cripps AW, Schembri MA, Ulett GC. Epithelial cell coculture models for studying infectious diseases: benefits and limitations. J Biomed Biotechnol. 2011;2011:852419.

462. Barrila J, Radtke AL, Crabbe A, Sarker SF, Herbst-Kralovetz MM, Ott CM, et al. Organotypic 3D cell culture models: using the rotating wall vessel to study host-pathogen interactions. Nat Rev Microbiol. 2010;8(11):791-801.

463. Rust JH. Animal models for human diseases. Perspect Biol Med. 1982;25(4):662- 72.

464. Hau J. Animal Models for Human Diseases. In: Conn PM, editor. Sourcebook of models for biomedical research. Totowa, NJ: Humana Press; 2008. p. 3-8.

465. Burm R, Collignon L, Mesalam AA, Meuleman P. Animal models to study hepatitis C virus infection. Front Immunol. 2018;9:1032.

466. Lai F, Chen Q. Humanized mouse models for the study of infection and pathogenesis of human viruses. Viruses. 2018;10(11).

467. Wright KJ, Seed PC, Hultgren SJ. Development of intracellular bacterial communities of uropathogenic Escherichia coli depends on type 1 pili. Cell Microbiol. 2007;9(9):2230-41.

468. Carey AJ, Tan CK, Ipe DS, Sullivan MJ, Cripps AW, Schembri MA, et al. Urinary tract infection of mice to model human disease: Practicalities, implications and limitations. Crit Rev Microbiol. 2016;42(5):780-99.

469. Rosen DA, Hooton TM, Stamm WE, Humphrey PA, Hultgren SJ. Detection of

189 intracellular bacterial communities in human urinary tract infection. PLoS Med. 2007;4(12):e329.

470. Soutourina OA, Bertin PN. Regulation cascade of flagellar expression in gram- negative bacteria. FEMS Microbiol Rev. 2003;27(4):505-23.

471. Torcia MG, Nencioni L, Clemente AM, Civitelli L, Celestino I, Limongi D, et al. Sex differences in the response to viral infections: TLR8 and TLR9 ligand stimulation induce higher IL10 production in males. PLoS ONE. 2012;7(6):e39853.

472. Sanchez-Ruiz JM. Protein kinetic stability. Biophys Chem. 2010;148(1-3):1-15.

473. Matsuura Y, Takehira M, Joti Y, Ogasahara K, Tanaka T, Ono N, et al. Thermodynamics of protein denaturation at temperatures over 100 degrees C: CutA1 mutant proteins substituted with hydrophobic and charged residues. Sci Rep. 2015;5:15545.

474. Cao Y, Li H. How do chemical denaturants affect the mechanical folding and unfolding of proteins? J Mol Biol. 2008;375(1):316-24.

475. Greenfield NJ. Using circular dichroism spectra to estimate protein secondary structure. Nat Protoc. 2006;1(6):2876-90.

476. Ghisaidoobe AB, Chung SJ. Intrinsic tryptophan fluorescence in the detection and analysis of proteins: a focus on Forster resonance energy transfer techniques. Int J Mol Sci. 2014;15(12):22518-38.

477. Douzi B. Protein-protein interactions: surface plasmon resonance. Methods Mol Biol. 2017;1615:257-75.

478. Mysorekar IU, Hultgren SJ. Mechanisms of uropathogenic Escherichia coli persistence and eradication from the urinary tract. Proc Natl Acad Sci U S A. 2006;103(38):14170-5.

479. Scott VC, Haake DA, Churchill BM, Justice SS, Kim JH. Intracellular bacterial communities: A potential etiology for chronic lower urinary tract symptoms. Urology. 2015;86(3):425-31.

480. Justice SS, Hunstad DA, Seed PC, Hultgren SJ. Filamentation by Escherichia coli subverts innate defenses during urinary tract infection. Proc Natl Acad Sci U S A. 2006;103(52):19884-9.

481. Souza AC, Zatz R, de Oliveira RB, Santinho MA, Ribalta M, Romao JE, Jr., et al.

190

Is urinary density an adequate predictor of urinary osmolality? BMC Nephrol. 2015;16:46.

482. Dielubanza EJ, Schaeffer AJ. Urinary tract infections in women. Med Clin North Am. 2011;95(1):27-41.

483. Kruze D, Biro K, Holzbecher K, Andrial M, Bossart W. Protection by a polyvalent vaccine against challenge infection and pyelonephritis. Urol Res. 1992;20(2):177-81.

191

Appendix 1

Additional methods and results not included in chapter 3

Plasmid and bacterial genomic DNA extraction

Plasmid extraction was performed using QIAprep Spin Miniprep Kit according to manufacturer’s instruction (QIAGEN, USA). The plasmid was eluted using water (pH 8).

Bacterial genomic DNA preparation was performed using laboratory reagents. Briefly, bacterial cells were grown overnight at 37°C in 10 ml LB broth with appropriate antibiotics where necessary. A cellular pellet was prepared from 1.5 ml of the overnight culture by spinning at 13,000 × g at 4°C for 10 min. The supernatant was discarded. The pellet was resuspended in 567 µl TE buffer by pipetting. Approximately 30 µl of 10% SDS and 6 µl of 20 mg/ml proteinase K were added along with 2 µl of 100 mg/ml RNase A. The suspension was mixed thoroughly and incubated for 1 h at 37°C. Approximately, 100 µl of 5M NaCl was added to the tube and mixed thoroughly using repeated pipetting for about 3-4 min. The cell wall debris, denatured protein, and polysaccharides were removed by CTAB/NaCl. To achieve this, 80 µl CTAB/NaCl solution was added and mixed thoroughly using repeated pipetting for about 3-4 min, and incubated for 10 min at 65°C. An equal volume (i.e. 700 µl) of chloroform (in a fume hood) was added, mixed thoroughly and spun for 5 min at 13,000 × g. The centrifugation separated the solution into three layers, chloroform on the bottom, a white interface and the supernatant containing DNA on the top. The top, aqueous and viscous supernatant was transferred into new Eppendorf tube and equal volume of phenol/chloroform/isoamyl alcohol was added and mixed thoroughly. The solution was centrifuged again at 13,000 × g for 5 min to remove cell debris and other contaminants. The top aqueous supernatant was finally transferred to new Eppendorf tube and DNA was precipitated with 0.6 volume of isopropanol. The precipitate was centrifuged at 13,000 × g for 5 min and all the supernatant was removed using pipette. Approximately, 500 µl 70% ethanol was added and mixed gently and centrifuged at 13,000 × g for 5 min. The supernatant was removed and dried at 37°C. Finally, the pellet was redissolved in 200 µl water by vortexing and heating at 50°C. Thus, extracted plasmid and genome DNA (2 µl) were quantified using Bio spectrophotometer and stored in -20°C for further use.

In some experiments, DNA was extracted from bacterial colonies by the boiled cell method, as described previously with minor modifications (1). Briefly, to an Eppendorf

192 tube, 50 µl of sterile water was added; and by using a tip, a colony was scratched from a petri dish, and resuspended in it by the help of vortex. The cell suspension was boiled for 10 min and immediately transferred to ice, followed by centrifugation for 10 min at 8000 × g at 4°C. The supernatant was transferred as DNA template solution for subsequent analysis.

Gel electrophoresis

Various concentrations of agarose gel (0.8% to 1.2%) were prepared, unless stated otherwise. A final volume of 60 ml for small gel with 10 combs were prepared. The volume was adjusted according to the comb size applied. Agarose (Low EEO Electrophoresis grade; Fisher Scientific) was weighted and dissolve in 1x TAE in a microwavable flask. The solution was microwaved for 1-2 min until all the agarose dissolved. The agarose solution was stand still to cool down to approximately 50°C. Six microlitre of SYBR Safe DNA gel stain (ThermoFisher Scientific) was added to 60 ml of agarose solution (1:10000 dilution) for visualisation of DNA in agarose gel. The gel was poured to the pre-fixed gel casting tray with the well comb in place. The poured gel was placed at room temperature for 20-30 min until completely solidified. Approximately, 2- 3 µl of loading dye was mixed with the DNA sample before loading to the respective well. The agarose gel was placed in an electrophoresis unit (Bio-Rad, USA). The gel box was filled with 1x TAE buffer until the gel was covered. The samples were resolved at 120 V for 1 h, unless stated otherwise until the dye line is approximately 70-80% of the way down the gel. The gels were visualised using UV light on Safe Imager 2.0 (Invitrogen) or images were taken using Gel Doc EZ Imager (Bio-Rad, USA).

Determination of electroporation efficiency of bacterial cells

Plasmid pUC19, a widely used cloning vector for E. coli, was used to examine electroporation efficiency of some UPEC strains. The electrocompetent cells (CFT0734f9::KnR; GU2600) were prepared following standard protocol. Briefly, the electrocompetent cells (either UPEC or DH-5α) were applied. Plasmid DNA was extracted using QIAprep Spin Miniprep Kit according to manufacturer’s instruction (QIAGEN, USA) and confirmed by using restriction digestion. Approximately 100 ng of plasmid DNA (1 µl) and 1 µg (10 µl) were electroporated into 50 µl electrocompetent cells for each reaction. The shocked cells were immediately added to 1 ml LB media, incubated for 1 h at 37°C. The stabilized cells (100 µl) were plated in LBAAmp100 plates

193 in different dilutions, mostly 10-0 to 10-5, unless stated otherwise, and incubated for 18 h at 30°C. The next day, plates were observed for the growth and colonies were counted. The efficiency of transformation was calculated using mathematical formula. Plasmid pUC19 was extracted from laboratory stock and confirmed by using restriction digestion (Figure S3a). Following electroporation of 100 ng plasmid DNA, transformants were serially diluted from 100 to 10-5. In the efficiency testing using 100 ng plasmid, undiluted and 10-1 diluted (i.e. 1/10) transformation resulted in TMTC (too many to count) cells. From plating out 100 µl of the 10-2 dilution (i.e. 1/100), 294 colonies grew overnight. Similarly, 1 µg plasmid DNA resulted in only 17 colonies in the same dilution. No DNA yielded no colonies. Transformation efficiency was calculated below, and it was noted that 100 ng of pUC19 gave the best result.

The efficiency of electroporation was calculated as follows.

For 100 ng DNA with 10-2 dilution (1/100)

Colony forming units (CFU)/ml = No. of colonies x dilution/ volume (ml)

= 294 x 100/0.1 = 2.94 x 105 CFU/ml

CFU per µg DNA = 2.94 x 105 CFU x 0.1 µg

= 2.94 x 106 CFU/µg

For 1 µg DNA with 10-2 dilution (1/100)

Colony forming units (CFU)/ml = No. of colonies x dilution/ volume (ml)

=17 x 100/0.1

= 1.7 x 104 CFU/ml

CFU per µg DNA = 1.7 x 104 CFU x 0.1 µg

=1.7 x 104 CFU/µg

194

Figure S3a. Restriction digestion of pUC19. (A) Circular map of pUC19 genome showing recognition sites for AatII and XbaI. The expected fragments size for single cut was 2686 bp and double cut were 2198 bp and 488 bp. The image was extracted from NEBcutter V2.0. (B) Plasmid pUC19 was digested with uncut (Lane 1), AatII (Lane 2), XbaI (Lane 3) and both AatII and XbaI (Lane 4) for 2 h at 37°C and resolved in 0.8 % agarose gel at 120 V for 1 h. Marker (Lane M).

195

Targeted mutation of fliC in CFT073Δ4 using λ-red recombinase method

UPEC strain CFT073Δ4 was targeted for fliC deletion by a method of allelic exchange using λ-red recombinase method described by Datsenko and Wanner, routinely used to generate mutations in E. coli (2). The schematic representation of the protocol is shown in Figure S3b. Typically, in this method, PCR primers are used to generate an amplicon comprising a Kan-resistance cassette (KnR) with flippase recognition target (FRT) sequences upstream and downstream, flanked by 30-40 nt of DNA homologous to the bacterial chromosome flanking the region to be deleted. This PCR product is transformed into E. coli, and with the help of plasmid pKD46, which carries the λ red genes controlled by araBAD promoter and a temperature sensitive origin of replication (permissive growth at ≤ 32°C) facilitates mutation by allelic exchange, and by inserting the KnR-FRT cassette in place of the target gene. By exploiting a non-permissive temperature in subsequent passages (e.g. 37°C), pKD46 is lost and the KnR-marker remains, flanked by FRT sites. A second recombinase, termed flippase (FLP) is then applied, using plasmid pCP20, to excise the KnR marker and facilitate a marker less mutation (2).

196

Figure S3b: Schematic representation of the construction of fliC mutant using λ-red recombinase gene replacement system. The basic strategy is to replace a chromosomal sequence (e.g., fliC) with a kanamycin resistance gene cassette that is generated by PCR by using primers with 36-nt homology extensions to fliC gene. This is accomplished by λ-red mediated recombination (contained in pKD46) in these flanking homologies. After selection, the resistance gene is eliminated by using a helper plasmid expressing the FLP recombinase (pCP20), which acts on the directly repeated FRT (FLP recognition target) sites flanking the resistance gene. The Red and FLP helper plasmids can be simply cured by growth at 37°C because they are temperature-sensitive replicons.

197

Plasmid pKD46 DNA was extracted from E. coli MG1655 (GU2627). Restriction digestion was performed to confirm the plasmid using BamHI, which cuts the plasmid once to yield a linear DNA fragment of 6329 bp, and in double-digestion reaction with BamHI and PstI (which cuts twice) to yield a DNA fragment with expected sizes of 5013, 1069 and 247 bp (Figure S3cA). The plasmid pKD4 (3267bp; resistance to ampicillin and kanamycin) was extracted from E. coli. pKD4 was analysed by restriction digestion with XbaI (yielding 1874 and 1393 bp DNA fragments) and PstI (yielding 3267 bp linear DNA fragment) (Figure S3cB). The plasmid DNA was used as template to amplify the FRT containing kanamycin resistant cassette (KnR-FRT fragment). The primers used were previously designed and published (3), FliC mutant construct (F) ATGGCACAAGTCATTAATACCAACAGCCTCTCGCTGATCAATGGGAATTAG CCATGGTCC and FliC mutant construct (R) GCAGCAGAGACAGAACCTGCTGCGGTACCTGGTTGGCTTTGTGTAGGCTGG AGCTGCTTC. The underlined portions of the oligonucleotide sequences are specific to kanamycin cassette while the remaining 36-nt are homologous to fliC region. A standard protocol of PCR was applied. Briefly a typical master mix was prepared for multiple reactions, and per reaction contained 1 µl of template, 4 µl of 5x HF reaction buffer, 1 µl of each of the primers at 10 mM, 0.4 µl dNTP (10 mM each), 0.2 µl of Pfu DNA polymerase (5 U/ml) and made up to 20 µl using molecular biology grade H2O (Life Technologies) unless otherwise stated during optimisations. The thermocycle conditions were denaturation at 94°C for 1 min, annealing temperature was optimized and applied for 1 min, extension at 72°C for 2 min and storage at 4°C for 30 cycles, unless stated otherwise. A gradient of annealing temperatures from 55-68oC was used to optimize the annealing temperature of the primer pair. This demonstrated that the optimal temperature for annealing was 62°C, due to the intensity of the DNA band at 1498 bp (Figure S3dA). The PCR amplification was repeated at larger scale (50 µl reactions) and the amplified 1498 bp fragment was extracted using QIAquick PCR purification kit (QIAGEN, USA) (Figure S3dB). Following purification, the fliC-KnR PCR product was digested with DpnI which removes methylated, pKD4 plasmid DNA that served as the template in PCR, separated on an agarose gel and extracted before in electroporation reactions (Figure S3dC).

198

Figure S3c: (A) Plasmid pKD46 was digested with BamHI (Lane 1), BamHI and PstI (Lane 2) for 2 h at 37oC and resolved in 0.8% agarose gel at 120 V for 1 h. Marker (Lane M). The expected fragments size for single digestion was 6329 bp and double digestions were 5013 bp, 1069 bp and 247 bp. (B) Plasmid pKD4 was digested with XbaI (Lane 1) and PstI (Lane2) for 2 h at 37oC and resolved in 0.8% agarose gel at 120 V for 1 h. Marker (Lane M). The expected fragments size for XbaI was 1874 bp and 1393 bp and PstI was 3267 bp.

Figure S3d: (A) Annealing temperature optimization for amplification of KnR-FRT cassette (1490 bp) from pKD4. Marker (Lane M); Annealing temperature 55, 58, 62, 64 and 68, no template blank (Lane C). (B) Amplification of KnR cassette (1490 bp) from pKD4 with annealing temperature 62°C. Two 50 µl reactions were prepared (Lane 1 and 2) with no template control (Lane 3). Marker (Lane M). (C) DpnI digestion of amplified fragment and pKD46 genome. pKD46 DNA with DpnI digestion for 1 h (Lane 1), pKD46 DNA undigested (Lane 2), two identical reactions of DpnI digested KnR fragment (Lane 3 and 4), Marker (Lane M).

199

The fliC-KnR DNA was electroporated into UPEC CFT073Δ4 using standard protocol, as described previously (4). Briefly, bacterial cells were plated out from frozen stock in LB agar plates with appropriate antibiotics. Approximately, 2-3 colonies were inoculated in 10 ml of LB broth in a 50 ml tube and grown overnight at 37°C with shaking at 200 rpm. Approximately, 500 µl of the culture broth was added to pre-autoclaved 50 ml of LB broth in a 250 ml flask and incubated for 3-4 h at 37°C with shaking at 200 rpm. Bacterial cells with pKD46 were grown in the presence of 20 µM L-arabinose (1000 µl of 1M stock) at 30°C with shaking at 200 rpm. The culture was checked frequently to the OD600 of 0.6 to 0.8. The whole culture was centrifuged at 3000 × g for 10 min. The pellet was resuspended in 10 ml ice-cold 10% glycerol and centrifuged at 3000 × g for 10 min to wash three times. The final pellet was resuspended in 200 µl of 10% glycerol. Approximately 100 ng of DNA (1-10µl) was added to 35 to 50 µl electrocompetent cells in cold electro cuvette (0.2 cm), unless stated otherwise. The mixture was electroporated using GenePulser Xcell (Bio-Rad) with voltage 2.45 kV, capacitance 25 µF, and resistance 200 Ω. Approximately, 1 ml SOC media was immediately added to the shocked cells and incubated for 2 h at 28°C or 37°C improve cell viability and cloning efficiency. The stabilized cells were plated in LBA plates with appropriate antibiotics in different volumes (50, 100 and 200 µl) and incubated for 18-24 h at 28°C or 37°C for selection.

First, 50 ng pKD46 was electroporated in CFT073Δ4 (GU2597) and after immediate recovery at 28°C for 1 h, the transformants were spreaded in LBA plates containing ampicillin 100 µg/ml (LBAAmp100) plates and incubated at 28°C overnight. From this electroporation, the efficiency was 5.6 x 105 CFU/µg DNA. A single colony transformant was selected and purified by passaging on LBAAmp100 at 28°C. CFT073Δ4 carrying pKD46 was designated as GU2628. GU2628 was then made electrocompetent as above for the electroporation of fliC-KnR PCR product. Briefly, from overnight culture pre- grown with ampicillin (100 µg/ml) and L-arabinose (20 µM), 100 ml LB broth was prepared at 1:100 dilution. The culture was grown for 3-4 h to OD600 of 0.3-0.4. L- arabinose (20 µM) was added and incubated for next couple of hours until OD600 was 0.6- 0.8. Approximately 50 µl cells were used for electroporation. No DNA, 30 ng and 300 ng fliC-KnR PCR fragment was electroporated in to strain GU2628. After recovery at 28°C for 1 h, the transformants were incubated at 28°C in LBA plates containing kanamycin

50 µg/ml (LBAKm50) plates overnight. From this electroporation, the efficiency was 1.3 x 104 CFU/µg DNA.

Genomic DNA from a potential ΔfliC::KnR mutant derivative of CFT073Δ4 was used as

200 a PCR template for screening. All the reaction volumes and thermocycler conditions were according to manufacturer’s instructions as explained above. Primers FliC Screen (Forward) CAGACGATAACAGGGTTGACGGC and FliC Screen (Reverse) TCAGGCAATTTGGCGTTGCCGTC were used. PCR amplicons from Wt and the candidate mutants were separated on an agarose gel. The expected amplicon sizes from CFT073Δ4 and CFT073Δ4∆fliC::KnR strains were 1.9 kb and 1.7 kb, respectively. Separation of the PCR products showed bands of similar sizes (Figure S3eA), indicating the attempt at mutation was unsuccessful. Nevertheless, the PCR was repeated, PCR DNA was gel excised and sent for sequencing at AGRF Brisbane for confirmation (Figure S3eB). As predicted based on the agarose gels, there was no mutation at the fliC locus (Figure S3eC), and the mutation was unsuccessful in this attempt (Figure S3f). This approach was attempted three times independently, without success. Due to the importance in generating a fliC mutation in the work described in this thesis, an alternative approach to mutation was taken with success (Chapter 3).

201

Figure S3e: (A) E. coli CFT073Δ4 (parental strain, Lane 1); candidate strain with fliC deleted in CFT073Δ4 (Lane 2) and no template control (Lane 3). The expected band size of parental strain was 1.9 kbp and fliC mutant was 1.7 kbp. (B) PCR amplified fragments from genomic DNA of the potential CFT073Δ4ΔfliC strain (Lane 1 and 2) and the parental strain CFT073Δ4 (Lane 3) were gel excised and sent for sequencing for further analysis. Marker (Lane M). (C) Linear representation of nucleotide sequence from UPEC CFT073 genome. The sequence from potential fliC deleted strain was blasted against UPEC CFT073 genome. Green arrows show location of priming sites. No mutation in fliC locus was noted.

202

Figure S3f: Assembled sequences and chromatograms from potential fliC deletion in CFT073. Primers FliC screen (F) and FliC screen (F) (Table 4) were used for sequencing. (A) Assembly of sequenced amplicons forming a contig. (B) Chromatogram of each sequences. Sequencing analysis were done using SEQUENCHER 5.4.6 (Gene Codes Corporation) software.

203

Construction of fliC deletion in UTI89 strain

The same protocol as applied to make fliC deletion in CFT073 strains (Chapter 3) was used to make fliC deletion in UPEC reference strain UTI89 (GU2019). Briefly, PCR was used to amplify >500 bp of DNA flanking the fliC gene of UTI89 (GU2019), using primers that contained overlapping homologous sequence with the KnR cassette. The KnR cassette was also amplified, and the three PCR amplified products were fused by an overlap extension method using thermocycler conditions as shown in Table S3a. Thus, a larger DNA fragment was subsequently used to delete fliC. The confirmations of the deletion strains were obtained by PCR and sequencing.

Table S3a: Thermocycler conditions of modified overlapping extension PCR method.

Temperature Time No. of Conditions Remarks (°C) cycles Pre-denaturation 98 2 min Denaturation 98 10 sec Ramp up max rate Annealing 70 1 sec Ramp down max rate 20 Annealing 55-72 30 sec Ramp down at 0.1°C/sec Extension 72 2.5 min Ramp up at 0.2°C/sec Denaturation 98 20 sec Ramp up max rate Annealing 70 1 sec Ramp down max rate Annealing 55-72 30 sec 5 Ramp down at 0.1°C/sec Ramp up at 0.2°C/sec, then Extension 72 5 min 5 sec/cycle Denaturation 98 20 sec Ramp up max rate Annealing 70 1 sec Ramp down max rate Annealing 55-72 30 sec 10 Ramp down at 0.1°C/sec Ramp up at 0.2°C/sec, then Extension 72 5 min 20 sec/cycle

Plasmid pKD46 DNA was extracted from E. coli MG1655 (GU2627) and restriction digestion was performed confirm plasmid as explained above. Approximately, 115 ng pKD46 DNA was electroporated to 50 µl electrocompetent cells (GU2019) following standard protocol explained above. The shocked cells were immediately added to 1 ml

SOC media, incubated 1 h at 37°C. The stabilized cells (100 µl) were plated in LBAAmp100

204 plates and incubated for 18 h at 30°C. Control was used simultaneously with UTI89 electroporated without DNA. No colonies were observed with control, whereas only one colony was observed with pKD46. The single colony was further streaked in to separate

LBAAmp100 plate and pKD46 was extracted from this strain and confirmed using restriction digestion. UTI89 containing pKD46 were designated GU2670.

Plasmid pKD4 DNA was extracted from GU2289 using commercial kit as per manufacturer’s instructions (QIAGEN, USA) and confirmed with restriction digestion as explained above. The plasmid DNA from pKD4 was used as template to amplify the FRT containing kanamycin resistant cassette (KnR-FRT fragment). The primers used were, FliC mutant construct (F) ATGGCACAAGTCATTAATACCAACAGCCTCTCGCTGATCAATGGGAATTAG CCATGGTCC and FliC mutant construct (R) GCAGCAGAGACAGAACCTGCTGCGGTACCTGGTTGGCTTTGTGTAGGCTGG AGCTGCTTC. The underlined portions of the oligonucleotide sequences are specific to kanamycin cassette while the remaining 36-nt are homologous to fliC region. The master mix contents, volume and thermocycler conditions were according to manufacturer’s instructions as explained in chapter 3. The two chromosomal upstream (575 bp) and downstream (574 bp) fragments of fliC were amplified from UTI89 genome using primers fliC-Kan-Up-F1 and fliC-Kan-Up-R2 for upstream and fliC-Kan-Down-F1 and fliC-Kan- Down-R1 for downstream regions respectively (Primer details are listed in Chapter 3). In order to scale up the amplicon products, PCR amplification of KnR-FRT fragment (1.47 kb) using annealing temperature of 55.2°C was performed in 4 different 50 µl reactions, while upstream and downstream regions of fliC were performed in 2 different reactions (Figure S3gA). All the three fragments were purified from gels using QIAquick PCR purification kit as per manufacturer’s instruction (QIAGEN, USA). These three products were combined together with Primers fliC-Kan-Up-F1 and fliC-Kan-Down-R1 to generate single fragment of 2.45 kb (KnR-fliC) using overlap extension method (Figure S3gB). The fragment was gel extracted, purified and stored at -20°C for further use.

205

Figure S3g: Amplification of upstream and downstream regions of fliC and KnR-FRT fragment and generation of fliC-KnR fragment using 3-way PCR method. (A) PCR amplified DNA fragments of KnR-FRT (1.47 kb) with 4 identical reactions (Lane 1-4), and upstream (575 bp) (lane 5 and 6) and downstream (574 bp) (lane 7 and 8) regions of fliC resolved in 1.2% agarose gel. Lane M is the marker. (B) Construction of fliC-KnR fragment using KnR cassette, upstream and downstream PCR amplified products by overlap extension method (2.5kb). Four reactions (50 µl each) to scale up PCR production yield (Lane 1 to 4).

The fliC-KnR fragment was electroporated into UPEC UTI89. The cells were grown in

LB media with ampicillin (100 µg/ml) and L-arabinose (20 µM) at 30°C to an OD600 of ~0.6. The cells were washed twice with pre-chilled ice-cold 10% glycerol. The final pellet was resuspended in 100 µl 10% glycerol. First, 1 µg (10 µl) of purified KnR-fliC fragment was electroporated to 80 µl electrocompetent cells. The shocked cells were immediately added to 1 ml SOC media, incubated for 2 h at 30°C, and spread onto LBAKn50 plates for selection of cells carrying the fliC-KnR cassette. Control electroporation without DNA were carried out simultaneously. For electroporations using UTI89, 3 colonies grew in total, with none growing on the respective controls without DNA. From those 3 colonies from transformation, 1 colony was selected for further work. To check for the loss of helper plasmid, the colony was streaked onto LBAKn50 and LBAAmp100 plates. This confirmed the loss of AmpR marker of pKD46 had been lost in all cases. The isolate arising from fliC mutation in the Wt parental background (GU2019) was termed GU2671. Genomic DNA was isolated from this transformant using laboratory reagents described as above. The screening of the replacement of fliC with fliC-KnR was completed using PCR with primers fliC-chk-F1 and fliC-chk-R1, using an optimized annealing 206 temperature of 68.8°C. PCR amplicons from Wt UTI89 (GU2019) and the potential mutants (UTI89∆fliC::KnR) were separated on 1.2% agarose gel. The amplicon sizes from Wt and mutant strains were 3.07 kb and 2.7 kb, respectively as anticipated (Figure S3hB; lane 1 and lane 2).

Elimination of kanamycin containing FRT from transformants was accomplished using FLP helper plasmid pCP20. pCP20 is an ampicillin resistance plasmid that shows temperature sensitive replication and thermal induction of FLP synthesis. Competent cells of strain GU2671 were electroporated with 1 µl (containing 118 ng) pCP20. After 2 h of recovery at 30°C, 100 µl of transformants were diluted to 10-0, 10-1 and 10-2, and plated into LBAAmp100 plates. The plates were incubated at 30°C overnight. Only 4 colonies grew in undiluted suspension. Those colonies from the plates were inoculated to 5 ml LB broth and incubated at 43°C for 8 h. Then, 10 µl culture was streaked onto LBA plates (no antibiotics) to isolate single colony and incubated at 43°C overnight. From the resultant plates, 10 single colonies were picked and streaked onto LB agar, and then LBAAmp100 and LBAKn50 plates in order to identify those that had lost both the pCP20 helper plasmid, R and the Kn marker. All 10 grew only on LBA plates but did not grow on LBAAmp100 and

LBAKn50 plates, indicating pCP20-mediated marker loss had occurred. Four separate single colonies (termed GU2687, GU2688, GU2689, GU2690) were chosen, and genomic DNA were isolated. PCR using primers fliC-chk-F1 and fliC-chk-R1 was used to compare fliC locus between the Kanamycin sensitive isolates GU2687-GU2690, and the strain containing fliC-KnR (GU2671) (Figure S3hA). PCR amplicons from Wt UTI89 (GU2019), UTI89∆fliC::KnR (GU 2671) and 3 identical strains of UTI89∆fliC (GU2687, GU2688, GU2689) were resolved in 0.6% agarose gel (Figure S3hB). The amplified bands were gel extracted and send for sequencing at AGRF Brisbane for confirmation. As predicted, based on agarose gel images, and DNA sequencing (Figure S3hC), KnR cassette was completely removed from all isolates GU2687-GU2690 (Figure S3i).

207

Figure S3h: Removal of KnR cassette from UTI89∆fliC::KnR. (A) UTI89∆fliC::KnR (expected band size 2.7 kb), Lane 2-5 are four colonies of UTI89∆fliC (expected band size 1.5 kb) and Lane 6 is no DNA control. Lane M is marker. (B) Screening of fliC deleted UTI89 strains. Lane 1 is UTI89 Wt (expected band size 3.1 kb), Lane 2 is UTI89∆fliC::KnR (expected band size 2.7 kb), Lane 3, 4 and 5 are UTI89∆fliC (expected band size 1.5 kb) respectively Lane 6 is no DNA control. Lane M is marker. (C) Linear representation of nucleotide sequence from UPEC UTI89 genome. The sequence from UTI89ΔfliC strain was blasted against UPEC CFT073 genome. Green arrows show location of priming sites. Red sequences are nucleotide remained after FLP mediated excision of kanamycin gene. “Scar” are shown in black lined boxes.

208

Figure S3i: Assembled sequences and chromatograms from UTI89ΔfliC. Primers fliC- chk-F1 and fliC-chk-R1 (Table 4) were used for sequencing. (A) Assembly of sequenced amplicons forming a contig. (B) Chromatogram of each sequences. The highlighted contig is fragments of kanamycin resistance cassettes after FLP mediated excision of KnR. Sequencing analysis were done using SEQUENCHER 5.4.6 (Gene Codes Corporation) software.

209

Generation of flagella overexpression in UPEC strains

Motility and chemotaxis in E. coli are controlled by a master regulator encoded by flhD and flhC, which comprise the flhDC operon (5). Artificial overexpression of the flhDC operon in liquid-grown bacterial cell result in the formation of filamentous, multinucleated, and hyperflagellated cells (6). Plasmid pMG600 carries a Ptac- flhDC transcriptional fusion and lacI, where the expression of flhDC operon is controlled by IPTG addition to the medium, and this plasmid confers kanamycin resistance to the host (7). Hence, I decided to generate overexpression of flagella in various UPEC strains, so that I can use these strains to extract abundant flagella protein for various immune assays in this thesis. pMG600 from laboratory stocks was electroporated in two UPEC backgrounds; namely (i) CFT073Δ4 (GU2597), and (ii) CFT073Δ4ΔfliC (GU2642). Plasmid DNA of pMG600 was extracted using QIAprep Spin Miniprep Kit according to manufacturer’s instruction (QIAGEN, USA). Plasmid pMG600 DNA (171.9 ng/µl) was extracted from UPEC reference strain containing pMG600 (CFT073/pflhDC; GU2139) (laboratory stock). Preparation of electrocompetent cells of GU2597 and GU2642 were performed according to the protocol explained above. From overnight grown cultures of these two strains, 10 µl was inoculated to 100 ml fresh pre-autoclaved LB broth and incubated at 37°C for 2 h until OD600 of 0.8. The cells were washed twice with pre-chilled ice-cold 10% glycerol. The final pellets were resuspended in 100 µl 10% glycerol. First, 1µg (~8 µl) pMG600 DNA was electroporated to 50 µl electrocompetent cells of the two strains separately, following standard protocol explained above. One ml SOC media were immediately added to the shocked cells and incubated for 1 h at 37°C. The stabilized cells (100 µl) were plated in LBAKn50 plates and incubated for 18 h at 37°C. Controls were used simultaneously with competent cells electroporated without DNA. No colonies were observed with controls, whereas electroporations of GU2597 or GU2642 with pMG600 yielded 7 x 104 and 4.5 x 105 CFU per µg plasmid DNA, respectively. Single colonies were isolated and were accepted as successful transformants. GU2597 carrying pMG600 was designated GU2647 and GU2642 carrying pMG600 was designated GU2648.

1. Pui CF, Wong WC, Chai LC, Lee HY, Noorlis A, Zainazor TC, et al. Multiplex PCR for the concurrent detection and differentiation of Salmonella spp., Salmonella Typhi and Salmonella Typhimurium. Trop Med Health. 2011;39(1):9-15.

210

2. Datsenko KA, Wanner BL. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A. 2000;97(12):6640- 5.

3. Lane MC, Lockatell V, Monterosso G, Lamphier D, Weinert J, Hebel JR, et al. Role of motility in the colonization of uropathogenic Escherichia coli in the urinary tract. Infect Immun. 2005;73(11):7644-56.

4. Potter H. Transfection by electroporation. Curr Protoc Mol Biol. 2003;Chapter 9:Unit 9.3.

5. Liu X, Matsumura P. The FlhD/FlhC complex, a transcriptional activator of the Escherichia coli flagellar class II operons. J Bacteriol. 1994;176(23):7345-51.

6. Eberl L, Christiansen G, Molin S, Givskov M. Differentiation of Serratia liquefaciens into swarm cells is controlled by the expression of the flhD master operon. J Bacteriol. 1996;178(2):554-9.

7. Givskov M, Eberl L, Christiansen G, Benedik MJ, Molin S. Induction of phospholipase- and flagellar synthesis in Serratia liquefaciens is controlled by expression of the flagellar master operon flhD. Mol Microbiol. 1995;15(3):445-54.

211

Appendix 2

Supplementary Tables from Chapter 5

Table S1: Bladder transcriptome in Wt mice in response to pure FliC from UPEC CFT073∆4. The following table is the list of transcriptional response of genes by FliC- treated Wt mice, exhibiting significantly altered expression in the bladder, compared to carrier control-treated Wt mice. The differential expressions were judged by those exhibiting ±2-fold changes in expression compared to the carrier control, with a q-value (adjusted p-value) of < 0.05.

Ensembl ID Gene name Fold change p-adjusted ENSMUSG00000026166 Ccl20 980.27 2.6E-53 ENSMUSG00000032484 Ngp 934.14 2.6E-10 ENSMUSG00000031089 Slc6a14 647.20 1.4E-124 ENSMUSG00000055030 Sprr2e 510.01 1.4E-14 ENSMUSG00000041293 Adgrf1 298.04 2.0E-12 ENSMUSG00000074115 Saa1 245.01 5.9E-10 ENSMUSG00000042212 Sprr2d 199.80 3.8E-14 ENSMUSG00000057465 Saa2 185.06 2.4E-04 ENSMUSG00000032496 Ltf 159.89 1.5E-28 ENSMUSG00000040136 Abcc8 152.05 6.9E-52 ENSMUSG00000022026 Olfm4 145.60 4.2E-09 ENSMUSG00000097804 Gm16685 140.17 5.4E-70 ENSMUSG00000096719 Mrgpra2b 124.57 1.9E-05 ENSMUSG00000079597 Gm5483 123.73 2.6E-06 ENSMUSG00000046259 Sprr2h 123.36 2.1E-08 ENSMUSG00000020651 Slc26a4 104.42 2.4E-07 ENSMUSG00000030472 Ceacam18 93.10 3.4E-06 ENSMUSG00000026822 Lcn2 91.25 1.6E-153 ENSMUSG00000044103 Il1f9 90.83 3.9E-21 ENSMUSG00000027925 Sprr2j-ps 89.98 2.4E-06 ENSMUSG00000034855 Cxcl10 85.34 9.9E-159 ENSMUSG00000065601 Mir146 78.60 2.6E-06 ENSMUSG00000058427 Cxcl2 78.43 1.3E-21 ENSMUSG00000056054 S100a8 75.38 2.5E-10 ENSMUSG00000024313 Mep1b 74.96 3.5E-06 ENSMUSG00000056071 S100a9 67.82 6.6E-07 ENSMUSG00000029380 Cxcl1 67.36 4.4E-17 ENSMUSG00000064246 Chil1 67.16 2.1E-65 ENSMUSG00000024409 Psors1c2 67.03 2.3E-26 ENSMUSG00000087075 Lbhd2 66.58 4.0E-05 ENSMUSG00000029371 Cxcl5 63.71 1.5E-60 ENSMUSG00000018623 Mmp7 58.00 4.0E-06 ENSMUSG00000001901 Kcnh6 58.00 8.6E-19 212

ENSMUSG00000040026 Saa3 57.93 4.0E-19 ENSMUSG00000096146 Kcnj11 55.19 2.6E-37 ENSMUSG00000020826 Nos2 54.43 1.3E-70 ENSMUSG00000079339 Ifit1bl1 51.53 5.7E-37 ENSMUSG00000050440 Hamp 50.23 3.5E-05 ENSMUSG00000029379 Cxcl3 50.17 8.3E-31 ENSMUSG00000063234 Gpr84 49.38 2.7E-25 ENSMUSG00000036067 Slc2a6 49.04 1.6E-300 ENSMUSG00000092130 D030025P21Rik 46.72 5.0E-07 ENSMUSG00000027225 Duoxa2 42.61 4.8E-76 ENSMUSG00000044162 Tnip3 41.07 6.4E-121 ENSMUSG00000035638 Muc20 39.57 4.5E-28 ENSMUSG00000096506 CR974586.5 37.90 9.1E-07 ENSMUSG00000059657 Stfa2l1 36.38 2.6E-04 ENSMUSG00000038357 Camp 35.21 7.2E-06 ENSMUSG00000045551 Fpr1 34.75 7.6E-20 ENSMUSG00000022651 Retnlg 34.54 9.8E-13 ENSMUSG00000035818 Plekhs1 34.53 2.4E-106 ENSMUSG00000090176 Cd200r2 33.55 4.8E-04 ENSMUSG00000046108 Il17c 29.77 9.0E-23 ENSMUSG00000086320 Gm12840 29.02 3.9E-08 ENSMUSG00000065503 Mir351 27.64 4.9E-05 ENSMUSG00000022126 Acod1 25.07 3.2E-14 ENSMUSG00000018459 Slc13a3 24.87 2.1E-56 ENSMUSG00000051439 Cd14 23.74 9.4E-53 ENSMUSG00000019489 Cd70 23.57 4.3E-07 ENSMUSG00000030017 Reg3g 23.10 5.9E-05 ENSMUSG00000068452 Duox2 23.10 2.3E-91 ENSMUSG00000076534 Igkv12-89 22.77 3.2E-02 ENSMUSG00000036805 Noxa1 22.53 4.2E-14 ENSMUSG00000032257 Ankk1 21.96 5.1E-08 ENSMUSG00000023341 Mx2 19.70 1.0E-43 ENSMUSG00000062345 Serpinb2 19.47 4.0E-08 ENSMUSG00000105504 Gbp5 19.13 3.6E-59 ENSMUSG00000097815 Gm26809 18.79 1.7E-36 ENSMUSG00000020310 Madcam1 18.68 2.3E-04 ENSMUSG00000015316 Slamf1 18.08 1.7E-10 ENSMUSG00000050578 Mmp13 18.04 3.1E-28 ENSMUSG00000000204 Slfn4 18.04 8.1E-44 ENSMUSG00000019850 Tnfaip3 17.81 4.0E-42 ENSMUSG00000066363 Serpina3f 17.63 4.2E-35 ENSMUSG00000071036 Gm10309 17.22 1.9E-25 ENSMUSG00000041754 Trem3 15.96 1.7E-04 ENSMUSG00000052270 Fpr2 15.76 7.7E-22 ENSMUSG00000024401 Tnf 15.53 3.3E-34

213

ENSMUSG00000044313 Mab21l3 15.50 1.5E-102 ENSMUSG00000038067 Csf3 15.31 1.8E-23 ENSMUSG00000022603 Mroh4 15.27 2.2E-05 ENSMUSG00000020641 Rsad2 14.75 1.5E-32 ENSMUSG00000035186 Ubd 14.42 5.0E-17 ENSMUSG00000104082 Gm7115 14.12 4.7E-06 ENSMUSG00000042662 Dusp15 14.11 1.0E-06 ENSMUSG00000035385 Ccl2 13.97 1.9E-08 ENSMUSG00000047180 Neurl3 13.94 8.6E-41 ENSMUSG00000034459 Ifit1 13.68 5.2E-56 ENSMUSG00000027995 Tlr2 13.65 9.0E-94 ENSMUSG00000095298 Gm12407 13.38 2.1E-04 ENSMUSG00000024215 Spdef 13.18 2.9E-22 ENSMUSG00000039934 Gsap 12.85 6.9E-92 ENSMUSG00000059213 Ddn 12.73 3.5E-06 ENSMUSG00000052212 Cd177 12.62 2.1E-02 ENSMUSG00000051076 Vtcn1 12.50 7.3E-59 ENSMUSG00000027832 Ptx3 12.41 1.1E-04 ENSMUSG00000104713 Gbp6 12.18 2.7E-19 ENSMUSG00000071005 Ccl19 12.06 1.7E-07 ENSMUSG00000002565 Scin 11.98 8.3E-86 ENSMUSG00000030413 Pglyrp1 11.97 1.7E-49 ENSMUSG00000054855 Rnd1 11.54 1.4E-05 ENSMUSG00000000982 Ccl3 11.47 6.5E-24 ENSMUSG00000005800 Mmp8 11.35 1.0E-02 ENSMUSG00000079563 Pglyrp2 11.30 3.3E-21 ENSMUSG00000027398 Il1b 10.91 6.8E-05 ENSMUSG00000082507 Gm9378 10.82 9.4E-04 ENSMUSG00000050635 Sprr2f 10.74 1.4E-15 ENSMUSG00000053797 Krt16 10.72 8.4E-06 ENSMUSG00000042349 Ikbke 10.53 0.0E+00 ENSMUSG00000042268 Slc26a9 10.42 1.1E-07 ENSMUSG00000018916 Csf2 10.38 8.4E-05 ENSMUSG00000041827 Oasl1 10.12 1.4E-15 ENSMUSG00000063354 Slc39a4 10.10 2.5E-57 ENSMUSG00000060183 Cxcl11 9.93 6.5E-06 ENSMUSG00000087943 Gm24245 9.86 1.9E-02 ENSMUSG00000020638 Cmpk2 9.65 6.8E-17 ENSMUSG00000018930 Ccl4 9.58 7.2E-13 ENSMUSG00000030162 Olr1 9.56 1.4E-06 ENSMUSG00000027470 Mylk2 9.53 4.6E-10 ENSMUSG00000030142 Clec4e 9.53 1.7E-10 ENSMUSG00000035692 Isg15 9.41 2.7E-42 ENSMUSG00000020891 Alox8 9.39 3.3E-36 ENSMUSG00000042677 Zc3h12a 9.37 2.0E-29

214

ENSMUSG00000046688 Tifa 9.29 1.6E-60 ENSMUSG00000082676 Gm11843 9.25 8.1E-11 ENSMUSG00000079022 Col22a1 9.19 3.9E-08 ENSMUSG00000062488 Ifit3b 9.12 1.7E-17 ENSMUSG00000046031 Fam26f 9.05 5.3E-18 ENSMUSG00000027360 Hdc 8.97 1.2E-09 ENSMUSG00000098434 2010110E17Rik 8.97 1.4E-03 ENSMUSG00000062826 Ces2f 8.84 2.0E-52 ENSMUSG00000037405 Icam1 8.78 6.0E-18 ENSMUSG00000032661 Oas3 8.73 9.3E-33 ENSMUSG00000000386 Mx1 8.71 3.3E-16 ENSMUSG00000044006 Cilp2 8.69 3.8E-25 ENSMUSG00000042265 Trem1 8.66 3.9E-05 ENSMUSG00000028037 Ifi44 8.52 5.1E-13 ENSMUSG00000075611 Gm11545 8.50 3.0E-08 ENSMUSG00000024771 Lipk 8.43 2.7E-35 ENSMUSG00000040328 Olfr56 8.35 4.7E-10 ENSMUSG00000030111 A2m 8.04 5.2E-04 ENSMUSG00000097134 1110002J07Rik 7.99 1.3E-23 ENSMUSG00000032369 Plscr1 7.97 9.8E-39 ENSMUSG00000032845 Alpk2 7.96 1.1E-11 ENSMUSG00000025059 Gk 7.86 1.3E-73 ENSMUSG00000079620 Muc4 7.82 1.5E-13 ENSMUSG00000079014 Serpina3i 7.82 1.2E-02 ENSMUSG00000075010 AW112010 7.81 1.4E-27 ENSMUSG00000011008 Mcoln2 7.80 1.8E-09 ENSMUSG00000021025 Nfkbia 7.78 1.5E-59 ENSMUSG00000107750 Gm44013 7.68 2.3E-21 ENSMUSG00000072620 Slfn2 7.65 4.9E-33 ENSMUSG00000008193 Spib 7.63 9.9E-10 ENSMUSG00000000182 Fgf23 7.62 1.0E-02 ENSMUSG00000030474 Siglece 7.55 1.7E-12 ENSMUSG00000043953 Ccrl2 7.54 1.0E-33 ENSMUSG00000048215 A630023P12Rik 7.54 5.8E-04 ENSMUSG00000082292 Gm12250 7.53 3.5E-24 ENSMUSG00000032338 Hcn4 7.52 1.6E-13 ENSMUSG00000105703 Gm43305 7.47 3.1E-02 ENSMUSG00000031257 Nox1 7.40 9.0E-04 ENSMUSG00000087365 C430049B03Rik 7.27 3.6E-37 ENSMUSG00000041135 Ripk2 7.26 2.2E-161 ENSMUSG00000032000 Birc3 7.10 2.9E-138 ENSMUSG00000052396 Mogat2 7.00 7.4E-30 ENSMUSG00000074896 Ifit3 6.96 9.9E-18 ENSMUSG00000034686 Prr7 6.95 1.0E-20 ENSMUSG00000028859 Csf3r 6.92 1.6E-25

215

ENSMUSG00000023947 Nfkbie 6.92 1.2E-34 ENSMUSG00000100291 2310069B03Rik 6.86 2.8E-10 ENSMUSG00000031762 Mt2 6.84 1.0E-07 ENSMUSG00000079012 Serpina3m 6.81 5.1E-03 ENSMUSG00000074676 Foxs1 6.80 8.4E-23 ENSMUSG00000064280 Ccdc146 6.74 9.5E-07 ENSMUSG00000028270 Gbp2 6.72 9.0E-37 ENSMUSG00000078920 Ifi47 6.67 2.7E-32 ENSMUSG00000078780 Gm5150 6.55 2.2E-02 ENSMUSG00000047517 Dmbt1 6.46 3.6E-12 ENSMUSG00000085078 C030013C21Rik 6.46 3.4E-06 ENSMUSG00000003283 Hck 6.44 5.2E-46 ENSMUSG00000003206 Ebi3 6.44 1.8E-17 ENSMUSG00000017652 Cd40 6.38 4.1E-42 ENSMUSG00000023078 Cxcl13 6.38 5.1E-12 ENSMUSG00000031860 Pbx4 6.34 7.3E-26 ENSMUSG00000051748 Wfdc21 6.34 1.0E-06 ENSMUSG00000020400 Tnip1 6.31 6.7E-93 ENSMUSG00000032691 Nlrp3 6.30 7.4E-08 ENSMUSG00000029605 Oas1b 6.19 4.6E-25 ENSMUSG00000017002 Slpi 6.12 2.3E-19 ENSMUSG00000102055 Gm28913 6.09 9.0E-31 ENSMUSG00000037033 Clca3b 6.08 3.8E-02 ENSMUSG00000086866 4930512H18Rik 6.05 3.4E-02 ENSMUSG00000068606 Gm4841 6.05 5.8E-15 ENSMUSG00000024778 Fas 6.04 2.5E-43 ENSMUSG00000041449 Serpina3h 6.04 3.9E-06 ENSMUSG00000073529 F830208F22Rik 5.98 3.1E-03 ENSMUSG00000102027 Gm28914 5.96 1.4E-08 ENSMUSG00000050141 Fam205c 5.95 1.2E-03 ENSMUSG00000025498 Irf7 5.94 2.2E-15 ENSMUSG00000078612 Fyb2 5.91 2.7E-08 ENSMUSG00000047898 Ccr4 5.91 1.6E-17 ENSMUSG00000021281 Tnfaip2 5.90 1.2E-33 ENSMUSG00000060615 Ang4 5.86 1.4E-02 ENSMUSG00000049100 Pcdh10 5.82 1.9E-10 ENSMUSG00000026725 Tnn 5.76 1.3E-08 ENSMUSG00000034422 Parp14 5.72 1.7E-66 ENSMUSG00000033538 Casp4 5.70 1.5E-12 ENSMUSG00000046958 4930432E11Rik 5.70 1.9E-02 ENSMUSG00000107017 Gm43196 5.67 9.2E-06 ENSMUSG00000035373 Ccl7 5.63 1.5E-02 ENSMUSG00000012428 Steap4 5.61 1.1E-03 ENSMUSG00000070327 Rnf213 5.55 1.3E-30 ENSMUSG00000022176 Rem2 5.51 2.1E-02

216

ENSMUSG00000057615 Ldoc1 5.51 9.0E-04 ENSMUSG00000028051 Hcn3 5.46 5.0E-11 ENSMUSG00000084083 Gm15782 5.43 2.1E-03 ENSMUSG00000016498 Pdcd1lg2 5.37 1.1E-02 ENSMUSG00000036834 Plch1 5.35 7.7E-13 ENSMUSG00000026981 Il1rn 5.31 1.1E-11 ENSMUSG00000066861 Oas1g 5.30 4.8E-08 ENSMUSG00000022906 Parp9 5.27 2.6E-46 ENSMUSG00000054203 Ifi205 5.27 3.9E-07 ENSMUSG00000041481 Serpina3g 5.26 6.6E-07 ENSMUSG00000029762 Akr1b8 5.26 2.6E-07 ENSMUSG00000018920 Cxcl16 5.20 5.6E-96 ENSMUSG00000083195 Gm13567 5.15 7.5E-03 ENSMUSG00000027399 Il1a 5.09 1.6E-11 ENSMUSG00000097081 Gm10425 5.08 2.0E-09 ENSMUSG00000047810 Ccdc88b 5.04 2.0E-27 ENSMUSG00000033355 Rtp4 5.03 8.7E-33 ENSMUSG00000070524 Fcrlb 5.02 5.1E-04 ENSMUSG00000031722 Hp 5.01 1.7E-02 ENSMUSG00000002983 Relb 4.98 1.1E-18 ENSMUSG00000040483 Xaf1 4.94 2.8E-18 ENSMUSG00000030107 Usp18 4.94 5.3E-17 ENSMUSG00000035356 Nfkbiz 4.92 7.5E-28 ENSMUSG00000022949 Clic6 4.89 1.5E-09 ENSMUSG00000030921 Trim30a 4.89 1.6E-21 ENSMUSG00000049502 Dtx3l 4.88 4.2E-66 ENSMUSG00000046999 1110032F04Rik 4.84 1.8E-02 ENSMUSG00000037443 Cep85 4.81 7.8E-14 ENSMUSG00000055994 Nod2 4.81 3.4E-28 ENSMUSG00000109485 Gm45016 4.80 4.2E-02 ENSMUSG00000052776 Oas1a 4.79 4.1E-15 ENSMUSG00000039747 Orai2 4.75 3.4E-35 ENSMUSG00000106734 Gm20559 4.75 9.1E-13 ENSMUSG00000017830 Dhx58 4.75 1.6E-22 ENSMUSG00000038781 Stap2 4.71 2.4E-45 ENSMUSG00000085977 Gm5970 4.71 1.3E-03 ENSMUSG00000031765 Mt1 4.67 2.6E-03 ENSMUSG00000079138 Gm8818 4.66 7.2E-03 ENSMUSG00000058794 Nfe2 4.66 1.8E-06 ENSMUSG00000103292 Gm35048 4.66 8.2E-03 ENSMUSG00000086006 Gm13293 4.63 2.2E-04 ENSMUSG00000047798 Cd300lf 4.60 6.7E-07 ENSMUSG00000034551 Hdx 4.59 1.2E-11 ENSMUSG00000052749 Trim30b 4.58 2.2E-09 ENSMUSG00000078763 Slfn1 4.54 8.1E-14

217

ENSMUSG00000031780 Ccl17 4.54 1.2E-05 ENSMUSG00000027368 Dusp2 4.53 7.9E-11 ENSMUSG00000039193 Nlrc4 4.52 5.0E-16 ENSMUSG00000033508 Asprv1 4.52 6.1E-04 ENSMUSG00000035200 Chrnb4 4.52 3.7E-03 ENSMUSG00000047735 Samd9l 4.51 1.1E-34 ENSMUSG00000109341 Gm30873 4.48 1.3E-02 ENSMUSG00000026971 Itgb6 4.47 3.1E-36 ENSMUSG00000029561 Oasl2 4.47 5.5E-16 ENSMUSG00000067203 H2-K2 4.46 3.5E-11 ENSMUSG00000026149 Tm4sf20 4.44 5.2E-03 ENSMUSG00000029449 Rhof 4.44 4.4E-14 ENSMUSG00000078853 Igtp 4.43 4.1E-17 ENSMUSG00000029005 Draxin 4.41 2.1E-02 ENSMUSG00000024772 Ehd1 4.40 7.7E-44 ENSMUSG00000025225 Nfkb2 4.39 8.3E-21 ENSMUSG00000034266 Batf 4.38 1.2E-10 ENSMUSG00000086347 Gm11626 4.38 2.2E-02 ENSMUSG00000046879 Irgm1 4.37 2.1E-28 ENSMUSG00000099974 Bcl2a1d 4.35 3.6E-13 ENSMUSG00000001249 Hpn 4.33 1.2E-22 ENSMUSG00000085786 Gm15987 4.33 2.2E-09 ENSMUSG00000048992 Prss32 4.32 7.2E-06 ENSMUSG00000044701 Il27 4.32 3.4E-03 ENSMUSG00000107215 Gm43197 4.31 8.9E-08 ENSMUSG00000070868 Skint3 4.30 7.0E-03 ENSMUSG00000035448 Ccr3 4.30 2.3E-02 ENSMUSG00000029798 Herc6 4.28 1.7E-09 ENSMUSG00000102037 Bcl2a1a 4.27 2.8E-04 ENSMUSG00000037580 Gch1 4.27 2.1E-06 ENSMUSG00000015312 Gadd45b 4.26 8.9E-10 ENSMUSG00000058163 Gm5431 4.25 2.3E-04 ENSMUSG00000068245 Phf11d 4.21 8.2E-25 ENSMUSG00000077704 Snord89 4.20 2.9E-02 ENSMUSG00000020901 Pik3r5 4.20 7.4E-17 ENSMUSG00000092035 Peg10 4.20 1.3E-08 ENSMUSG00000108720 Gm44672 4.17 1.6E-02 ENSMUSG00000109864 Eid3 4.15 4.9E-03 ENSMUSG00000031538 Plat 4.15 2.7E-06 ENSMUSG00000032068 Plet1 4.15 1.3E-68 ENSMUSG00000051682 Treml4 4.13 3.0E-03 ENSMUSG00000025429 Pstpip2 4.12 2.3E-35 ENSMUSG00000089776 Gm15684 4.09 3.5E-06 ENSMUSG00000079451 Tmprss11g 4.09 3.0E-02 ENSMUSG00000022938 Fam3b 4.08 6.4E-04

218

ENSMUSG00000079038 D130040H23Rik 4.06 6.3E-14 ENSMUSG00000030595 Nfkbib 4.04 1.0E-59 ENSMUSG00000061825 Ces2c 4.04 3.6E-03 ENSMUSG00000024124 Prss30 4.03 3.0E-02 ENSMUSG00000027514 Zbp1 4.02 1.0E-13 ENSMUSG00000104654 Gm43814 4.00 6.1E-03 ENSMUSG00000057346 Apol9a 3.99 9.2E-11 ENSMUSG00000023041 Krt6b 3.95 1.4E-02 ENSMUSG00000030144 Clec4d 3.95 2.7E-04 ENSMUSG00000036931 Nfkbid 3.95 5.1E-11 ENSMUSG00000031778 Cx3cl1 3.95 1.2E-11 ENSMUSG00000030134 Rasgef1a 3.94 1.4E-13 ENSMUSG00000020701 Tmem132e 3.93 6.5E-06 ENSMUSG00000042388 Dlgap3 3.93 1.3E-05 ENSMUSG00000073409 H2-Q6 3.93 1.9E-21 ENSMUSG00000029417 Cxcl9 3.92 8.2E-04 ENSMUSG00000016496 Cd274 3.92 1.0E-22 ENSMUSG00000045502 Hcar2 3.91 1.1E-21 ENSMUSG00000053338 Tarm1 3.90 1.1E-02 ENSMUSG00000004359 Spic 3.90 5.1E-08 ENSMUSG00000028268 Gbp3 3.89 6.3E-11 ENSMUSG00000110386 Gm42031 3.87 2.2E-11 ENSMUSG00000048905 4930539E08Rik 3.87 9.4E-03 ENSMUSG00000027962 Vcam1 3.87 2.0E-14 ENSMUSG00000030747 Dgat2 3.86 3.1E-06 ENSMUSG00000034394 Lif 3.85 1.7E-23 ENSMUSG00000028262 Clca3a2 3.85 1.2E-25 ENSMUSG00000073555 Gm4951 3.84 1.5E-05 ENSMUSG00000028699 Tspan1 3.84 9.5E-05 ENSMUSG00000018569 Cldn7 3.84 1.5E-07 ENSMUSG00000040296 Ddx58 3.83 5.7E-21 ENSMUSG00000091387 Gcnt4 3.82 4.0E-08 ENSMUSG00000026180 Cxcr2 3.82 8.5E-03 ENSMUSG00000026580 Selp 3.82 6.7E-07 ENSMUSG00000086754 Gm16098 3.81 5.4E-04 ENSMUSG00000030156 Cd69 3.80 1.4E-03 ENSMUSG00000035929 H2-Q4 3.79 1.2E-28 ENSMUSG00000025064 Col17a1 3.75 2.7E-02 ENSMUSG00000026536 Ifi211 3.72 1.7E-12 ENSMUSG00000021303 Gng4 3.72 5.9E-05 ENSMUSG00000033213 AA467197 3.72 4.8E-03 ENSMUSG00000026475 Rgs16 3.71 2.4E-02 ENSMUSG00000043939 A530064D06Rik 3.71 1.7E-02 ENSMUSG00000000567 Sox9 3.70 5.9E-06 ENSMUSG00000004446 Bid 3.70 1.5E-16

219

ENSMUSG00000029664 Tfpi2 3.70 2.6E-21 ENSMUSG00000002228 Ppm1j 3.69 7.2E-04 ENSMUSG00000053137 Mapk11 3.68 4.2E-11 ENSMUSG00000027580 Helz2 3.68 3.2E-45 ENSMUSG00000037921 Ddx60 3.68 3.0E-03 ENSMUSG00000106290 Gm43429 3.68 9.4E-03 ENSMUSG00000086324 Gm15564 3.67 1.9E-02 ENSMUSG00000049988 Lrrc25 3.66 1.5E-31 ENSMUSG00000069874 Irgm2 3.66 2.5E-21 ENSMUSG00000027737 Slc7a11 3.64 3.5E-06 ENSMUSG00000024235 Map3k8 3.64 1.7E-16 ENSMUSG00000101009 1700108F19Rik 3.62 3.2E-02 ENSMUSG00000097422 Gm26521 3.62 1.1E-02 ENSMUSG00000108736 Gm45151 3.60 2.1E-04 ENSMUSG00000069919 Hba-a1 3.59 2.8E-02 ENSMUSG00000037440 Vnn1 3.57 4.9E-06 ENSMUSG00000052305 Hbb-bs 3.56 1.5E-02 ENSMUSG00000044350 Lacc1 3.56 4.2E-39 ENSMUSG00000029298 Gbp9 3.56 1.1E-06 ENSMUSG00000097857 Gm26603 3.56 2.1E-02 ENSMUSG00000085958 A930019D19Rik 3.55 1.2E-02 ENSMUSG00000078922 Tgtp1 3.55 5.1E-04 ENSMUSG00000025491 Ifitm1 3.54 8.6E-25 ENSMUSG00000025481 Urah 3.53 1.3E-02 ENSMUSG00000040253 Gbp7 3.53 2.6E-12 ENSMUSG00000039232 Stx11 3.52 4.4E-55 ENSMUSG00000105873 Gm43708 3.51 4.2E-02 ENSMUSG00000032327 Stra6 3.50 5.3E-05 ENSMUSG00000027347 Rasgrp1 3.49 1.9E-08 ENSMUSG00000013643 Lypd8 3.49 5.0E-07 ENSMUSG00000040528 Milr1 3.48 2.1E-17 ENSMUSG00000022780 Meltf 3.48 2.7E-04 ENSMUSG00000011034 Slc5a1 3.44 1.7E-14 ENSMUSG00000057596 Trim30d 3.44 1.4E-11 ENSMUSG00000031880 Rrad 3.44 1.8E-05 ENSMUSG00000086443 4933421A08Rik 3.43 2.9E-02 ENSMUSG00000022237 Ankrd33b 3.40 4.1E-04 ENSMUSG00000038213 Tapbpl 3.40 6.6E-24 ENSMUSG00000040033 Stat2 3.40 4.4E-16 ENSMUSG00000073980 Gm9574 3.40 2.7E-02 ENSMUSG00000049097 Ankrd34a 3.39 3.4E-04 ENSMUSG00000038301 Snx10 3.38 3.3E-26 ENSMUSG00000079197 Psme2 3.37 3.6E-38 ENSMUSG00000029321 Slc10a6 3.37 7.4E-08 ENSMUSG00000054072 Iigp1 3.34 1.2E-06

220

ENSMUSG00000063388 BC023105 3.34 1.3E-03 ENSMUSG00000056144 Trim34a 3.34 3.3E-11 ENSMUSG00000035208 Slfn8 3.33 3.0E-15 ENSMUSG00000026068 Il18rap 3.32 5.9E-05 ENSMUSG00000027215 Cd82 3.32 3.7E-43 ENSMUSG00000022876 Samsn1 3.32 9.3E-05 ENSMUSG00000037321 Tap1 3.32 5.9E-13 ENSMUSG00000022965 Ifngr2 3.30 7.6E-47 ENSMUSG00000045932 Ifit2 3.30 9.8E-10 ENSMUSG00000038201 Kcna7 3.29 2.2E-04 ENSMUSG00000096929 A330023F24Rik 3.29 1.7E-50 ENSMUSG00000056271 Lman1l 3.29 2.4E-03 ENSMUSG00000020723 Cacng4 3.28 4.3E-06 ENSMUSG00000060985 Tdrd5 3.28 1.1E-02 ENSMUSG00000082154 Gm16464 3.28 3.1E-03 ENSMUSG00000032313 Tmem266 3.27 1.0E-05 ENSMUSG00000078783 Gm9733 3.27 3.3E-02 ENSMUSG00000016529 Il10 3.27 6.0E-03 ENSMUSG00000040570 Rundc3b 3.26 2.0E-04 ENSMUSG00000018899 Irf1 3.26 4.2E-10 ENSMUSG00000015652 Steap1 3.25 3.6E-03 ENSMUSG00000000628 Hk2 3.24 1.6E-06 ENSMUSG00000031549 Ido2 3.24 2.5E-02 ENSMUSG00000066258 Trim12a 3.23 5.4E-15 ENSMUSG00000078921 Tgtp2 3.22 1.0E-05 ENSMUSG00000025058 5430427O19Rik 3.22 1.6E-04 ENSMUSG00000019832 Rab32 3.22 3.8E-16 ENSMUSG00000025746 Il6 3.22 1.9E-02 ENSMUSG00000014773 Dll1 3.21 4.6E-09 ENSMUSG00000028965 Tnfrsf9 3.19 2.4E-03 ENSMUSG00000026073 Il1r2 3.19 1.6E-10 ENSMUSG00000038670 Mybpc2 3.18 8.4E-06 ENSMUSG00000059434 Gckr 3.18 1.6E-02 ENSMUSG00000004043 Stat5a 3.18 1.2E-20 ENSMUSG00000022534 Mefv 3.17 7.3E-03 ENSMUSG00000006818 Sod2 3.17 8.2E-40 ENSMUSG00000027333 Smox 3.17 3.2E-13 ENSMUSG00000020599 Rgs9 3.16 9.1E-21 ENSMUSG00000001763 Tspan33 3.15 9.8E-10 ENSMUSG00000047884 Klk9 3.13 1.4E-02 ENSMUSG00000006517 Mvd 3.13 1.0E-24 ENSMUSG00000020250 Txnrd1 3.13 5.1E-12 ENSMUSG00000025270 Alas2 3.12 3.3E-03 ENSMUSG00000012519 Mlkl 3.12 3.9E-08 ENSMUSG00000034917 Tjp3 3.12 1.8E-31

221

ENSMUSG00000030560 Ctsc 3.11 6.7E-29 ENSMUSG00000096727 Psmb9 3.09 7.3E-05 ENSMUSG00000034127 Tspan8 3.09 9.5E-15 ENSMUSG00000029998 Pcyox1 3.07 2.0E-107 ENSMUSG00000003617 Cp 3.06 1.2E-04 ENSMUSG00000071637 Cebpd 3.06 4.3E-02 ENSMUSG00000073940 Hbb-bt 3.05 6.4E-04 ENSMUSG00000052271 Bhlha15 3.05 6.7E-07 ENSMUSG00000097418 Mir155hg 3.04 2.9E-05 ENSMUSG00000030717 Nupr1 3.04 3.8E-14 ENSMUSG00000026874 Hc 3.04 5.2E-03 ENSMUSG00000030366 Ceacam12 3.03 1.4E-02 ENSMUSG00000024737 Slc15a3 3.02 1.8E-05 ENSMUSG00000043263 Ifi209 3.02 2.4E-11 ENSMUSG00000100141 Gm6445 3.02 2.3E-02 ENSMUSG00000031994 Adamts8 3.02 3.5E-06 ENSMUSG00000069917 Hba-a2 3.01 4.6E-03 ENSMUSG00000025492 Ifitm3 3.00 1.9E-16 ENSMUSG00000028163 Nfkb1 3.00 4.3E-16 ENSMUSG00000062007 Hsh2d 2.99 1.1E-02 ENSMUSG00000063268 Parp10 2.99 9.1E-19 ENSMUSG00000033220 Rac2 2.98 5.7E-12 ENSMUSG00000035683 Melk 2.98 3.7E-04 ENSMUSG00000060878 Olfr1420 2.98 7.8E-03 ENSMUSG00000067297 Ifit1bl2 2.97 2.8E-04 ENSMUSG00000022885 St6gal1 2.97 3.5E-16 ENSMUSG00000101304 Plet1os 2.97 7.9E-13 ENSMUSG00000108456 4732496C06Rik 2.97 2.8E-14 ENSMUSG00000025044 Msr1 2.97 2.7E-06 ENSMUSG00000105613 Gm43684 2.95 1.4E-02 ENSMUSG00000024743 Syt7 2.95 1.1E-08 ENSMUSG00000028392 Bspry 2.95 6.1E-14 ENSMUSG00000031024 St5 2.94 1.1E-14 ENSMUSG00000053004 Hrh1 2.94 6.1E-07 ENSMUSG00000075302 Erich2 2.92 2.5E-05 ENSMUSG00000020181 Nav3 2.92 2.2E-05 ENSMUSG00000051022 Hs3st1 2.92 4.4E-05 ENSMUSG00000039672 Kcne2 2.92 1.0E-02 ENSMUSG00000002289 Angptl4 2.92 1.7E-05 ENSMUSG00000041949 Tango6 2.91 2.5E-27 ENSMUSG00000006724 Cyp27b1 2.91 6.0E-03 ENSMUSG00000027469 Tpx2 2.91 4.5E-06 ENSMUSG00000040723 Rcsd1 2.90 5.0E-05 ENSMUSG00000097567 Gm26637 2.89 1.3E-05 ENSMUSG00000026077 Npas2 2.88 3.4E-13

222

ENSMUSG00000073234 Gm8773 2.88 3.4E-03 ENSMUSG00000031897 Psmb10 2.88 1.5E-23 ENSMUSG00000051225 Fam83a 2.87 1.9E-02 ENSMUSG00000042333 Tnfrsf14 2.87 3.8E-07 ENSMUSG00000026896 Ifih1 2.87 4.6E-11 ENSMUSG00000059493 Nhs 2.87 3.0E-08 ENSMUSG00000003644 Rps6ka1 2.87 6.6E-10 ENSMUSG00000010601 Apol7a 2.87 3.3E-05 ENSMUSG00000030966 Trim21 2.87 1.9E-31 ENSMUSG00000039997 Ifi203 2.86 1.7E-06 ENSMUSG00000038045 Sult6b1 2.86 1.1E-04 ENSMUSG00000032690 Oas2 2.86 1.1E-08 ENSMUSG00000006519 Cyba 2.85 1.7E-16 ENSMUSG00000002227 Mov10 2.85 1.6E-13 ENSMUSG00000023206 Il15ra 2.84 3.3E-08 ENSMUSG00000042228 Lyn 2.84 2.5E-30 ENSMUSG00000020227 Irak3 2.84 2.7E-17 ENSMUSG00000104728 Gm42462 2.83 3.2E-02 ENSMUSG00000027078 Ube2l6 2.83 1.0E-08 ENSMUSG00000055413 H2-Q5 2.83 5.5E-10 ENSMUSG00000059089 Fcgr4 2.82 8.5E-04 ENSMUSG00000037849 Ifi206 2.81 6.8E-04 ENSMUSG00000091549 Gm6548 2.81 1.1E-12 ENSMUSG00000020737 Jpt1 2.81 1.9E-16 ENSMUSG00000032596 Uba7 2.80 1.2E-09 ENSMUSG00000026994 Galnt3 2.79 5.1E-05 ENSMUSG00000028874 Fgr 2.78 1.3E-05 ENSMUSG00000039981 Zc3h12d 2.78 9.3E-06 ENSMUSG00000023084 Lrrc71 2.78 3.7E-02 ENSMUSG00000015533 Itga2 2.77 1.7E-05 ENSMUSG00000036832 Lpar3 2.77 3.9E-22 ENSMUSG00000031803 B3gnt3 2.76 2.6E-07 ENSMUSG00000025938 Slco5a1 2.76 9.0E-03 ENSMUSG00000073491 Ifi213 2.75 1.3E-03 ENSMUSG00000048852 Gm12185 2.74 3.3E-02 ENSMUSG00000002076 Hsf2bp 2.74 1.0E-02 ENSMUSG00000025076 Casp7 2.73 9.2E-23 ENSMUSG00000035004 Igsf6 2.73 5.8E-08 ENSMUSG00000038037 Socs1 2.73 2.5E-09 ENSMUSG00000030157 Clec2d 2.72 1.4E-21 ENSMUSG00000033016 Nfatc1 2.71 2.5E-10 ENSMUSG00000068246 Apol9b 2.71 1.2E-03 ENSMUSG00000044309 Apol7c 2.71 8.3E-03 ENSMUSG00000020407 Upp1 2.71 1.1E-03 ENSMUSG00000035861 Tmprss11b 2.71 7.9E-03

223

ENSMUSG00000024338 Psmb8 2.71 6.7E-11 ENSMUSG00000015437 Gzmb 2.70 4.0E-04 ENSMUSG00000045216 Hs6st1 2.70 1.5E-06 ENSMUSG00000053475 Tnfaip6 2.70 2.0E-02 ENSMUSG00000048621 Gm6377 2.69 3.4E-02 ENSMUSG00000002020 Ltbp2 2.69 1.1E-08 ENSMUSG00000090272 Mndal 2.69 5.2E-08 ENSMUSG00000053626 Tll1 2.69 1.4E-03 ENSMUSG00000085894 Gm15832 2.68 4.6E-05 ENSMUSG00000006587 Snai3 2.68 5.8E-04 ENSMUSG00000032776 Mctp2 2.68 5.8E-06 ENSMUSG00000024079 Eif2ak2 2.68 1.9E-19 ENSMUSG00000031444 F10 2.68 1.0E-03 ENSMUSG00000026875 Traf1 2.67 1.1E-08 ENSMUSG00000021871 Gm49342 2.66 2.2E-13 ENSMUSG00000000562 Adora3 2.66 7.0E-03 ENSMUSG00000072244 Trim6 2.65 1.0E-02 ENSMUSG00000032174 Icam5 2.65 3.5E-05 ENSMUSG00000097566 A930024N18Rik 2.65 2.0E-08 ENSMUSG00000018387 Shroom1 2.64 6.4E-23 ENSMUSG00000047786 Lix1 2.64 3.3E-02 ENSMUSG00000043421 Hilpda 2.63 1.5E-05 ENSMUSG00000054204 Alkal2 2.63 3.9E-02 ENSMUSG00000024349 Tmem173 2.62 1.1E-04 ENSMUSG00000091649 Phf11b 2.62 8.4E-04 ENSMUSG00000035352 Ccl12 2.61 2.0E-05 ENSMUSG00000026770 Il2ra 2.61 4.2E-07 ENSMUSG00000035042 Ccl5 2.61 1.6E-04 ENSMUSG00000028599 Tnfrsf1b 2.61 1.3E-16 ENSMUSG00000033545 Znrf1 2.61 1.9E-06 ENSMUSG00000028525 Pde4b 2.61 5.7E-07 ENSMUSG00000032812 Arap1 2.60 1.1E-09 ENSMUSG00000021256 Vash1 2.60 1.7E-04 ENSMUSG00000042784 Muc1 2.59 5.5E-04 ENSMUSG00000073489 Ifi204 2.59 2.1E-04 ENSMUSG00000103108 Rncr4 2.59 4.9E-02 ENSMUSG00000031896 Ctrl 2.58 3.6E-03 ENSMUSG00000002325 Irf9 2.58 3.5E-11 ENSMUSG00000028970 Abcb1b 2.58 3.9E-16 ENSMUSG00000038507 Parp12 2.57 4.8E-11 ENSMUSG00000096957 E230013L22Rik 2.57 9.5E-07 ENSMUSG00000039501 Znfx1 2.57 2.7E-32 ENSMUSG00000053641 Dennd4a 2.56 1.2E-16 ENSMUSG00000017009 Sdc4 2.56 7.8E-09 ENSMUSG00000087651 1500009L16Rik 2.56 1.2E-06

224

ENSMUSG00000034329 Brip1 2.55 6.9E-04 ENSMUSG00000060550 H2-Q7 2.55 1.5E-07 ENSMUSG00000030199 Etv6 2.55 2.7E-12 ENSMUSG00000013846 St3gal1 2.54 5.1E-09 ENSMUSG00000035852 Misp 2.54 2.0E-03 ENSMUSG00000103313 Gm38357 2.54 1.9E-02 ENSMUSG00000097077 Gm16712 2.54 2.0E-02 ENSMUSG00000032572 Col6a4 2.54 5.1E-07 ENSMUSG00000079414 Gm11110 2.53 1.4E-02 ENSMUSG00000028793 Rnf19b 2.53 3.0E-10 ENSMUSG00000055216 9430025C20Rik 2.53 8.8E-03 ENSMUSG00000029322 Plac8 2.53 3.5E-06 ENSMUSG00000038525 Armc10 2.53 3.1E-39 ENSMUSG00000001248 Gramd1a 2.52 1.2E-20 ENSMUSG00000028655 Mfsd2a 2.52 4.6E-04 ENSMUSG00000019979 Apaf1 2.52 3.5E-15 ENSMUSG00000022575 Gsdmd 2.51 5.5E-14 ENSMUSG00000030748 Il4ra 2.51 4.1E-03 ENSMUSG00000050737 Ptges 2.51 9.3E-18 ENSMUSG00000021125 Arg2 2.51 5.3E-08 ENSMUSG00000001014 Icam4 2.51 1.3E-02 ENSMUSG00000025283 Sat1 2.51 4.6E-16 ENSMUSG00000027570 Col9a3 2.50 2.1E-03 ENSMUSG00000044827 Tlr1 2.50 1.1E-08 ENSMUSG00000100813 Gm28874 2.50 5.2E-05 ENSMUSG00000042249 Grk3 2.49 5.4E-17 ENSMUSG00000040111 Gramd1b 2.49 3.1E-04 ENSMUSG00000079363 Gbp4 2.49 5.9E-03 ENSMUSG00000008496 Pou2f2 2.49 1.1E-06 ENSMUSG00000019779 Frk 2.48 2.1E-12 ENSMUSG00000085852 Gm13807 2.48 9.2E-08 ENSMUSG00000047098 Rnf31 2.48 4.3E-24 ENSMUSG00000016526 Dyrk3 2.47 8.8E-03 ENSMUSG00000022500 Litaf 2.47 4.6E-06 ENSMUSG00000032688 Malt1 2.47 8.6E-23 ENSMUSG00000055926 Gm14137 2.47 1.1E-09 ENSMUSG00000040093 Bmf 2.47 9.8E-08 ENSMUSG00000004885 Crabp2 2.45 1.2E-05 ENSMUSG00000018012 Rac3 2.45 6.7E-07 ENSMUSG00000026088 Mitd1 2.44 9.0E-12 ENSMUSG00000053318 Slamf8 2.44 1.0E-04 ENSMUSG00000015396 Cd83 2.44 1.4E-04 ENSMUSG00000021702 Thbs4 2.44 4.4E-02 ENSMUSG00000026222 Sp100 2.44 9.6E-05 ENSMUSG00000057367 Birc2 2.43 2.5E-30

225

ENSMUSG00000025017 Pik3ap1 2.43 4.9E-09 ENSMUSG00000040525 Cblc 2.42 4.0E-10 ENSMUSG00000074272 Ceacam1 2.42 4.1E-05 ENSMUSG00000031551 Ido1 2.42 3.0E-03 ENSMUSG00000002111 Spi1 2.42 3.6E-13 ENSMUSG00000030895 Hpx 2.42 5.0E-02 ENSMUSG00000087006 Gm13889 2.41 6.7E-03 ENSMUSG00000109244 Gm44751 2.41 2.8E-07 ENSMUSG00000049037 Clec4a1 2.41 9.9E-05 ENSMUSG00000043439 Epop 2.41 9.7E-03 ENSMUSG00000075602 Ly6a 2.41 2.5E-05 ENSMUSG00000102719 Gm37760 2.41 3.0E-02 ENSMUSG00000019320 Noxo1 2.40 5.0E-06 ENSMUSG00000050747 Trim15 2.40 1.4E-02 ENSMUSG00000025582 Nptx1 2.40 5.7E-03 ENSMUSG00000060519 Tor3a 2.40 2.0E-13 ENSMUSG00000006930 Hap1 2.40 3.8E-06 ENSMUSG00000021556 Golm1 2.40 5.9E-20 ENSMUSG00000004864 Mapk13 2.39 5.3E-11 ENSMUSG00000035105 Egln3 2.39 1.7E-10 ENSMUSG00000026417 Pigr 2.39 1.4E-04 ENSMUSG00000039236 Isg20 2.39 3.1E-14 ENSMUSG00000019122 Ccl9 2.39 5.2E-03 ENSMUSG00000078606 Gm4070 2.39 4.7E-03 ENSMUSG00000037095 Lrg1 2.39 3.5E-05 ENSMUSG00000057137 Tmem140 2.38 4.1E-07 ENSMUSG00000010358 Ifi35 2.37 9.1E-08 ENSMUSG00000032380 Dapk2 2.37 1.2E-03 ENSMUSG00000078238 Gm12854 2.37 3.5E-03 ENSMUSG00000021280 Exoc3l4 2.36 4.9E-03 ENSMUSG00000087150 BC064078 2.36 9.3E-13 ENSMUSG00000066677 Ifi208 2.36 2.8E-02 ENSMUSG00000032724 Abtb2 2.36 5.4E-10 ENSMUSG00000007034 Slc44a4 2.36 1.7E-10 ENSMUSG00000024308 Tapbp 2.36 2.0E-16 ENSMUSG00000036606 Plxnb2 2.35 2.3E-13 ENSMUSG00000058818 Pirb 2.35 7.5E-15 ENSMUSG00000026104 Stat1 2.35 2.4E-07 ENSMUSG00000055602 Tcp10b 2.34 1.2E-02 ENSMUSG00000041984 Rptn 2.34 1.1E-03 ENSMUSG00000035337 Uchl4 2.34 4.6E-02 ENSMUSG00000016024 Lbp 2.33 5.0E-16 ENSMUSG00000029084 Cd38 2.33 3.7E-10 ENSMUSG00000039328 Rnf122 2.32 5.0E-04 ENSMUSG00000009621 Vav2 2.32 4.1E-22

226

ENSMUSG00000071414 Gm6736 2.32 1.6E-02 ENSMUSG00000092134 Gm17089 2.32 1.3E-02 ENSMUSG00000026946 Nmi 2.32 5.3E-11 ENSMUSG00000026470 Stx6 2.32 2.6E-25 ENSMUSG00000078153 Psme2b 2.32 1.4E-02 ENSMUSG00000029915 Clec5a 2.31 4.9E-02 ENSMUSG00000080115 Eef1akmt3 2.31 2.2E-05 ENSMUSG00000024842 Cabp4 2.31 6.9E-03 ENSMUSG00000027951 Adar 2.31 9.9E-14 ENSMUSG00000037347 Chst7 2.31 4.2E-05 ENSMUSG00000018417 Myo1b 2.30 2.5E-13 ENSMUSG00000001750 Tcirg1 2.30 3.0E-10 ENSMUSG00000054404 Slfn5 2.30 1.6E-06 ENSMUSG00000018334 Ksr1 2.30 1.5E-10 ENSMUSG00000005087 Cd44 2.29 1.2E-02 ENSMUSG00000070284 Gmppb 2.29 1.2E-07 ENSMUSG00000026435 Slc45a3 2.29 7.8E-04 ENSMUSG00000020062 Slc5a8 2.28 3.5E-02 ENSMUSG00000047557 Lxn 2.28 1.7E-15 ENSMUSG00000025779 Ly96 2.28 1.5E-08 ENSMUSG00000001542 Ell2 2.28 1.2E-07 ENSMUSG00000061731 Ext1 2.28 1.5E-06 ENSMUSG00000027555 Car13 2.28 4.8E-06 ENSMUSG00000057143 Trim12c 2.27 6.6E-08 ENSMUSG00000049401 Ogfr 2.26 1.7E-12 ENSMUSG00000090891 D6Ertd527e 2.26 6.8E-04 ENSMUSG00000037428 Vgf 2.26 5.0E-02 ENSMUSG00000062794 Zfp599 2.26 2.5E-04 ENSMUSG00000031504 Rab20 2.25 2.1E-08 ENSMUSG00000021133 Susd6 2.25 2.3E-18 ENSMUSG00000108732 2310043P16Rik 2.25 1.0E-02 ENSMUSG00000044719 E230025N22Rik 2.25 5.8E-03 ENSMUSG00000024539 Ptpn2 2.24 4.0E-08 ENSMUSG00000097610 A930012L18Rik 2.24 3.0E-02 ENSMUSG00000031652 N4bp1 2.24 1.0E-23 ENSMUSG00000052125 F730043M19Rik 2.24 7.5E-06 ENSMUSG00000110605 Gm32856 2.24 1.6E-03 ENSMUSG00000024339 Tap2 2.24 4.2E-13 ENSMUSG00000039699 Batf2 2.23 2.0E-03 ENSMUSG00000085501 Gm11772 2.23 1.7E-02 ENSMUSG00000026676 Ccdc3 2.23 5.3E-05 ENSMUSG00000032508 Myd88 2.23 1.6E-03 ENSMUSG00000027087 Itgav 2.23 4.7E-18 ENSMUSG00000041782 Lad1 2.22 2.0E-05 ENSMUSG00000025150 Cbr2 2.22 1.6E-07

227

ENSMUSG00000042306 S100a14 2.22 1.5E-02 ENSMUSG00000042607 Asb4 2.22 1.6E-03 ENSMUSG00000032487 Ptgs2 2.22 9.7E-04 ENSMUSG00000022111 Uchl3 2.21 1.4E-03 ENSMUSG00000089901 Gm8113 2.21 1.2E-04 ENSMUSG00000078954 Arhgap8 2.21 7.6E-05 ENSMUSG00000040829 Zmynd15 2.21 2.1E-03 ENSMUSG00000030269 Mtmr14 2.21 8.4E-19 ENSMUSG00000109408 A930037H05Rik 2.21 2.9E-03 ENSMUSG00000042195 Slc35f2 2.21 2.3E-03 ENSMUSG00000045392 Olfr1033 2.21 3.2E-02 ENSMUSG00000025921 Rdh10 2.21 4.0E-03 ENSMUSG00000025227 Mfsd13a 2.20 5.2E-07 ENSMUSG00000046711 Hmga1 2.20 1.2E-03 ENSMUSG00000082560 Gm15157 2.20 4.2E-02 ENSMUSG00000060441 Trim5 2.20 3.5E-04 ENSMUSG00000023088 Abcc1 2.19 4.5E-10 ENSMUSG00000027613 Eif6 2.19 9.5E-05 ENSMUSG00000015947 Fcgr1 2.18 4.1E-04 ENSMUSG00000018821 Avpi1 2.18 2.1E-03 ENSMUSG00000035678 Tnfsf9 2.18 7.6E-03 ENSMUSG00000034591 Slc41a2 2.17 2.1E-06 ENSMUSG00000029992 Gfpt1 2.17 2.2E-10 ENSMUSG00000025314 Ptprj 2.17 6.4E-11 ENSMUSG00000020120 Plek 2.17 4.5E-03 ENSMUSG00000030681 Mvp 2.17 4.6E-05 ENSMUSG00000025889 Snca 2.17 1.3E-02 ENSMUSG00000078813 Leng1 2.17 1.2E-09 ENSMUSG00000060512 0610040J01Rik 2.16 1.6E-03 ENSMUSG00000055865 Fam19a3 2.16 3.6E-02 ENSMUSG00000024014 Pim1 2.16 2.4E-10 ENSMUSG00000023087 Noct 2.16 2.5E-02 ENSMUSG00000100280 Gm28417 2.16 3.7E-03 ENSMUSG00000076867 Trdv4 2.16 4.6E-02 ENSMUSG00000006731 B4galnt1 2.16 1.7E-06 ENSMUSG00000087700 Gm15283 2.15 1.1E-02 ENSMUSG00000026942 Traf2 2.15 4.6E-15 ENSMUSG00000017057 Il13ra1 2.15 2.3E-03 ENSMUSG00000048234 Rnf149 2.15 2.8E-09 ENSMUSG00000087141 Plcxd2 2.15 6.0E-06 ENSMUSG00000023048 Prr13 2.15 3.6E-04 ENSMUSG00000024679 Ms4a6d 2.15 1.3E-02 ENSMUSG00000028480 Glipr2 2.15 1.7E-08 ENSMUSG00000026656 Fcgr2b 2.14 1.5E-05 ENSMUSG00000039911 Spsb1 2.14 1.4E-05

228

ENSMUSG00000053886 Sh2d4a 2.14 1.5E-07 ENSMUSG00000069910 Spdl1 2.14 1.6E-03 ENSMUSG00000097000 Gm17435 2.14 3.2E-04 ENSMUSG00000020733 Slc9a3r1 2.13 3.1E-38 ENSMUSG00000056501 Cebpb 2.13 4.9E-03 ENSMUSG00000073802 Cdkn2b 2.13 2.1E-16 ENSMUSG00000023030 Slc11a2 2.12 1.4E-05 ENSMUSG00000029826 Zc3hav1 2.12 2.2E-35 ENSMUSG00000031877 Ces2g 2.12 2.8E-10 ENSMUSG00000069808 Fam57a 2.11 1.7E-02 ENSMUSG00000002699 Lcp2 2.11 9.0E-04 ENSMUSG00000028159 Dapp1 2.11 2.8E-05 ENSMUSG00000024675 Ms4a4c 2.11 1.5E-05 ENSMUSG00000052310 Slc39a1 2.10 1.9E-06 ENSMUSG00000109555 Gm44891 2.10 1.6E-02 ENSMUSG00000078249 Hmga1b 2.10 1.9E-02 ENSMUSG00000026473 Glul 2.09 3.2E-09 ENSMUSG00000038422 Hdhd3 2.09 4.5E-04 ENSMUSG00000025068 Gsto1 2.09 1.0E-03 ENSMUSG00000024379 Tslp 2.09 7.9E-04 ENSMUSG00000042808 Gpx2 2.09 9.9E-03 ENSMUSG00000044024 Rell2 2.09 3.4E-02 ENSMUSG00000015536 Mocs2 2.09 2.4E-15 ENSMUSG00000048216 Gpr85 2.08 1.9E-02 ENSMUSG00000043924 Ncmap 2.08 1.4E-05 ENSMUSG00000035314 Gdpd5 2.08 1.3E-08 ENSMUSG00000024561 Mbd1 2.08 1.2E-17 ENSMUSG00000022848 Dirc2 2.08 1.5E-11 ENSMUSG00000053166 Cdh22 2.08 3.4E-06 ENSMUSG00000039304 Tnfsf10 2.07 1.5E-02 ENSMUSG00000054520 Sh3bp2 2.07 3.4E-05 ENSMUSG00000028100 Nudt17 2.07 8.6E-04 ENSMUSG00000030790 Adm 2.07 8.9E-06 ENSMUSG00000046718 Bst2 2.06 7.3E-06 ENSMUSG00000049897 Stkld1 2.06 2.6E-02 ENSMUSG00000079659 Tmem243 2.06 1.2E-15 ENSMUSG00000069792 Wfdc17 2.06 3.1E-04 ENSMUSG00000069793 Slfn9 2.06 3.0E-03 ENSMUSG00000046546 Fam43a 2.06 4.7E-02 ENSMUSG00000035376 Hacd2 2.06 9.2E-11 ENSMUSG00000029370 Rassf6 2.06 4.1E-03 ENSMUSG00000057421 Las1l 2.05 2.0E-04 ENSMUSG00000024399 Ltb 2.05 1.2E-02 ENSMUSG00000031825 Crispld2 2.05 3.4E-04 ENSMUSG00000070034 Sp110 2.05 5.5E-07

229

ENSMUSG00000024479 Mal2 2.05 2.9E-04 ENSMUSG00000030148 Clec4a2 2.05 3.1E-04 ENSMUSG00000035441 Myo1d 2.05 2.7E-06 ENSMUSG00000006169 Clint1 2.05 3.0E-07 ENSMUSG00000043613 Mmp3 2.04 4.0E-02 ENSMUSG00000020077 Srgn 2.04 4.8E-09 ENSMUSG00000037872 Ackr1 2.04 1.4E-02 ENSMUSG00000044244 Il20rb 2.04 1.6E-03 ENSMUSG00000068011 Mkrn2os 2.04 2.7E-02 ENSMUSG00000040688 Tbl3 2.04 6.4E-04 ENSMUSG00000000275 Trim25 2.03 4.7E-09 ENSMUSG00000017692 Rhbdl3 2.03 7.5E-08 ENSMUSG00000019876 Pkib 2.03 2.8E-02 ENSMUSG00000022146 Osmr 2.03 5.8E-03 ENSMUSG00000070031 Sp140 2.03 3.1E-04 ENSMUSG00000039676 Capsl 2.03 9.5E-03 ENSMUSG00000043832 Clec4a3 2.03 2.9E-02 ENSMUSG00000061665 Cd2ap 2.03 1.1E-37 ENSMUSG00000026806 Ddx31 2.02 6.7E-04 ENSMUSG00000042106 Fam212a 2.02 4.2E-06 ENSMUSG00000029375 Cxcl15 2.02 4.4E-02 ENSMUSG00000103711 Tstd1 2.02 7.1E-03 ENSMUSG00000036053 Fmnl2 2.02 1.0E-10 ENSMUSG00000040552 C3ar1 2.01 3.2E-07 ENSMUSG00000072115 Ang 2.01 9.7E-08 ENSMUSG00000033487 Fndc3a 2.01 2.6E-19 ENSMUSG00000041992 Rapgef5 2.01 3.3E-07 ENSMUSG00000097121 D130020L05Rik 2.01 1.9E-02 ENSMUSG00000035498 Cdcp1 2.01 1.7E-07 ENSMUSG00000020484 Xbp1 2.01 3.4E-05 ENSMUSG00000033644 Piwil2 2.01 1.3E-02 ENSMUSG00000032712 2810474O19Rik 2.00 4.7E-14 ENSMUSG00000001156 Mxd1 2.00 7.9E-10 ENSMUSG00000049265 Kcnk3 -2.00 3.8E-04 ENSMUSG00000031788 Kifc3 -2.00 1.5E-05 ENSMUSG00000060380 C030014I23Rik -2.00 5.2E-07 ENSMUSG00000059668 Krt4 -2.00 9.1E-03 ENSMUSG00000027254 Map1a -2.00 5.8E-04 ENSMUSG00000075033 Nxpe3 -2.01 1.2E-04 ENSMUSG00000072066 6720489N17Rik -2.01 3.4E-02 ENSMUSG00000022383 Ppara -2.01 8.4E-07 ENSMUSG00000072769 Gm10419 -2.01 8.4E-03 ENSMUSG00000022364 Tbc1d31 -2.01 2.5E-02 ENSMUSG00000042807 Hecw2 -2.01 1.3E-06 ENSMUSG00000046613 Vwa5b2 -2.01 3.6E-02

230

ENSMUSG00000038349 Plcl1 -2.01 3.1E-03 ENSMUSG00000041245 Wnk3 -2.01 1.9E-02 ENSMUSG00000010051 Hyal1 -2.01 1.9E-13 ENSMUSG00000018168 Ikzf3 -2.01 3.1E-08 ENSMUSG00000039765 Cc2d2a -2.01 1.4E-02 ENSMUSG00000089804 Gm16136 -2.02 2.5E-07 ENSMUSG00000055323 Gm9967 -2.02 3.6E-03 ENSMUSG00000047888 Tnrc6b -2.02 1.1E-04 ENSMUSG00000028545 Bend5 -2.02 1.6E-04 ENSMUSG00000046318 Ccbe1 -2.02 4.8E-03 ENSMUSG00000021719 Rgs7bp -2.02 3.8E-03 ENSMUSG00000039891 Txlnb -2.03 2.6E-02 ENSMUSG00000032028 Nxpe2 -2.03 1.8E-02 ENSMUSG00000078640 Gm11627 -2.03 5.8E-04 ENSMUSG00000097084 Foxl1 -2.03 2.5E-02 ENSMUSG00000036641 Ccdc148 -2.03 2.7E-03 ENSMUSG00000021466 Ptch1 -2.03 2.8E-02 ENSMUSG00000038119 Cdon -2.04 2.2E-04 ENSMUSG00000044340 Phlpp1 -2.04 1.9E-08 ENSMUSG00000025656 Arhgef9 -2.04 1.3E-03 ENSMUSG00000044708 Kcnj10 -2.04 2.5E-02 ENSMUSG00000031133 Arhgef6 -2.04 4.0E-03 ENSMUSG00000052331 Ankrd44 -2.04 4.9E-06 ENSMUSG00000015476 Prrt1 -2.04 9.6E-05 ENSMUSG00000020212 Mdm1 -2.04 4.6E-04 ENSMUSG00000075420 Smim6 -2.04 1.0E-05 ENSMUSG00000022099 Dmtn -2.04 5.3E-09 ENSMUSG00000020335 Zfp354b -2.04 1.1E-02 ENSMUSG00000061536 Sec22c -2.04 1.6E-05 ENSMUSG00000048706 Lurap1l -2.04 1.3E-08 ENSMUSG00000045629 Sh3tc2 -2.04 5.6E-12 ENSMUSG00000047344 Lancl3 -2.05 3.8E-09 ENSMUSG00000024063 Lbh -2.05 3.1E-09 ENSMUSG00000021767 Kat6b -2.05 7.6E-05 ENSMUSG00000032064 Dixdc1 -2.05 2.6E-03 ENSMUSG00000029260 Ugt2b34 -2.06 2.1E-03 ENSMUSG00000040852 Plekhh2 -2.06 2.1E-03 ENSMUSG00000042118 Bhmt2 -2.06 6.8E-03 ENSMUSG00000028782 Adgrb2 -2.06 8.7E-03 ENSMUSG00000032549 Rab6b -2.06 2.7E-05 ENSMUSG00000053580 Tanc2 -2.06 1.6E-03 ENSMUSG00000044927 H1fx -2.06 4.3E-02 ENSMUSG00000038570 Saxo2 -2.06 1.5E-02 ENSMUSG00000048814 Lonrf2 -2.06 8.9E-06 ENSMUSG00000026259 Ngef -2.07 9.8E-05

231

ENSMUSG00000028565 Nfia -2.07 3.4E-03 ENSMUSG00000021200 Asb2 -2.07 5.6E-03 ENSMUSG00000053964 Lgals4 -2.07 5.5E-09 ENSMUSG00000048058 Ldlrad3 -2.07 2.1E-05 ENSMUSG00000019944 Rhobtb1 -2.07 2.9E-04 ENSMUSG00000027748 Trpc4 -2.07 1.2E-02 ENSMUSG00000084843 B230312C02Rik -2.08 2.2E-03 ENSMUSG00000027035 Cers6 -2.08 4.1E-08 ENSMUSG00000033713 Foxn3 -2.08 1.0E-03 ENSMUSG00000026080 Chst10 -2.08 1.9E-09 ENSMUSG00000066842 Hmcn1 -2.08 2.0E-04 ENSMUSG00000074971 Fibin -2.08 1.9E-03 ENSMUSG00000052135 Foxo6 -2.08 7.2E-03 ENSMUSG00000033767 Tmem131l -2.09 9.4E-09 ENSMUSG00000106951 5930430L01Rik -2.09 1.6E-03 ENSMUSG00000096992 Gm26788 -2.09 3.5E-02 ENSMUSG00000016239 Lonrf3 -2.09 9.7E-03 ENSMUSG00000019813 Cep57l1 -2.09 2.2E-03 ENSMUSG00000021994 Wnt5a -2.09 2.2E-11 ENSMUSG00000040387 Klhl32 -2.09 2.7E-02 ENSMUSG00000041762 Gpr155 -2.09 2.6E-02 ENSMUSG00000106361 Gm35066 -2.10 3.0E-02 ENSMUSG00000043004 Gng2 -2.10 7.7E-03 ENSMUSG00000036186 Fam69b -2.10 1.4E-02 ENSMUSG00000085743 8430419K02Rik -2.10 3.0E-03 ENSMUSG00000039385 Cdh6 -2.10 3.8E-02 ENSMUSG00000052188 Gm14964 -2.10 4.0E-02 ENSMUSG00000032531 Amotl2 -2.10 2.2E-02 ENSMUSG00000004891 Nes -2.11 2.9E-03 ENSMUSG00000108688 Gm44985 -2.11 1.7E-02 ENSMUSG00000073678 Pgap1 -2.11 2.6E-06 ENSMUSG00000032268 Tmprss5 -2.11 4.4E-02 ENSMUSG00000049511 Htr1b -2.12 1.3E-02 ENSMUSG00000019848 Popdc3 -2.12 9.4E-03 ENSMUSG00000091890 A830073O21Rik -2.12 8.7E-03 ENSMUSG00000048782 Insc -2.12 3.6E-02 ENSMUSG00000040950 Mgl2 -2.12 9.6E-04 ENSMUSG00000038893 Fam117a -2.12 2.9E-04 ENSMUSG00000108207 1810059H22Rik -2.12 2.7E-04 ENSMUSG00000054477 Kcnn2 -2.12 7.5E-03 ENSMUSG00000025815 Dhtkd1 -2.12 9.6E-03 ENSMUSG00000027238 Frmd5 -2.13 3.4E-02 ENSMUSG00000050830 Vwc2 -2.13 2.7E-02 ENSMUSG00000020160 Meis1 -2.13 3.3E-06 ENSMUSG00000086266 Igf2os -2.13 3.1E-03

232

ENSMUSG00000034472 Rasd2 -2.13 8.0E-05 ENSMUSG00000034911 Ushbp1 -2.13 4.0E-02 ENSMUSG00000047205 Dusp18 -2.13 4.0E-06 ENSMUSG00000039835 Nhsl1 -2.13 4.4E-08 ENSMUSG00000042797 Aqp11 -2.13 1.2E-05 ENSMUSG00000038903 Ccdc68 -2.13 3.3E-03 ENSMUSG00000085558 4930412C18Rik -2.14 6.8E-04 ENSMUSG00000046794 Ppp1r3b -2.14 9.4E-07 ENSMUSG00000029516 Cit -2.14 1.1E-02 ENSMUSG00000025085 Ablim1 -2.14 2.4E-04 ENSMUSG00000050592 Fam78a -2.14 7.4E-03 ENSMUSG00000087691 Gm15674 -2.14 2.6E-02 ENSMUSG00000001739 Cldn15 -2.14 1.2E-03 ENSMUSG00000019831 Wasf1 -2.15 7.6E-03 ENSMUSG00000107350 Gm19610 -2.15 2.8E-02 ENSMUSG00000087013 2610027K06Rik -2.15 7.7E-08 ENSMUSG00000020431 Adcy1 -2.15 5.6E-05 ENSMUSG00000107000 Gm43481 -2.15 1.2E-03 ENSMUSG00000087368 BC065397 -2.15 2.4E-02 ENSMUSG00000028488 Sh3gl2 -2.15 8.8E-06 ENSMUSG00000097101 1810034E14Rik -2.16 3.0E-03 ENSMUSG00000049907 Rasl11b -2.16 1.4E-09 ENSMUSG00000067889 Sptbn2 -2.16 1.0E-09 ENSMUSG00000037681 Esyt3 -2.16 1.1E-04 ENSMUSG00000021313 Ryr2 -2.16 2.1E-03 ENSMUSG00000019124 Scrn1 -2.16 2.7E-02 ENSMUSG00000046618 Olfml2a -2.16 8.5E-03 ENSMUSG00000061397 Krt79 -2.17 7.8E-04 ENSMUSG00000063430 Wscd2 -2.17 8.4E-03 ENSMUSG00000075592 Nynrin -2.17 7.0E-03 ENSMUSG00000105550 Gm35585 -2.17 3.9E-02 ENSMUSG00000019856 Fam184a -2.17 6.9E-07 ENSMUSG00000051379 Flrt3 -2.17 5.9E-04 ENSMUSG00000040009 Gnaz -2.17 2.6E-04 ENSMUSG00000048337 Npy4r -2.17 1.6E-03 ENSMUSG00000002007 Srpk3 -2.17 4.0E-03 ENSMUSG00000041552 Ptchd1 -2.18 5.6E-04 ENSMUSG00000037188 Grhl3 -2.18 1.0E-13 ENSMUSG00000060568 Fam78b -2.18 9.0E-09 ENSMUSG00000041361 Myzap -2.19 1.4E-08 ENSMUSG00000020173 Cobl -2.19 1.9E-05 ENSMUSG00000074867 Zfp808 -2.19 3.5E-02 ENSMUSG00000020546 Stxbp4 -2.19 9.0E-03 ENSMUSG00000022090 Pdlim2 -2.19 1.5E-02 ENSMUSG00000030465 Psd3 -2.19 1.1E-07

233

ENSMUSG00000053522 Lgals7 -2.19 4.8E-02 ENSMUSG00000024172 St6gal2 -2.20 1.6E-02 ENSMUSG00000027401 Tgm3 -2.20 2.8E-02 ENSMUSG00000097617 Gm10687 -2.20 3.1E-03 ENSMUSG00000054252 Fgfr3 -2.20 2.0E-22 ENSMUSG00000022537 Tmem44 -2.20 2.6E-03 ENSMUSG00000049556 Lingo1 -2.20 7.4E-04 ENSMUSG00000010476 Ebf3 -2.21 4.9E-02 ENSMUSG00000054622 D730045B01Rik -2.21 3.6E-02 ENSMUSG00000031883 Car7 -2.22 1.7E-02 ENSMUSG00000039349 C130074G19Rik -2.22 2.0E-03 ENSMUSG00000040929 Rfx3 -2.22 5.0E-05 ENSMUSG00000023927 Satb1 -2.22 4.7E-06 ENSMUSG00000061414 Cracr2a -2.22 3.9E-02 ENSMUSG00000038600 Atp6v0a4 -2.22 3.0E-02 ENSMUSG00000038132 Rbm24 -2.23 1.8E-04 ENSMUSG00000075324 Fign -2.23 6.8E-05 ENSMUSG00000073414 Mpig6b -2.23 4.6E-02 ENSMUSG00000087314 Prkag2os2 -2.23 2.2E-03 ENSMUSG00000034903 Cobll1 -2.23 3.7E-06 ENSMUSG00000086555 Gm13446 -2.23 1.7E-02 ENSMUSG00000102953 Gm37019 -2.23 1.2E-02 ENSMUSG00000034641 Cd300ld -2.24 1.3E-02 ENSMUSG00000087054 Gm12405 -2.24 3.0E-04 ENSMUSG00000041287 Sox15 -2.24 4.2E-05 ENSMUSG00000037379 Spon2 -2.24 8.3E-04 ENSMUSG00000047496 Rnf152 -2.24 2.4E-03 ENSMUSG00000087371 Gm15541 -2.24 1.3E-02 ENSMUSG00000059857 Ntng1 -2.24 3.1E-02 ENSMUSG00000043587 Pxylp1 -2.24 1.3E-09 ENSMUSG00000043456 Zfp536 -2.25 1.4E-02 ENSMUSG00000071176 Arhgef10 -2.25 2.8E-07 ENSMUSG00000030000 Add2 -2.25 7.4E-05 ENSMUSG00000063594 Gng8 -2.25 1.6E-03 ENSMUSG00000062545 Tlr12 -2.26 3.0E-02 ENSMUSG00000019838 Slc16a10 -2.26 8.2E-04 ENSMUSG00000087670 9530036M11Rik -2.26 3.5E-04 ENSMUSG00000026185 Igfbp5 -2.26 1.0E-05 ENSMUSG00000038949 Cnst -2.26 6.3E-08 ENSMUSG00000079164 Tlr5 -2.27 3.4E-05 ENSMUSG00000070576 Mn1 -2.27 2.3E-04 ENSMUSG00000031302 Nlgn3 -2.28 9.1E-03 ENSMUSG00000086924 Gm11766 -2.28 4.4E-02 ENSMUSG00000041540 Sox5 -2.28 8.6E-03 ENSMUSG00000022860 Chodl -2.28 1.9E-02

234

ENSMUSG00000103160 C130012C08Rik -2.28 3.8E-02 ENSMUSG00000036098 Myrf -2.28 1.7E-02 ENSMUSG00000052572 Dlg2 -2.29 1.2E-03 ENSMUSG00000028005 Gucy1b1 -2.29 5.9E-03 ENSMUSG00000031070 Mrgprf -2.29 9.0E-07 ENSMUSG00000001819 Hoxd13 -2.29 1.0E-06 ENSMUSG00000030256 Bhlhe41 -2.29 1.3E-04 ENSMUSG00000018126 Baiap2l2 -2.30 3.6E-05 ENSMUSG00000032010 Usp2 -2.30 1.6E-10 ENSMUSG00000025658 Cnksr2 -2.30 8.1E-03 ENSMUSG00000085091 Egfros -2.30 1.9E-04 ENSMUSG00000042115 Klhdc8a -2.31 1.4E-04 ENSMUSG00000049107 Ntf3 -2.31 1.0E-02 ENSMUSG00000026141 Col19a1 -2.31 3.0E-02 ENSMUSG00000020793 Galr2 -2.31 2.9E-02 ENSMUSG00000024043 Arhgap28 -2.31 1.0E-02 ENSMUSG00000110170 St6galnac2 -2.32 1.1E-03 ENSMUSG00000047085 Lrrc4b -2.32 2.8E-02 ENSMUSG00000025375 Aatk -2.32 1.3E-07 ENSMUSG00000078307 AI593442 -2.32 3.0E-03 ENSMUSG00000047586 Nccrp1 -2.32 3.1E-02 ENSMUSG00000026207 Speg -2.32 1.2E-07 ENSMUSG00000021318 Gli3 -2.32 2.7E-06 ENSMUSG00000024459 H2-M5 -2.33 2.8E-02 ENSMUSG00000085151 1110018N20Rik -2.33 2.9E-02 ENSMUSG00000038526 Car14 -2.33 5.3E-03 ENSMUSG00000097058 -2.33 3.2E-02 ENSMUSG00000061815 Rufy4 -2.34 1.4E-04 ENSMUSG00000028019 Pdgfc -2.34 8.3E-04 ENSMUSG00000072437 Nanos1 -2.34 1.5E-02 ENSMUSG00000028023 Pitx2 -2.34 2.8E-05 ENSMUSG00000041729 Coro2b -2.34 4.3E-04 ENSMUSG00000033006 Sox10 -2.35 1.4E-06 ENSMUSG00000087291 Gm11946 -2.35 3.6E-05 ENSMUSG00000009633 G0s2 -2.35 7.6E-03 ENSMUSG00000000216 Scnn1g -2.36 1.1E-06 ENSMUSG00000034522 Zfp395 -2.36 4.7E-06 ENSMUSG00000037490 Slc2a12 -2.36 9.3E-06 ENSMUSG00000031659 Adcy7 -2.37 2.0E-02 ENSMUSG00000085779 Atcayos -2.37 7.1E-03 ENSMUSG00000034320 Slc26a2 -2.37 5.1E-26 ENSMUSG00000030866 Ern2 -2.37 9.8E-04 ENSMUSG00000031647 Mfap3l -2.37 5.9E-17 ENSMUSG00000009394 Syn2 -2.37 1.5E-03 ENSMUSG00000049555 Tmie -2.37 3.7E-07

235

ENSMUSG00000106464 C130083M11Rik -2.38 5.7E-03 ENSMUSG00000039706 Ldb2 -2.38 7.7E-03 ENSMUSG00000032649 Colgalt2 -2.38 1.7E-03 ENSMUSG00000037138 Aff3 -2.38 3.0E-02 ENSMUSG00000038319 Kcnh2 -2.38 2.6E-02 ENSMUSG00000045871 Slitrk6 -2.38 3.4E-04 ENSMUSG00000085001 Rapgef4os2 -2.38 6.7E-04 ENSMUSG00000044748 Defb1 -2.38 4.2E-02 ENSMUSG00000052951 C130021I20Rik -2.38 6.1E-04 ENSMUSG00000036944 Tmem71 -2.39 6.4E-11 ENSMUSG00000035878 Hykk -2.39 2.3E-03 ENSMUSG00000031284 Pak3 -2.40 1.7E-03 ENSMUSG00000052085 Dock8 -2.40 7.2E-06 ENSMUSG00000004151 Etv1 -2.40 2.2E-02 ENSMUSG00000041324 Inhba -2.40 1.1E-02 ENSMUSG00000024299 Adamts10 -2.40 2.5E-02 ENSMUSG00000085971 Gm15411 -2.41 1.4E-06 ENSMUSG00000003863 Ppfia3 -2.41 1.7E-02 ENSMUSG00000042041 2010003K11Rik -2.41 3.7E-02 ENSMUSG00000061578 Ksr2 -2.41 1.5E-05 ENSMUSG00000037016 Frem2 -2.41 1.3E-02 ENSMUSG00000056602 Fry -2.41 1.6E-03 ENSMUSG00000105366 Gm43719 -2.42 6.0E-05 ENSMUSG00000046312 AI464131 -2.43 3.5E-03 ENSMUSG00000048096 Lmod1 -2.43 3.7E-03 ENSMUSG00000097157 Gm26512 -2.43 4.0E-02 ENSMUSG00000040543 Pitpnm3 -2.43 4.3E-08 ENSMUSG00000042851 Zc3h6 -2.43 1.9E-03 ENSMUSG00000090671 Gm5067 -2.43 2.3E-02 ENSMUSG00000028031 Dkk2 -2.44 4.0E-03 ENSMUSG00000061126 Cyp4f39 -2.45 7.8E-04 ENSMUSG00000091405 Hist2h4 -2.45 7.4E-03 ENSMUSG00000040061 Plcb2 -2.45 3.9E-02 ENSMUSG00000020623 Map2k6 -2.45 4.6E-04 ENSMUSG00000072966 Gprasp2 -2.46 3.0E-02 ENSMUSG00000059336 Slc14a1 -2.46 1.1E-09 ENSMUSG00000050545 Fam228b -2.46 1.8E-02 ENSMUSG00000086740 Gm17029 -2.46 7.5E-03 ENSMUSG00000021509 Slc25a48 -2.47 7.5E-05 ENSMUSG00000059824 Dbp -2.47 1.7E-03 ENSMUSG00000051817 Sox12 -2.48 6.3E-06 ENSMUSG00000005672 Kit -2.48 1.1E-04 ENSMUSG00000027186 Elf5 -2.49 4.8E-05 ENSMUSG00000007877 Tcap -2.50 2.3E-02 ENSMUSG00000084761 Gm12406 -2.50 1.1E-04

236

ENSMUSG00000013089 Etv5 -2.50 1.3E-06 ENSMUSG00000068614 Actc1 -2.51 2.4E-05 ENSMUSG00000003949 Hlf -2.51 3.6E-03 ENSMUSG00000097494 4933406C10Rik -2.51 3.5E-03 ENSMUSG00000006542 Prkag3 -2.51 2.1E-03 ENSMUSG00000106641 Gm43534 -2.52 4.3E-02 ENSMUSG00000022342 Kcnv1 -2.52 3.4E-05 ENSMUSG00000086390 1810019D21Rik -2.52 8.8E-13 ENSMUSG00000049565 Aknad1 -2.53 2.1E-08 ENSMUSG00000038486 Sv2a -2.53 2.3E-04 ENSMUSG00000058921 Slc10a5 -2.54 2.2E-02 ENSMUSG00000000126 Wnt9a -2.54 3.8E-05 ENSMUSG00000060212 Pcnx2 -2.55 3.6E-03 ENSMUSG00000102577 Gm37969 -2.55 4.9E-02 ENSMUSG00000025207 Sema4g -2.55 1.4E-06 ENSMUSG00000048442 Smim5 -2.55 3.7E-05 ENSMUSG00000031344 Gabrq -2.55 5.7E-03 ENSMUSG00000041351 Rap1gap -2.56 9.2E-09 ENSMUSG00000101162 Gm26728 -2.56 3.4E-02 ENSMUSG00000045667 Smtnl2 -2.56 5.0E-03 ENSMUSG00000031216 Stard8 -2.57 2.3E-03 ENSMUSG00000033705 Stard9 -2.57 1.2E-02 ENSMUSG00000036598 Ccdc113 -2.57 2.2E-04 ENSMUSG00000036192 Rorb -2.58 4.4E-02 ENSMUSG00000062760 1810041L15Rik -2.58 8.9E-04 ENSMUSG00000030222 Rerg -2.59 1.3E-04 ENSMUSG00000097353 A430046D13Rik -2.59 5.0E-05 ENSMUSG00000000861 Bcl11a -2.59 2.7E-07 ENSMUSG00000055725 Paqr3 -2.60 6.2E-05 ENSMUSG00000043448 Gjc2 -2.60 1.0E-02 ENSMUSG00000045954 Cavin2 -2.60 1.3E-04 ENSMUSG00000005580 Adcy9 -2.61 4.2E-05 ENSMUSG00000032226 Gcnt3 -2.61 9.9E-11 ENSMUSG00000037259 Dzank1 -2.61 3.5E-03 ENSMUSG00000047507 Baiap3 -2.61 9.3E-06 ENSMUSG00000027009 Itga4 -2.62 1.6E-03 ENSMUSG00000034023 Fancd2 -2.62 1.1E-05 ENSMUSG00000005583 Mef2c -2.62 1.0E-04 ENSMUSG00000026357 Rgs18 -2.62 2.9E-02 ENSMUSG00000040860 Crocc -2.63 9.1E-05 ENSMUSG00000055827 Gsdmc3 -2.64 2.0E-11 ENSMUSG00000086372 Gm16246 -2.64 1.2E-03 ENSMUSG00000025154 Arhgap19 -2.65 3.0E-03 ENSMUSG00000044217 Aqp5 -2.65 3.1E-02 ENSMUSG00000084616 Gm25047 -2.66 2.5E-04

237

ENSMUSG00000079355 Ackr4 -2.67 4.0E-03 ENSMUSG00000021944 Gata4 -2.67 3.2E-02 ENSMUSG00000053675 Tgm5 -2.67 2.4E-03 ENSMUSG00000034227 Foxj1 -2.68 3.5E-02 ENSMUSG00000109635 Gm45670 -2.69 4.3E-03 ENSMUSG00000097184 4632428C04Rik -2.69 2.4E-04 ENSMUSG00000028238 Atp6v0d2 -2.70 2.2E-02 ENSMUSG00000006642 Tcf23 -2.70 8.0E-05 ENSMUSG00000105632 Gm43272 -2.71 4.7E-10 ENSMUSG00000109904 Gm45819 -2.71 1.4E-03 ENSMUSG00000097960 A330074K22Rik -2.71 1.3E-02 ENSMUSG00000047773 Ankfn1 -2.71 5.7E-04 ENSMUSG00000050463 Krt78 -2.71 3.9E-05 ENSMUSG00000056293 Gsdmc2 -2.72 8.6E-14 ENSMUSG00000026961 Lrrc26 -2.72 3.7E-04 ENSMUSG00000000244 Tspan32 -2.72 2.9E-02 ENSMUSG00000024593 Megf10 -2.72 2.2E-02 ENSMUSG00000028386 Slc46a2 -2.72 2.2E-03 ENSMUSG00000050071 Bex1 -2.73 2.7E-02 ENSMUSG00000086607 4930511M06Rik -2.73 2.0E-02 ENSMUSG00000050288 Fzd2 -2.73 9.6E-05 ENSMUSG00000108723 Gm44837 -2.73 3.9E-03 ENSMUSG00000030757 Zkscan2 -2.73 4.4E-02 ENSMUSG00000025993 Slc40a1 -2.74 8.8E-06 ENSMUSG00000038077 Kcna6 -2.74 1.2E-04 ENSMUSG00000032750 Gab3 -2.74 3.2E-02 ENSMUSG00000036523 Greb1 -2.74 2.3E-02 ENSMUSG00000031448 Adprhl1 -2.75 2.0E-02 ENSMUSG00000085162 Gm12295 -2.75 2.0E-02 ENSMUSG00000049811 Fam161a -2.76 7.5E-03 ENSMUSG00000087357 Gm12498 -2.76 3.5E-04 ENSMUSG00000097243 -2.77 1.4E-02 ENSMUSG00000040978 Gm11992 -2.78 2.3E-02 ENSMUSG00000030643 Rab30 -2.78 1.5E-02 ENSMUSG00000091475 2810468N07Rik -2.78 1.7E-02 ENSMUSG00000040694 Apobec2 -2.79 3.0E-04 ENSMUSG00000028940 Hes2 -2.79 6.2E-03 ENSMUSG00000021567 Nkd2 -2.80 2.9E-04 ENSMUSG00000079465 Col4a3 -2.80 1.9E-02 ENSMUSG00000097145 9230114K14Rik -2.80 5.4E-03 ENSMUSG00000002265 Peg3 -2.81 1.1E-03 ENSMUSG00000038233 Fam198a -2.81 3.6E-02 ENSMUSG00000078234 Klhdc7a -2.81 2.6E-06 ENSMUSG00000003469 Phyhip -2.81 2.7E-02 ENSMUSG00000031965 Tbx20 -2.81 9.6E-04

238

ENSMUSG00000027895 Kcnc4 -2.82 8.1E-05 ENSMUSG00000048022 Tmem229a -2.83 6.5E-16 ENSMUSG00000045613 Chrm2 -2.83 4.0E-04 ENSMUSG00000017724 Etv4 -2.84 1.4E-02 ENSMUSG00000037263 Aldh3b3 -2.84 2.9E-03 ENSMUSG00000020081 Tacr2 -2.84 4.6E-04 ENSMUSG00000066510 Ankdd1a -2.84 2.4E-04 ENSMUSG00000038354 Ankrd35 -2.84 8.4E-06 ENSMUSG00000020061 Mybpc1 -2.85 1.4E-02 ENSMUSG00000043668 Tox3 -2.86 3.1E-02 ENSMUSG00000046169 Adamts6 -2.86 9.6E-04 ENSMUSG00000071042 Rasgrp3 -2.88 3.1E-05 ENSMUSG00000097806 Gm6556 -2.89 4.0E-02 ENSMUSG00000105594 Gm43398 -2.90 2.2E-02 ENSMUSG00000043811 Rtn4r -2.91 1.1E-03 ENSMUSG00000058966 Fam57b -2.91 1.2E-02 ENSMUSG00000085833 Gm13003 -2.92 2.2E-06 ENSMUSG00000067389 Gm17080 -2.92 9.2E-06 ENSMUSG00000010825 Grid2ip -2.94 5.0E-09 ENSMUSG00000020542 Myocd -2.96 3.4E-05 ENSMUSG00000037892 Pcdh18 -2.97 2.6E-06 ENSMUSG00000044716 Dok7 -2.97 3.4E-05 ENSMUSG00000025271 Pfkfb1 -2.98 2.7E-02 ENSMUSG00000046743 Fat4 -2.98 9.0E-05 ENSMUSG00000021294 Kif26a -2.99 4.6E-03 ENSMUSG00000015627 Gata5 -3.01 4.6E-04 ENSMUSG00000110115 Gm32486 -3.01 1.2E-02 ENSMUSG00000043259 Fam13c -3.01 2.3E-04 ENSMUSG00000033855 Ston1 -3.02 4.2E-03 ENSMUSG00000047591 Mafa -3.02 2.8E-02 ENSMUSG00000057751 Megf6 -3.03 2.3E-07 ENSMUSG00000060548 Tnfrsf19 -3.03 1.6E-06 ENSMUSG00000080806 Gm13005 -3.03 4.4E-02 ENSMUSG00000090053 Palm2 -3.05 5.0E-02 ENSMUSG00000021624 Cd180 -3.07 5.1E-04 ENSMUSG00000097820 E530011L22Rik -3.08 2.4E-03 ENSMUSG00000064065 Ipcef1 -3.09 2.2E-03 ENSMUSG00000004360 9330159F19Rik -3.09 5.2E-05 ENSMUSG00000108353 Gm45205 -3.10 9.0E-04 ENSMUSG00000100127 Gsdmcl-ps -3.10 1.2E-03 ENSMUSG00000045259 Klhdc9 -3.13 2.1E-02 ENSMUSG00000028871 Rspo1 -3.13 2.7E-02 ENSMUSG00000042514 Klhl14 -3.15 1.5E-08 ENSMUSG00000084950 Gm5577 -3.15 2.4E-03 ENSMUSG00000020140 Lgr5 -3.15 3.3E-03

239

ENSMUSG00000016262 Sertad4 -3.16 4.6E-05 ENSMUSG00000046442 Ppm1e -3.18 8.5E-16 ENSMUSG00000109136 Gm45114 -3.19 4.6E-02 ENSMUSG00000035811 Ugt2b35 -3.19 2.1E-02 ENSMUSG00000053040 Aph1c -3.22 5.5E-03 ENSMUSG00000041272 Tox -3.22 2.1E-02 ENSMUSG00000095407 Tmem200c -3.22 1.7E-05 ENSMUSG00000061411 Nol4l -3.23 1.3E-12 ENSMUSG00000053093 Myh7 -3.24 2.3E-03 ENSMUSG00000094437 Gm9830 -3.24 9.3E-03 ENSMUSG00000016756 Cmah -3.25 2.1E-02 ENSMUSG00000109674 Gm45470 -3.26 9.2E-04 ENSMUSG00000063239 Grm4 -3.26 4.6E-02 ENSMUSG00000085069 Gm13111 -3.27 1.0E-02 ENSMUSG00000035349 -3.27 4.5E-02 ENSMUSG00000070687 Htr1d -3.27 6.1E-05 ENSMUSG00000079103 Tgm7 -3.28 4.0E-02 ENSMUSG00000047976 Kcna1 -3.29 2.3E-08 ENSMUSG00000015843 Rxrg -3.30 1.9E-05 ENSMUSG00000034584 Exph5 -3.32 5.3E-08 ENSMUSG00000006784 Ttc25 -3.33 3.4E-02 ENSMUSG00000020990 Cdkl1 -3.33 5.7E-04 ENSMUSG00000020639 Pfn4 -3.34 6.4E-03 ENSMUSG00000030889 Vwa3a -3.34 4.7E-02 ENSMUSG00000020532 Acaca -3.34 3.1E-02 ENSMUSG00000042010 Acacb -3.36 1.0E-03 ENSMUSG00000048458 Fam212b -3.36 3.3E-05 ENSMUSG00000047146 Tet1 -3.37 2.4E-04 ENSMUSG00000021575 Ahrr -3.37 2.2E-02 ENSMUSG00000105059 Gm42498 -3.41 1.1E-02 ENSMUSG00000015890 Amdhd1 -3.41 2.5E-04 ENSMUSG00000097811 2810425M01Rik -3.43 2.1E-02 ENSMUSG00000089635 Gm16559 -3.43 1.7E-04 ENSMUSG00000097339 Gm26671 -3.45 1.2E-02 ENSMUSG00000103527 Gm37261 -3.46 1.6E-05 ENSMUSG00000029678 Hyal5 -3.47 3.7E-02 ENSMUSG00000039059 Hrh3 -3.47 2.1E-05 ENSMUSG00000038020 Rapgefl1 -3.48 1.7E-14 ENSMUSG00000085527 Gm15535 -3.49 3.3E-02 ENSMUSG00000036377 C530008M17Rik -3.51 1.1E-04 ENSMUSG00000074575 Kcng1 -3.52 2.3E-02 ENSMUSG00000031258 Xkrx -3.53 2.3E-08 ENSMUSG00000086233 Gm11816 -3.53 2.6E-02 ENSMUSG00000040703 Cyp2s1 -3.53 7.2E-11 ENSMUSG00000022123 Scel -3.54 8.5E-06

240

ENSMUSG00000024526 Cidea -3.55 5.0E-03 ENSMUSG00000110477 Gm3045 -3.55 3.4E-02 ENSMUSG00000034282 Evpl -3.56 1.8E-22 ENSMUSG00000047428 Dlk2 -3.57 4.6E-10 ENSMUSG00000020811 Wscd1 -3.59 4.3E-02 ENSMUSG00000097233 Gm17552 -3.61 2.1E-04 ENSMUSG00000097124 A530020G20Rik -3.61 1.4E-04 ENSMUSG00000030046 Bmp10 -3.63 8.6E-04 ENSMUSG00000109508 Gm44956 -3.64 1.9E-03 ENSMUSG00000027977 Ndst3 -3.64 1.2E-02 ENSMUSG00000002266 Zim1 -3.66 4.4E-04 ENSMUSG00000089812 Gm15867 -3.68 7.7E-03 ENSMUSG00000105444 Gm10727 -3.68 1.5E-02 ENSMUSG00000059659 Gm10069 -3.70 4.9E-02 ENSMUSG00000027796 Smad9 -3.70 3.1E-04 ENSMUSG00000103378 Gm37176 -3.70 3.7E-02 ENSMUSG00000086283 2810433D01Rik -3.71 1.5E-02 ENSMUSG00000040724 Kcna2 -3.73 9.1E-09 ENSMUSG00000051726 Kcnf1 -3.73 2.0E-09 ENSMUSG00000097684 Gm26645 -3.77 4.3E-02 ENSMUSG00000020992 4930512B01Rik -3.78 2.8E-02 ENSMUSG00000031374 Zfp92 -3.81 2.1E-04 ENSMUSG00000000318 Clec10a -3.84 4.6E-10 ENSMUSG00000090307 1700071M16Rik -3.86 1.6E-02 ENSMUSG00000029685 Asb15 -3.87 4.4E-05 ENSMUSG00000020182 Ddc -3.89 5.5E-04 ENSMUSG00000071332 E230015B07Rik -3.90 1.0E-02 ENSMUSG00000033910 Gucy1a1 -3.91 7.9E-05 ENSMUSG00000109930 Gm34730 -3.91 3.1E-05 ENSMUSG00000084850 Gm12092 -3.94 2.9E-02 ENSMUSG00000106871 Gm3289 -3.97 2.7E-02 ENSMUSG00000100733 4932411K12Rik -4.02 3.1E-06 ENSMUSG00000099146 0610031O16Rik -4.03 2.7E-02 ENSMUSG00000038765 Lmx1b -4.07 2.9E-11 ENSMUSG00000021055 Esr2 -4.07 1.5E-03 ENSMUSG00000089679 Gm16299 -4.10 3.1E-02 ENSMUSG00000035930 Chst4 -4.10 1.8E-02 ENSMUSG00000023931 Efhb -4.10 2.8E-02 ENSMUSG00000043110 Lrrn4 -4.10 6.4E-03 ENSMUSG00000088793 Gm22540 -4.11 6.0E-03 ENSMUSG00000022053 Ebf2 -4.13 1.6E-02 ENSMUSG00000038768 9130409I23Rik -4.13 3.5E-02 ENSMUSG00000086181 C230034O21Rik -4.14 3.3E-02 ENSMUSG00000027221 Chst1 -4.15 2.9E-02 ENSMUSG00000030365 Clec2i -4.17 4.9E-02

241

ENSMUSG00000084890 A830036E02Rik -4.18 2.2E-02 ENSMUSG00000011171 Vipr2 -4.21 4.8E-02 ENSMUSG00000024500 Ppp2r2b -4.22 7.1E-11 ENSMUSG00000104330 Gm38285 -4.23 1.5E-02 ENSMUSG00000021379 Id4 -4.26 6.8E-03 ENSMUSG00000056966 Gjc3 -4.27 2.4E-02 ENSMUSG00000025153 Fasn -4.28 2.8E-02 ENSMUSG00000021573 Tppp -4.28 2.9E-09 ENSMUSG00000020878 Lrrc46 -4.30 3.1E-02 ENSMUSG00000055980 Irs1 -4.30 4.0E-05 ENSMUSG00000070337 Gpr179 -4.35 2.0E-03 ENSMUSG00000001823 Hoxd12 -4.37 6.0E-03 ENSMUSG00000048038 Ccdc187 -4.42 2.1E-02 ENSMUSG00000063919 Srrm4 -4.43 1.3E-04 ENSMUSG00000032394 Igdcc3 -4.45 2.0E-09 ENSMUSG00000047822 Angptl8 -4.46 2.0E-02 ENSMUSG00000048776 Pthlh -4.51 1.4E-05 ENSMUSG00000035486 Plk5 -4.54 1.1E-04 ENSMUSG00000029861 Fam131b -4.68 1.7E-02 ENSMUSG00000025905 Oprk1 -4.83 3.4E-03 ENSMUSG00000070802 Pnmal2 -4.85 2.0E-04 ENSMUSG00000109644 0610005C13Rik -4.94 4.3E-02 ENSMUSG00000078137 Ankrd63 -4.95 1.7E-03 ENSMUSG00000079157 Fam155a -4.96 1.7E-02 ENSMUSG00000040270 Bach2 -5.05 4.7E-15 ENSMUSG00000108872 -5.06 1.4E-02 ENSMUSG00000101615 Gm8495 -5.06 1.1E-02 ENSMUSG00000022376 Adcy8 -5.16 6.9E-04 ENSMUSG00000058975 Kcnc1 -5.24 1.4E-03 ENSMUSG00000106350 Gm4869 -5.26 3.0E-07 ENSMUSG00000070369 Itgad -5.26 5.5E-03 ENSMUSG00000026220 Slc16a14 -5.31 1.4E-10 ENSMUSG00000052957 Gas1 -5.40 5.5E-04 ENSMUSG00000040752 Myh6 -5.41 1.7E-02 ENSMUSG00000038980 Rbbp8nl -5.43 4.9E-05 ENSMUSG00000082149 Gm13002 -5.52 8.1E-03 ENSMUSG00000040907 Atp1a3 -5.52 3.5E-02 ENSMUSG00000090667 Gm765 -5.70 4.2E-04 ENSMUSG00000037279 Ovol2 -5.76 1.9E-10 ENSMUSG00000106896 G630022F23Rik -5.98 2.1E-02 ENSMUSG00000050511 Oprd1 -6.04 1.3E-13 ENSMUSG00000087247 Alkal1 -6.13 1.3E-02 ENSMUSG00000107272 Gm34583 -6.32 5.3E-04 ENSMUSG00000051599 Pcdhb2 -6.41 1.3E-02 ENSMUSG00000086236 5830418P13Rik -6.45 1.3E-02

242

ENSMUSG00000030307 Slc6a11 -6.45 2.8E-02 ENSMUSG00000107076 Gm43480 -6.49 1.5E-02 ENSMUSG00000079025 Gsdmc -6.55 2.3E-04 ENSMUSG00000001815 Evx2 -6.79 3.8E-06 ENSMUSG00000057068 Fam47e -6.91 1.0E-02 ENSMUSG00000048304 Slitrk3 -7.03 5.1E-03 ENSMUSG00000032942 Ucp3 -7.24 2.8E-04 ENSMUSG00000086291 Gm15513 -7.38 1.2E-02 ENSMUSG00000040264 Gbp2b -7.57 4.9E-02 ENSMUSG00000002057 Foxn1 -7.63 2.4E-04 ENSMUSG00000045776 Lrtm1 -8.08 2.7E-02 ENSMUSG00000020052 Ascl1 -8.15 2.9E-03 ENSMUSG00000102796 Gm37711 -8.77 2.3E-06 ENSMUSG00000026322 Htr4 -8.88 4.2E-04 ENSMUSG00000105102 Gm35507 -29.13 1.9E-02 ENSMUSG00000051596 Otop1 -29.48 3.6E-02 ENSMUSG00000039533 Mmd2 -31.89 2.1E-03

243

Table S2: Bladder transcriptome in Wt mice in response to pure FliC from UPEC CFT073∆4. The following table is the list of significant biological pathways activated according to innateDB analysis (Reactome) analysed in transcriptional response of genes by FliC-treated Wt mice, exhibiting significantly altered expression in the bladder, compared to carrier control-treated Wt mice. The differential expressions were judged by those exhibiting ±2-fold changes in expression compared to the carrier control, with a q- value (adjusted p-value) of < 0.05.

Pathway Id Pathway Name p-value adjusted 17702 Immune System 1.15E-13 19018 Chemokine receptors bind chemokines 8.96E-10 18914 G alpha (i) signaling events 1.71E-09 16640 TRAF6 mediated NF-kB activation 2.50E-08 17370 Cytokine Signaling in Immune system 5.58E-08 16733 Innate Immune System 5.83E-08 18683 Peptide ligand-binding receptors 1.01E-07 19911 Toll Like Receptor 4 (TLR4) Cascade 1.92E-07 19167 Activated TLR4 signaling 5.19E-07 18614 Interferon gamma signaling 5.22E-07 17050 Class A/1 (Rhodopsin-like receptors) 7.19E-07 18742 Toll-Like Receptors Cascades 8.87E-07 18616 Interferon Signaling 9.10E-07 19392 MyD88-independent cascade 1.26E-06 19584 TRIF-mediated TLR3/TLR4 signaling 1.26E-06 16686 Toll Like Receptor 3 (TLR3) Cascade 1.26E-06 19497 RIG-I/MDA5 mediated induction of IFN-alpha/beta pathways 4.77E-06 19563 MyD88:Mal cascade initiated on plasma membrane 4.93E-06 16707 Toll Like Receptor 2 (TLR2) Cascade 4.93E-06 17466 Toll Like Receptor TLR1:TLR2 Cascade 4.93E-06 17784 Toll Like Receptor TLR6:TLR2 Cascade 4.93E-06 18571 GPCR ligand binding 4.95E-06 17023 Signaling by GPCR 4.95E-06 19053 RIP-mediated NFkB activation via ZBP1 6.19E-06 18295 Potassium Channels 1.45E-05 17701 ZBP1(DAI) mediated induction of type I IFNs 2.42E-05 18727 DEx/H-box helicases activate type I IFN and inflammatory cytokines production 3.05E-05 19654 TAK1 activates NFkB by phosphorylation and activation of IKKs complex 4.95E-05 17213 MyD88 cascade initiated on plasma membrane 1.16E-04 19899 Toll Like Receptor 10 (TLR10) Cascade 1.16E-04 17772 Toll Like Receptor 5 (TLR5) Cascade 1.16E-04 18829 MyD88 dependent cascade initiated on endosome 1.59E-04 19531 Toll Like Receptor 7/8 (TLR7/8) Cascade 1.59E-04 19426 Signal Transduction 1.59E-04 16814 GPCR downstream signaling 1.99E-04 18230 Toll Like Receptor 9 (TLR9) Cascade 2.35E-04 244

19094 Neuronal System 2.35E-04 18853 Cytosolic sensors of pathogen-associated DNA 3.16E-04 17894 TRAF6 mediated IRF7 activation 3.17E-04 19331 Interleukin-1 signaling 3.30E-04 19298 Voltage gated Potassium channels 3.31E-04 16690 TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation 3.85E-04 19764 Formyl peptide receptors bind formyl peptides and many other ligands 0.0015652 18761 Signaling by Interleukins 0.0029797 18177 FCGR activation 0.0044635 19595 TRAF3-dependent IRF activation pathway 0.0044635 19062 Adaptive Immune System 0.0066394 18865 GABA receptor activation 0.0087487 19404 Adenylate cyclase activating pathway 0.0119348 17816 Activation of GABAB receptors 0.0120078 18543 GABA B receptor activation 0.0120078 17852 Aquaporin-mediated transport 0.0127747 17201 O-linked glycosylation of mucins 0.0138983 18857 Transmembrane transport of small molecules 0.0140341 17036 Glucagon signaling in metabolic regulation 0.0142665 16992 Transport of glucose and other sugars, bile salts and organic acids, metal ions and amine compounds 0.0149148 18791 Antigen processing-Cross presentation 0.0149816 19484 p75 NTR receptor-mediated signaling 0.0181673 19686 Metal ion SLC transporters 0.019643 17379 Termination of O-glycan biosynthesis 0.0237536 18717 IRF3-mediated induction of type I IFN 0.0265235 19652 Transfer of LPS from LBP carrier to CD14 0.027433 18808 Interleukin-1 processing 0.0274519 16949 Multifunctional anion exchangers 0.0274519 19583 Synthesis of 15-eicosatetraenoic acid derivatives 0.0274519 19142 Nucleotide-binding domain, leucine rich repeat containing receptor (NLR) signaling pathways 0.0276137 18603 G alpha (z) signaling events 0.0281231 18718 Rho GTPase cycle 0.0301122 18142 Signaling by Rho GTPases 0.0301122 17324 Immunoregulatory interactions between a Lymphoid and a non-Lymphoid cell 0.0333957 18766 NOD1/2 Signaling Pathway 0.0372866 18316 Activation of NF-kappaB in B cells 0.0373193 17620 Adenylate cyclase inhibitory pathway 0.0373995 18343 Death Receptor Signaling 0.0373995 19114 Extrinsic Pathway for Apoptosis 0.0373995 18098 Inhibition of adenylate cyclase pathway 0.0373995 19806 PKA activation 0.0373995 18937 STING mediated induction of host immune responses 0.0374125 19927 O-linked glycosylation 0.0376339 19704 Scavenging by Class B Receptors 0.0391818 17060 Integration of energy metabolism 0.0410914 16750 Apoptosis 0.0420867 18291 Vasopressin regulates renal water homeostasis via 0.0471097 245

Aquaporins 17698 PKA activation in glucagon signaling 0.0474355 17603 PKA-mediated phosphorylation of CREB 0.0474355 19028 Signaling by NGF 0.0506807 17058 Amine ligand-binding receptors 0.0535595 17629 Histamine receptors 0.0581918 19247 Interconversion of polyamines 0.0581918 18772 p75NTR signals via NF-kB 0.0587529 17474 Latent infection of Homo sapiens with Mycobacterium tuberculosis 0.0597929 17472 Phagosomal maturation (early endosomal stage) 0.0597929 18392 GPVI-mediated activation cascade 0.0638121 19569 BMAL1:CLOCK,NPAS2 activates circadian gene expression 0.0713205 17032 SLC-mediated transmembrane transport 0.0786146 17848 ER-Phagosome pathway 0.0801423 17261 Neurotransmitter Receptor Binding And Downstream Transmission In The Postsynaptic Cell 0.0860139 19864 Activation of PPARGC1A (PGC-1alpha) by phosphorylation 0.095191 17934 Caspase-8 activation by cleavage 0.095191 16903 Dimerization of procaspase-8 0.095191 18945 NF-kB activation through FADD/RIP-1 pathway mediated by caspase-8 and -10 0.095191 18474 Regulation by c-FLIP 0.095191 17757 Binding and Uptake of Ligands by Scavenger Receptors 0.0955401 19666 Activation of IRF3/IRF7 mediated by TBK1/IKK epsilon 0.099334 16812 WNT5A-dependent internalization of FZD2, FZD5 and ROR2 0.0994348 17306 FCERI mediated NF-kB activation 0.1006062 17668 Negative regulators of RIG-I/MDA5 signaling 0.1006062 19369 G-protein beta:gamma signaling 0.115062 19905 Antigen Presentation: Folding, assembly and peptide loading of class I MHC 0.1160321 18134 Advanced glycosylation endproduct receptor signaling 0.1169766 17467 Serotonin receptors 0.1169766 16805 Signaling by the B Cell Receptor (BCR) 0.1279109 16765 Inwardly rectifying K+ channels 0.1281223 19645 PLC beta mediated events 0.1287125 19547 Transmission across Chemical Synapses 0.1308818 17667 Antiviral mechanism by IFN-stimulated genes 0.1313894 19198 IKK complex recruitment mediated by RIP1 0.1313894 17669 ISG15 antiviral mechanism 0.1313894 17682 CREB phosphorylation through the activation of Adenylate Cyclase 0.1349823 18002 ChREBP activates metabolic gene expression 0.1349823 17149 G beta:gamma signaling through PLC beta 0.1349823 17566 Histidine catabolism 0.1349823 19703 G-protein mediated events 0.1360791 246

17954 Iron uptake and transport 0.1360791 14813 Bmal1:Clock,Npas2 activates circadian gene expression 0.1374813 18815 Reversible hydration of carbon dioxide 0.1374813 19760 Collagen degradation 0.1390094 18054 activated TAK1 mediates p38 MAPK activation 0.1423066 16844 Class I MHC mediated antigen processing & presentation 0.1474968 17371 Activation of caspases through apoptosome-mediated cleavage 0.1807832 17887 Cytochrome c-mediated apoptotic response 0.1807832 19327 Presynaptic function of Kainate receptors 0.1807832 17842 TNF signaling 0.1807832 16941 Hemostasis 0.1818003 17697 MAP kinase activation in TLR cascade 0.1832138 17926 CaM pathway 0.184232 19381 Calmodulin induced events 0.184232 19848 Downstream signaling events of B Cell Receptor (BCR) 0.1921345 19599 Activation of G protein gated Potassium channels 0.1937592 18303 CDO in myogenesis 0.1937592 17069 G protein gated Potassium channels 0.1937592 19521 Inhibition of voltage gated Ca2+ channels via Gbeta/gamma subunits 0.1937592 17709 Myogenesis 0.1937592 17082 Activation of gene expression by SREBF (SREBP) 0.2027743 18452 G alpha (12/13) signaling events 0.2027773 19313 Opioid Signaling 0.2035351 19567 Interferon alpha/beta signaling 0.2035713 17223 Regulation of KIT signaling 0.2035713 17041 Hedgehog 'off' state 0.2074405 17183 Ca-dependent events 0.2084594 19520 G beta:gamma signaling through PI3Kgamma 0.2084594 18075 Cross-presentation of soluble exogenous antigens (endosomes) 0.2105892 18764 Integrin cell surface interactions 0.211295 17250 BH3-only proteins associate with and inactivate anti- apoptotic BCL-2 members 0.2120934 18819 Cross-presentation of particulate exogenous antigens (phagosomes) 0.2120934 18384 HS-GAG biosynthesis 0.2243309 19928 Intrinsic Pathway for Apoptosis 0.2268308 19893 DAP12 interactions 0.2331073 17436 NRAGE signals death through JNK 0.2455633 17285 Transport of inorganic cations/anions and amino acids/oligopeptides 0.2513062 19713 Apoptotic factor-mediated response 0.2526523 17493 Axonal growth inhibition (RHOA activation) 0.2526523 18132 Regulation of IFNG signaling 0.2526523 17752 Scavenging of heme from plasma 0.2526523 19087 Nitric oxide stimulates guanylate cyclase 0.2548098 19465 Mitochondrial biogenesis 0.2579797 247

19176 DAG and IP3 signaling 0.2608262 17352 Striated Muscle Contraction 0.2608262 17051 Synthesis of substrates in N-glycan biosythesis 0.2611278 16694 G alpha (s) signaling events 0.2624597 17861 Defective B3GAT3 causes JDSSDHD 0.2677368 19245 Defective B4GALT1 causes B4GALT1-CDG (CDG- 2d) 0.2677368 17791 Defective B4GALT7 causes EDS, progeroid type 0.2677368 19017 Defective CHST14 causes EDS, musculocontractural type 0.2677368 19031 Defective CHST3 causes SEDCJD 0.2677368 19716 Defective CHST6 causes MCDC1 0.2677368 17859 Defective CHSY1 causes TPBS 0.2677368 19490 Defective EXT1 causes exostoses 1, TRPS2 and CHDS 0.2677368 19903 Defective EXT2 causes exostoses 2 0.2677368 19463 Defective PAPSS2 causes SEMD-PA 0.2677368 19918 Defective SLC26A2 causes chondrodysplasias 0.2677368 17949 Diseases associated with glycosaminoglycan metabolism 0.2677368 17808 Diseases of glycosylation 0.2677368 16666 Glycosaminoglycan metabolism 0.2677368 17707 MPS I - Hurler syndrome 0.2677368 17928 MPS II - Hunter syndrome 0.2677368 19358 MPS IIIA - Sanfilippo syndrome A 0.2677368 19355 MPS IIIB - Sanfilippo syndrome B 0.2677368 17652 MPS IIIC - Sanfilippo syndrome C 0.2677368 17761 MPS IIID - Sanfilippo syndrome D 0.2677368 17376 MPS IV - Morquio syndrome A 0.2677368 17124 MPS IV - Morquio syndrome B 0.2677368 18442 MPS IX - Natowicz syndrome 0.2677368 19188 MPS VI - Maroteaux-Lamy syndrome 0.2677368 18978 MPS VII - Sly syndrome 0.2677368 19617 Mucopolysaccharidoses 0.2677368 16967 Circadian Clock 0.2713086 16675 Assembly of collagen fibrils and other multimeric structures 0.2739115 19711 TCR signaling 0.2739357 16672 Collagen formation 0.2830863 17713 Extracellular matrix organization 0.2851919 17017 Activation, myristolyation of BID and translocation to mitochondria 0.2858501 18912 Dissolution of Fibrin Clot 0.2858501 17552 IRF3 mediated activation of type 1 IFN 0.2858501 19393 Regulated proteolysis of p75NTR 0.2858501 18879 TRIF-mediated programmed cell death 0.2858501 17681 Zinc influx into cells by the SLC39 gene family 0.2858501 16842 p75NTR regulates axonogenesis 0.2858501 19611 Glucagon-like Peptide-1 (GLP1) regulates insulin secretion 0.2864651 16810 PLCG1 events in ERBB2 signaling 0.2864651 19066 Signaling by PDGF 0.2872957 248

17265 ERK/MAPK targets 0.2910155 16899 Platelet homeostasis 0.2912386 19238 Signaling by Hedgehog 0.2915597 17745 EGFR interacts with phospholipase C-gamma 0.293217 17584 PLC-gamma1 signaling 0.293217 18342 negative regulation of TCF-dependent signaling by WNT ligand antagonists 0.2948459 18269 Cell death signaling via NRAGE, NRIF and NADE 0.2956999 18704 Ca2+ pathway 0.3062834 17048 Class B/2 (Secretin family receptors) 0.3094296 16738 Syndecan interactions 0.3163231 17083 Regulation of cholesterol biosynthesis by SREBP (SREBF) 0.3186356 18081 DSCAM interactions 0.3316852 19125 Formation of Senescence-Associated Heterochromatin Foci (SAHF) 0.3316852 18476 Passive transport by Aquaporins 0.3316852 18594 Signaling by NOTCH4 0.3316852 18222 Tryptophan catabolism 0.3316852 19883 Adrenaline,noradrenaline inhibits insulin secretion 0.3393094 18053 Triglyceride Biosynthesis 0.3428834 19258 Asymmetric localization of PCP proteins 0.3489086 18562 GLI3 is processed to GLI3R by the proteasome 0.3489086 18632 Phospholipase C-mediated cascade 0.3521881 18200 G-protein activation 0.3580134 19130 Import of palmitoyl-CoA into the mitochondrial matrix 0.3580134 19100 NF-kB is activated and signals survival 0.3580134 18362 Signaling by NOTCH3 0.3580134 18131 The NLRP3 inflammasome 0.3580134 18587 p38MAPK events 0.3580134 18360 p75NTR recruits signaling complexes 0.3580134 18048 Laminin interactions 0.3596466 19872 Nuclear Events (kinase and transcription factor activation) 0.3596466 17143 Downstream TCR signaling 0.3605133 18195 Regulation of Apoptosis 0.3688295 18551 Costimulation by the CD28 family 0.3696876 17462 Biosynthesis of the N-glycan precursor (dolichol lipid-linked oligosaccharide, LLO) and transfer to a nascent protein 0.380382 17869 Regulation of insulin secretion 0.380382 16973 GABA A receptor activation 0.3867759 18062 Platelet Adhesion to exposed collagen 0.3867759 19564 Regulation of IFNA signaling 0.3867759 17578 Activation of Matrix Metalloproteinases 0.3870527 19615 TRP channels 0.3974953 18951 Regulation of activated PAK-2p34 by proteasome mediated degradation 0.4002855 18779 Regulation of ornithine decarboxylase (ODC) 0.4002855 19649 FCERI mediated MAPK activation 0.4039681 17282 Gastrin-CREB signaling pathway via PKC and 0.4043459 249

MAPK 17042 Interleukin-2 signaling 0.4159145 17380 beta-catenin independent WNT signaling 0.4164686 17526 CDK-mediated phosphorylation and removal of Cdc6 0.4166592 16683 PD-1 signaling 0.4171254 18575 Rap1 signaling 0.4171254 18479 CD28 co-stimulation 0.4184509 16756 Keratan sulfate biosynthesis 0.4184509 18361 Signaling by NOTCH2 0.4184509 19749 Arachidonic acid metabolism 0.4233788 16703 Autodegradation of the E3 ubiquitin ligase COP1 0.4233788 19153 Ubiquitin-dependent degradation of Cyclin D 0.4233788 16945 Ubiquitin-dependent degradation of Cyclin D1 0.4233788 18120 Metabolism of amino acids and derivatives 0.424639 18964 Fcgamma receptor (FCGR) dependent phagocytosis 0.4257412 17665 Stabilization of p53 0.4334638 18050 Ubiquitin Mediated Degradation of Phosphorylated Cdc25A 0.4334638 17397 p53-Independent DNA Damage Response 0.4334638 16678 p53-Independent G1/S DNA damage checkpoint 0.4334638 17514 Detoxification of Reactive Oxygen Species 0.4340172 18382 Inflammasomes 0.4350716 19102 Metabolism of polyamines 0.4350716 17899 TRAF6 mediated IRF7 activation in TLR7/8 or 9 signaling 0.4350716 17663 TRAF6 mediated induction of TAK1 complex 0.4350716 18930 The canonical retinoid cycle in rods (twilight vision) 0.4350716 18163 PCP/CE pathway 0.4358247 19284 NGF signaling via TRKA from the plasma membrane 0.4368188 17646 Cell surface interactions at the vascular wall 0.4402451 17019 MAPK targets/ Nuclear events mediated by MAP kinases 0.4477198 17788 SCF-beta-TrCP mediated degradation of Emi1 0.4612609 19239 degradation of AXIN 0.4612609 14815 Circadian Clock 0.4615517 18180 Muscle contraction 0.4615517 19386 Amino acid transport across the plasma membrane 0.4619207 16786 Glucagon-type ligand receptors 0.4619207 17774 Post NMDA receptor activation events 0.4619207 17151 Activation of Kainate Receptors upon glutamate binding 0.4640115 18018 Fatty Acyl-CoA Biosynthesis 0.4640115 19671 Synthesis of Prostaglandins (PG) and Thromboxanes (TX) 0.4640115 18577 Zinc transporters 0.4640115 19757 Degradation of the extracellular matrix 0.4652661 17765 Post-translational protein modification 0.4654258 17381 AUF1 (hnRNP D0) destabilizes mRNA 0.4682772 19127 Non-integrin membrane-ECM interactions 0.4684856 19896 DAP12 signaling 0.4738639 18703 Fc epsilon receptor (FCERI) signaling 0.4741957 18104 Signaling to RAS 0.4801385 250

18505 Hh ligand biogenesis disease 0.4810021 19632 SCF(Skp2)-mediated degradation of p27/p21 0.4810021 17219 degradation of DVL 0.4810021 17944 Na+/Cl- dependent neurotransmitter transporters 0.4852828 18862 Signal transduction by L1 0.4852828 16983 CDT1 association with the CDC6:ORC:origin complex 0.4947002 17485 p53-Dependent G1 DNA Damage Response 0.4947002 17516 p53-Dependent G1/S DNA damage checkpoint 0.4947002 18706 FCERI mediated Ca+2 mobilization 0.4964877 19318 Keratan sulfate/keratin metabolism 0.4964877 17317 Molecules associated with elastic fibres 0.4964877 19921 Sialic acid metabolism 0.4964877 18385 Heparan sulfate/heparin (HS-GAG) metabolism 0.5003278 18498 Degradation of GLI1 by the proteasome 0.5045296 18318 Degradation of GLI2 by the proteasome 0.5045296 19157 Regulation of innate immune responses to cytosolic DNA 0.507198 14814 Rora activates circadian gene expression 0.507198 16958 Nuclear Receptor transcription pathway 0.5108373 19633 Activation of NMDA receptor upon glutamate binding and postsynaptic events 0.5145486 17470 Apoptotic cleavage of cellular proteins 0.5145486 18310 Autodegradation of Cdh1 by Cdh1:APC/C 0.5165103 16813 Antigen activates B Cell Receptor (BCR) leading to generation of second messengers 0.5294912 19059 Activation of BH3-only proteins 0.5298614 17212 JNK (c-Jun kinases) phosphorylation and activation mediated by activated human TAK1 0.5298614 17872 Ligand-gated ion channel transport 0.5298614 18364 NOTCH2 Activation and Transmission of Signal to the Nucleus 0.5298614 17230 REV-ERBA represses gene expression 0.5298614 17233 RORA activates circadian gene expression 0.5298614 18251 Sema4D induced cell migration and growth-cone collapse 0.5298614 18495 G1/S DNA Damage Checkpoints 0.5344102 18662 VEGFA-VEGFR2 Pathway 0.5349938 18074 Antigen processing: Ubiquitination & Proteasome degradation 0.5361227 17716 Platelet activation, signaling and aggregation 0.5368265 17549 Collagen biosynthesis and modifying enzymes 0.5379145 19126 ECM proteoglycans 0.5379145 17875 Intrinsic Pathway 0.5484702 17073 Role of phospholipids in phagocytosis 0.5484702 19432 Signaling by Leptin 0.5484702 19293 G alpha (q) signaling events 0.5508875 18091 Cellular Senescence 0.5512545 17892 Downstream signal transduction 0.5541961 17806 Hedgehog ligand biogenesis 0.5545503 18009 Processing-defective Hh variants abrogate ligand secretion 0.5545503 251

17313 Elastic fibre formation 0.5584502 18457 APC/C:Cdc20 mediated degradation of Securin 0.5616854 16682 Transcriptional regulation of white adipocyte differentiation 0.5616854 17275 Cyclin A:Cdk2-associated events at S phase entry 0.5685456 19417 Cyclin E associated events during G1/S transition 0.5685456 18833 Sema4D in semaphorin signaling 0.5691891 18281 EPH-ephrin mediated repulsion of cells 0.5737055 19332 Growth hormone receptor signaling 0.5737055 19853 Assembly of the pre-replicative complex 0.5837693 18860 Senescence-Associated Secretory Phenotype (SASP) 0.5893428 19597 Generation of second messenger molecules 0.5909147 18490 Interleukin receptor SHC signaling 0.5909147 17227 Amyloids 0.5998388 17216 Signaling by VEGF 0.602238 18746 Signaling to ERKs 0.612265 17390 Orphan transporters 0.6126722 17895 Downstream signaling of activated FGFR 0.6147057 18315 Defective AMN causes hereditary megaloblastic anemia 1 0.6180962 18555 Defective BTD causes biotidinase deficiency 0.6180962 18552 Defective CD320 causes methylmalonic aciduria 0.6180962 18560 Defective CUBN causes hereditary megaloblastic anemia 1 0.6180962 18319 Defective GIF causes intrinsic factor deficiency 0.6180962 19910 Defective HLCS causes multiple carboxylase deficiency 0.6180962 16859 Defective LMBRD1 causes methylmalonic aciduria and homocystinuria type cblF 0.6180962 18486 Defective MMAA causes methylmalonic aciduria type cblA 0.6180962 18557 Defective MMAB causes methylmalonic aciduria type cblB 0.6180962 18487 Defective MMACHC causes methylmalonic aciduria and homocystinuria type cblC 0.6180962 18489 Defective MMADHC causes methylmalonic aciduria and homocystinuria type cblD 0.6180962 18558 Defective MTR causes methylmalonic aciduria and homocystinuria type cblG 0.6180962 18559 Defective MTRR causes methylmalonic aciduria and homocystinuria type cblE 0.6180962 18553 Defective MUT causes methylmalonic aciduria mut type 0.6180962 19702 Defective TCN2 causes hereditary megaloblastic anemia 0.6180962 18554 Defects in biotin (Btn) metabolism 0.6180962 19701 Defects in cobalamin (B12) metabolism 0.6180962 19699 Defects in vitamin and cofactor metabolism 0.6180962 18408 EPH-Ephrin signaling 0.6180962 19001 Metabolism of vitamins and cofactors 0.6180962 19297 Metabolism of water-soluble vitamins and cofactors 0.6180962 18754 Removal of licensing factors from origins 0.6180962 252

16931 APC/C:Cdc20 mediated degradation of mitotic proteins 0.6190712 18253 APC/C:Cdh1 mediated degradation of Cdc20 and other APC/C:Cdh1 targeted proteins in late mitosis/early G1 0.6190712 18150 Orc1 removal from chromatin 0.6190712 17188 Switching of origins to a post-replicative state 0.6190712 17198 Cellular responses to stress 0.6198786 17152 Regulation of mRNA stability by proteins that bind AU-rich elements 0.6201472 18602 Ion channel transport 0.6222105 19407 Interleukin-3, 5 and GM-CSF signaling 0.6254599 16877 Disease 0.626268 19277 Insulin receptor recycling 0.626518 18650 VEGFR2 mediated vascular permeability 0.626518 17115 WNT ligand biogenesis and trafficking 0.626518 18926 WNT ligand secretion is abrogated by the PORCN inhibitor LGK974 0.626518 17537 AMER1 mutants destabilize the destruction complex 0.6269917 18771 APC truncation mutants are not K63 polyubiquitinated 0.6269917 18066 APC truncation mutants have impaired AXIN binding 0.6269917 18535 AXIN missense mutants destabilize the destruction complex 0.6269917 17836 AXIN mutants destabilize the destruction complex, activating WNT signaling 0.6269917 17332 Degradation of beta-catenin by the destruction complex 0.6269917 19427 Diseases associated with visual transduction 0.6269917 18076 Regulation of DNA replication 0.6269917 19677 S33 mutants of beta-catenin aren't phosphorylated 0.6269917 18503 S37 mutants of beta-catenin aren't phosphorylated 0.6269917 18800 S45 mutants of beta-catenin aren't phosphorylated 0.6269917 17885 T41 mutants of beta-catenin aren't phosphorylated 0.6269917 18946 TCF7L2 mutants don't bind CTBP 0.6269917 19178 Visual phototransduction 0.6269917 16911 deletions in the AMER1 gene destabilize the destruction complex 0.6269917 18337 deletions in the AXIN genes in hepatocellular carcinoma result in elevated WNT signaling 0.6269917 18935 misspliced GSK3beta mutants stabilize beta-catenin 0.6269917 18209 phosphorylation site mutants of CTNNB1 are not targeted to the proteasome by the destruction complex 0.6269917 19510 truncated APC mutants destabilize the destruction complex 0.6269917 19104 truncations of AMER1 destabilize the destruction complex 0.6269917 17295 Activation of APC/C and APC/C:Cdc20 mediated degradation of mitotic proteins 0.6332709 18940 Signaling by FGFR1 mutants 0.6340515 253

19445 Synthesis of IP3 and IP4 in the cytosol 0.6340515 19158 YAP1- and WWTR1 (TAZ)-stimulated gene expression 0.6340515 18141 Factors involved in megakaryocyte development and platelet production 0.6413834 16742 Stimuli-sensing channels 0.6447425 19283 ABC-family proteins mediated transport 0.6463645 17199 Transferrin endocytosis and recycling 0.6463645 19735 Apoptotic execution phase 0.6481834 17267 Signaling by FGFR in disease 0.6488374 17556 Chondroitin sulfate/dermatan sulfate metabolism 0.6539025 18344 Activated NOTCH1 Transmits Signal to the Nucleus 0.6629635 17280 Signaling by SCF-KIT 0.6677203 19667 DNA Replication Pre-Initiation 0.670236 19011 L1CAM interactions 0.670236 18162 M/G1 Transition 0.670236 16862 Synthesis of PIPs at the plasma membrane 0.6780083 18336 Signaling by EGFR 0.6783399 18229 Regulation of APC/C activators between G1/S and early anaphase 0.6800465 16809 Signaling by ERBB2 0.6816735 19576 Signaling by FGFR 0.6816735 16965 Fatty acid, triacylglycerol, and ketone body metabolism 0.6831424 16740 Regulation of actin dynamics for phagocytic cup formation 0.6905031 19724 Signaling by EGFR in Cancer 0.691182 17396 EPHA-mediated growth cone collapse 0.6919945 18723 Transcriptional activation of mitochondrial biogenesis 0.6919945 14802 Transcriptional Regulation of Adipocyte Differentiation in 3T3-L1 Pre-adipocytes 0.7015344 19034 Asparagine N-linked glycosylation 0.7140344 19101 Developmental Biology 0.7204862 17977 Formation of Fibrin Clot (Clotting Cascade) 0.7218456 19700 Cell-Cell communication 0.7225393 17693 APC/C-mediated degradation of cell cycle proteins 0.7234844 18373 Regulation of mitotic cell cycle 0.7234844 19717 Constitutive Signaling by NOTCH1 HD+PEST Domain Mutants 0.7353596 17915 Constitutive Signaling by NOTCH1 PEST Domain Mutants 0.7353596 18938 Signaling by FGFR mutants 0.7517586 18944 Glycogen storage diseases 0.7520521 19819 Metabolism of carbohydrates 0.7520521 19721 Myoclonic epilepsy of Lafora 0.7520521 17026 Recycling pathway of L1 0.7609663 19068 FRS2-mediated cascade 0.7782776 18680 Axon guidance 0.7816534 16910 Synthesis of DNA 0.7853214 16641 Platelet degranulation 0.7864878 18697 Glucose transport 0.8042239 254

18167 RNF mutants show enhanced WNT signaling and proliferation 0.8139728 18550 TCF dependent signaling in response to WNT 0.8139728 19889 XAV939 inhibits tankyrase, stabilizing AXIN 0.8139728 18155 misspliced LRP5 mutants have enhanced beta- catenin-dependent signaling 0.8139728 18921 Hexose transport 0.8140872 17154 Netrin-1 signaling 0.8140872 19315 Response to elevated platelet cytosolic Ca2+ 0.8159902 19281 Semaphorin interactions 0.8167028 16979 Retinoid metabolism and transport 0.8192388 19461 Cell junction organization 0.8298166 17107 DNA Replication 0.8299757 19443 Inositol phosphate metabolism 0.8303044 19156 XBP1(S) activates chaperone genes 0.8303044 17973 IRE1alpha activates chaperones 0.8393794 19083 PPARA activates gene expression 0.853865 18625 Role of LAT2/NTAL/LAB on calcium mobilization 0.8597889 18725 G1/S Transition 0.8600167 17409 DNA Damage/Telomere Stress Induced Senescence 0.8603731 17340 PI Metabolism 0.8610339 17037 Signaling by Insulin receptor 0.8618491 17948 Regulation of lipid metabolism by Peroxisome proliferator-activated receptor alpha (PPARalpha) 0.8661632 18886 Mitotic G1-G1/S phases 0.8663518 16762 Oxidative Stress Induced Senescence 0.8821651 16761 Nuclear signaling by ERBB4 0.8971238 19616 Signaling by NOTCH 0.8977498 17123 Signaling by WNT in cancer 0.8980881 18028 PI-3K cascade 0.906287 19422 PI3K events in ERBB2 signaling 0.906287 18006 PI3K events in ERBB4 signaling 0.906287 18809 PI3K/AKT Signaling in Cancer 0.906287 17613 PIP3 activates AKT signaling 0.906287 19854 S Phase 0.9066215 17750 Cell Cycle Checkpoints 0.9068525 19299 IRS-mediated signaling 0.9070724 18598 FBXW7 Mutants and NOTCH1 in Cancer 0.9080739 18341 Signaling by NOTCH1 0.9080739 18595 Signaling by NOTCH1 HD Domain Mutants in Cancer 0.9080739 18599 Signaling by NOTCH1 HD+PEST Domain Mutants in Cancer 0.9080739 18596 Signaling by NOTCH1 PEST Domain Mutants in Cancer 0.9080739 18593 Signaling by NOTCH1 in Cancer 0.9080739 18363 Signaling by NOTCH1 t(7;9)(NOTCH1:M1580_K2555) Translocation Mutant 0.9080739 19725 NCAM signaling for neurite out-growth 0.9085624 16953 Signaling by Wnt 0.9118813 19250 IRS-related events 0.9158904 255

18469 IRS-related events triggered by IGF1R 0.9158904 16822 PI3K/AKT activation 0.9158904 17279 Signaling by ERBB4 0.9189963 19372 Generic Transcription Pathway 0.9192261 19115 GAB1 signalosome 0.9194735 16816 Phase 1 - Functionalization of compounds 0.9241684 16776 Organelle biogenesis and maintenance 0.9249083 18472 IGF1R signaling cascade 0.9259122 18473 Signaling by Type 1 Insulin-like Growth Factor 1 Receptor (IGF1R) 0.9259122 18398 Insulin receptor signaling cascade 0.9287842 17157 Unfolded Protein Response (UPR) 0.9296916 18655 PI3K Cascade 0.9377347 17330 Phase II conjugation 0.9474046 16648 Cytochrome P450 - arranged by substrate type 0.9511693 17916 Constitutive PI3K/AKT Signaling in Cancer 0.9768791 19213 Phospholipid metabolism 0.9784727 19782 Metabolism of nucleotides 0.9808956 16986 Separation of Sister Chromatids 0.9817143 19257 Biological oxidations 0.9826985 19211 Glycerophospholipid biosynthesis 0.9884498 16801 Mus musculus biological processes 0.9892207 19723 Mitotic Anaphase 0.9894833 18597 Mitotic Metaphase and Anaphase 0.9898438 18215 MHC class II antigen presentation 0.9902005 17674 Metabolism 0.9981405 17812 Metabolism of lipids and lipoproteins 0.9993527 17635 Cell Cycle 1 16819 Cell Cycle, Mitotic 1 18029 Chromatin modifying enzymes 1 16838 Chromatin organization 1 18436 Epigenetic regulation of gene expression 1 19038 Gene Expression 1 17355 HATs acetylate histones 1 17726 M Phase 1 17132 Membrane Trafficking 1 17734 Metabolism of proteins 1 16787 RNA Polymerase I, RNA Polymerase III, and Mitochondrial Transcription 1 19108 Regulatory RNA pathways 1 17057 The citric acid (TCA) cycle and respiratory electron transport 1

256

Table S3: Bladder transcriptome in response to pure FliC from UPEC CFT073∆4. The table represents transcriptional response of genes by FliC-treated Wt mice in comparison to FliC-treated B6.129S1-Tlr5tm1Flv/J mice, exhibiting significantly altered expression in the bladder. The differential expressions were judged by those exhibiting ±2-fold changes in expression, with a q-value (adjusted p-value) of < 0.05.

Ensembl ID Gene name Fold Change p-adjusted ENSMUSG00000026166 Ccl20 888.01 7.6E-63 ENSMUSG00000055030 Sprr2e 582.80 2.2E-13 ENSMUSG00000031089 Slc6a14 269.97 9.3E-19 ENSMUSG00000042212 Sprr2d 256.16 4.9E-11 ENSMUSG00000057465 Saa2 226.47 4.2E-03 ENSMUSG00000044103 Il1f9 204.72 9.4E-08 ENSMUSG00000032484 Ngp 167.13 7.8E-04 ENSMUSG00000097804 Gm16685 161.76 6.9E-30 ENSMUSG00000029380 Cxcl1 133.02 7.6E-17 ENSMUSG00000096146 Kcnj11 131.58 9.3E-19 ENSMUSG00000020651 Slc26a4 118.49 1.1E-05 ENSMUSG00000034855 Cxcl10 113.93 7.9E-14 ENSMUSG00000064246 Chil1 111.95 5.1E-27 ENSMUSG00000058427 Cxcl2 103.55 2.5E-14 ENSMUSG00000065601 Mir146 88.42 1.8E-04 ENSMUSG00000029371 Cxcl5 87.33 4.0E-13 ENSMUSG00000092130 D030025P21Rik 86.21 6.0E-05 ENSMUSG00000056071 S100a9 82.37 2.2E-12 ENSMUSG00000059657 Stfa2l1 74.19 3.5E-05 ENSMUSG00000022126 Acod1 70.63 1.1E-14 ENSMUSG00000026822 Lcn2 68.90 1.1E-34 ENSMUSG00000041293 Adgrf1 67.66 2.2E-02 ENSMUSG00000056054 S100a8 65.37 3.5E-12 ENSMUSG00000022651 Retnlg 64.46 6.0E-10 ENSMUSG00000001901 Kcnh6 64.41 9.8E-13 ENSMUSG00000041754 Trem3 59.70 2.6E-05 ENSMUSG00000074115 Saa1 53.10 3.4E-07 ENSMUSG00000040136 Abcc8 51.69 3.3E-18 ENSMUSG00000029379 Cxcl3 51.40 1.7E-06 ENSMUSG00000066677 Ifi208 50.80 1.5E-16 ENSMUSG00000063234 Gpr84 50.01 1.0E-13 ENSMUSG00000024313 Mep1b 45.85 4.1E-06 ENSMUSG00000079339 Ifit1bl1 44.38 7.0E-28 ENSMUSG00000027225 Duoxa2 43.55 5.9E-21 ENSMUSG00000110240 Gm45486 41.59 1.1E-02 ENSMUSG00000085015 Gm14424 41.35 1.1E-02 ENSMUSG00000087075 Lbhd2 40.25 1.1E-04

257

ENSMUSG00000035818 Plekhs1 38.35 7.0E-116 ENSMUSG00000018623 Mmp7 35.59 7.5E-06 ENSMUSG00000073209 Klf14 33.93 7.6E-04 ENSMUSG00000073386 9830107B12Rik 33.53 2.9E-03 ENSMUSG00000044162 Tnip3 33.11 9.3E-26 ENSMUSG00000035638 Muc20 33.09 1.5E-14 ENSMUSG00000058207 Serpina3k 32.60 7.6E-04 ENSMUSG00000052212 Cd177 32.45 2.9E-05 ENSMUSG00000046108 Il17c 31.97 2.1E-12 ENSMUSG00000036067 Slc2a6 31.23 1.2E-49 ENSMUSG00000032496 Ltf 30.97 6.8E-10 ENSMUSG00000020826 Nos2 30.58 2.3E-30 ENSMUSG00000042244 Pglyrp3 30.36 1.8E-03 ENSMUSG00000019489 Cd70 30.20 5.1E-04 ENSMUSG00000000182 Fgf23 29.86 3.8E-03 ENSMUSG00000038357 Camp 28.83 1.4E-04 ENSMUSG00000032338 Hcn4 28.65 4.3E-07 ENSMUSG00000058435 Btnl4 27.43 7.7E-03 ENSMUSG00000027925 Sprr2j-ps 26.99 1.5E-02 ENSMUSG00000015316 Slamf1 26.07 4.7E-08 ENSMUSG00000035186 Ubd 25.52 8.8E-08 ENSMUSG00000042662 Dusp15 24.90 2.3E-05 ENSMUSG00000079597 Gm5483 24.86 1.5E-02 ENSMUSG00000040026 Saa3 24.42 1.5E-08 ENSMUSG00000059213 Ddn 23.98 6.9E-04 ENSMUSG00000098434 2010110E17Rik 23.85 1.7E-04 ENSMUSG00000024409 Psors1c2 23.70 1.6E-10 ENSMUSG00000030017 Reg3g 23.15 2.8E-04 ENSMUSG00000027832 Ptx3 22.52 6.2E-07 ENSMUSG00000042268 Slc26a9 22.49 2.1E-08 ENSMUSG00000105096 Gbp10 22.43 1.2E-02 ENSMUSG00000051439 Cd14 22.20 4.1E-18 ENSMUSG00000053338 Tarm1 21.88 1.5E-07 ENSMUSG00000033854 Kcnk10 21.62 4.7E-03 ENSMUSG00000099349 1700047G03Rik 21.43 6.1E-03 ENSMUSG00000046259 Sprr2h 21.42 3.8E-04 ENSMUSG00000023341 Mx2 21.37 4.8E-24 ENSMUSG00000042265 Trem1 20.62 7.2E-07 ENSMUSG00000018459 Slc13a3 20.57 3.5E-25 ENSMUSG00000050578 Mmp13 20.52 7.4E-12 ENSMUSG00000045551 Fpr1 20.32 1.5E-15 ENSMUSG00000105504 Gbp5 19.61 3.6E-11 ENSMUSG00000036805 Noxa1 19.55 1.2E-10 ENSMUSG00000066363 Serpina3f 19.55 2.4E-11 ENSMUSG00000030472 Ceacam18 19.31 1.0E-02

258

ENSMUSG00000097815 Gm26809 18.77 2.7E-11 ENSMUSG00000075611 Gm11545 18.58 1.5E-06 ENSMUSG00000030162 Olr1 17.60 3.5E-07 ENSMUSG00000019850 Tnfaip3 17.33 1.7E-21 ENSMUSG00000054855 Rnd1 17.31 1.3E-05 ENSMUSG00000101574 1700112H15Rik 17.13 1.4E-02 ENSMUSG00000051748 Wfdc21 17.00 5.1E-10 ENSMUSG00000068452 Duox2 16.91 7.1E-20 ENSMUSG00000005800 Mmp8 16.60 3.0E-06 ENSMUSG00000024215 Spdef 16.53 2.4E-08 ENSMUSG00000000386 Mx1 15.60 1.0E-18 ENSMUSG00000022026 Olfm4 15.37 2.0E-03 ENSMUSG00000065471 Mir222 15.08 2.6E-02 ENSMUSG00000027398 Il1b 14.94 3.8E-04 ENSMUSG00000034459 Ifit1 14.89 3.1E-27 ENSMUSG00000032845 Alpk2 14.62 3.1E-11 ENSMUSG00000060183 Cxcl11 14.39 3.4E-05 ENSMUSG00000030142 Clec4e 14.27 2.2E-08 ENSMUSG00000055413 H2-Q5 14.23 6.3E-07 ENSMUSG00000020641 Rsad2 14.15 1.0E-24 ENSMUSG00000048652 Samd13 14.10 1.2E-02 ENSMUSG00000000204 Slfn4 14.07 2.7E-19 ENSMUSG00000024401 Tnf 13.96 3.9E-16 ENSMUSG00000050635 Sprr2f 13.94 3.8E-10 ENSMUSG00000060550 H2-Q7 13.57 6.3E-04 ENSMUSG00000073409 H2-Q6 13.50 1.8E-04 ENSMUSG00000018916 Csf2 13.39 1.3E-04 ENSMUSG00000041827 Oasl1 13.23 2.8E-20 ENSMUSG00000086006 Gm13293 13.01 6.3E-05 ENSMUSG00000085810 Gm16325 12.96 3.9E-02 ENSMUSG00000032257 Ankk1 12.71 7.9E-07 ENSMUSG00000079563 Pglyrp2 12.20 1.1E-07 ENSMUSG00000096506 CR974586.5 11.95 3.9E-04 ENSMUSG00000095589 Ighv1-55 11.87 2.3E-02 ENSMUSG00000020310 Madcam1 11.85 1.2E-02 ENSMUSG00000031722 Hp 11.69 3.6E-07 ENSMUSG00000040328 Olfr56 11.64 1.4E-09 ENSMUSG00000059201 Lep 11.58 9.0E-05 ENSMUSG00000046958 4930432E11Rik 11.40 2.3E-03 ENSMUSG00000071036 Gm10309 11.37 1.6E-07 ENSMUSG00000109685 Gm45912 11.36 3.3E-02 ENSMUSG00000107750 Gm44013 11.25 6.3E-16 ENSMUSG00000085941 Gm11201 11.22 1.3E-02 ENSMUSG00000103098 Gm37559 11.15 1.1E-03 ENSMUSG00000052270 Fpr2 11.10 3.4E-10

259

ENSMUSG00000018930 Ccl4 11.03 1.2E-07 ENSMUSG00000039934 Gsap 10.97 1.0E-22 ENSMUSG00000027360 Hdc 10.96 3.2E-08 ENSMUSG00000102055 Gm28913 10.94 6.2E-24 ENSMUSG00000104181 Gm8850 10.90 4.2E-03 ENSMUSG00000071005 Ccl19 10.83 2.4E-06 ENSMUSG00000050440 Hamp 10.60 7.9E-03 ENSMUSG00000084894 10.57 9.0E-03 ENSMUSG00000079620 Muc4 10.54 4.2E-11 ENSMUSG00000043286 Pnpla1 10.36 1.3E-02 ENSMUSG00000022938 Fam3b 10.34 6.9E-08 ENSMUSG00000027470 Mylk2 10.32 6.5E-08 ENSMUSG00000030413 Pglyrp1 10.32 1.7E-21 ENSMUSG00000104082 Gm7115 10.30 4.8E-04 ENSMUSG00000089994 Gm16239 10.29 2.3E-02 ENSMUSG00000032661 Oas3 10.28 1.1E-14 ENSMUSG00000035385 Ccl2 10.23 2.6E-04 ENSMUSG00000051076 Vtcn1 10.21 1.4E-15 ENSMUSG00000090176 Cd200r2 10.06 6.8E-03 ENSMUSG00000042677 Zc3h12a 9.80 1.1E-26 ENSMUSG00000029417 Cxcl9 9.76 3.0E-05 ENSMUSG00000062826 Ces2f 9.76 1.4E-14 ENSMUSG00000079451 Tmprss11g 9.72 1.8E-04 ENSMUSG00000103467 Gm38245 9.69 4.2E-02 ENSMUSG00000042349 Ikbke 9.51 7.0E-28 ENSMUSG00000087477 Gm13822 9.50 2.9E-02 ENSMUSG00000011008 Mcoln2 9.49 7.6E-05 ENSMUSG00000085471 4933423P22Rik 9.46 1.6E-02 ENSMUSG00000047222 Rnase2a 9.45 3.3E-03 ENSMUSG00000085786 Gm15987 9.43 9.4E-12 ENSMUSG00000022603 Mroh4 9.39 3.8E-03 ENSMUSG00000103439 Gm7019 9.37 3.0E-02 ENSMUSG00000038067 Csf3 9.27 2.5E-15 ENSMUSG00000078780 Gm5150 9.26 2.6E-02 ENSMUSG00000012428 Steap4 9.21 9.5E-07 ENSMUSG00000108696 Gm5738 9.20 2.7E-02 ENSMUSG00000002565 Scin 9.15 2.8E-22 ENSMUSG00000026981 Il1rn 9.11 9.3E-12 ENSMUSG00000090588 Gm9573 9.06 1.3E-02 ENSMUSG00000053797 Krt16 9.01 6.0E-03 ENSMUSG00000110484 Gm45712 8.96 4.5E-02 ENSMUSG00000104212 Gm37986 8.90 5.4E-07 ENSMUSG00000044313 Mab21l3 8.86 3.6E-11 ENSMUSG00000044701 Il27 8.79 2.6E-04 ENSMUSG00000070524 Fcrlb 8.77 7.0E-05

260

ENSMUSG00000037405 Icam1 8.77 1.5E-09 ENSMUSG00000027995 Tlr2 8.76 1.5E-15 ENSMUSG00000108812 C130083A15Rik 8.57 3.4E-02 ENSMUSG00000079014 Serpina3i 8.57 6.5E-03 ENSMUSG00000047180 Neurl3 8.51 5.9E-15 ENSMUSG00000069518 Gm10271 8.51 6.1E-03 ENSMUSG00000082292 Gm12250 8.46 4.2E-07 ENSMUSG00000000982 Ccl3 8.41 2.3E-08 ENSMUSG00000082382 Gm14970 8.31 4.1E-02 ENSMUSG00000079022 Col22a1 8.25 1.4E-04 ENSMUSG00000030111 A2m 8.25 3.7E-04 ENSMUSG00000062488 Ifit3b 8.20 3.6E-12 ENSMUSG00000047798 Cd300lf 8.13 3.9E-09 ENSMUSG00000103588 Gm18445 8.10 2.8E-02 ENSMUSG00000065968 Ifitm7 8.09 3.2E-02 ENSMUSG00000020010 Vnn3 8.09 9.7E-07 ENSMUSG00000016498 Pdcd1lg2 8.08 5.5E-04 ENSMUSG00000095298 Gm12407 8.07 1.8E-03 ENSMUSG00000024771 Lipk 8.07 6.6E-12 ENSMUSG00000104735 C130075A20Rik 8.03 3.9E-02 ENSMUSG00000078763 Slfn1 8.01 1.2E-13 ENSMUSG00000027399 Il1a 7.95 2.3E-07 ENSMUSG00000084834 4930565N06Rik 7.95 2.8E-04 ENSMUSG00000086754 Gm16098 7.89 2.7E-04 ENSMUSG00000032000 Birc3 7.83 3.7E-22 ENSMUSG00000026180 Cxcr2 7.79 1.0E-02 ENSMUSG00000063851 Rnf183 7.78 1.9E-02 ENSMUSG00000078612 Fyb2 7.77 2.7E-07 ENSMUSG00000082902 Ccl19-ps1 7.76 3.8E-02 ENSMUSG00000073529 F830208F22Rik 7.73 1.4E-03 ENSMUSG00000081731 Calr-ps 7.64 4.8E-03 ENSMUSG00000103313 Gm38357 7.58 6.7E-05 ENSMUSG00000031980 Agt 7.53 3.9E-04 ENSMUSG00000105239 Gm43091 7.52 1.9E-02 ENSMUSG00000026475 Rgs16 7.47 4.2E-04 ENSMUSG00000099703 Gm28285 7.47 4.2E-02 ENSMUSG00000020891 Alox8 7.42 1.0E-12 ENSMUSG00000031549 Ido2 7.32 5.4E-05 ENSMUSG00000035929 H2-Q4 7.27 1.3E-18 ENSMUSG00000044574 5031434C07Rik 7.23 1.3E-02 ENSMUSG00000042671 Rgs8 7.21 8.6E-03 ENSMUSG00000105613 Gm43684 7.13 1.6E-03 ENSMUSG00000020181 Nav3 7.06 4.9E-04 ENSMUSG00000025059 Gk 6.99 2.1E-12 ENSMUSG00000041460 Cacna2d4 6.91 2.1E-03

261

ENSMUSG00000068606 Gm4841 6.88 2.3E-04 ENSMUSG00000025498 Irf7 6.85 1.4E-14 ENSMUSG00000023947 Nfkbie 6.83 6.7E-31 ENSMUSG00000098268 Gm27514 6.81 4.2E-02 ENSMUSG00000086347 Gm11626 6.78 1.2E-03 ENSMUSG00000021025 Nfkbia 6.77 2.9E-17 ENSMUSG00000028859 Csf3r 6.68 3.1E-12 ENSMUSG00000070327 Rnf213 6.67 2.1E-16 ENSMUSG00000073980 Gm9574 6.65 1.5E-04 ENSMUSG00000010592 Dazl 6.65 1.1E-02 ENSMUSG00000020638 Cmpk2 6.62 5.6E-10 ENSMUSG00000031257 Nox1 6.56 4.5E-04 ENSMUSG00000026725 Tnn 6.54 2.1E-06 ENSMUSG00000035356 Nfkbiz 6.53 5.1E-27 ENSMUSG00000035692 Isg15 6.52 7.0E-16 ENSMUSG00000044006 Cilp2 6.51 3.9E-10 ENSMUSG00000028037 Ifi44 6.51 1.3E-08 ENSMUSG00000034422 Parp14 6.49 3.4E-15 ENSMUSG00000078783 Gm9733 6.48 2.3E-03 ENSMUSG00000092277 Gm19684 6.46 2.9E-02 ENSMUSG00000041347 Bdkrb1 6.45 3.0E-02 ENSMUSG00000015533 Itga2 6.35 3.0E-07 ENSMUSG00000101581 C430002N11Rik 6.35 3.3E-02 ENSMUSG00000065661 Gm22580 6.34 4.6E-02 ENSMUSG00000097134 1110002J07Rik 6.32 4.1E-09 ENSMUSG00000031765 Mt1 6.31 2.4E-04 ENSMUSG00000020400 Tnip1 6.31 2.1E-20 ENSMUSG00000084083 Gm15782 6.29 2.9E-03 ENSMUSG00000025064 Col17a1 6.28 3.3E-04 ENSMUSG00000062296 Trank1 6.25 1.1E-04 ENSMUSG00000041135 Ripk2 6.24 5.1E-27 ENSMUSG00000022534 Mefv 6.22 2.1E-04 ENSMUSG00000090007 Rpl30-ps2 6.21 3.0E-03 ENSMUSG00000074896 Ifit3 6.19 5.7E-11 ENSMUSG00000038298 Pdzk1 6.15 3.2E-02 ENSMUSG00000107971 Gm44260 6.14 1.3E-02 ENSMUSG00000046688 Tifa 6.13 7.5E-11 ENSMUSG00000109781 Gm45509 6.08 3.4E-02 ENSMUSG00000079012 Serpina3m 6.04 2.9E-02 ENSMUSG00000052485 Tmem171 6.03 3.2E-02 ENSMUSG00000055994 Nod2 6.03 4.7E-09 ENSMUSG00000074676 Foxs1 6.02 1.4E-06 ENSMUSG00000072624 Gm5460 6.02 1.1E-02 ENSMUSG00000092035 Peg10 6.01 5.0E-08 ENSMUSG00000081679 Gm11874 6.01 9.0E-03

262

ENSMUSG00000001131 Timp1 6.01 4.1E-03 ENSMUSG00000102027 Gm28914 6.00 2.4E-04 ENSMUSG00000025082 Vwa2 5.99 4.2E-02 ENSMUSG00000054203 Ifi205 5.98 3.4E-06 ENSMUSG00000033355 Rtp4 5.95 7.4E-16 ENSMUSG00000081068 Gm12804 5.94 1.1E-02 ENSMUSG00000028270 Gbp2 5.90 7.5E-07 ENSMUSG00000090665 Gad1-ps 5.90 2.9E-02 ENSMUSG00000064451 Snora23 5.89 1.2E-02 ENSMUSG00000034686 Prr7 5.88 5.4E-11 ENSMUSG00000049100 Pcdh10 5.88 5.6E-06 ENSMUSG00000000628 Hk2 5.86 2.1E-04 ENSMUSG00000078249 Hmga1b 5.85 3.0E-10 ENSMUSG00000103292 Gm35048 5.83 2.0E-02 ENSMUSG00000026068 Il18rap 5.79 2.1E-06 ENSMUSG00000021281 Tnfaip2 5.79 3.8E-11 ENSMUSG00000091387 Gcnt4 5.77 6.0E-07 ENSMUSG00000072620 Slfn2 5.73 2.2E-13 ENSMUSG00000107804 Gm44439 5.73 1.3E-02 ENSMUSG00000038745 Nlrp6 5.72 4.2E-02 ENSMUSG00000029762 Akr1b8 5.72 1.6E-04 ENSMUSG00000025429 Pstpip2 5.71 3.9E-19 ENSMUSG00000017652 Cd40 5.68 2.9E-12 ENSMUSG00000029449 Rhof 5.67 2.2E-17 ENSMUSG00000047810 Ccdc88b 5.65 4.8E-12 ENSMUSG00000008193 Spib 5.65 3.2E-04 ENSMUSG00000020963 Tshr 5.64 6.2E-03 ENSMUSG00000034551 Hdx 5.64 3.6E-07 ENSMUSG00000047898 Ccr4 5.64 2.1E-05 ENSMUSG00000099997 Tubb4b-ps2 5.62 5.8E-03 ENSMUSG00000068631 Gm7676 5.61 1.4E-04 ENSMUSG00000032021 Crtam 5.61 2.8E-02 ENSMUSG00000045569 Mc2r 5.61 8.8E-04 ENSMUSG00000054072 Iigp1 5.61 4.9E-04 ENSMUSG00000052749 Trim30b 5.59 2.8E-07 ENSMUSG00000029561 Oasl2 5.58 5.8E-13 ENSMUSG00000063354 Slc39a4 5.53 1.2E-11 ENSMUSG00000026536 Ifi211 5.52 3.0E-11 ENSMUSG00000052396 Mogat2 5.50 1.0E-09 ENSMUSG00000092134 Gm17089 5.49 2.6E-04 ENSMUSG00000109424 Gm44658 5.44 2.8E-02 ENSMUSG00000035373 Ccl7 5.43 1.6E-02 ENSMUSG00000105124 Gm5297 5.42 6.5E-03 ENSMUSG00000085977 Gm5970 5.41 3.0E-03 ENSMUSG00000109864 Eid3 5.37 1.8E-03

263

ENSMUSG00000030650 Tmc5 5.36 4.5E-02 ENSMUSG00000037428 Vgf 5.35 1.8E-04 ENSMUSG00000046031 Calhm6 5.35 5.5E-03 ENSMUSG00000023064 Sncg 5.34 3.2E-08 ENSMUSG00000032369 Plscr1 5.29 1.3E-08 ENSMUSG00000003283 Hck 5.27 4.9E-21 ENSMUSG00000030474 Siglece 5.22 2.8E-10 ENSMUSG00000059898 Dsc3 5.19 4.5E-02 ENSMUSG00000000567 Sox9 5.18 2.5E-07 ENSMUSG00000105378 Gm42515 5.16 2.3E-02 ENSMUSG00000073407 Gm6034 5.16 2.2E-02 ENSMUSG00000031779 Ccl22 5.15 5.5E-05 ENSMUSG00000082676 Gm11843 5.14 2.0E-04 ENSMUSG00000029298 Gbp9 5.11 1.4E-05 ENSMUSG00000087365 C430049B03Rik 5.10 2.4E-06 ENSMUSG00000100291 2310069B03Rik 5.08 6.4E-06 ENSMUSG00000031860 Pbx4 5.08 1.4E-22 ENSMUSG00000033538 Casp4 5.06 9.5E-07 ENSMUSG00000063586 Gm5513 5.06 4.3E-02 ENSMUSG00000029378 Areg 5.06 3.6E-02 ENSMUSG00000006538 Ihh 5.05 1.6E-02 ENSMUSG00000020159 Gabrp 5.04 1.0E-03 ENSMUSG00000097983 Gm26971 5.03 3.2E-02 ENSMUSG00000087700 Gm15283 5.02 3.5E-03 ENSMUSG00000034394 Lif 5.01 1.4E-12 ENSMUSG00000042784 Muc1 4.98 1.0E-05 ENSMUSG00000086320 Gm12840 4.97 2.6E-02 ENSMUSG00000012519 Mlkl 4.95 6.9E-10 ENSMUSG00000035208 Slfn8 4.95 7.1E-13 ENSMUSG00000032327 Stra6 4.94 2.1E-08 ENSMUSG00000070564 Ntn5 4.89 4.6E-02 ENSMUSG00000051225 Fam83a 4.88 6.8E-06 ENSMUSG00000072621 Slfn10-ps 4.87 5.4E-04 ENSMUSG00000003617 Cp 4.87 8.8E-09 ENSMUSG00000039193 Nlrc4 4.86 1.1E-08 ENSMUSG00000102037 Bcl2a1a 4.85 1.6E-06 ENSMUSG00000040483 Xaf1 4.83 1.1E-11 ENSMUSG00000080768 Gm12219 4.82 1.1E-02 ENSMUSG00000016496 Cd274 4.82 9.5E-10 ENSMUSG00000030747 Dgat2 4.82 5.7E-09 ENSMUSG00000107017 Gm43196 4.81 1.7E-05 ENSMUSG00000041358 Nutm1 4.80 4.5E-02 ENSMUSG00000103548 Gm37670 4.79 8.8E-03 ENSMUSG00000024778 Fas 4.78 4.6E-09 ENSMUSG00000025225 Nfkb2 4.74 1.7E-13

264

ENSMUSG00000031538 Plat 4.73 1.3E-03 ENSMUSG00000064280 Ccdc146 4.71 7.6E-06 ENSMUSG00000029005 Draxin 4.71 1.3E-02 ENSMUSG00000031551 Ido1 4.69 6.2E-05 ENSMUSG00000040033 Stat2 4.69 1.9E-15 ENSMUSG00000031780 Ccl17 4.68 1.8E-06 ENSMUSG00000051228 Nyx 4.68 2.2E-03 ENSMUSG00000027737 Slc7a11 4.68 2.1E-05 ENSMUSG00000049502 Dtx3l 4.65 4.0E-13 ENSMUSG00000106741 4930513D17Rik 4.64 2.8E-02 ENSMUSG00000075302 Erich2 4.64 5.2E-08 ENSMUSG00000027514 Zbp1 4.64 2.0E-08 ENSMUSG00000002983 Relb 4.63 3.3E-13 ENSMUSG00000004043 Stat5a 4.63 9.8E-12 ENSMUSG00000073598 1700066B19Rik 4.61 2.9E-03 ENSMUSG00000062345 Serpinb2 4.60 7.3E-03 ENSMUSG00000077380 Gm22661 4.59 2.7E-04 ENSMUSG00000108108 Gm44270 4.58 3.9E-02 ENSMUSG00000050141 Fam205c 4.58 6.1E-03 ENSMUSG00000093256 Gm22933 4.57 4.0E-02 ENSMUSG00000025481 Urah 4.56 3.0E-03 ENSMUSG00000071068 Treml2 4.54 1.3E-03 ENSMUSG00000041449 Serpina3h 4.54 3.3E-03 ENSMUSG00000037580 Gch1 4.53 4.6E-05 ENSMUSG00000066361 Serpina3c 4.52 8.8E-06 ENSMUSG00000071867 Gm6304 4.51 3.2E-03 ENSMUSG00000090389 Cdv3-ps 4.50 1.2E-05 ENSMUSG00000035200 Chrnb4 4.50 1.1E-03 ENSMUSG00000028613 Lrp8 4.50 7.9E-03 ENSMUSG00000034266 Batf 4.49 2.2E-06 ENSMUSG00000041481 Serpina3g 4.49 3.6E-03 ENSMUSG00000075010 AW112010 4.48 9.9E-07 ENSMUSG00000107215 Gm43197 4.47 3.3E-04 ENSMUSG00000028553 Angptl3 4.47 4.8E-03 ENSMUSG00000022041 Chrna2 4.46 2.4E-05 ENSMUSG00000046999 1110032F04Rik 4.46 3.4E-02 ENSMUSG00000082878 Gm12583 4.45 3.2E-06 ENSMUSG00000028965 Tnfrsf9 4.44 3.4E-04 ENSMUSG00000027670 Ocstamp 4.44 4.6E-02 ENSMUSG00000055865 Fam19a3 4.43 3.5E-04 ENSMUSG00000047735 Samd9l 4.43 2.1E-15 ENSMUSG00000053175 Bcl3 4.41 4.1E-02 ENSMUSG00000023078 Cxcl13 4.41 8.1E-06 ENSMUSG00000022906 Parp9 4.40 8.4E-13 ENSMUSG00000020901 Pik3r5 4.39 7.5E-11

265

ENSMUSG00000097016 Gm26708 4.39 1.5E-02 ENSMUSG00000099875 Rbm3-ps 4.39 1.4E-17 ENSMUSG00000022237 Ankrd33b 4.39 2.3E-05 ENSMUSG00000053137 Mapk11 4.39 3.1E-11 ENSMUSG00000027580 Helz2 4.38 3.6E-13 ENSMUSG00000067235 H2-Q10 4.38 3.3E-02 ENSMUSG00000059493 Nhs 4.37 1.8E-07 ENSMUSG00000035861 Tmprss11b 4.37 8.3E-04 ENSMUSG00000048215 A630023P12Rik 4.36 1.3E-02 ENSMUSG00000030921 Trim30a 4.35 3.3E-13 ENSMUSG00000108720 Gm44672 4.34 9.1E-03 ENSMUSG00000021256 Vash1 4.34 3.5E-06 ENSMUSG00000003206 Ebi3 4.34 7.2E-08 ENSMUSG00000043953 Ccrl2 4.32 1.7E-07 ENSMUSG00000097857 Gm26603 4.29 4.4E-02 ENSMUSG00000059912 Rpl21-ps6 4.27 2.3E-02 ENSMUSG00000047517 Dmbt1 4.25 4.8E-05 ENSMUSG00000050896 Rtn4rl2 4.25 2.3E-02 ENSMUSG00000016529 Il10 4.25 2.8E-04 ENSMUSG00000002100 Mybpc3 4.23 7.0E-03 ENSMUSG00000037443 Cep85 4.22 1.4E-09 ENSMUSG00000068245 Phf11d 4.22 1.8E-13 ENSMUSG00000054404 Slfn5 4.21 9.8E-09 ENSMUSG00000045502 Hcar2 4.21 1.7E-09 ENSMUSG00000110438 Gm45756 4.21 4.2E-03 ENSMUSG00000006389 Mpl 4.21 1.9E-02 ENSMUSG00000090891 D6Ertd527e 4.20 6.8E-08 ENSMUSG00000028268 Gbp3 4.20 7.8E-07 ENSMUSG00000004359 Spic 4.20 6.3E-05 ENSMUSG00000084113 Gm14277 4.20 5.1E-03 ENSMUSG00000025582 Nptx1 4.19 3.7E-04 ENSMUSG00000024235 Map3k8 4.19 1.5E-09 ENSMUSG00000025938 Slco5a1 4.19 9.6E-04 ENSMUSG00000036834 Plch1 4.18 1.6E-09 ENSMUSG00000032776 Mctp2 4.18 4.6E-07 ENSMUSG00000039196 Orm1 4.17 1.2E-02 ENSMUSG00000103138 Gm2238 4.17 2.1E-02 ENSMUSG00000092021 Gbp11 4.16 2.0E-02 ENSMUSG00000024772 Ehd1 4.16 8.3E-11 ENSMUSG00000029798 Herc6 4.15 1.0E-07 ENSMUSG00000069874 Irgm2 4.12 2.3E-05 ENSMUSG00000089125 Gm26403 4.11 1.1E-04 ENSMUSG00000028874 Fgr 4.09 1.0E-07 ENSMUSG00000002459 Rgs20 4.09 4.1E-02 ENSMUSG00000022949 Clic6 4.08 1.2E-04

266

ENSMUSG00000029605 Oas1b 4.06 3.1E-09 ENSMUSG00000073274 Gm14636 4.06 5.0E-03 ENSMUSG00000022206 Npr3 4.06 1.5E-02 ENSMUSG00000065341 Gm25579 4.05 3.9E-05 ENSMUSG00000005087 Cd44 4.04 7.6E-05 ENSMUSG00000056271 Lman1l 4.04 8.8E-04 ENSMUSG00000049097 Ankrd34a 4.03 5.2E-06 ENSMUSG00000078922 Tgtp1 4.02 3.0E-03 ENSMUSG00000082100 Glns-ps1 4.02 9.1E-08 ENSMUSG00000078606 Gm4070 4.02 2.9E-05 ENSMUSG00000099998 Gm6501 4.02 1.1E-03 ENSMUSG00000058163 Gm5431 4.01 2.4E-04 ENSMUSG00000026450 Chit1 4.01 9.8E-03 ENSMUSG00000031762 Mt2 4.01 3.9E-02 ENSMUSG00000081512 Gm15821 3.99 5.0E-05 ENSMUSG00000108238 Gm43984 3.98 6.6E-03 ENSMUSG00000045102 Poln 3.96 4.2E-02 ENSMUSG00000085563 2210411M09Rik 3.96 1.2E-05 ENSMUSG00000045932 Ifit2 3.95 3.8E-10 ENSMUSG00000081248 Gm13787 3.95 2.2E-02 ENSMUSG00000038781 Stap2 3.94 1.3E-17 ENSMUSG00000102856 Gm37084 3.93 7.9E-03 ENSMUSG00000069125 Rps24-ps2 3.93 7.9E-03 ENSMUSG00000090319 Gm4462 3.93 1.2E-09 ENSMUSG00000028051 Hcn3 3.92 1.9E-12 ENSMUSG00000069793 Slfn9 3.91 5.2E-06 ENSMUSG00000057160 Gm16372 3.91 2.7E-02 ENSMUSG00000045216 Hs6st1 3.91 1.7E-08 ENSMUSG00000106734 Gm20559 3.90 2.1E-08 ENSMUSG00000033508 Asprv1 3.90 1.4E-04 ENSMUSG00000058794 Nfe2 3.90 3.6E-05 ENSMUSG00000030317 Timp4 3.89 1.4E-02 ENSMUSG00000018920 Cxcl16 3.89 6.2E-16 ENSMUSG00000030144 Clec4d 3.89 2.7E-02 ENSMUSG00000103132 Gm37978 3.88 5.5E-03 ENSMUSG00000034145 Tmem63c 3.88 4.3E-02 ENSMUSG00000047441 Antxrl 3.88 1.0E-02 ENSMUSG00000109484 Gm44870 3.88 2.6E-02 ENSMUSG00000047728 BC025446 3.88 3.4E-03 ENSMUSG00000021702 Thbs4 3.88 6.2E-03 ENSMUSG00000021303 Gng4 3.88 3.6E-04 ENSMUSG00000073489 Ifi204 3.87 3.1E-07 ENSMUSG00000002228 Ppm1j 3.87 2.4E-04 ENSMUSG00000047884 Klk9 3.87 7.7E-03 ENSMUSG00000030595 Nfkbib 3.86 5.7E-16

267

ENSMUSG00000027368 Dusp2 3.86 1.7E-05 ENSMUSG00000082530 Gm12168 3.85 5.7E-03 ENSMUSG00000108389 Gm45206 3.85 1.4E-02 ENSMUSG00000051022 Hs3st1 3.85 7.6E-07 ENSMUSG00000039747 Orai2 3.85 1.5E-08 ENSMUSG00000026580 Selp 3.84 4.8E-05 ENSMUSG00000055978 Fut2 3.84 1.2E-03 ENSMUSG00000074771 Ankef1 3.84 3.7E-02 ENSMUSG00000000805 Car4 3.82 3.4E-03 ENSMUSG00000051314 Ffar2 3.82 7.0E-03 ENSMUSG00000025473 Adam8 3.81 1.8E-02 ENSMUSG00000031778 Cx3cl1 3.81 1.8E-07 ENSMUSG00000032691 Nlrp3 3.81 2.6E-05 ENSMUSG00000097904 Gm26711 3.80 8.2E-04 ENSMUSG00000086866 4930512H18Rik 3.80 4.9E-02 ENSMUSG00000031898 Dpep3 3.80 4.4E-02 ENSMUSG00000054204 Alkal2 3.79 2.1E-02 ENSMUSG00000031910 Has3 3.79 1.4E-02 ENSMUSG00000001249 Hpn 3.79 8.6E-09 ENSMUSG00000026971 Itgb6 3.78 2.4E-08 ENSMUSG00000039981 Zc3h12d 3.78 2.1E-06 ENSMUSG00000020227 Irak3 3.77 4.0E-13 ENSMUSG00000026773 Pfkfb3 3.77 4.5E-07 ENSMUSG00000104654 Gm43814 3.75 4.1E-03 ENSMUSG00000047562 Mmp10 3.73 2.3E-02 ENSMUSG00000062007 Hsh2d 3.73 4.9E-03 ENSMUSG00000073555 Gm4951 3.73 5.9E-03 ENSMUSG00000066861 Oas1g 3.73 2.1E-05 ENSMUSG00000050663 Trhde 3.72 2.8E-02 ENSMUSG00000027962 Vcam1 3.72 1.0E-10 ENSMUSG00000090564 A430057M04Rik 3.70 5.6E-04 ENSMUSG00000017830 Dhx58 3.70 1.2E-09 ENSMUSG00000026815 Gfi1b 3.70 3.1E-02 ENSMUSG00000000562 Adora3 3.70 1.2E-03 ENSMUSG00000023083 H2-M10.2 3.68 1.5E-02 ENSMUSG00000106239 Gm9260 3.68 8.7E-03 ENSMUSG00000001763 Tspan33 3.67 3.6E-10 ENSMUSG00000031880 Rrad 3.66 8.1E-07 ENSMUSG00000107745 Gm43917 3.66 3.7E-02 ENSMUSG00000070868 Skint3 3.65 8.9E-03 ENSMUSG00000037849 Ifi206 3.65 1.1E-04 ENSMUSG00000032068 Plet1 3.64 8.2E-16 ENSMUSG00000002289 Angptl4 3.64 2.2E-05 ENSMUSG00000025278 Flnb 3.63 2.4E-03 ENSMUSG00000020599 Rgs9 3.62 7.2E-09

268

ENSMUSG00000086443 4933421A08Rik 3.62 2.1E-02 ENSMUSG00000102235 Gm37886 3.61 4.7E-02 ENSMUSG00000024079 Eif2ak2 3.60 5.1E-13 ENSMUSG00000093760 3.60 7.8E-05 ENSMUSG00000048992 Prss32 3.60 7.6E-05 ENSMUSG00000022584 Ly6c2 3.58 3.0E-05 ENSMUSG00000033213 AA467197 3.58 3.3E-03 ENSMUSG00000046879 Irgm1 3.58 2.0E-06 ENSMUSG00000043939 A530064D06Rik 3.58 9.7E-03 ENSMUSG00000023206 Il15ra 3.57 2.0E-10 ENSMUSG00000008496 Pou2f2 3.57 6.8E-10 ENSMUSG00000091177 Gm15494 3.57 4.2E-02 ENSMUSG00000105641 Gm5853 3.55 1.7E-02 ENSMUSG00000101589 Rbm6-ps1 3.53 3.8E-03 ENSMUSG00000104841 Gm17743 3.53 1.3E-03 ENSMUSG00000027333 Smox 3.53 2.1E-08 ENSMUSG00000022876 Samsn1 3.52 1.7E-05 ENSMUSG00000023828 Slc22a3 3.52 1.1E-02 ENSMUSG00000087050 Dhrs13os 3.52 8.5E-03 ENSMUSG00000085213 Gm13091 3.52 3.2E-06 ENSMUSG00000040296 Ddx58 3.52 2.1E-14 ENSMUSG00000024842 Cabp4 3.52 3.2E-06 ENSMUSG00000098414 Mir6909 3.51 3.8E-02 ENSMUSG00000083767 Gm11405 3.51 2.8E-02 ENSMUSG00000014773 Dll1 3.51 4.8E-06 ENSMUSG00000022878 Adipoq 3.51 2.3E-02 ENSMUSG00000029368 Alb 3.51 2.5E-03 ENSMUSG00000041653 Pnpla3 3.50 1.4E-02 ENSMUSG00000024675 Ms4a4c 3.50 8.4E-06 ENSMUSG00000096954 Gdap10 3.50 6.6E-07 ENSMUSG00000023903 Mmp25 3.50 1.3E-03 ENSMUSG00000109812 Gm45640 3.50 6.6E-07 ENSMUSG00000092985 Mir378b 3.49 1.3E-02 ENSMUSG00000028262 Clca3a2 3.48 7.6E-08 ENSMUSG00000057596 Trim30d 3.48 5.8E-10 ENSMUSG00000097081 Gm10425 3.47 5.2E-05 ENSMUSG00000079363 Gbp4 3.45 1.7E-02 ENSMUSG00000063388 BC023105 3.45 2.5E-02 ENSMUSG00000074272 Ceacam1 3.44 3.2E-07 ENSMUSG00000078853 Igtp 3.44 1.2E-02 ENSMUSG00000078920 Ifi47 3.44 5.6E-04 ENSMUSG00000085289 Gm15337 3.44 2.5E-02 ENSMUSG00000046546 Fam43a 3.44 1.2E-03 ENSMUSG00000015312 Gadd45b 3.44 8.0E-06 ENSMUSG00000088856 Gm24727 3.43 2.0E-02

269

ENSMUSG00000050243 Gm5446 3.43 1.9E-02 ENSMUSG00000073821 8030451A03Rik 3.42 6.8E-03 ENSMUSG00000005057 Sh2b2 3.42 1.0E-06 ENSMUSG00000061517 Sox21 3.42 1.1E-02 ENSMUSG00000108214 Gm43982 3.42 3.1E-02 ENSMUSG00000099974 Bcl2a1d 3.41 2.0E-07 ENSMUSG00000026874 Hc 3.41 7.9E-03 ENSMUSG00000074892 B3galt5 3.41 8.0E-05 ENSMUSG00000035337 Uchl4 3.41 2.0E-03 ENSMUSG00000036699 Zcchc12 3.40 1.6E-02 ENSMUSG00000032688 Malt1 3.40 3.1E-18 ENSMUSG00000037321 Tap1 3.40 5.1E-07 ENSMUSG00000079225 Gm9531 3.39 3.4E-12 ENSMUSG00000044434 Gm9791 3.39 2.6E-03 ENSMUSG00000044350 Lacc1 3.38 4.2E-11 ENSMUSG00000059195 Gm12715 3.37 1.1E-05 ENSMUSG00000107304 Gm43775 3.37 3.3E-02 ENSMUSG00000026994 Galnt3 3.37 6.4E-04 ENSMUSG00000045868 Gvin1 3.36 7.7E-06 ENSMUSG00000097418 Mir155hg 3.35 6.2E-04 ENSMUSG00000007946 Phox2a 3.35 3.3E-02 ENSMUSG00000042333 Tnfrsf14 3.35 3.7E-04 ENSMUSG00000027347 Rasgrp1 3.34 7.5E-06 ENSMUSG00000015437 Gzmb 3.34 5.4E-04 ENSMUSG00000070729 Gm12966 3.34 6.3E-17 ENSMUSG00000079038 D130040H23Rik 3.33 1.3E-08 ENSMUSG00000057346 Apol9a 3.32 4.5E-06 ENSMUSG00000052776 Oas1a 3.32 1.6E-07 ENSMUSG00000002020 Ltbp2 3.32 1.1E-04 ENSMUSG00000020264 Slc36a2 3.31 3.9E-02 ENSMUSG00000082057 Gm15789 3.31 3.3E-02 ENSMUSG00000049515 Espnl 3.31 6.0E-03 ENSMUSG00000087281 Gm16015 3.31 2.5E-02 ENSMUSG00000040253 Gbp7 3.30 2.7E-04 ENSMUSG00000031725 Ces1f 3.30 3.0E-02 ENSMUSG00000079224 Gm6565 3.30 3.3E-04 ENSMUSG00000089999 Gm6485 3.29 7.1E-07 ENSMUSG00000039232 Stx11 3.29 7.4E-14 ENSMUSG00000036931 Nfkbid 3.28 7.4E-08 ENSMUSG00000090222 Ifi203-ps 3.27 1.4E-04 ENSMUSG00000092837 Rpph1 3.27 1.9E-02 ENSMUSG00000089296 Gm23205 3.27 1.4E-03 ENSMUSG00000021091 Serpina3n 3.27 4.6E-02 ENSMUSG00000024737 Slc15a3 3.27 4.1E-04 ENSMUSG00000054958 Nt5c1a 3.26 4.9E-02

270

ENSMUSG00000107161 Gm43850 3.26 3.7E-02 ENSMUSG00000028699 Tspan1 3.26 2.9E-04 ENSMUSG00000030666 Calcb 3.26 4.1E-02 ENSMUSG00000067736 Gm10222 3.25 3.2E-03 ENSMUSG00000071637 Cebpd 3.25 4.4E-02 ENSMUSG00000051682 Treml4 3.24 1.4E-03 ENSMUSG00000100922 Gm8520 3.24 6.0E-03 ENSMUSG00000085958 A930019D19Rik 3.23 1.4E-02 ENSMUSG00000025017 Pik3ap1 3.23 1.3E-14 ENSMUSG00000035020 Epgn 3.22 4.9E-02 ENSMUSG00000039518 Cdsn 3.22 3.9E-03 ENSMUSG00000090272 Mndal 3.21 7.9E-08 ENSMUSG00000081619 Gm13351 3.21 3.6E-02 ENSMUSG00000065549 Mir200b 3.21 4.8E-02 ENSMUSG00000073491 Ifi213 3.21 5.3E-04 ENSMUSG00000046636 Gm7729 3.20 1.1E-02 ENSMUSG00000108456 4732496C06Rik 3.20 2.2E-07 ENSMUSG00000096929 A330023F24Rik 3.20 1.3E-10 ENSMUSG00000061232 H2-K1 3.20 1.4E-09 ENSMUSG00000031803 B3gnt3 3.19 2.3E-08 ENSMUSG00000100280 Gm28417 3.18 2.9E-06 ENSMUSG00000101009 1700108F19Rik 3.18 2.4E-02 ENSMUSG00000020062 Slc5a8 3.18 1.5E-03 ENSMUSG00000059434 Gckr 3.18 3.4E-02 ENSMUSG00000105198 Gm42502 3.17 1.1E-02 ENSMUSG00000037411 Serpine1 3.17 4.8E-02 ENSMUSG00000001542 Ell2 3.17 6.5E-06 ENSMUSG00000083195 Gm13567 3.17 2.1E-02 ENSMUSG00000032357 Tinag 3.16 3.2E-02 ENSMUSG00000021416 Eci3 3.16 2.0E-02 ENSMUSG00000039997 Ifi203 3.15 3.3E-07 ENSMUSG00000035355 Kcnh4 3.15 3.0E-02 ENSMUSG00000048905 4930539E08Rik 3.15 2.4E-02 ENSMUSG00000079588 Tmem182 3.14 2.5E-02 ENSMUSG00000102329 Gm10851 3.14 3.6E-02 ENSMUSG00000020701 Tmem132e 3.13 1.7E-03 ENSMUSG00000018899 Irf1 3.13 1.2E-05 ENSMUSG00000109984 Gm38948 3.13 9.7E-03 ENSMUSG00000037921 Ddx60 3.12 4.5E-03 ENSMUSG00000025044 Msr1 3.11 5.9E-05 ENSMUSG00000097223 Gm2449 3.11 1.3E-02 ENSMUSG00000107211 Gm5864 3.11 5.6E-04 ENSMUSG00000094392 Gm3788 3.11 7.5E-08 ENSMUSG00000033016 Nfatc1 3.11 1.9E-05 ENSMUSG00000102496 Gm36989 3.10 1.2E-04

271

ENSMUSG00000050092 Sprr2b 3.10 2.1E-02 ENSMUSG00000097139 Gm26626 3.10 7.1E-03 ENSMUSG00000028163 Nfkb1 3.09 7.4E-08 ENSMUSG00000056749 Nfil3 3.09 3.2E-02 ENSMUSG00000019852 Arfgef3 3.09 7.5E-05 ENSMUSG00000018569 Cldn7 3.08 9.0E-04 ENSMUSG00000013643 Lypd8 3.08 1.6E-07 ENSMUSG00000026896 Ifih1 3.08 1.4E-09 ENSMUSG00000101450 Gm28941 3.07 1.2E-02 ENSMUSG00000021109 Hif1a 3.07 2.3E-02 ENSMUSG00000060802 B2m 3.07 4.2E-11 ENSMUSG00000020250 Txnrd1 3.06 1.7E-05 ENSMUSG00000087141 Plcxd2 3.06 4.7E-05 ENSMUSG00000029664 Tfpi2 3.06 1.5E-04 ENSMUSG00000031444 F10 3.05 8.0E-03 ENSMUSG00000050747 Trim15 3.05 3.2E-04 ENSMUSG00000044141 E130201H02Rik 3.04 3.7E-02 ENSMUSG00000102324 Gm19721 3.04 1.1E-02 ENSMUSG00000058743 Kcnj14 3.04 1.2E-02 ENSMUSG00000062593 Gm49339 3.02 1.1E-03 ENSMUSG00000089672 3.02 3.9E-02 ENSMUSG00000021070 Bdkrb2 3.02 3.1E-03 ENSMUSG00000090942 F830016B08Rik 3.01 4.1E-02 ENSMUSG00000042759 Apobr 3.01 6.3E-14 ENSMUSG00000110386 Gm42031 3.00 9.5E-06 ENSMUSG00000082925 Gm13135 3.00 1.8E-02 ENSMUSG00000090673 Gm340 3.00 1.7E-05 ENSMUSG00000085088 4931413K12Rik 3.00 8.5E-04 ENSMUSG00000029992 Gfpt1 2.99 1.3E-08 ENSMUSG00000038213 Tapbpl 2.99 1.3E-08 ENSMUSG00000053740 Gm6457 2.99 6.0E-06 ENSMUSG00000002111 Spi1 2.98 9.1E-14 ENSMUSG00000083670 Gm6829 2.97 4.5E-03 ENSMUSG00000102070 Gm28661 2.97 1.6E-14 ENSMUSG00000070407 Hs3st3b1 2.97 1.7E-03 ENSMUSG00000032690 Oas2 2.97 3.5E-07 ENSMUSG00000110245 Gm20100 2.97 5.7E-05 ENSMUSG00000109485 Gm45016 2.97 4.5E-02 ENSMUSG00000060647 Gm7099 2.97 6.9E-03 ENSMUSG00000100104 Gm5644 2.96 6.9E-07 ENSMUSG00000082321 Gm14253 2.96 8.4E-05 ENSMUSG00000049988 Lrrc25 2.95 5.4E-10 ENSMUSG00000022015 Tnfsf11 2.95 2.5E-02 ENSMUSG00000077148 Gm22935 2.95 1.5E-03 ENSMUSG00000046070 Igfals 2.95 4.7E-02

272

ENSMUSG00000033545 Znrf1 2.95 1.2E-05 ENSMUSG00000030157 Clec2d 2.94 1.5E-06 ENSMUSG00000077704 Snord89 2.94 2.5E-02 ENSMUSG00000022146 Osmr 2.94 6.4E-04 ENSMUSG00000030134 Rasgef1a 2.94 2.5E-05 ENSMUSG00000078956 Gm14221 2.93 4.5E-03 ENSMUSG00000055602 Tcp10b 2.93 1.8E-04 ENSMUSG00000108486 Gm44836 2.93 1.3E-02 ENSMUSG00000097566 A930024N18Rik 2.93 2.0E-06 ENSMUSG00000017057 Il13ra1 2.93 3.5E-04 ENSMUSG00000097727 F630040K05Rik 2.93 1.3E-02 ENSMUSG00000039956 Mrap 2.93 1.6E-02 ENSMUSG00000026946 Nmi 2.92 7.4E-16 ENSMUSG00000013846 St3gal1 2.92 1.6E-06 ENSMUSG00000027611 Procr 2.92 5.1E-03 ENSMUSG00000026222 Sp100 2.91 4.3E-05 ENSMUSG00000100701 Gm19587 2.91 3.3E-02 ENSMUSG00000037447 Arid5a 2.90 2.7E-02 ENSMUSG00000034917 Tjp3 2.90 1.2E-13 ENSMUSG00000026415 Fcamr 2.90 3.9E-14 ENSMUSG00000065406 Mirlet7i 2.90 2.3E-02 ENSMUSG00000028793 Rnf19b 2.89 8.8E-08 ENSMUSG00000031994 Adamts8 2.89 7.1E-04 ENSMUSG00000031760 Mt3 2.88 4.7E-02 ENSMUSG00000097536 2610037D02Rik 2.87 1.9E-05 ENSMUSG00000083287 Gm13502 2.87 1.5E-02 ENSMUSG00000049608 Gpr55 2.87 3.6E-03 ENSMUSG00000081111 Gm5913 2.87 6.6E-05 ENSMUSG00000028137 Celf3 2.87 3.2E-08 ENSMUSG00000039501 Znfx1 2.87 4.6E-12 ENSMUSG00000084067 Gm14269 2.87 2.0E-05 ENSMUSG00000026875 Traf1 2.86 7.9E-05 ENSMUSG00000001497 Pax9 2.86 4.3E-02 ENSMUSG00000040111 Gramd1b 2.86 4.3E-05 ENSMUSG00000030748 Il4ra 2.86 2.5E-02 ENSMUSG00000019832 Rab32 2.85 1.4E-07 ENSMUSG00000053641 Dennd4a 2.85 6.8E-06 ENSMUSG00000030717 Nupr1 2.85 4.7E-07 ENSMUSG00000065738 Gm24494 2.85 2.8E-03 ENSMUSG00000096991 Gm26789 2.85 9.6E-03 ENSMUSG00000026770 Il2ra 2.84 1.1E-07 ENSMUSG00000091905 Gm6395 2.83 2.7E-05 ENSMUSG00000067203 H2-K2 2.83 1.2E-05 ENSMUSG00000035352 Ccl12 2.83 7.0E-04 ENSMUSG00000053318 Slamf8 2.83 4.9E-05

273

ENSMUSG00000040570 Rundc3b 2.83 2.8E-02 ENSMUSG00000024743 Syt7 2.82 1.0E-14 ENSMUSG00000004110 Cacna1e 2.82 3.0E-02 ENSMUSG00000030107 Usp18 2.82 8.5E-07 ENSMUSG00000085246 Gm15893 2.82 2.0E-03 ENSMUSG00000107846 Gm43963 2.82 8.8E-03 ENSMUSG00000030199 Etv6 2.82 2.6E-07 ENSMUSG00000020676 Ccl11 2.81 3.4E-06 ENSMUSG00000026473 Glul 2.80 2.1E-12 ENSMUSG00000020723 Cacng4 2.80 1.0E-03 ENSMUSG00000072589 Gm10371 2.80 4.5E-02 ENSMUSG00000027907 S100a11 2.80 1.4E-10 ENSMUSG00000106558 Gm5552 2.79 3.0E-02 ENSMUSG00000022965 Ifngr2 2.79 8.8E-11 ENSMUSG00000078954 Arhgap8 2.78 1.1E-06 ENSMUSG00000032860 P2ry2 2.78 4.4E-04 ENSMUSG00000083261 Gm7816 2.78 2.8E-06 ENSMUSG00000083477 Gm5555 2.78 5.6E-04 ENSMUSG00000071713 Csf2rb 2.77 9.5E-10 ENSMUSG00000102573 Gm7265 2.77 2.2E-02 ENSMUSG00000004892 Bcan 2.77 1.1E-02 ENSMUSG00000058818 Pirb 2.77 1.2E-09 ENSMUSG00000006731 B4galnt1 2.76 8.7E-10 ENSMUSG00000087701 Gm13493 2.76 3.6E-03 ENSMUSG00000082491 Gm5909 2.76 3.2E-03 ENSMUSG00000024349 Tmem173 2.76 2.9E-03 ENSMUSG00000023087 Noct 2.76 1.1E-02 ENSMUSG00000006818 Sod2 2.76 2.4E-08 ENSMUSG00000023045 Soat2 2.75 1.9E-02 ENSMUSG00000097330 Gm26672 2.75 4.4E-02 ENSMUSG00000024479 Mal2 2.75 3.4E-05 ENSMUSG00000034329 Brip1 2.74 3.6E-04 ENSMUSG00000106988 Tsg101-ps 2.74 1.5E-05 ENSMUSG00000000631 Myo18a 2.74 1.7E-05 ENSMUSG00000021260 Hhipl1 2.73 3.6E-03 ENSMUSG00000103443 Gm37132 2.73 1.7E-02 ENSMUSG00000028950 Tas1r1 2.73 1.5E-02 ENSMUSG00000086670 Gm13194 2.71 1.3E-02 ENSMUSG00000086741 Gm15816 2.71 8.3E-04 ENSMUSG00000031024 St5 2.71 7.5E-09 ENSMUSG00000049281 Scn3b 2.71 1.8E-02 ENSMUSG00000057157 Gm6054 2.71 1.8E-03 ENSMUSG00000107225 Gm43637 2.71 2.2E-02 ENSMUSG00000035004 Igsf6 2.70 1.2E-05 ENSMUSG00000025270 Alas2 2.70 1.2E-02

274

ENSMUSG00000110458 Gm21769 2.69 1.2E-02 ENSMUSG00000042249 Grk3 2.69 2.8E-07 ENSMUSG00000082419 Gm11425 2.69 1.3E-02 ENSMUSG00000046711 Hmga1 2.69 3.8E-05 ENSMUSG00000033576 Apol6 2.69 8.9E-04 ENSMUSG00000011034 Slc5a1 2.69 1.3E-08 ENSMUSG00000097635 Gm26826 2.69 3.9E-02 ENSMUSG00000038670 Mybpc2 2.68 3.0E-02 ENSMUSG00000032174 Icam5 2.68 4.4E-05 ENSMUSG00000022148 Fyb 2.67 6.6E-07 ENSMUSG00000078813 Leng1 2.67 5.7E-15 ENSMUSG00000098207 Arl14 2.67 5.3E-04 ENSMUSG00000024539 Ptpn2 2.67 3.7E-07 ENSMUSG00000077440 Gm23130 2.67 6.9E-04 ENSMUSG00000085525 Gm13166 2.67 9.7E-03 ENSMUSG00000030966 Trim21 2.66 9.7E-09 ENSMUSG00000035960 Apex1 2.66 1.6E-06 ENSMUSG00000060594 Layn 2.66 1.8E-04 ENSMUSG00000030187 Klra2 2.66 1.2E-03 ENSMUSG00000019779 Frk 2.66 6.9E-07 ENSMUSG00000061665 Cd2ap 2.66 7.3E-13 ENSMUSG00000064925 Snora62 2.65 1.1E-02 ENSMUSG00000045672 Col27a1 2.65 2.0E-08 ENSMUSG00000020407 Upp1 2.65 5.7E-03 ENSMUSG00000084098 Gm13422 2.65 2.4E-02 ENSMUSG00000085636 Gm11769 2.65 1.1E-02 ENSMUSG00000096957 E230013L22Rik 2.65 4.0E-13 ENSMUSG00000044309 Apol7c 2.65 2.6E-02 ENSMUSG00000062588 Gm6104 2.64 9.4E-03 ENSMUSG00000039328 Rnf122 2.64 1.8E-05 ENSMUSG00000071714 Csf2rb2 2.64 3.3E-05 ENSMUSG00000060512 0610040J01Rik 2.64 3.0E-04 ENSMUSG00000035678 Tnfsf9 2.64 4.6E-05 ENSMUSG00000101191 Gm28809 2.63 1.6E-02 ENSMUSG00000028525 Pde4b 2.63 2.0E-03 ENSMUSG00000026417 Pigr 2.63 8.9E-08 ENSMUSG00000073647 Gm10557 2.63 2.7E-07 ENSMUSG00000030156 Cd69 2.62 8.5E-03 ENSMUSG00000038301 Snx10 2.62 3.2E-06 ENSMUSG00000033214 Slitrk5 2.62 1.1E-03 ENSMUSG00000041782 Lad1 2.62 9.7E-07 ENSMUSG00000089670 Gm16581 2.62 4.6E-04 ENSMUSG00000015652 Steap1 2.62 3.2E-02 ENSMUSG00000055216 9430025C20Rik 2.61 1.1E-02 ENSMUSG00000061897 Gm14292 2.61 7.8E-03

275

ENSMUSG00000020122 Egfr 2.61 1.7E-05 ENSMUSG00000053475 Tnfaip6 2.61 1.7E-02 ENSMUSG00000089820 Gm15775 2.60 2.2E-03 ENSMUSG00000015134 Aldh1a3 2.59 9.0E-03 ENSMUSG00000028392 Bspry 2.59 2.2E-06 ENSMUSG00000068246 Apol9b 2.59 2.2E-03 ENSMUSG00000035852 Misp 2.58 7.3E-05 ENSMUSG00000015947 Fcgr1 2.58 8.7E-04 ENSMUSG00000070034 Sp110 2.57 6.2E-13 ENSMUSG00000041984 Rptn 2.57 3.0E-06 ENSMUSG00000087635 Gm13414 2.57 2.8E-02 ENSMUSG00000024486 Hbegf 2.57 5.3E-03 ENSMUSG00000028794 A3galt2 2.57 3.5E-02 ENSMUSG00000039672 Kcne2 2.56 2.5E-02 ENSMUSG00000056836 Gm6851 2.56 1.3E-02 ENSMUSG00000081228 Gm16089 2.56 8.5E-07 ENSMUSG00000063628 Gm7665 2.56 1.5E-07 ENSMUSG00000071265 1700086L19Rik 2.56 3.5E-02 ENSMUSG00000053835 H2-T24 2.56 6.2E-10 ENSMUSG00000057789 Bak1 2.56 9.2E-16 ENSMUSG00000108614 2610306O10Rik 2.56 1.9E-04 ENSMUSG00000020077 Srgn 2.56 4.7E-07 ENSMUSG00000091649 Phf11b 2.55 1.1E-03 ENSMUSG00000026073 Il1r2 2.55 3.6E-05 ENSMUSG00000079164 Tlr5 2.55 4.8E-05 ENSMUSG00000015501 Hivep2 2.55 1.5E-05 ENSMUSG00000052397 Ezr 2.55 1.3E-03 ENSMUSG00000107997 Gm44243 2.54 5.9E-04 ENSMUSG00000001248 Gramd1a 2.54 6.2E-07 ENSMUSG00000029862 Clcn1 2.53 8.8E-03 ENSMUSG00000082154 Gm16464 2.53 1.3E-02 ENSMUSG00000006517 Mvd 2.53 1.9E-06 ENSMUSG00000017009 Sdc4 2.53 7.2E-06 ENSMUSG00000094910 D430019H16Rik 2.53 1.1E-03 ENSMUSG00000037095 Lrg1 2.53 2.9E-05 ENSMUSG00000023048 Prr13 2.52 7.5E-05 ENSMUSG00000081076 Rpsa-ps4 2.52 1.4E-05 ENSMUSG00000051149 Adnp 2.52 6.4E-03 ENSMUSG00000078616 Trim30c 2.52 1.4E-02 ENSMUSG00000063268 Parp10 2.52 6.5E-07 ENSMUSG00000043263 Ifi209 2.52 2.4E-04 ENSMUSG00000109244 Gm44751 2.51 6.4E-04 ENSMUSG00000050628 Ubald2 2.51 8.5E-10 ENSMUSG00000038507 Parp12 2.51 2.2E-09 ENSMUSG00000097077 Gm16712 2.51 3.9E-02

276

ENSMUSG00000061825 Ces2c 2.51 1.7E-02 ENSMUSG00000047098 Rnf31 2.51 4.3E-13 ENSMUSG00000102478 BC085271 2.51 8.0E-07 ENSMUSG00000043279 Trim56 2.50 4.5E-12 ENSMUSG00000103382 Gm37755 2.50 4.4E-03 ENSMUSG00000045659 Plekha7 2.50 1.5E-05 ENSMUSG00000058126 Tpm3-rs7 2.50 3.8E-06 ENSMUSG00000066258 Trim12a 2.50 2.8E-06 ENSMUSG00000108732 2310043P16Rik 2.50 2.6E-05 ENSMUSG00000039699 Batf2 2.50 1.8E-03 ENSMUSG00000002227 Mov10 2.50 2.8E-08 ENSMUSG00000077192 Snora17 2.50 4.4E-04 ENSMUSG00000082560 Gm15157 2.49 3.3E-03 ENSMUSG00000048188 Gm8181 2.49 4.4E-02 ENSMUSG00000035299 Mid1 2.49 4.8E-03 ENSMUSG00000041949 Tango6 2.49 1.3E-05 ENSMUSG00000102824 Pdcd5-ps 2.48 1.2E-07 ENSMUSG00000044719 E230025N22Rik 2.48 2.2E-04 ENSMUSG00000092193 Cd9-ps 2.48 3.6E-02 ENSMUSG00000073490 Ifi207 2.48 3.5E-05 ENSMUSG00000043424 Eif3j2 2.48 6.9E-06 ENSMUSG00000061684 Rpl21-ps8 2.48 4.2E-06 ENSMUSG00000092341 Malat1 2.47 2.6E-04 ENSMUSG00000107946 Gm44066 2.47 9.1E-03 ENSMUSG00000052353 Cemip 2.47 1.0E-02 ENSMUSG00000033902 Mapkbp1 2.47 3.8E-06 ENSMUSG00000057421 Las1l 2.47 2.1E-04 ENSMUSG00000030659 Nucb2 2.47 5.5E-14 ENSMUSG00000028634 Hivep3 2.47 3.0E-06 ENSMUSG00000098755 Gm27651 2.47 2.1E-02 ENSMUSG00000026077 Npas2 2.46 8.7E-07 ENSMUSG00000038039 Gcc2 2.46 3.4E-09 ENSMUSG00000082675 Gm6382 2.46 6.3E-06 ENSMUSG00000003644 Rps6ka1 2.46 3.9E-05 ENSMUSG00000069808 Fam57a 2.46 4.9E-03 ENSMUSG00000046223 Plaur 2.46 6.1E-03 ENSMUSG00000025491 Ifitm1 2.46 6.3E-07 ENSMUSG00000022885 St6gal1 2.45 6.8E-07 ENSMUSG00000072492 Gm10364 2.45 4.6E-02 ENSMUSG00000085852 Gm13807 2.45 6.9E-04 ENSMUSG00000050737 Ptges 2.45 3.5E-05 ENSMUSG00000015217 Hmgb3 2.45 9.6E-18 ENSMUSG00000021408 Ripk1 2.45 5.0E-07 ENSMUSG00000084519 Gm22478 2.45 5.6E-03 ENSMUSG00000020120 Plek 2.45 3.7E-03

277

ENSMUSG00000074264 Amy1 2.44 3.0E-02 ENSMUSG00000022780 Meltf 2.44 4.7E-03 ENSMUSG00000032712 Resf1 2.44 1.6E-09 ENSMUSG00000102550 Gm8276 2.44 1.4E-03 ENSMUSG00000020057 Dram1 2.44 2.7E-04 ENSMUSG00000086229 Gm4887 2.44 3.5E-03 ENSMUSG00000060878 Olfr1420 2.43 1.1E-02 ENSMUSG00000052560 Cpne8 2.43 2.5E-03 ENSMUSG00000038059 Smim3 2.43 1.4E-02 ENSMUSG00000032572 Col6a4 2.43 2.1E-04 ENSMUSG00000011179 Odc1 2.42 1.2E-03 ENSMUSG00000021741 Gm5457 2.42 4.9E-02 ENSMUSG00000104969 Gm43445 2.42 1.2E-04 ENSMUSG00000092517 Art2a-ps 2.42 4.5E-02 ENSMUSG00000027087 Itgav 2.42 1.1E-04 ENSMUSG00000042195 Slc35f2 2.42 1.8E-03 ENSMUSG00000097002 Gm2670 2.42 8.6E-05 ENSMUSG00000085351 Gm12472 2.41 4.2E-02 ENSMUSG00000038045 Sult6b1 2.41 2.5E-03 ENSMUSG00000050211 Pla2g4e 2.41 1.3E-02 ENSMUSG00000053158 Fes 2.41 2.8E-06 ENSMUSG00000089764 Gm16580 2.41 3.5E-13 ENSMUSG00000058624 Gda 2.40 8.9E-03 ENSMUSG00000091955 Gm9844 2.40 2.3E-04 ENSMUSG00000086786 Gm15908 2.40 4.0E-02 ENSMUSG00000098889 Gm27206 2.40 4.6E-02 ENSMUSG00000031304 Il2rg 2.40 6.3E-10 ENSMUSG00000050910 Cdr2l 2.40 3.3E-03 ENSMUSG00000067297 Ifit1bl2 2.39 1.1E-02 ENSMUSG00000058013 Sept11 2.39 1.5E-04 ENSMUSG00000042808 Gpx2 2.39 1.8E-03 ENSMUSG00000028214 Gem 2.39 3.8E-02 ENSMUSG00000109609 Gm4972 2.39 2.5E-02 ENSMUSG00000031652 N4bp1 2.39 1.4E-10 ENSMUSG00000072244 Trim6 2.39 1.3E-02 ENSMUSG00000097657 Gm7389 2.38 7.2E-03 ENSMUSG00000004446 Bid 2.38 2.1E-06 ENSMUSG00000091269 Gm6682 2.38 4.5E-02 ENSMUSG00000104280 Rps2-ps11 2.38 4.6E-02 ENSMUSG00000024270 Slc39a6 2.38 6.2E-05 ENSMUSG00000060985 Tdrd5 2.38 2.7E-02 ENSMUSG00000024339 Tap2 2.37 2.9E-08 ENSMUSG00000098082 Gm20574 2.37 6.2E-03 ENSMUSG00000093080 Mir3060 2.37 4.2E-05 ENSMUSG00000032373 Car12 2.37 8.2E-03

278

ENSMUSG00000031309 Rps6ka3 2.36 3.7E-04 ENSMUSG00000012350 Ehf 2.36 1.3E-07 ENSMUSG00000062794 Zfp599 2.36 2.4E-04 ENSMUSG00000025921 Rdh10 2.36 2.8E-02 ENSMUSG00000053783 1700016K19Rik 2.36 2.9E-02 ENSMUSG00000039676 Capsl 2.36 1.7E-03 ENSMUSG00000106777 Gm43150 2.35 4.9E-02 ENSMUSG00000091449 Gm10269 2.35 1.6E-05 ENSMUSG00000103388 Gm37581 2.35 4.1E-03 ENSMUSG00000097020 Gm26613 2.35 4.7E-02 ENSMUSG00000002325 Irf9 2.35 9.3E-07 ENSMUSG00000030681 Mvp 2.35 7.9E-06 ENSMUSG00000083161 Gm11427 2.34 1.6E-02 ENSMUSG00000037833 Sh2d4b 2.33 1.4E-02 ENSMUSG00000057137 Tmem140 2.33 1.0E-05 ENSMUSG00000022951 Rcan1 2.33 3.5E-04 ENSMUSG00000105655 Gm42659 2.33 2.3E-02 ENSMUSG00000079297 Gm2223 2.33 7.1E-06 ENSMUSG00000058922 Gm10052 2.33 2.2E-09 ENSMUSG00000025314 Ptprj 2.32 1.4E-06 ENSMUSG00000081788 Gm5898 2.32 2.7E-05 ENSMUSG00000026204 Ptprn 2.32 8.5E-04 ENSMUSG00000049303 Syt12 2.32 3.5E-02 ENSMUSG00000013974 Mcemp1 2.32 3.5E-02 ENSMUSG00000052125 F730043M19Rik 2.32 4.1E-03 ENSMUSG00000028362 Tnfsf8 2.32 2.3E-02 ENSMUSG00000090877 Hspa1b 2.32 2.3E-03 ENSMUSG00000060487 Samd5 2.31 2.0E-03 ENSMUSG00000083367 Gm8806 2.31 1.6E-05 ENSMUSG00000042388 Dlgap3 2.31 7.3E-04 ENSMUSG00000079645 Gm17193 2.31 3.4E-06 ENSMUSG00000039853 Trim14 2.31 1.3E-05 ENSMUSG00000052310 Slc39a1 2.31 2.0E-06 ENSMUSG00000026126 Ptpn18 2.31 6.4E-11 ENSMUSG00000035441 Myo1d 2.31 1.9E-08 ENSMUSG00000107035 Ybx1-ps2 2.31 3.7E-06 ENSMUSG00000035047 Kri1 2.31 1.4E-05 ENSMUSG00000029370 Rassf6 2.30 4.2E-03 ENSMUSG00000060989 Gm11847 2.30 3.0E-02 ENSMUSG00000027078 Ube2l6 2.30 1.5E-05 ENSMUSG00000027951 Adar 2.30 9.8E-07 ENSMUSG00000104342 Gm36401 2.30 3.4E-02 ENSMUSG00000041235 Chd7 2.30 1.2E-04 ENSMUSG00000097558 Gm26902 2.30 6.8E-03 ENSMUSG00000032508 Myd88 2.29 4.0E-03

279

ENSMUSG00000086688 Gm11560 2.29 4.3E-04 ENSMUSG00000034591 Slc41a2 2.29 6.0E-04 ENSMUSG00000042228 Lyn 2.29 1.5E-08 ENSMUSG00000004814 Ccl24 2.29 1.2E-04 ENSMUSG00000022272 Myo10 2.29 4.3E-06 ENSMUSG00000040363 Bcor 2.29 7.5E-09 ENSMUSG00000029381 Shroom3 2.29 6.6E-03 ENSMUSG00000075312 Gm13597 2.29 4.8E-05 ENSMUSG00000033220 Rac2 2.28 8.0E-05 ENSMUSG00000036606 Plxnb2 2.28 1.2E-07 ENSMUSG00000105359 Rpl21-ps10 2.28 2.2E-02 ENSMUSG00000042429 Adora1 2.28 8.8E-07 ENSMUSG00000097246 Gm26890 2.28 1.1E-02 ENSMUSG00000005124 Wisp1 2.28 6.8E-04 ENSMUSG00000026470 Stx6 2.28 5.3E-11 ENSMUSG00000036986 Pml 2.28 8.8E-10 ENSMUSG00000038525 Armc10 2.28 5.9E-15 ENSMUSG00000060591 Ifitm2 2.27 8.3E-10 ENSMUSG00000051351 Zfp46 2.27 3.5E-06 ENSMUSG00000024014 Pim1 2.27 1.7E-05 ENSMUSG00000028655 Mfsd2a 2.27 8.6E-03 ENSMUSG00000066245 Gm10156 2.27 3.7E-02 ENSMUSG00000033581 Igf2bp2 2.26 1.2E-05 ENSMUSG00000001504 Irx2 2.26 3.2E-06 ENSMUSG00000070031 Sp140 2.26 1.1E-07 ENSMUSG00000101166 Gm28496 2.26 4.4E-03 ENSMUSG00000061288 Taok3 2.26 2.6E-16 ENSMUSG00000066475 Gm10268 2.26 7.9E-03 ENSMUSG00000073411 H2-D1 2.25 1.1E-08 ENSMUSG00000101249 Gm29216 2.25 1.0E-10 ENSMUSG00000038011 Dnah10 2.25 1.6E-02 ENSMUSG00000110494 Gm31774 2.24 2.1E-02 ENSMUSG00000040528 Milr1 2.24 2.3E-05 ENSMUSG00000025019 Lcor 2.24 8.3E-03 ENSMUSG00000089988 Gm16238 2.24 3.0E-08 ENSMUSG00000052271 Bhlha15 2.24 7.9E-03 ENSMUSG00000090035 Galnt4 2.24 7.6E-12 ENSMUSG00000108655 Gm44949 2.24 8.5E-05 ENSMUSG00000069910 Spdl1 2.23 4.7E-04 ENSMUSG00000047911 Npm2 2.23 6.5E-03 ENSMUSG00000058006 Mdn1 2.23 2.9E-03 ENSMUSG00000028970 Abcb1b 2.23 3.1E-03 ENSMUSG00000096727 Psmb9 2.23 1.3E-02 ENSMUSG00000102559 Gm37570 2.23 2.2E-03 ENSMUSG00000090125 Pou3f1 2.23 4.2E-02

280

ENSMUSG00000079277 Hoxd3 2.22 1.9E-04 ENSMUSG00000054321 Taf4b 2.22 1.8E-02 ENSMUSG00000103272 Gm37914 2.22 4.0E-02 ENSMUSG00000058927 Gm10053 2.22 1.8E-02 ENSMUSG00000107509 Gm44941 2.22 1.5E-02 ENSMUSG00000097567 Gm26637 2.22 4.9E-04 ENSMUSG00000108024 Gm43912 2.21 3.9E-04 ENSMUSG00000022094 Slc39a14 2.21 1.6E-02 ENSMUSG00000032812 Arap1 2.21 1.1E-05 ENSMUSG00000029998 Pcyox1 2.21 2.5E-08 ENSMUSG00000018334 Ksr1 2.21 4.0E-05 ENSMUSG00000054520 Sh3bp2 2.20 1.0E-04 ENSMUSG00000084145 Gm12263 2.20 5.1E-05 ENSMUSG00000102305 Gm38192 2.20 1.9E-03 ENSMUSG00000106416 Gm5857 2.20 8.0E-03 ENSMUSG00000018986 Slfn3 2.20 4.0E-03 ENSMUSG00000087594 2.20 2.1E-04 ENSMUSG00000042622 Maff 2.20 6.2E-04 ENSMUSG00000104350 Gm38244 2.20 1.2E-05 ENSMUSG00000006169 Clint1 2.20 3.0E-05 ENSMUSG00000024338 Psmb8 2.20 5.9E-04 ENSMUSG00000063286 Gm8995 2.20 5.5E-04 ENSMUSG00000028028 Alpk1 2.20 1.8E-07 ENSMUSG00000030137 Tuba8 2.20 1.7E-02 ENSMUSG00000027215 Cd82 2.20 2.3E-07 ENSMUSG00000050014 Apol10b 2.19 1.3E-02 ENSMUSG00000037860 Aim2 2.19 2.1E-05 ENSMUSG00000065236 n-R5s197 2.19 2.6E-02 ENSMUSG00000026880 Stom 2.19 3.9E-05 ENSMUSG00000035021 Baz1a 2.19 2.5E-03 ENSMUSG00000104443 4932442E05Rik 2.19 9.4E-03 ENSMUSG00000025192 Entpd7 2.19 5.1E-03 ENSMUSG00000026525 Opn3 2.19 9.7E-03 ENSMUSG00000065265 Gm23455 2.18 1.8E-03 ENSMUSG00000052248 Zeb2os 2.18 1.4E-03 ENSMUSG00000010601 Apol7a 2.18 8.9E-04 ENSMUSG00000020275 Rel 2.18 1.2E-03 ENSMUSG00000081752 Sms-ps 2.18 2.7E-03 ENSMUSG00000019122 Ccl9 2.18 2.7E-02 ENSMUSG00000046959 Slc26a1 2.18 9.3E-03 ENSMUSG00000029075 Tnfrsf4 2.18 2.4E-05 ENSMUSG00000022111 Uchl3 2.17 1.0E-02 ENSMUSG00000091549 Gm6548 2.17 6.1E-06 ENSMUSG00000038057 Dbil5 2.17 2.8E-02 ENSMUSG00000074342 I830077J02Rik 2.17 8.7E-03

281

ENSMUSG00000029826 Zc3hav1 2.16 4.2E-11 ENSMUSG00000054582 Pabpc1l 2.16 2.9E-03 ENSMUSG00000034127 Tspan8 2.16 8.8E-04 ENSMUSG00000021453 Gadd45g 2.16 3.7E-03 ENSMUSG00000041992 Rapgef5 2.16 6.1E-03 ENSMUSG00000090062 Galnt6os 2.16 4.1E-02 ENSMUSG00000103076 Gm37902 2.16 2.7E-02 ENSMUSG00000009585 Apobec3 2.16 5.1E-06 ENSMUSG00000081669 Npm3-ps1 2.15 2.4E-03 ENSMUSG00000079559 Colca2 2.15 6.3E-03 ENSMUSG00000001056 Nhp2 2.15 1.7E-03 ENSMUSG00000043340 6530409C15Rik 2.15 4.2E-02 ENSMUSG00000030609 Aen 2.15 4.7E-04 ENSMUSG00000097576 D930030I03Rik 2.15 1.9E-02 ENSMUSG00000052912 Smarca5-ps 2.15 2.6E-02 ENSMUSG00000034987 Hrh2 2.15 2.1E-02 ENSMUSG00000025911 Adhfe1 2.15 3.2E-02 ENSMUSG00000030729 Pgm2l1 2.15 6.6E-07 ENSMUSG00000000303 Cdh1 2.15 9.0E-04 ENSMUSG00000040711 Sh3pxd2b 2.15 6.1E-03 ENSMUSG00000036718 Micall2 2.14 4.5E-07 ENSMUSG00000032724 Abtb2 2.14 1.9E-06 ENSMUSG00000024789 Jak2 2.14 3.8E-05 ENSMUSG00000029471 Camkk2 2.14 2.3E-04 ENSMUSG00000043439 Epop 2.14 2.8E-02 ENSMUSG00000019979 Apaf1 2.14 9.0E-05 ENSMUSG00000040659 Efhd2 2.14 2.7E-06 ENSMUSG00000028459 Cd72 2.13 3.9E-04 ENSMUSG00000067547 Gm7666 2.13 3.0E-04 ENSMUSG00000053166 Cdh22 2.13 1.0E-05 ENSMUSG00000040829 Zmynd15 2.13 6.8E-04 ENSMUSG00000097610 A930012L18Rik 2.13 3.5E-02 ENSMUSG00000028671 Gale 2.13 2.7E-02 ENSMUSG00000074151 Nlrc5 2.12 3.3E-04 ENSMUSG00000026070 Il18r1 2.12 7.4E-05 ENSMUSG00000025612 Bach1 2.12 1.7E-04 ENSMUSG00000001227 Sema6b 2.12 4.2E-03 ENSMUSG00000032358 Fam83b 2.12 4.6E-04 ENSMUSG00000094245 Gm23966 2.12 4.1E-02 ENSMUSG00000050854 Tmem125 2.12 6.6E-03 ENSMUSG00000083396 Gm15542 2.12 9.4E-04 ENSMUSG00000033987 Dnah17 2.12 4.4E-03 ENSMUSG00000030342 Cd9 2.12 1.5E-09 ENSMUSG00000019320 Noxo1 2.11 3.6E-04 ENSMUSG00000026303 Mlph 2.11 8.7E-07

282

ENSMUSG00000070284 Gmppb 2.11 2.3E-03 ENSMUSG00000048216 Gpr85 2.11 2.9E-03 ENSMUSG00000024597 Slc12a2 2.11 1.9E-03 ENSMUSG00000038151 Prdm1 2.11 2.5E-02 ENSMUSG00000027469 Tpx2 2.11 7.1E-04 ENSMUSG00000002797 Ggct 2.11 3.9E-04 ENSMUSG00000059742 Kcnh7 2.11 5.5E-03 ENSMUSG00000109390 Gm45718 2.11 2.4E-02 ENSMUSG00000041161 Otud3 2.11 3.1E-05 ENSMUSG00000078945 Naip2 2.10 7.9E-08 ENSMUSG00000026479 Lamc2 2.10 7.6E-03 ENSMUSG00000025889 Snca 2.10 2.1E-02 ENSMUSG00000040723 Rcsd1 2.10 6.5E-03 ENSMUSG00000068141 Gm10232 2.10 5.6E-04 ENSMUSG00000000275 Trim25 2.10 2.8E-06 ENSMUSG00000025644 Gm7628 2.10 2.9E-03 ENSMUSG00000107749 Gm44321 2.10 2.0E-02 ENSMUSG00000110605 Gm32856 2.10 2.7E-05 ENSMUSG00000028381 Ugcg 2.09 1.2E-02 ENSMUSG00000023991 Foxp4 2.09 6.2E-10 ENSMUSG00000048003 Catsper4 2.09 8.8E-03 ENSMUSG00000085894 Gm15832 2.09 1.9E-02 ENSMUSG00000087006 Gm13889 2.09 1.4E-02 ENSMUSG00000028862 Map3k6 2.08 1.4E-02 ENSMUSG00000026797 Stxbp1 2.08 2.3E-09 ENSMUSG00000097335 Gm26563 2.08 4.5E-02 ENSMUSG00000070443 Gm10291 2.08 1.3E-03 ENSMUSG00000025509 Pnpla2 2.08 5.5E-03 ENSMUSG00000021958 Pinx1 2.08 5.8E-04 ENSMUSG00000020961 Ston2 2.07 6.6E-05 ENSMUSG00000004885 Crabp2 2.07 2.2E-02 ENSMUSG00000080115 Eef1akmt3 2.07 6.0E-04 ENSMUSG00000025591 Tma16 2.07 5.4E-04 ENSMUSG00000039236 Isg20 2.07 9.7E-07 ENSMUSG00000095180 Rhox5 2.07 5.6E-04 ENSMUSG00000055415 Atp10b 2.07 4.8E-04 ENSMUSG00000004709 Cd244a 2.07 5.6E-03 ENSMUSG00000049401 Ogfr 2.07 1.4E-07 ENSMUSG00000032596 Uba7 2.06 2.2E-04 ENSMUSG00000018417 Myo1b 2.06 1.6E-07 ENSMUSG00000096544 Gm4617 2.06 4.6E-10 ENSMUSG00000030691 Fchsd2 2.06 4.9E-08 ENSMUSG00000005774 Rfx5 2.06 8.5E-09 ENSMUSG00000085501 Gm11772 2.06 2.1E-02 ENSMUSG00000071757 Zhx2 2.06 1.9E-08

283

ENSMUSG00000030560 Ctsc 2.06 8.6E-05 ENSMUSG00000026234 Ncl 2.06 2.1E-05 ENSMUSG00000061436 Hipk2 2.06 7.2E-03 ENSMUSG00000056144 Trim34a 2.05 1.9E-04 ENSMUSG00000103756 Gm37285 2.05 4.3E-02 ENSMUSG00000107877 Gm43951 2.05 4.3E-02 ENSMUSG00000039994 Timeless 2.05 3.3E-04 ENSMUSG00000026104 Stat1 2.05 4.1E-04 ENSMUSG00000026074 Map4k4 2.05 2.8E-07 ENSMUSG00000021451 Sema4d 2.05 2.6E-05 ENSMUSG00000029014 Dnajc2 2.05 3.9E-06 ENSMUSG00000024732 Ccdc86 2.05 6.1E-03 ENSMUSG00000042607 Asb4 2.05 1.4E-02 ENSMUSG00000026435 Slc45a3 2.05 9.8E-03 ENSMUSG00000048234 Rnf149 2.04 1.1E-04 ENSMUSG00000032501 Trib1 2.04 4.7E-02 ENSMUSG00000076867 Trdv4 2.04 1.6E-02 ENSMUSG00000034919 Ttc22 2.04 3.0E-03 ENSMUSG00000006930 Hap1 2.04 4.7E-04 ENSMUSG00000086453 Gm11457 2.04 2.0E-02 ENSMUSG00000044786 Zfp36 2.04 1.5E-02 ENSMUSG00000067367 Lyar 2.04 2.5E-07 ENSMUSG00000005148 Klf5 2.03 1.4E-05 ENSMUSG00000019817 Plagl1 2.03 8.3E-06 ENSMUSG00000002603 Tgfb1 2.03 1.0E-04 ENSMUSG00000037536 Fbxo34 2.03 1.6E-05 ENSMUSG00000030790 Adm 2.03 4.2E-05 ENSMUSG00000052727 Map1b 2.03 7.0E-04 ENSMUSG00000016024 Lbp 2.03 1.1E-04 ENSMUSG00000043126 D830039M14Rik 2.03 1.1E-02 ENSMUSG00000103984 Gm37447 2.03 1.9E-02 ENSMUSG00000108465 Gm45110 2.02 3.1E-03 ENSMUSG00000103469 Gm9910 2.02 7.0E-03 ENSMUSG00000028583 Pdpn 2.02 2.4E-02 ENSMUSG00000002897 Il17ra 2.02 1.6E-02 ENSMUSG00000001305 Rrp15 2.02 2.3E-03 ENSMUSG00000096252 2.02 2.1E-02 ENSMUSG00000020627 Klhl29 2.02 4.0E-02 ENSMUSG00000038037 Socs1 2.02 8.5E-05 ENSMUSG00000038976 Ppp1r9b 2.02 1.7E-07 ENSMUSG00000064368 mt-Nd6 2.02 6.5E-05 ENSMUSG00000108801 Gm39090 2.02 3.8E-02 ENSMUSG00000025058 5430427O19Rik 2.01 9.0E-03 ENSMUSG00000020527 Myo19 2.01 6.2E-05 ENSMUSG00000002699 Lcp2 2.01 4.9E-04

284

ENSMUSG00000009621 Vav2 2.01 8.7E-08 ENSMUSG00000055629 B4galnt4 2.01 4.8E-02 ENSMUSG00000100131 Gm28439 2.01 2.7E-07 ENSMUSG00000032113 Chek1 2.01 3.6E-03 ENSMUSG00000064354 mt-Co2 2.01 4.3E-06 ENSMUSG00000107962 Gm43980 2.01 1.5E-02 ENSMUSG00000079575 Rbpj-ps3 2.00 4.2E-02 ENSMUSG00000030847 Bag3 2.00 1.2E-06 ENSMUSG00000081406 Rps6-ps4 2.00 2.9E-08 ENSMUSG00000021280 Exoc3l4 2.00 4.8E-03 ENSMUSG00000008200 Fnbp4 2.00 2.6E-08 ENSMUSG00000024991 Eif3a 2.00 4.9E-06 ENSMUSG00000030055 Rab43 2.00 1.1E-03 ENSMUSG00000021556 Golm1 2.00 1.7E-05 ENSMUSG00000048200 Cracr2b -2.00 3.1E-03 ENSMUSG00000025701 Alox5 -2.00 1.5E-02 ENSMUSG00000002058 Unc119 -2.00 9.4E-03 ENSMUSG00000029650 Slc46a3 -2.00 6.6E-05 ENSMUSG00000037466 Tedc1 -2.00 1.1E-02 ENSMUSG00000059336 Slc14a1 -2.01 1.1E-03 ENSMUSG00000051212 Gpr183 -2.01 2.9E-05 ENSMUSG00000085151 1110018N20Rik -2.01 2.1E-02 ENSMUSG00000019214 Chtf18 -2.01 5.3E-04 ENSMUSG00000046330 Rpl37a -2.01 9.3E-07 ENSMUSG00000028167 Bdh2 -2.01 1.1E-02 ENSMUSG00000074211 Sdhaf1 -2.01 8.7E-04 ENSMUSG00000038984 Tspyl5 -2.01 1.3E-02 ENSMUSG00000105881 4932422M17Rik -2.01 1.4E-03 ENSMUSG00000076437 Selenoh -2.02 4.2E-04 ENSMUSG00000000901 Mmp11 -2.02 2.9E-03 ENSMUSG00000072980 Oip5 -2.02 3.1E-02 ENSMUSG00000085457 1110046J04Rik -2.02 1.0E-02 ENSMUSG00000079604 Gm13219 -2.02 1.1E-04 ENSMUSG00000019124 Scrn1 -2.02 4.3E-02 ENSMUSG00000044976 Wdr72 -2.03 1.7E-05 ENSMUSG00000021509 Slc25a48 -2.03 2.0E-03 ENSMUSG00000051169 Rpusd3 -2.03 2.2E-03 ENSMUSG00000038623 Tm6sf1 -2.03 8.2E-03 ENSMUSG00000025289 Prdx4 -2.03 8.5E-09 ENSMUSG00000007805 Twist2 -2.03 3.9E-02 ENSMUSG00000042514 Klhl14 -2.03 2.9E-04 ENSMUSG00000051007 Gatd1 -2.03 9.3E-06 ENSMUSG00000038086 Hspb2 -2.03 5.2E-03 ENSMUSG00000042942 Greb1l -2.03 2.4E-02 ENSMUSG00000109587 Gm31105 -2.04 3.6E-02

285

ENSMUSG00000047022 Mipol1 -2.04 6.6E-03 ENSMUSG00000017491 Rarb -2.04 6.4E-05 ENSMUSG00000020895 Tmem107 -2.04 1.1E-02 ENSMUSG00000033585 Ndn -2.04 8.9E-05 ENSMUSG00000025933 Tmem14a -2.04 2.3E-05 ENSMUSG00000032952 Ap4b1 -2.04 1.2E-03 ENSMUSG00000061451 Tmem151a -2.04 3.3E-04 ENSMUSG00000024459 H2-M5 -2.04 2.6E-02 ENSMUSG00000023020 Cox14 -2.04 9.4E-06 ENSMUSG00000004360 9330159F19Rik -2.05 3.3E-02 ENSMUSG00000042115 Klhdc8a -2.05 8.3E-04 ENSMUSG00000037953 A4gnt -2.05 1.8E-02 ENSMUSG00000054252 Fgfr3 -2.05 9.8E-05 ENSMUSG00000090553 Snrpe -2.05 3.8E-04 ENSMUSG00000018126 Baiap2l2 -2.05 2.2E-03 ENSMUSG00000027463 Slc52a3 -2.05 1.1E-06 ENSMUSG00000053161 Daw1 -2.05 2.2E-02 ENSMUSG00000050503 Fbxl22 -2.05 5.6E-03 ENSMUSG00000072066 6720489N17Rik -2.06 1.8E-02 ENSMUSG00000020653 Klf11 -2.06 2.5E-02 ENSMUSG00000004988 Fxyd4 -2.06 1.5E-03 ENSMUSG00000039109 F13a1 -2.06 1.3E-02 ENSMUSG00000028909 Ptpru -2.06 4.0E-04 ENSMUSG00000045414 1190002N15Rik -2.06 2.7E-05 ENSMUSG00000020098 Pcbd1 -2.06 8.0E-05 ENSMUSG00000086839 Gm11973 -2.06 4.9E-02 ENSMUSG00000022899 Slc15a2 -2.06 8.8E-03 ENSMUSG00000082163 Gm14276 -2.07 3.1E-02 ENSMUSG00000031659 Adcy7 -2.07 2.6E-02 ENSMUSG00000007039 Ddah2 -2.07 5.6E-03 ENSMUSG00000079455 Gm16026 -2.07 2.1E-02 ENSMUSG00000030256 Bhlhe41 -2.07 1.6E-02 ENSMUSG00000097215 Gm26550 -2.07 3.8E-02 ENSMUSG00000049124 Gm8186 -2.07 3.3E-06 ENSMUSG00000033882 Rbm46 -2.07 2.9E-02 ENSMUSG00000038486 Sv2a -2.08 1.9E-02 ENSMUSG00000073293 Nudt10 -2.08 9.0E-03 ENSMUSG00000109118 Gm32031 -2.08 3.3E-03 ENSMUSG00000072437 Nanos1 -2.09 1.7E-02 ENSMUSG00000085576 Dpy19l2 -2.09 3.8E-03 ENSMUSG00000051890 Klhdc1 -2.09 1.2E-03 ENSMUSG00000042246 Tmc7 -2.09 1.2E-05 ENSMUSG00000105896 Gm43311 -2.09 2.2E-03 ENSMUSG00000097178 2310002F09Rik -2.09 4.4E-04 ENSMUSG00000051379 Flrt3 -2.10 2.4E-03

286

ENSMUSG00000082127 Gm13577 -2.10 3.0E-02 ENSMUSG00000072966 Gprasp2 -2.10 3.8E-02 ENSMUSG00000025893 Kbtbd3 -2.10 1.6E-05 ENSMUSG00000040703 Cyp2s1 -2.11 3.0E-02 ENSMUSG00000097791 Gm17315 -2.11 2.7E-02 ENSMUSG00000041729 Coro2b -2.11 3.5E-03 ENSMUSG00000026080 Chst10 -2.11 7.5E-05 ENSMUSG00000041658 Rragb -2.11 1.6E-07 ENSMUSG00000044716 Dok7 -2.11 1.6E-02 ENSMUSG00000050621 Rps27rt -2.11 2.2E-03 ENSMUSG00000002324 Rec8 -2.11 2.9E-02 ENSMUSG00000050592 Fam78a -2.12 2.7E-03 ENSMUSG00000026938 Fcna -2.12 1.1E-02 ENSMUSG00000035041 Creb3l3 -2.12 2.5E-02 ENSMUSG00000030499 Kctd15 -2.12 1.1E-06 ENSMUSG00000029720 Gm20605 -2.12 2.5E-02 ENSMUSG00000015852 Fcrls -2.12 1.5E-03 ENSMUSG00000085971 Gm15411 -2.13 1.3E-03 ENSMUSG00000004610 Etfb -2.13 6.2E-04 ENSMUSG00000040270 Bach2 -2.13 3.9E-03 ENSMUSG00000037710 Cisd1 -2.13 1.9E-07 ENSMUSG00000022199 Slc22a17 -2.14 1.8E-08 ENSMUSG00000093483 AA465934 -2.14 7.2E-03 ENSMUSG00000041423 Paqr6 -2.14 3.4E-03 ENSMUSG00000026095 Asnsd1 -2.14 2.6E-04 ENSMUSG00000105006 Gm9484 -2.15 3.4E-02 ENSMUSG00000044522 A730020M07Rik -2.15 4.5E-03 ENSMUSG00000095193 Gm20939 -2.15 2.5E-03 ENSMUSG00000001020 S100a4 -2.15 3.0E-02 ENSMUSG00000053522 Lgals7 -2.15 2.0E-02 ENSMUSG00000020897 Aurkb -2.15 2.7E-02 ENSMUSG00000049907 Rasl11b -2.15 3.0E-07 ENSMUSG00000026411 Tmem9 -2.16 2.9E-04 ENSMUSG00000050708 Ftl1 -2.16 8.9E-05 ENSMUSG00000038570 Saxo2 -2.16 5.0E-04 ENSMUSG00000021928 Ebpl -2.16 2.0E-06 ENSMUSG00000044991 Shld1 -2.16 3.2E-03 ENSMUSG00000063568 Jazf1 -2.16 8.4E-06 ENSMUSG00000024084 Qpct -2.16 2.4E-05 ENSMUSG00000022132 Cldn10 -2.17 6.6E-05 ENSMUSG00000040963 Asgr2 -2.17 6.8E-03 ENSMUSG00000046159 Chrm3 -2.17 1.0E-02 ENSMUSG00000097378 B230208H11Rik -2.18 2.6E-02 ENSMUSG00000100213 Gm28151 -2.18 3.7E-04 ENSMUSG00000028591 Pramef12 -2.18 2.9E-02

287

ENSMUSG00000101162 Gm26728 -2.18 9.0E-03 ENSMUSG00000020672 Sntg2 -2.18 1.2E-03 ENSMUSG00000063765 Chadl -2.19 5.5E-05 ENSMUSG00000021573 Tppp -2.19 1.9E-02 ENSMUSG00000089736 Tgfbr3l -2.19 6.4E-08 ENSMUSG00000022123 Scel -2.19 8.3E-03 ENSMUSG00000085218 BB218582 -2.19 2.2E-02 ENSMUSG00000031595 Pdgfrl -2.19 1.9E-02 ENSMUSG00000024232 Bambi -2.19 5.6E-23 ENSMUSG00000079465 Col4a3 -2.20 2.5E-02 ENSMUSG00000000884 Gnb1l -2.20 4.0E-07 ENSMUSG00000041351 Rap1gap -2.20 3.9E-05 ENSMUSG00000079593 Gm14597 -2.20 1.9E-04 ENSMUSG00000020793 Galr2 -2.20 1.8E-02 ENSMUSG00000029260 Ugt2b34 -2.21 1.5E-03 ENSMUSG00000036111 Lmo1 -2.21 6.2E-04 ENSMUSG00000044156 Hepacam2 -2.21 2.9E-02 ENSMUSG00000030787 Lyve1 -2.21 3.8E-04 ENSMUSG00000000126 Wnt9a -2.22 7.1E-03 ENSMUSG00000038020 Rapgefl1 -2.22 3.8E-03 ENSMUSG00000038286 Bphl -2.22 2.5E-06 ENSMUSG00000047880 Cxcr5 -2.22 5.2E-05 ENSMUSG00000003429 Rps11 -2.22 3.3E-06 ENSMUSG00000024593 Megf10 -2.22 2.1E-02 ENSMUSG00000031965 Tbx20 -2.23 4.5E-02 ENSMUSG00000027827 Kcnab1 -2.23 9.4E-03 ENSMUSG00000086607 4930511M06Rik -2.23 2.8E-02 ENSMUSG00000030089 Slc41a3 -2.23 7.3E-04 ENSMUSG00000085091 Egfros -2.23 3.0E-05 ENSMUSG00000035202 Lars2 -2.24 3.9E-02 ENSMUSG00000041120 Nbl1 -2.24 8.3E-06 ENSMUSG00000085639 Gm15410 -2.24 4.4E-02 ENSMUSG00000009394 Syn2 -2.24 2.2E-02 ENSMUSG00000023031 Cela1 -2.24 3.9E-06 ENSMUSG00000050288 Fzd2 -2.24 1.8E-02 ENSMUSG00000028195 Cyr61 -2.25 2.1E-02 ENSMUSG00000071291 Zfp58 -2.25 3.3E-10 ENSMUSG00000052160 Pld4 -2.25 4.4E-03 ENSMUSG00000038793 Lefty1 -2.25 6.5E-04 ENSMUSG00000104420 E230020A03Rik -2.25 2.4E-06 ENSMUSG00000063611 Gm10134 -2.26 7.4E-03 ENSMUSG00000074736 Syndig1 -2.26 3.4E-03 ENSMUSG00000032565 Nudt16 -2.26 5.3E-05 ENSMUSG00000029830 Svopl -2.26 1.8E-02 ENSMUSG00000021290 Atp5mpl -2.26 1.6E-06

288

ENSMUSG00000055827 Gsdmc3 -2.26 4.4E-04 ENSMUSG00000032346 Ooep -2.27 1.1E-03 ENSMUSG00000062691 Cebpzos -2.27 4.4E-05 ENSMUSG00000021390 Ogn -2.27 2.1E-03 ENSMUSG00000037887 Dusp8 -2.27 1.9E-02 ENSMUSG00000028457 Atp8b5 -2.27 1.5E-02 ENSMUSG00000007777 0610009B22Rik -2.28 1.9E-06 ENSMUSG00000069920 B3gnt9 -2.28 1.6E-03 ENSMUSG00000038007 Acer2 -2.28 5.1E-06 ENSMUSG00000015355 Cd48 -2.28 2.4E-03 ENSMUSG00000042992 Borcs5 -2.28 1.7E-08 ENSMUSG00000048482 Bdnf -2.29 2.6E-02 ENSMUSG00000036585 Fgf1 -2.29 4.2E-03 ENSMUSG00000068614 Actc1 -2.29 2.8E-02 ENSMUSG00000096474 Gm5561 -2.29 3.5E-03 ENSMUSG00000108660 Gm21284 -2.29 2.8E-02 ENSMUSG00000026311 Asb1 -2.30 1.2E-12 ENSMUSG00000050830 Vwc2 -2.30 3.8E-03 ENSMUSG00000036731 Cysrt1 -2.31 2.6E-02 ENSMUSG00000031284 Pak3 -2.31 4.6E-05 ENSMUSG00000034164 Emid1 -2.31 4.5E-06 ENSMUSG00000087220 Gm11377 -2.32 3.2E-02 ENSMUSG00000027460 Angpt4 -2.32 1.4E-02 ENSMUSG00000047965 Rpl9-ps7 -2.32 2.4E-02 ENSMUSG00000045877 4933415A04Rik -2.33 2.0E-03 ENSMUSG00000020460 Rps27a -2.33 1.6E-06 ENSMUSG00000055725 Paqr3 -2.33 1.4E-04 ENSMUSG00000027661 Slc2a10 -2.34 7.9E-06 ENSMUSG00000105366 Gm43719 -2.34 1.2E-03 ENSMUSG00000039883 Lrrc17 -2.34 6.5E-03 ENSMUSG00000086428 Gm15199 -2.34 1.8E-04 ENSMUSG00000022860 Chodl -2.34 2.1E-02 ENSMUSG00000026167 Wnt10a -2.34 2.1E-03 ENSMUSG00000039405 Prss23 -2.34 1.7E-07 ENSMUSG00000048337 Npy4r -2.34 4.4E-04 ENSMUSG00000078444 Gm10941 -2.35 4.3E-03 ENSMUSG00000058831 Opn1sw -2.35 8.3E-03 ENSMUSG00000058267 Mrps14 -2.35 4.1E-08 ENSMUSG00000043668 Tox3 -2.36 2.8E-02 ENSMUSG00000042073 Abhd14b -2.36 5.0E-07 ENSMUSG00000029925 Tbxas1 -2.36 6.1E-03 ENSMUSG00000048307 Ankrd46 -2.36 3.5E-13 ENSMUSG00000059325 Hopx -2.36 2.5E-05 ENSMUSG00000022090 Pdlim2 -2.36 1.7E-02 ENSMUSG00000036766 Dner -2.36 2.8E-02

289

ENSMUSG00000048706 Lurap1l -2.37 1.1E-04 ENSMUSG00000070576 Mn1 -2.37 1.1E-03 ENSMUSG00000091475 2810468N07Rik -2.37 3.8E-02 ENSMUSG00000067158 Col4a4 -2.37 2.8E-03 ENSMUSG00000108461 AV356131 -2.37 2.2E-02 ENSMUSG00000010803 Gabra1 -2.38 4.1E-02 ENSMUSG00000107758 Gm19253 -2.38 1.3E-03 ENSMUSG00000048022 Tmem229a -2.39 2.5E-04 ENSMUSG00000024043 Arhgap28 -2.39 1.9E-02 ENSMUSG00000061013 Mkx -2.39 2.7E-02 ENSMUSG00000110298 Gm8189 -2.39 2.1E-02 ENSMUSG00000027186 Elf5 -2.39 1.5E-04 ENSMUSG00000107251 Gm43102 -2.39 4.4E-02 ENSMUSG00000056418 BC043934 -2.40 2.5E-02 ENSMUSG00000100733 4932411K12Rik -2.40 5.7E-03 ENSMUSG00000091803 Cox16 -2.40 6.6E-04 ENSMUSG00000017195 Zpbp2 -2.41 6.3E-03 ENSMUSG00000110156 Gm42067 -2.41 3.6E-02 ENSMUSG00000072762 4930522L14Rik -2.41 3.1E-06 ENSMUSG00000039873 Neurl2 -2.41 4.9E-03 ENSMUSG00000074651 Mcidas -2.41 3.7E-02 ENSMUSG00000097858 9530052C20Rik -2.41 2.9E-02 ENSMUSG00000088793 Gm22540 -2.42 2.2E-02 ENSMUSG00000097697 4833412C05Rik -2.42 1.2E-03 ENSMUSG00000085162 Gm12295 -2.42 7.1E-03 ENSMUSG00000001665 Gstt3 -2.42 3.7E-06 ENSMUSG00000079049 Serpinb1c -2.43 2.7E-02 ENSMUSG00000090110 Cmc4 -2.43 3.6E-07 ENSMUSG00000085175 Gm11423 -2.43 3.7E-06 ENSMUSG00000090925 1810064F22Rik -2.43 4.1E-04 ENSMUSG00000056043 Rgs9bp -2.43 4.8E-04 ENSMUSG00000038980 Rbbp8nl -2.43 2.9E-02 ENSMUSG00000097604 Gm17322 -2.44 3.3E-02 ENSMUSG00000060548 Tnfrsf19 -2.44 1.0E-03 ENSMUSG00000085171 D830026I12Rik -2.45 1.3E-02 ENSMUSG00000027220 Syt13 -2.45 9.7E-03 ENSMUSG00000097162 2310010J17Rik -2.45 9.1E-06 ENSMUSG00000038022 Mindy4 -2.45 4.1E-04 ENSMUSG00000085881 Gm15912 -2.45 2.8E-05 ENSMUSG00000020017 Hal -2.46 1.9E-02 ENSMUSG00000104614 Fbxw27 -2.46 6.5E-05 ENSMUSG00000051726 Kcnf1 -2.46 2.5E-02 ENSMUSG00000056293 Gsdmc2 -2.46 2.4E-04 ENSMUSG00000071324 Armc2 -2.47 1.6E-02 ENSMUSG00000045435 Tmem60 -2.47 1.5E-08

290

ENSMUSG00000020990 Cdkl1 -2.47 1.4E-02 ENSMUSG00000099632 2900093K20Rik -2.47 3.0E-03 ENSMUSG00000086390 1810019D21Rik -2.47 2.2E-05 ENSMUSG00000042976 9930038B18Rik -2.47 4.0E-02 ENSMUSG00000021665 Hexb -2.48 3.0E-07 ENSMUSG00000082044 Snrpert -2.49 1.6E-05 ENSMUSG00000030147 Clec4b1 -2.49 4.5E-02 ENSMUSG00000043811 Rtn4r -2.49 1.6E-02 ENSMUSG00000025905 Oprk1 -2.49 3.6E-02 ENSMUSG00000048520 Fbxl13 -2.50 1.8E-03 ENSMUSG00000020798 Spns3 -2.50 2.7E-02 ENSMUSG00000036192 Rorb -2.50 2.2E-02 ENSMUSG00000053040 Aph1c -2.50 3.0E-02 ENSMUSG00000070366 Plpp4 -2.50 1.5E-04 ENSMUSG00000028488 Sh3gl2 -2.50 3.8E-05 ENSMUSG00000039611 Tmem246 -2.51 5.7E-12 ENSMUSG00000045667 Smtnl2 -2.51 1.6E-02 ENSMUSG00000036502 Tmem255a -2.51 1.4E-02 ENSMUSG00000092741 Mir3074-1 -2.51 6.5E-03 ENSMUSG00000050777 Tmem37 -2.51 2.5E-04 ENSMUSG00000032766 Gng11 -2.51 2.8E-07 ENSMUSG00000095677 Dynlt1f -2.52 5.7E-07 ENSMUSG00000048489 Depp1 -2.52 7.4E-03 ENSMUSG00000089818 Gm15950 -2.52 2.3E-02 ENSMUSG00000088752 Mir1934 -2.52 2.4E-02 ENSMUSG00000107300 Gm43279 -2.52 1.3E-02 ENSMUSG00000079103 Tgm7 -2.53 2.5E-02 ENSMUSG00000097867 Lppos -2.53 2.1E-04 ENSMUSG00000032122 Slc37a2 -2.53 3.3E-07 ENSMUSG00000078202 Nrarp -2.53 1.2E-07 ENSMUSG00000036523 Greb1 -2.54 4.6E-02 ENSMUSG00000035455 Fignl1 -2.54 3.8E-03 ENSMUSG00000061126 Cyp4f39 -2.54 4.5E-05 ENSMUSG00000086429 Gt(ROSA)26Sor -2.55 1.9E-07 ENSMUSG00000023992 Trem2 -2.55 4.2E-04 ENSMUSG00000043644 0610009L18Rik -2.56 8.4E-06 ENSMUSG00000075033 Nxpe3 -2.56 1.5E-08 ENSMUSG00000071042 Rasgrp3 -2.56 2.4E-03 ENSMUSG00000034387 Ssu2 -2.56 2.7E-02 ENSMUSG00000109810 Gm45592 -2.56 3.1E-02 ENSMUSG00000024608 Rps14 -2.57 1.0E-05 ENSMUSG00000050520 Cldn8 -2.57 1.4E-03 ENSMUSG00000074867 Zfp808 -2.57 5.4E-05 ENSMUSG00000079450 Cldn34c1 -2.57 8.4E-04 ENSMUSG00000062545 Tlr12 -2.57 3.9E-02

291

ENSMUSG00000040471 Ggt6 -2.57 2.2E-05 ENSMUSG00000096145 Vkorc1 -2.58 9.6E-05 ENSMUSG00000025170 Rab40b -2.58 1.6E-05 ENSMUSG00000035189 Ano4 -2.58 1.4E-02 ENSMUSG00000092335 Zfp977 -2.58 7.6E-03 ENSMUSG00000021944 Gata4 -2.58 4.0E-02 ENSMUSG00000056174 Col8a2 -2.59 7.1E-03 ENSMUSG00000081058 Hist2h3c2 -2.59 8.9E-03 ENSMUSG00000003469 Phyhip -2.59 2.9E-02 ENSMUSG00000097184 4632428C04Rik -2.59 7.3E-05 ENSMUSG00000074603 Gm10729 -2.60 4.4E-02 ENSMUSG00000067276 Capn6 -2.61 3.4E-03 ENSMUSG00000037259 Dzank1 -2.62 1.1E-03 ENSMUSG00000023966 Rsph9 -2.62 3.0E-05 ENSMUSG00000035403 Crb2 -2.62 1.7E-03 ENSMUSG00000071532 Gm10335 -2.63 2.4E-02 ENSMUSG00000078487 Ankrd65 -2.63 6.5E-03 ENSMUSG00000051504 Siglech -2.63 2.7E-05 ENSMUSG00000028386 Slc46a2 -2.63 3.8E-04 ENSMUSG00000031216 Stard8 -2.64 2.0E-03 ENSMUSG00000105814 Mir703 -2.64 6.5E-03 ENSMUSG00000085069 Gm13111 -2.65 9.0E-03 ENSMUSG00000055093 Gm8430 -2.65 3.4E-03 ENSMUSG00000008682 Rpl10 -2.65 8.3E-09 ENSMUSG00000016262 Sertad4 -2.66 7.1E-03 ENSMUSG00000097326 A330048O09Rik -2.67 1.2E-02 ENSMUSG00000047146 Tet1 -2.67 4.8E-03 ENSMUSG00000027071 P2rx3 -2.67 1.5E-02 ENSMUSG00000085891 Gm14634 -2.67 5.1E-03 ENSMUSG00000023070 Rgn -2.67 4.2E-03 ENSMUSG00000055976 Cldn23 -2.68 2.8E-06 ENSMUSG00000016756 Cmah -2.69 3.3E-02 ENSMUSG00000053675 Tgm5 -2.69 4.9E-04 ENSMUSG00000010830 Kdelr3 -2.69 1.4E-04 ENSMUSG00000000216 Scnn1g -2.69 3.3E-06 ENSMUSG00000037152 Ndufc1 -2.69 2.9E-09 ENSMUSG00000020492 Ska2 -2.70 1.5E-06 ENSMUSG00000070802 Pnmal2 -2.70 3.8E-02 ENSMUSG00000006642 Tcf23 -2.70 6.4E-04 ENSMUSG00000034892 Rps29 -2.71 3.3E-20 ENSMUSG00000085382 Gm13861 -2.71 1.5E-02 ENSMUSG00000037686 Aspg -2.71 3.3E-02 ENSMUSG00000084850 Gm12092 -2.72 1.5E-02 ENSMUSG00000048782 Insc -2.73 4.2E-03 ENSMUSG00000029847 Slc23a4 -2.73 3.7E-02

292

ENSMUSG00000090733 Rps27 -2.74 1.5E-08 ENSMUSG00000097383 1500026H17Rik -2.75 2.3E-03 ENSMUSG00000103640 Gm31406 -2.75 1.1E-02 ENSMUSG00000089797 Gm16118 -2.75 2.8E-02 ENSMUSG00000099146 0610031O16Rik -2.76 1.8E-02 ENSMUSG00000030865 Chp2 -2.76 1.7E-02 ENSMUSG00000032394 Igdcc3 -2.76 4.2E-03 ENSMUSG00000038583 Pln -2.77 1.4E-03 ENSMUSG00000061171 Slc38a11 -2.82 2.5E-02 ENSMUSG00000072949 Acot1 -2.82 1.9E-04 ENSMUSG00000025154 Arhgap19 -2.83 1.3E-03 ENSMUSG00000096039 D830030K20Rik -2.83 1.3E-02 ENSMUSG00000045318 Adra2c -2.83 9.4E-04 ENSMUSG00000089679 Gm16299 -2.84 4.5E-02 ENSMUSG00000050511 Oprd1 -2.84 1.8E-04 ENSMUSG00000030905 Crym -2.84 1.9E-02 ENSMUSG00000097494 4933406C10Rik -2.84 2.9E-07 ENSMUSG00000083083 Gm15382 -2.85 2.7E-02 ENSMUSG00000021643 Serf1 -2.85 2.8E-06 ENSMUSG00000064326 Siva1 -2.86 6.7E-08 ENSMUSG00000069085 Dytn -2.86 4.6E-02 ENSMUSG00000074865 Zfp934 -2.86 3.4E-04 ENSMUSG00000057103 Nat8f1 -2.87 6.5E-03 ENSMUSG00000043252 Tmem64 -2.87 1.1E-08 ENSMUSG00000002057 Foxn1 -2.89 3.3E-02 ENSMUSG00000060063 Alox5ap -2.90 2.6E-05 ENSMUSG00000030889 Vwa3a -2.90 3.3E-02 ENSMUSG00000021572 Cep72 -2.90 8.2E-04 ENSMUSG00000035811 Ugt2b35 -2.91 8.8E-03 ENSMUSG00000031258 Xkrx -2.91 2.7E-06 ENSMUSG00000056966 Gjc3 -2.91 4.4E-02 ENSMUSG00000022881 Rfc4 -2.91 4.4E-08 ENSMUSG00000036098 Myrf -2.93 5.7E-03 ENSMUSG00000061848 Gm5805 -2.93 3.7E-04 ENSMUSG00000088179 Gm23106 -2.93 4.2E-02 ENSMUSG00000032034 Kcnj5 -2.93 4.6E-02 ENSMUSG00000029844 Hoxa1 -2.93 3.6E-02 ENSMUSG00000000318 Clec10a -2.94 3.0E-04 ENSMUSG00000104710 Gm31243 -2.94 3.5E-02 ENSMUSG00000089253 Gm25716 -2.95 4.1E-02 ENSMUSG00000074635 3110070M22Rik -2.95 1.6E-03 ENSMUSG00000106350 Gm4869 -2.96 1.2E-04 ENSMUSG00000052957 Gas1 -2.96 4.1E-02 ENSMUSG00000109508 Gm44956 -2.96 2.4E-04 ENSMUSG00000096606 Tpbgl -2.97 1.6E-03

293

ENSMUSG00000027574 Nkain4 -2.98 2.4E-03 ENSMUSG00000026961 Lrrc26 -2.98 3.3E-04 ENSMUSG00000037379 Spon2 -2.98 3.9E-09 ENSMUSG00000020182 Ddc -2.99 4.4E-03 ENSMUSG00000079641 Rpl39 -3.00 9.8E-09 ENSMUSG00000040978 Gm11992 -3.00 1.2E-03 ENSMUSG00000033450 Tagap -3.01 2.2E-04 ENSMUSG00000036446 Lum -3.01 4.2E-09 ENSMUSG00000001815 Evx2 -3.02 1.8E-02 ENSMUSG00000020878 Lrrc46 -3.02 2.2E-02 ENSMUSG00000083833 Gm13841 -3.03 3.0E-02 ENSMUSG00000031698 Mylk3 -3.03 4.4E-02 ENSMUSG00000071332 E230015B07Rik -3.04 5.0E-04 ENSMUSG00000051515 Fam181b -3.04 6.7E-04 ENSMUSG00000097934 6720483E21Rik -3.04 6.7E-03 ENSMUSG00000021612 Slc6a18 -3.07 2.3E-04 ENSMUSG00000024500 Ppp2r2b -3.08 2.7E-05 ENSMUSG00000068122 Agtr2 -3.09 3.8E-02 ENSMUSG00000044164 Rnf182 -3.09 3.1E-02 ENSMUSG00000052133 Sema5b -3.09 1.6E-02 ENSMUSG00000110679 Rpl10-ps5 -3.09 9.1E-03 ENSMUSG00000079355 Ackr4 -3.09 3.9E-03 ENSMUSG00000074228 Gm10645 -3.11 3.9E-02 ENSMUSG00000047976 Kcna1 -3.14 1.1E-02 ENSMUSG00000057068 Fam47e -3.14 3.3E-02 ENSMUSG00000084950 Gm5577 -3.15 1.7E-05 ENSMUSG00000087249 Gm16062 -3.15 1.6E-02 ENSMUSG00000038508 Gdf15 -3.15 3.7E-02 ENSMUSG00000075420 Smim6 -3.16 3.9E-06 ENSMUSG00000073448 Gm10509 -3.16 7.1E-04 ENSMUSG00000073295 Nudt11 -3.19 9.1E-10 ENSMUSG00000096006 Gm21596 -3.21 1.2E-02 ENSMUSG00000044217 Aqp5 -3.22 1.2E-03 ENSMUSG00000041673 Lrrc18 -3.22 2.0E-02 ENSMUSG00000027654 Fam83d -3.24 9.8E-03 ENSMUSG00000010086 Rnf112 -3.24 1.1E-02 ENSMUSG00000026220 Slc16a14 -3.25 7.9E-05 ENSMUSG00000061808 Ttr -3.25 4.6E-06 ENSMUSG00000001739 Cldn15 -3.28 1.7E-04 ENSMUSG00000022940 Pigp -3.29 4.3E-10 ENSMUSG00000033715 Akr1c14 -3.30 1.4E-03 ENSMUSG00000105444 Gm10727 -3.30 3.0E-02 ENSMUSG00000025909 Sntg1 -3.31 2.0E-02 ENSMUSG00000025922 Gm5045 -3.32 2.3E-02 ENSMUSG00000056643 Chst13 -3.33 3.1E-02

294

ENSMUSG00000031027 Stk33 -3.37 2.1E-02 ENSMUSG00000064065 Ipcef1 -3.37 3.8E-06 ENSMUSG00000030046 Bmp10 -3.38 5.5E-06 ENSMUSG00000107902 Gm32592 -3.41 3.6E-02 ENSMUSG00000057751 Megf6 -3.42 2.4E-05 ENSMUSG00000031344 Gabrq -3.42 2.1E-03 ENSMUSG00000048442 Smim5 -3.42 1.2E-07 ENSMUSG00000029695 Aass -3.43 3.8E-02 ENSMUSG00000085705 Gm16046 -3.44 1.9E-02 ENSMUSG00000095427 Rps2-ps6 -3.44 2.8E-02 ENSMUSG00000103755 Gm37805 -3.46 2.9E-02 ENSMUSG00000021278 Amn -3.46 8.7E-08 ENSMUSG00000070324 Fbxw22 -3.46 1.9E-05 ENSMUSG00000103715 4933431K14Rik -3.47 4.5E-06 ENSMUSG00000029861 Fam131b -3.47 3.1E-02 ENSMUSG00000047507 Baiap3 -3.47 1.1E-07 ENSMUSG00000090223 Pcp4 -3.47 4.8E-09 ENSMUSG00000041361 Myzap -3.49 2.1E-12 ENSMUSG00000036186 Fam69b -3.51 1.2E-05 ENSMUSG00000027070 Lrp2 -3.53 8.6E-03 ENSMUSG00000038233 Fam198a -3.55 1.3E-03 ENSMUSG00000026023 Cdk15 -3.55 3.7E-04 ENSMUSG00000047115 Fam221a -3.55 3.0E-08 ENSMUSG00000025993 Slc40a1 -3.58 4.6E-09 ENSMUSG00000097115 1810019N24Rik -3.58 3.4E-02 ENSMUSG00000046178 Nxph1 -3.58 1.4E-02 ENSMUSG00000029678 Hyal5 -3.62 5.1E-04 ENSMUSG00000030365 Clec2i -3.62 1.6E-02 ENSMUSG00000028020 Glrb -3.64 7.4E-03 ENSMUSG00000026154 Sdhaf4 -3.68 5.6E-07 ENSMUSG00000099270 Gm27454 -3.68 3.5E-02 ENSMUSG00000086316 Nbdy -3.68 6.4E-16 ENSMUSG00000063919 Srrm4 -3.75 7.0E-04 ENSMUSG00000035187 Nkx6-1 -3.76 4.7E-02 ENSMUSG00000040138 Ndp -3.80 1.4E-02 ENSMUSG00000100775 Gm29107 -3.83 4.7E-02 ENSMUSG00000040229 Gpr34 -3.85 4.9E-02 ENSMUSG00000079364 Gm3558 -3.88 4.5E-02 ENSMUSG00000086054 Hnf1aos1 -3.91 4.6E-02 ENSMUSG00000037579 Kcnh3 -3.91 1.4E-02 ENSMUSG00000070687 Htr1d -3.93 1.1E-09 ENSMUSG00000038725 Pkhd1l1 -3.95 9.4E-03 ENSMUSG00000031517 Gpm6a -4.00 4.9E-03 ENSMUSG00000011171 Vipr2 -4.01 7.7E-03 ENSMUSG00000038600 Atp6v0a4 -4.07 1.5E-04

295

ENSMUSG00000022129 Dct -4.15 4.4E-02 ENSMUSG00000064330 Pde6h -4.19 3.0E-02 ENSMUSG00000011463 Cpb1 -4.23 1.6E-07 ENSMUSG00000021872 Rnase10 -4.24 4.8E-02 ENSMUSG00000109564 Muc16 -4.24 1.9E-02 ENSMUSG00000027015 Cybrd1 -4.24 5.9E-03 ENSMUSG00000026051 1500015O10Rik -4.26 5.4E-06 ENSMUSG00000041012 Cmtm8 -4.30 1.2E-02 ENSMUSG00000034881 Tbxa2r -4.30 2.9E-03 ENSMUSG00000035916 Ptprq -4.34 4.4E-02 ENSMUSG00000096842 Gm10736 -4.37 2.5E-28 ENSMUSG00000024245 Tmem178 -4.38 6.5E-04 ENSMUSG00000021974 Fgf9 -4.44 1.4E-03 ENSMUSG00000097756 A730056A06Rik -4.50 2.8E-05 ENSMUSG00000026012 Cd28 -4.52 4.5E-04 ENSMUSG00000002791 Pdxk-ps -4.57 3.9E-02 ENSMUSG00000022818 Cyp2ab1 -4.60 3.3E-02 ENSMUSG00000028003 Lrat -4.61 2.7E-02 ENSMUSG00000086233 Gm11816 -4.62 1.6E-04 ENSMUSG00000039097 Rln1 -4.72 1.7E-02 ENSMUSG00000004347 Pde1c -4.72 2.3E-02 ENSMUSG00000059305 Vpreb1 -4.84 4.0E-02 ENSMUSG00000021055 Esr2 -4.87 2.5E-06 ENSMUSG00000024600 Slc27a6 -4.88 2.6E-02 ENSMUSG00000086291 Gm15513 -4.95 1.5E-03 ENSMUSG00000028871 Rspo1 -4.95 4.0E-03 ENSMUSG00000084184 Gm13474 -4.98 4.3E-02 ENSMUSG00000060212 Pcnx2 -5.03 6.5E-05 ENSMUSG00000019874 Fabp7 -5.04 1.9E-03 ENSMUSG00000050035 Fhl4 -5.15 3.0E-03 ENSMUSG00000039059 Hrh3 -5.16 1.0E-16 ENSMUSG00000096852 Cyp2d12 -5.25 2.1E-02 ENSMUSG00000097702 Gm26739 -5.39 2.5E-03 ENSMUSG00000101156 Gm29114 -5.46 2.3E-02 ENSMUSG00000061654 Spry3 -5.59 3.8E-03 ENSMUSG00000030382 Slc27a5 -5.64 2.4E-02 ENSMUSG00000078505 Gm436 -5.69 1.1E-06 ENSMUSG00000086671 Gm13618 -5.70 3.4E-02 ENSMUSG00000098486 Gm27385 -5.71 1.2E-02 ENSMUSG00000040583 Cyp2b13 -5.97 1.4E-02 ENSMUSG00000025105 Bnc1 -6.16 4.2E-03 ENSMUSG00000087644 Gm14703 -6.18 2.3E-02 ENSMUSG00000044748 Defb1 -6.20 1.4E-10 ENSMUSG00000109243 Gm45867 -6.23 4.1E-03 ENSMUSG00000102796 Gm37711 -6.40 5.3E-13

296

ENSMUSG00000028004 Npy2r -6.50 4.0E-03 ENSMUSG00000071553 Cpa2 -6.90 3.0E-04 ENSMUSG00000085360 Arhgap27os2 -7.17 1.9E-03 ENSMUSG00000053765 Oas1f -7.65 1.6E-02 ENSMUSG00000085139 A730046J19Rik -7.99 5.3E-03 ENSMUSG00000015090 Ptgds -8.25 5.9E-03 ENSMUSG00000087247 Alkal1 -8.53 4.1E-03 ENSMUSG00000096003 Gm3500 -9.91 4.0E-02 ENSMUSG00000043110 Lrrn4 -10.11 6.9E-05 ENSMUSG00000050425 Mrgprb2 -10.17 1.3E-02 ENSMUSG00000035930 Chst4 -10.33 3.7E-08 ENSMUSG00000029522 Pla2g1b -10.34 1.5E-02 ENSMUSG00000090785 Gm17116 -10.40 2.5E-02 ENSMUSG00000046699 Slitrk4 -10.56 4.3E-02 ENSMUSG00000089683 4930570N18Rik -10.76 4.7E-02 ENSMUSG00000020469 Myl7 -10.97 8.1E-03 ENSMUSG00000053729 Spinkl -11.14 1.8E-02 ENSMUSG00000108783 Gm36546 -11.16 2.5E-02 ENSMUSG00000056089 Gm5468 -11.30 3.3E-02 ENSMUSG00000025091 Pnliprp2 -11.73 1.7E-02 ENSMUSG00000039913 Pak7 -12.01 2.6E-02 ENSMUSG00000040205 Cuzd1 -12.24 3.3E-02 ENSMUSG00000042353 Frem3 -13.10 3.2E-02 ENSMUSG00000065922 n-R5-8s1 -13.32 1.8E-02 ENSMUSG00000046160 Olig1 -13.97 1.6E-02 ENSMUSG00000104075 5430433H01Rik -14.61 5.7E-03 ENSMUSG00000043621 Ubxn10 -15.25 4.9E-03 ENSMUSG00000042372 Dmrt3 -15.34 1.5E-02 ENSMUSG00000107288 Gm42903 -15.44 3.4E-02 ENSMUSG00000101848 4933417E11Rik -16.55 5.0E-03 ENSMUSG00000097703 Gm26623 -17.15 2.5E-03 ENSMUSG00000095217 Hist1h2bn -18.18 6.2E-03 ENSMUSG00000102548 Gm16701 -18.55 4.1E-03 ENSMUSG00000022759 Lrrc74b -19.10 2.0E-03 ENSMUSG00000063903 Klk1 -19.31 1.9E-03 ENSMUSG00000076532 Igkv4-91 -20.09 1.5E-02 ENSMUSG00000030954 Gp2 -20.42 2.2E-03 ENSMUSG00000065878 Snord34 -22.03 1.8E-03 ENSMUSG00000040467 4921522P10Rik -22.11 1.1E-03 ENSMUSG00000084174 Sycn -23.30 2.3E-03 ENSMUSG00000026818 Cel -32.40 1.3E-11 ENSMUSG00000023140 Reg2 -39.28 4.2E-05 ENSMUSG00000049350 Zg16 -40.42 1.2E-05 ENSMUSG00000054446 Cpa1 -42.66 5.3E-11 ENSMUSG00000001670 Tat -47.51 5.3E-04

297

ENSMUSG00000023433 Cela3b -49.07 3.9E-06 ENSMUSG00000035896 Rnase1 -55.06 1.2E-06 ENSMUSG00000024225 Clps -61.30 2.1E-06 ENSMUSG00000036938 Try5 -70.66 1.3E-06 ENSMUSG00000001225 Slc26a3 -76.60 7.0E-05 ENSMUSG00000054106 Try4 -129.13 1.9E-08 ENSMUSG00000058579 Cela2a -160.79 1.1E-09 ENSMUSG00000042179 Pnliprp1 -201.65 1.5E-10 ENSMUSG00000029882 2210010C04Rik -245.04 1.7E-11 ENSMUSG00000057163 Prss2 -279.98 2.1E-12 ENSMUSG00000046008 Pnlip -494.00 9.5E-15 ENSMUSG00000031957 Ctrb1 -555.68 3.5E-15

298

Appendix 3

Published paper

D. Acharya, M. J. Sullivan, B. L. Duell, T. Eveno, M. A. Schembri, G. C. Ulett. 2019. Physical extraction and fast protein liquid chromatography for purifying flagella filament from uropathogenic Escherichia coli for immune assay. Front Cell Infect Microbiol. 2019 Apr 24;9:118. doi: 10.3389/fcimb.2019.00118. (PMID: 31069177)

The contributions of author’s to this publication were:

(Signed) ______(Date)______

Dhruba Acharya

(Countersigned) ______(Date)______

Supervisor: Professor Glen C. Ulett

299

METHODS published: 24 April 2019 doi: 10.3389/fcimb.2019.00118

Physical Extraction and Fast Protein Liquid Chromatography for Purifying Flagella Filament From Uropathogenic Escherichia coli for Immune Assay

Dhruba Acharya 1,2, Matthew J. Sullivan 1,2, Benjamin L. Duell 1,2†, Tanguy Eveno 3†, Mark A. Schembri 4 and Glen C. Ulett 1,2* Edited by: Jonathan Shaw, 1 School of Medical Science, Griffith University, Southport, QLD, Australia, 2 Menzies Health Institute Queensland, University of Sheffield, Griffith University, Southport, QLD, Australia, 3 Institute for Glycomics, Griffith University, Southport, QLD, Australia, 4 School United Kingdom of Chemistry and Molecular Biosciences, University of Queensland, St. Lucia, QLD, Australia Reviewed by: Phillip Aldridge, Newcastle University, United Kingdom Flagella are expressed on the surface of a wide range of bacteria, conferring motility Susana Merino, and contributing to virulence and innate immune stimulation. Host-pathogen interaction University of Barcelona, Spain studies of the roles of flagella in infection, including due to uropathogenic Escherichia *Correspondence: coli (UPEC), have used various methods to purify and examine the biology of the major Glen C. Ulett g.ulett@griffith.edu.au flagella subunit protein, FliC. These studies have offered insight into the ways in which flagella proteins interact with host cells. However, previous methods used to extract and †Present Address: Tanguy Eveno, purify FliC, such as mechanical shearing, ultracentrifugation, heterologous expression Biotechnologies Co., France in laboratory E. coli strains, and precipitation-inducing chemical treatments have various Benjamin L. Duell, CanImGuide Therapeutics AB, limitations; as a result, there are few observations based on highly purified, non-denatured Malmö, Sweden FliC in the literature. This is especially relevant to host-pathogen interaction studies such as immune assays that are designed to parallel, as closely as possible, naturally-occurring Specialty section: This article was submitted to interactions between host cells and flagella. In this study, we sought to establish a Molecular Bacterial Pathogenesis, new, carefully optimized method to extract and purify non-denatured, native FliC from a section of the journal the reference UPEC strain CFT073 to be suitable for immune assays. To achieve Frontiers in Cellular and Infection Microbiology purification of FliC to homogeneity, we used a mutant CFT073 strain containing deletions

Received: 24 December 2018 in four major chaperone-usher fimbriae operons (type 1, F1C and two P fimbrial gene Accepted: 03 April 2019 clusters; CFT0734). A sequential flagella extraction method based on mechanical Published: 24 April 2019 shearing, ultracentrifugation, size exclusion chromatography, protein concentration and Citation: Acharya D, Sullivan MJ, Duell BL, endotoxin removal was applied to CFT073 4. Protein purity and integrity was assessed Eveno T, Schembri MA and Ulett GC using SDS-PAGE, Western blots with anti-flagellin antisera, and native-PAGE. We also (2019) Physical Extraction and Fast generated a fliC-deficient strain, CFT0734fliC, to enable the concurrent preparation Protein Liquid Chromatography for Purifying Flagella Filament From of a suitable carrier control to be applied in downstream assays. Innate immune Uropathogenic Escherichia coli for stimulation was examined by exposing J774A.1 macrophages to 0.05-1 µg of purified Immune Assay. Front. Cell. Infect. Microbiol. 9:118. FliC for 5 h; the supernatants were analyzed for cytokines known to be induced by doi: 10.3389/fcimb.2019.00118 flagella, including TNF-α, IL-6, and IL-12; the results were assessed in the context of

Frontiers in Cellular and Infection Microbiology | www.frontiersin.org 1 April 2019 | Volume 9 | Article 118 Acharya et al. Puriﬁcation of UPEC FliC

prior literature. Macrophage responses to purified FliC encompassed significant levels of several cytokines consistent with prior literature reports. The purification method described here establishes a new approach to examine highly purified FliC in the context of host-pathogen interaction model systems.

Keywords: uropathogenic Escherichia coli, UPEC, Flagella, FliC ﬂagellin, fast protein liquid chromatography, FPLC, immune assay

INTRODUCTION E. coli (UPEC) reference strain, CFT073; whereas multidrug resistant and globally disseminated ST131 strains of UPEC Flagella are complex motility organelles expressed on the surface produce H4 flagella, and the UPEC reference cystitis strain, of a wide range of bacteria. The major structural component of UTI89, produces H7 flagella. Studies examining the biology of flagella is the filament that affords helical propeller properties UPEC flagella have contributed a great deal to our understanding to bacterial cells and is the principle component recognized of its roles in urinary tract infection and disease pathogenesis by the immune system, as reviewed elsewhere (Chaban et al., (Lane et al., 2005, 2007; Wright et al., 2005; Pichon et al., 2009; 2015; Hajam et al., 2017). The filament is a polymerized product Hung et al., 2013; Kakkanat et al., 2015). of more than 20,000 protein monomers termed flagellin or In addition to providing motility, flagella contribute to FliC, encoded by the gene termed fliC (Zhou et al., 2015), as bacterial virulence and host-pathogen interactions via adhesive reviewed elsewhere (Iino et al., 1988). Collectively, more than properties and by triggering immune responses, as reviewed fifty genes are required for flagellar biosynthesis, which are elsewhere (Duan et al., 2013; Haiko and Westerlund-Wikstrom, divided into 17 or more operons (Chilcott and Hughes, 2000). 2013; Rossez et al., 2015). For example, strains of E. coli To enable the complex process of flagellar biogenesis, bacteria use associated with meningitis are attenuated for adherence to hierarchical regulatory networks that involve transcriptional and brain microvascular endothelial cells when the bacteria lack post-translational mechanisms to control an ordered expression flagella (Parthasarathy et al., 2007). H6 and H7 flagella of of flagellar structural components. So-called “early genes” are enterohemorrhagic and enteropathogenic E. coli exhibit adhesive transcribed from a class 1 promoter in the flhDC operon, which properties (Giron et al., 2002; Erdem et al., 2007; Mahajan is sensitive to environmental and cell state sensors (Silverman et al., 2009), and H48 flagella from enterotoxigenic E. coli and Simon, 1974). As an early class operon, flhDC is termed adheres to human Caco-2 cells (Roy et al., 2009). Together, the master operon reflecting its essentiality for the transcription these observations signify a role for flagella in host colonization. of all the genes required for flagellar biosynthesis (Kutsukake In UPEC, flagella-mediated motility has been associated with et al., 1980). In contrast, “late genes” such as fliC are not the ascension of bacteria from the bladder to the kidneys, engaged translationally until the latter stages of flagella biogenesis where host-pathogen interactions leading to inflammation can (Chilcott and Hughes, 2000). In addition, some E. coli isolates can prompt pyelonephritis (Lane et al., 2007). Other studies have carry two or more fliC genes (Ratiner, 1998), and sequencing of also reported that UPEC flagella can promote urinary tract such alleles in pathogenic E. coli strains has been used to infer colonization and invasion of host cells (Wright et al., 2005; evolutionary relationships (Reid et al., 1999). Multiple types of Pichon et al., 2009) as well as biofilm formation (Duan et al., 2013; flagellin in a pathogenic bacterium may be related to immune Hung et al., 2013). evasion or niche versatility, as discussed elsewhere (Mcquiston There is also evidence supporting more nuanced roles for et al., 2008; Rossez et al., 2015). Finally, flagellar assembly is also flagella in E. coli disease pathogenesis, including findings of no affected by the growth-rate of bacteria, and flagellar abundance major contribution of flagella-mediated motility in urinary tract correlates with growth rate, whereby faster growing cells produce colonization (Lane et al., 2005), and no role for avian pathogenic more flagella (Sim et al., 2017). or shiga toxin-producing E. coli flagellin in adhesion to Hep-2 As an organelle, a flagellum comprises over 30 unique proteins cells (La Ragione et al., 2000) or epithelial cells (Rogers et al., that range in relative abundance from a few to tens of thousands 2012). Taken together, these observations are reflective of the of copies (Terashima et al., 2008; Chaban et al., 2015; Minamino highly diverse biological properties of the predicted thousands and Imada, 2015). The structure of the flagellin monomer of distinct types of flagella in bacteria (Pallen and Matzke, 2006) FliC was originally described in the context of supercoiling and highlight the importance of careful examination of the and different packing interactions (Samatey et al., 2001); FliC roles of flagella and flagellin in experimental systems. Finally, comprises four linearly connected domains; two core (D0 and the nature of bacterial flagella as a potent immune activator D1) with alpha-helical structures in lateral N- and C- terminals, of innate and adaptive immunity via the Toll-Like Receptor and two hypervariable (D3 and D4) that are exposed as folded (TLR) host protein, TLR5 has been described, as reviewed beta-sheets in the central region. On the basis of the flagellar elsewhere (Ramos et al., 2004; Gewirtz, 2006; Miao et al., 2007; filament structure, 56 serogroups of E. coli are defined, termed H1 Hajam et al., 2017). In this context, innate immune responses to to H56 (Orskov and Orskov, 1992; Wang et al., 2003). H1-type flagella can direct the development of flagellin-specific adaptive flagella are produced by the commonly studied uropathogenic immune responses and these can modulate the production of

Frontiers in Cellular and Infection Microbiology | www.frontiersin.org 2 April 2019 | Volume 9 | Article 118 Acharya et al. Puriﬁcation of UPEC FliC

flagella in the gut microbiome to help maintain mucosal barrier strain (GU2642; also devoid of fim, foc, pap1, and pap2). All integrity (Cullender et al., 2013). Thus, there remains a need for gene deletions were confirmed by PCR and sequencing. The improvement in our current understanding of flagella biology, primers used for the construction of mutants are listed in Table 3. including, in particular, advances in the tools used to examine the Bacteria were grown at 37◦C in lysogeny broth (LB) and on LB interactions between flagella and cells of the immune system. agar (1.5% agar unless otherwise stated) with antibiotic selection In studying FliC as the principle component of flagella, (kanamycin, 50 µg/mL) and IPTG induction (20 mM), as needed. various methods for extraction and purification of the protein have been described in diverse biological systems, Growth Conditions and Physical Extraction and these are summarized in Table 1. Methods described to of Flagella date include assorted combinations of mechanical shearing, Initial protein preparations enriched for flagella were isolated ultracentrifugation, heterologous expression in laboratory E. coli from overnight E. coli cultures using ultracentrifugation strains, and precipitation-inducing chemical treatments to isolate techniques, essentially as described elsewhere (Gerhardt, 1994) and concentrate FliC in order to explore how it interacts at the but with minor modifications. Briefly, bacterial cultures were host cell interface. However, these purification methods have grown overnight in 500mL LB at 37◦C with slow shaking (60 provided little insight into the biology of highly purified, native rpm) and were harvested and washed twice in PBS (500 mL, forms of FliC because of inherent limitations in the methods 50mL, 8,000 × g for 10min at 4◦C); bacterial suspensions were used, which can adversely affect protein integrity and/or lead aliquoted into 1.8 mL volumes for flagella isolation. To physically to extraneous protein or endotoxin contamination, which can shear the flagella, the bacteria were agitated in 2.0mL Safe-Lock effect downstream (especially immune) assays (Petsch and Microcentrifuge Tubes (Eppendorf) containing two stainless Anspach, 2000; Gorbet and Sefton, 2005; Schwarz et al., 2014). steel ball bearings (5 mm) using a Tissue Lyzer II (Qiagen, Additionally, there have been few methodological advances Netherlands) (5 × cyclesof30sat30Hz/30sonice).Thesheared to improve extraction and purification methods for FliC in bacterial suspensions were centrifuged at 12,000 × g for 10 min recent years. A single method that yields pure FliC, free from at 4◦C to pellet the bacteria, and the supernatants, containing the endotoxin contamination and limiting processes of purification sheared flagella, were passed through a 0.45 µM nitrocellulose such as protein denaturation would be valuable for studies of the filters (Millipore) to remove any remaining bacteria. In initial activities of FliC in host-pathogen interaction systems. assays, we used protease inhibitor (Complete Ultra, EDTA In this study, we sought to establish an optimized protocol for free) at the concentration recommended by the manufacturer extraction and purification of FliC from UPEC to homogeneity, (Roche) to assess any protein degradation. Bacteria-free solutions with particular reference to its application to downstream containing the sheared flagella were centrifuged at 100,000 × g immune assays. We developed and validated a new protocol for 90min (Beckman coulter L-90K) at 4◦C. The pellets were based on a combination of physical extraction methods and resuspended in 2 mL PBS, frozen, and quantitated (Thermo fast protein liquid chromatography (FPLC), followed by protein Scientific Pierce BCA Protein Assay Kit #23227, USA). concentration and endotoxin removal to generate highly pure In subsequent experiments, we used the protocol described FliC from UPEC CFT073. Finally, we applied purified FliC to by Tahoun et al. (2015) with minor modifications to achieve a macrophages in vitro, and measured proinflammatory cytokine higher degree of FliC purity. Briefly, following overnight growth responses to profile its immune stimulatory properties in the of 250mL LB cultures, cells were harvested at 4,100 × g for context of previous literature. 30min at 4◦C. Mechanical shearing of flagella was achieved as described above, and pooled solutions were centrifuged again, MATERIALS AND METHODS and supernatant was collected and re-centrifuged twice. Any Bacterial Strains, Plasmids, and Primers residual bacterial cells were removed by centrifugation at 15,000 × g for 10min at 4◦C. The supernatant was transferred into The UPEC reference strain, CFT073 was used in conjunction polycarbonate ultracentrifuge tubes and centrifuged at 135,000 with several gene-deficient derivatives of the wild-type (Wt) × g for 90min at 4◦C. The translucent brown gelatinous pellet, parent, and the laboratory E. coli strain MC4100. fliC-deficient representing flagella, was resuspended in 250 µl PBS and stored UPEC CFT073 (devoid of flagellar filament) was generated at −20◦C for subsequent quantification and use. We also applied using lambda red recombinase with kanamycin resistance for the protocol for purification of bacterial flagellin as reported by selection, as previously described (Datsenko and Wanner, 2000). Smith et al. (2003) to compare protein yield and purity with that E. coli MC4100 deficient in flhDC (for flagella biosynthesis) was generated based on the protocol described in the current study. also used. Wt CFT073 and MC4100 strains containing IPTG- inducible pMG600 carrying flhDC were used as hyperflagellated strains. A summary of the bacterial strains used in this study is Characterization of Protein Preparations listed in Table 2. by SDS-PAGE and Mass Spectrometry Additionally, a multiple gene-deficient derivative of Wt Purity of FliC preparations was assessed by SDS-PAGE, CFT073 carrying combined mutations in the 4 genes that encode Coomassie staining and western blots. Protein samples (between type 1 fimbriae (fim), F1C/S fimbriae (foc), and pyelonephritis- 1.0 and 12.5 µg per lane, unless otherwise stated and depending associated pili (pap1 and pap2), designated CFT0734 (Wurpel on the assay), representing whole cell lysates or flagella extract, et al., 2014), was used to generate a fliC-deficient derivative were separated in 12% SDS-PAGE gels run at 200V for 40min.

Frontiers in Cellular and Infection Microbiology | www.frontiersin.org 3 April 2019 | Volume 9 | Article 118 Acharya et al. Puriﬁcation of UPEC FliC

TABLE 1 | Methods for extraction and puriﬁcation of FliC as applied in previous studies.

Principle Details of method Biological considerations References

Physical, Mechanical shearing of flagella, ultracentrifugation, Multiple column elutions with NaCl, insufficient data Martinez, 1963 chromatography purification by ion exchange chromatography to establish purity of FliC Chemical, spheroblast Spheroplasts with lysozyme and EDTA, lysis with Potential for isolating intact flagella, chemically harsh Depamphilis and Adler, 1971 production Triton X-100, precipitation with (NH4)2SO4, conditions may effect protein integrity, purity not differential centrifugation, and CsCl gradient addressed centrifugation Chemical, precipitation Acid denaturation of flagella, ultracentrifugation, Protein denaturation, purity assessed only by Ibrahim et al., 1985 (NH4)2SO4 precipitation microscopy, endotoxin levels not reported Detergent, Phase transition separation with Triton X-114, Detergent effects on protein integrity, low yield, Kalmokoff et al., 1988 chromatography purification with column chromatography abundant contaminating protein Physical, centrifugation Mechanical shearing, ultracentrifugation, KBr Purity not addressed Gerhardt, 1994 gradient centrifugation Mechanical shearing, multiple rounds of Endotoxin levels not reported, sensitivity to detect Smith et al., 2003 ultracentrifugation extraneous protein contamination unclear Physical, precipitation Mechanical shearing, acetone precipitation, heat Chemical precipitation effects on protein integrity, Braga et al., 2008 treatment for FliC monomer unclearly defined yield Sequential Sequential cation- and anion-exchange Acid treatment to achieve FliC monomers may Simonsen et al., 2014 chromatography chromatography, tangential flow-filtration effect protein integrity, fermenter use suitable for large scale Physical, Mechanical shearing, ultra-centrifugation, size Minimal chemical treatment, maintained protein This study chromatography exclusion chromatography, endotoxin removal, integrity, pure FliC without endotoxin mild-heating

TABLE 2 | Bacterial strains and plasmids used in this study.

Strain Characteristics References

E. coli DH5α Cloning strain; dlacZ M15(lacZYA-argF) U169 recA1 endA1 hsdR17(rK-mK+) supE44 thi-1 gyrA96 relA1 Bethesda Research Laboratories MC4100 E. coli K-12 strain, OR:H48 Peters et al., 2003 MC4100+pMG600 MC4100 containing pMG600 (pflhDC); KnR Givskov et al., 1995 CFT073 Reference UPEC strain, O6:H1 (ATCC 700928) Mobley et al., 1990 GU2139 CFT073 + pMG600 (pflhDC); KnR This work GU2639 fliC-derivative of CFT073; KnR This work GU2132 GU2639 + pMG600 (pflhDC); KnR This work CFT0734 CFT073 with combined deletions fim foc pap1 pap2 Wurpel et al., 2014 GU2647 CFT0734 + pMG600 (pflhDC); KnR This work GU2642 CFT0734fliC; fliC-derivative of CFT0734 This work GU2648 GU2642 + pMG600 (pflhDC); KnR (for Carrier control) This work

Plasmid Relevantcharacteristics References pMG600 ﬂhDC operon from Serratia in pVLT33; CmR Givskov et al., 1995 pKD4 Template plasmid for kan gene ampliﬁcation Datsenko and Wanner, 2000 pKD46 λ-Red recombinase expression plasmid Datsenko and Wanner, 2000 pCP20 FLP synthesis under thermal control Datsenko and Wanner, 2000

For Coomassie staining, gels were stained with brilliant blue (Staten Serum Institut, Denmark) for 1h and washed three times solution for 1 h and de-stained (1% acetic acid) overnight for in PBS-T for 5 min. The secondary antibody was a 1:500 dilution visualization using a Chemidoc XRS (Bio-Rad). For western blot, of goat anti-rabbit IgG HRP-conjugate (Santa Cruz Biotech #sc- the gels were transferred to 0.45 µm nitrocellulose membranes 2030, USA) or Goat anti-rabbit IgG-AP (1:10,000; Santa Cruz (Bio-Rad #162-0115, USA) for 1h at 100V with cooling, and Biotechnology) for 1 h, subsequently washed four times in PBS- blocked with 5% skim milk in PBS-T. The membranes were T (5 min). Blots were developed using 3,3′-Diaminobenzidine incubated with a 1/100 dilution of polyclonal rabbit anti- substrate (Sigma #D4418, USA) or 5-bromo-4-chloro-3-indolyl ﬂagella H-pool-E (H48+others) or pool-A (H1+others) antibody phosphate (BCIP)/nitro blue tetrazolium (NBT) (Sigma). The

Frontiers in Cellular and Infection Microbiology | www.frontiersin.org 4 April 2019 | Volume 9 | Article 118 Acharya et al. Puriﬁcation of UPEC FliC

TABLE 3 | Primers used to generate mutant strains used in this study.

′ ′ Primer Sequence (5 → 3 ) * Application Amplicon

′ fliC-Kan-Up-F1 GGGTGACGCTGATGGTGTAT 5 region of fliC 574 bp fliC-Kan-Up-R2 CGAAGCAGCTCCAGCCTACACATGTGCCATGATTCGTTATCC ′ fliC-Kan-Down-F1 CTAAGGAGGATATTCATATGTAATCGCCGTAACCTGATTAACT 3 region of fliC 575 bp fliC-Kan-Down-R1 TGCGAAGTTCATCCAGCATA pKD4-KanR-F1 TGTGTAGGCTGGAGCTGCTTCG pKD4 KanR cassette 1,478 bp pKD4-KanR-R1 CATATGAATATCCTCCTTAG fliC-chk-F1 GTGAGTTTGCTGTCGCTGGT Sequencing 3,071 bp (Wt) fliC-chk-R1 CTATTGCCTGTGCCACTTCA Sequencing 1,339 bp (fliC)

*underlined text denotes sequence homologous to KanR cassette of pKD4. reactions were stopped by addition of water prior to image 0.2N NaOH overnight and after washes with 2M NaCl, capture using a flatbed scanner (Epson, Japan) or Chemidoc XRS. ultrapure water and endotoxin free buffer, the FliC extracts Mass spectrophotometry (MS) was performed to identify were added and incubated at 4◦C for 16 h. The proteins were several extraneous unknown proteins found to be present in recovered by centrifugation (500 × g for 1 min). Endotoxin initial FliC preparations. The MS was carried out using protein levels in purified protein samples were measured using the samples derived from CFT0734 or its fliC-deficient derivative. ToxinSensor Chromogenic LAL Assay (Genscript), according Proteins (2.5 µg) were resolved by SDS-PAGE, stained with to the manufacturer’s instructions. Briefly, 100 µl volumes Coomassie blue and de-stained (1% acetic acid) overnight. of samples were applied to endotoxin-free tubes after pH Proteins bands were isolated in 1% acetic acid and were adjustment (pH 6–8) and were mixed with 100 µl of LAL analyzed at the Translational Research Institute (University of reagent. The tubes were incubated for 15 min at 4◦C in the dark, Queensland), Proteomics Core Facility, Brisbane. the substrate and color stabilizers were added, and absorbance at 545 nm was measured. Endotoxin concentration is reported Fast Protein Liquid Chromatography in EU.µg−1. (FPLC) Post-purification of FliC extracts was undertaken by size Heat-Induced Monomerization of Flagellar exclusion chromatography on an ÄKTA Pure protein purification Filament system (GE Lifesciences). We used the Superdex 200 Increase De-polymerization of flagellar filaments into FliC monomers was 10/300 GL column with a 24 mL bed volume (GE Lifesciences) assessed by heating proteins (4.5 µg) at temperatures ranging equilibrated with 1.5 column volume (CV) of PBS buffer at between 30 and 90◦C for 10–15 min. Following heat treatment, 0.4 mL.min−1. Prior to application, the FliC extracts were proteins were mixed with native gel loading buffer containing resuspended in 250 µL of PBS, heated at 60◦C (10min) to 1M Tris (pH 6.8), glycerol and bromophenol blue, and were generate monomers, cooled on ice for 2 min, and applied to the separated in 10% native gels run at 100V for 1.5h. The native column using a 500 µL sample loop pre-filled with PBS. The 1.2 gels were stained with Coomassie blue and de-stained (1% acetic CV elution flow through was collected in 1 mL fractions using acid) overnight. Gels from three independent experiments were a Frac F9-R fraction collector (GE Lifesciences). The fractions imaged using a Chemidoc XRS and relative quantitation of were monitored for protein content by measuring the UV protein bands was achieved using ImageJ software (1.6.0_24). absorbance at both 215 and 280 nm throughout the elution. The Data are reported as mean arbitrary densitometric units (ADU) protein containing fraction(s) were subsequently concentrated ±SEM. The tendency of FliC monomers to remain stable (or approximately 8-fold using Amicon Ultra-4 10K Centrifugal self-re-polymerize) following heat-induced monomerization was Filters (Merck Millipore) (for example, 3 mL pool of fraction 13 tested by incubating monomers at temperatures between 4 and samples from three preparations concentrated to 400 µL). The 37◦C for 2, 24, and 48h; the proteins were then subsequently samples were stored at 80◦C or were used directly in procedures, examined and compared with untreated FliC monomers using including endotoxin removal, protein estimation, SDS-PAGE, or native gels. in vitro stimulation assays. All FLPC procedures were undertaken at 4◦C. A scheme of the protocol used for FliC extraction and Cell Culture and Immune Stimulation Assay purification is illustrated in Figure 1. Mouse J774A.1 macrophages (ATCC#TIB-67) were grown at ◦ 37 Cwith5%CO2 in complete RPMI (cRPMI) media, consisting Endotoxin Removal and Measurement of RPMI1640 (Life Technologies, USA) with 25 mM HEPES, FliC extracts were treated to remove residual endotoxin using 2 mM L-glutamine, 10% heat-inactivated fetal bovine serum, High Capacity Endotoxin Removal Resin Columns (Pierce, 100 mM non-essential amino acids, 1 mM sodium pyruvate, 88274), according to the manufacturer’s instructions (Thermo 100U mL−1 penicillin, and 100mg mL−1 streptomycin. In Scientific). Briefly, the columns were regenerated with 3.5mL some experiments, human 5637 uroepithelial (ATCC#HTB-9)

Frontiers in Cellular and Infection Microbiology | www.frontiersin.org 5 April 2019 | Volume 9 | Article 118 Acharya et al. Puriﬁcation of UPEC FliC

FIGURE 1 | Work flow schematic for extraction and chromatographical purification of FliC from UPEC CFT073. The protocol’s sequential steps of Culture and harvest (1), Deflagellation (2), Extraction (3), Purification (4), Decontamination (5), and Confirmation (6) are shown alongside schematics of the major elements comprising each step. Analytic tools used for quality control and validation of the FliC extracts, including MS are shown below the protocols sequential steps. and U937 monocyte (ATCC#CRL-1593.2) cell lines were used of the protocol to determine the effect of the endotoxin for comparison. Approximately 1 x 105 host cells in 200 µl removal. We also compared the responses of macrophages cRPMI were seeded into the wells of a 96-well tissue-culture to amounts of FliC ranging between 0.05-1 µg. Cell culture treated microtiter plate, and stimulated with up to 1 µg of supernatants from quadruplicate wells were collected, clarified purified FliC (50 µl challenge volume consisting of protein [in at 1,000 × g for 10min at 4◦C, and stored at −80◦C for PBS elution buffer] diluted with cRPMI) for 5 h. Control groups subsequent cytokine assay. Experiments were performed were treated with the equivalent volume of PBS elution buffer in four independent assays. The cytokine concentrations prepared from the corresponding FPLC fraction generated using in cell culture supernatants were measured using a multi- fliC-deficient E. coli. target Bio-Plex Assay (Bio-Rad) that included TNF-α, IL-1β, Additional comparisons were made of cells treated with IL-6, mouse keratinocyte-derived chemokine (KC; chosen purified FliC at the pre- and post-endotoxin removal stages as a functional equivalent of human IL-8), IL-12(p40),

Frontiers in Cellular and Infection Microbiology | www.frontiersin.org 6 April 2019 | Volume 9 | Article 118 Acharya et al. Puriﬁcation of UPEC FliC and IL-12(p70), which was performed according to the manufacturer’s instructions.

Statistics Numbers of c.f.u. in suspension cultures are reported as mean ± SEM and were compared using students t-test. Kruskal- Wallis ANOVA and Dunn’s multiple comparisons were used to analyze the cytokine levels in macrophage stimulation assays because some data did not satisfy Gaussian distribution and/or normality assumptions. The statistical analyses were performed using Graph Pad Prism v8.0 and SPSS Statistical software package v21. Statistical signiﬁcance was accepted at p ≤ 0.05.

RESULTS FliC in Protein Preparations From UPEC CFT073 and MC4100 We initially assessed the yield and relative purity of FliC in extracts from whole cell lysates and flagella-enriched protein preparations generated by physical shearing, filtration and ultracentrifugation. Western blot analysis of whole cell lysates prepared from UPEC CFT073 and MC4100 (grown in liquid media) using anti-flagellin antisera showed no distinct bands for either CFT073 or MC4100 (which has inoperative flhDC) (Barembruch and Hengge, 2007). Introduction of pMG600 (containing the flhDC genes from Serratia) into MC4100 resulted in a band for FliC (∼40 kDa) demonstrating reconstitution of flagella expression in this strain (Figure 2A). Subsequent analysis of protein preparations that were enriched for flagella by physical methods showed a band for CFT073 (∼60 kDa) and a similar reconstitution of flagella expression in MC4100 through the introduction of pflhDC in trans; in addition to a FliC band of expected size (∼40 kDa) in MC4100 pflhDC flagella-enrichment revealed a band of equivalent size compared to CFT073 (∼60 kDa) along with minor bands (Figure 2B). No bands were detected in protein preparations enriched for flagella derived from CFT073fliC (Figure 2B). Whole cell lysates prepared using 0.25% soft agar increased the expression of flagella and revealed a strong band for FliC but notable protein contaminants (Figures 2B,C). The addition of protease inhibitor had negligible effects in terms of proteolysis, as observed in a previous study (Lu et al., 2013). The agitation process in microcentrifuge tubes containing ball bearings had no detectable effect on the viability of E. coli, with 3 independent experiments comparing “pre-” and “post-”agitation cultures exhibiting equivalent numbers of c.f.u. (mean values ± SEM; “pre-” = 2.28 ± 0.1 × 108 c.f.u. mL−1 vs. “post-” 2.24 ± 0.1 × 108 mL−1). Taken together, these data show (i) FliC expression FIGURE 2 | Detection of FliC in whole cell lysate of UPEC CFT073 and is conferred to MC4100 by flhDC supplied in trans, (ii) flagella- MC4100 E. coli. (A) Western blot for FliC using whole cell lysate of CFT073 Wt enrichment produces a predominant population of ∼60 kDa (lane 1), MC4100 (lane 2), and MC4100+pflhDC (lane 3; band ∼40 kDa). Cell (CFT073/pflhDC); and ∼40 kDa (MC4100/pflhDC), and (iii) lysates were derived from bacterial liquid cultures and reacted with liquid culture is superior to soft agar culture to enrich FliC due to anti-flagellin pool H-type antisera. Flagella overexpression in MC4100+pflhDC higher purity, but provides lower overall yield due to less flagella results in FliC detection. (B) Western blot for FliC using protein preparations that were enriched for flagella using physical methods of shearing, filtration expression (even under culture conditions incorporating IPTG to (Continued) induce flhDC expression in CFT073/pflhDC).

Frontiers in Cellular and Infection Microbiology | www.frontiersin.org 7 April 2019 | Volume 9 | Article 118 Acharya et al. Puriﬁcation of UPEC FliC

FIGURE 2 | and ultracentrifugation. Shown: flagella-enriched preparations of CFT073 Wt (lane 1–2; 1.0, and 2.5 µg protein, respectively, bands ∼60 kDa), MC4100 (lane 3; no band), MC4100+pflhDC (4; bands ∼40, ∼60 kDa), CFT073fliC (5; no band), and MC4100+pflhDC whole cell lysate prepared from 0.25% soft agar cultures (6; band ∼40 kDa). (C) Coomassie stained SDS-PAGE gel of the protein samples shown used for Western blot. M, Marker.

Purification of FliC From CFT07314 and Identification of Co-purified Proteins The methods described above achieved a maximum relative purity of FliC of approximately 85% based on densitometric intensities of the major band (FliC) compared to minor contaminating bands observed within Coomassie-stained SDS- PAGE gels and Western blots (data not shown). For FliC to be suitable for immunological assays we sought to attain a higher degree of purity and undertook a genetic approach to further minimize extraneous protein contaminants. To achieve this, we used a multiple mutant strain of CFT073, designated CFT0734 (Wurpel et al., 2014), that contains deletions in genes encoding major surface fimbriae, including type 1, F1C and P fimbriae; this was used for FliC extraction alongside its derivative CFT0734fliC to generate carrier control for further assays. Physical extraction of flagella from CFT0734 improved the relative purity of the FliC extracts to ∼95% according to densitometric analysis of SDS-PAGE gels (Figure 3A). It was vital in these assays to analyze higher amounts of proteins in the gels (up to 12.5 µg) than would typically be analyzed in order to achieve a higher level of sensitivity for the detection of trace protein contamination. We gel-purified the remaining contaminating bands and identified these proteins using mass spectrometry (MS) to assess their potential importance in modifying host-pathogen interactions in downstream assays. MS analysis identified these proteins as major outer membrane proteins OmpA and OmpC, and surface-localized fimbrillin and fimbrial protein (Table 4); these proteins have prominent roles in host-pathogen interactions, including binding to phagocyte scavenger receptors and acting as major immunogens (Jeannin et al., 2005; Liu et al., 2012). Comparing with the protocol for purification of bacterial flagellin described by Smith et al. (2003) we observed a higher yield of protein and contamination with fimbrillin but less extraneous higher molecular weight species FIGURE 3 | Protein profiles of fliC-enriched extracts from CFT0734 (fim using our protocol (Figure 3B). Therefore, we sought additional foc pap1 pap2) and its fliC-deficient derivative. (A) Coomassie stained methods to separate these from FliC, post-purification. SDS-PAGE gel of FliC protein preparations (5 µg) enriched for flagella from CFT073/pflhDC (1), CFT073fliC/pflhDC (2), CFT0734/pflhDC (3), and Post-purification of FliC to Homogeneity CFT0734fliC/pflhDC (4); bands labeled a-e were gel extracted and subsequently analyzed by mass spectrophotometry to identify proteins and Using FPLC and Endotoxin Removal are listed in Table 3. (B) Coomassie stained SDS-PAGE gel of protein samples To generate highly pure FliC, protein extracts purified as (10 µg) prepared using the protocol for purification of bacterial flagellin above using physical processes of shearing, filtration and described by (Smith et al., 2003) (1) compared to the protocol used in the ultracentrifugation were subsequently separated by size exclusion current study (2). Differences in relative amounts of fimbrillin and extraneous higher molecular weight species are shown in the gel. M, Marker. chromatography using an ÄKTA Pure protein purification system with a Superdex 200 Increase 10/300 GL column. The fractions were analyzed by UV absorbance at 215 and 280 nm during elution, and were collected and protein containing 13 with a single peak, as illustrated in Figure 4A. Standard fraction(s) were subsequently concentrated using Ultra Spin UV absorbance settings of 280 nm (used for monitoring columns and analyzed by SDS-PAGE. FliC eluted in fraction proteins in eluted fractions) did not detect FliC due to an

Frontiers in Cellular and Infection Microbiology | www.frontiersin.org 8 April 2019 | Volume 9 | Article 118 Acharya et al. Puriﬁcation of UPEC FliC

TABLE 4 | Identities of co-purified proteins isolated with FliC from CFT0734 and its fliC-deficient derivative using physical processes of shearing, filtration and ultracentrifugation.

Protein Distinct peptides Distinct summed AA C’vg (%) Total protein ProteinMW(Da) Proteinname Species MS/MS search score spectral intensity a 21 302.13 36.5 3.28e+011 51294.1 FliC E. coli b 13 147.11 34.3 2.96e+010 37314.2 Outer membrane protein A E. coli c 19 231.86 43.2 2.17e+010 41224.4 Outer membrane protein C E. coli d 19 328.33 81.2 6.53e+011 19423.4 Fimbrillin E. coli e 10 164.13 76.5 1.31e+011 19298.3 Fimbrial protein E. coli

absence of tryptophan (and few tyrosine residues) in the protein, necessitating the application of the alternative 215 nm wavelength to monitor FliC. Importantly, these experiments demonstrated that FLPC achieved essentially complete removal of all extraneous protein contaminants from the CFT0734 FliC extracts (Figure 4B). The post-purification process was concluded by applying the FliC preparations to endotoxin removal columns, which resulted in average levels of endotoxin in the final preparations of 0.005 ± 0.002 EU.µg−1; well-below the levels reported in previous immune stimulation studies of purified FliC (max. 0.125 EU.µg−1; Braga et al., 2008, 0.025 EU.µg−1 Metcalfe et al., 2010) and FliA (0.011 EU.µg−1; Schulke et al., 2010). Without performing this endotoxin removal step the FliC preparations routinely exhibited concentrations of contaminating endotoxin above 1 EU.µg−1. Together, these data combined with our findings on physical extraction methods establish FLPC-based post-purification and endotoxin removal as an excellent method for the post-purification of non-denatured UPEC FliC to homogeneity, ideally suited for downstream immunological assays.

Characterization of the Heat Stability of FliC Homopolymers The flagellar filament is made up of 11 protofilaments, each comprised of FliC monomers stabilized as homopolymers by subunit hydrophobic interactions (Yonekura et al., 2003). Variation in the stability of flagella filaments between species (Yoon and Mekalanos, 2008) prompted us to characterize the heat stability of CFT073 FliC homopolymers with a goal of generating FliC monomers while minimizing protein denaturation so the purified proteins would be ideally suitable for host-pathogen interaction assays. Experiments performed with temperature gradients demonstrated that a treatment of 60◦C for 10 min generated FliC monomers at an efficiency ◦ approaching 90% (Figure 5). Temperatures above 60 C resulted FIGURE 4 | Protein profile of FliC-enriched extract from CFT0734 (fim in minor increases in efficiency of monomerization whereas at foc pap1 pap2). (A) Chromatogram of FliC from extract of CFT0734. temperatures below 50◦C there was minimal monomerization. (B) SDS-PAGE gel of protein (5 µg) in fraction 13 generated from Therefore, 60◦C was chosen as optimal to enable efficient CFT073 4/pflhDC (1) and CFT073 4 fliC/pflhDC (2) following protein concentration by centrifugal filters. M, Marker. generation of FliC monomers but limit the effects of heat denaturation. We then examined the tendency for monomerized FliC to self-polymerize following this heat treatment; for this, 37◦C for 2, 24, or 48h. Native gel analysis of proteins treated flagellar filaments were incubated at room temperature (RT), in this manner showed no appreciable re-polymerisation of FliC 60◦C or 90◦C; and the proteins were then stored at 4◦C, RT or monomers into filaments after monomers were incubated and

Frontiers in Cellular and Infection Microbiology | www.frontiersin.org 9 April 2019 | Volume 9 | Article 118 Acharya et al. Puriﬁcation of UPEC FliC

FIGURE 5 | Heat-induced momerisation of purified FliC. Native PAGE gel showing dissociation of FliC from polymeric filaments to FliC monomers (A) and relative densitometric quantification of monomers at each temperature FIGURE 6 | Stability of FliC monomers. Approximately 5 µg FliC (10 µl), ◦ tested (B). diluted in native gel buffer were incubated at room temperature (RT), 60 C or 90◦C; the proteins were then stored at 4◦C, RT or 37◦C for 2h (A), 24h (B) and 48 h (C) and subsequently resolved in native gels. The images show no ◦ ◦ appreciable re-polymerisation into flagella filaments of FliC that was incubated stored at 4 C. In contrast, FliC stored at RT or 37 C for 24 h or and stored at 4◦C. In contrast, FliC stored at RT or 37◦C for 24h or more, more, exhibited some re-polymerisation (Figure 6). We conclude exhibited some re-polymerisation apparent as two major bands (instead of a from these data that UPEC FliC monomers are relatively stable single band) in the images (B) and (C). as monomers for at least 2 h following de-polymerization at 60◦C for 10 min but incubation of monomers at higher temperatures and/or for longer periods of time leads to some degree of self-re- either the carrier control (i.e., extracts from GU2642) or culture polymerisation. media only control (Figure 7). We did not observe significant levels of other cytokines that have not previously been associated Cytokine Response of Macrophages to with flagella, such as G-CSF and GM-CSF (data not shown) and Highly Purified FliC also did not detect significant levels of IFN-γ that has previously To assess the immunological activity of FliC purified to been associated with cellular responses to flagella (Wyant et al., homogeneity, we next applied pure FliC to macrophage 1999). Investigation of the effect of endotoxin removal on stimulation assays in vitro. Exposure of murine J774A.1 macrophage responses demonstrated higher levels of several macrophages to 1 µg of FliC for 5 h led to significantly increased cytokines in cultures that were stimulated with purified FliC production of TNF-α, IL-1β, IL-6, KC, IL-12(p40) and IL-12(p70) that was not treated for endotoxin removal (“pre-”) compared to (Figure 7), We generated a suitable carrier control for these FliC that was treated for endotoxin removal (“post-”) (Figure 8). experiments by preparing extracts from a fliC derivative of Comparison of the responses of macrophages to different CFT0734 (GU2642), which were processed in an identical amounts of FliC showed that amounts of FliC <1 µg also manner to the FliC preparation above. In comparison to triggered significant production of several cytokines; for example, stimulation with FliC, there were no significant levels of any of 0.05 µg FliC induced significant production of TNF-α compared these cytokines in cultures of macrophages that were exposed to to control cultures that were treated with carrier alone (Figure 8).

Frontiers in Cellular and Infection Microbiology | www.frontiersin.org 10 April 2019 | Volume 9 | Article 118 Acharya et al. Puriﬁcation of UPEC FliC

FIGURE 7 | Cytokine response of macrophages to FliC puriﬁed to homogeneity from UPEC CFT0734. J774A.1 macrophages were stimulated with 1 µg of FliC for 5 h and supernatants were used to measure the levels of TNF-α, IL-1β, IL-6, KC (chosen as a functional equivalent of human IL-8), IL-12(p40), and IL-12(p70). FliC induced higher concentrations of these cytokines compared to Carrier control (prepared from GU2642 using identical puriﬁcation procedures) or Media only control.

In separate assays using human U937 monocytes and 5,637 et al., 1999; Gomez-Gomez and Boller, 2000; Eaves-Pyles et al., epithelial cells we observed similar significant responses for 2001). In the context of host-pathogen interaction experiments, TNF-α, IL-1β, and IL-6 but no significant responses for IL-8 FliC applied to in vivo or in vitro models ideally should be or IL-12(p70) (data not shown). Taken together, these findings highly purified by techniques that avoid protein denaturation show that macrophage proinflammatory cytokine responses as or degradation and endotoxin contamination that can make observed in this study are directly attributable to FliC and are interpreting experimental data difficult or impossible. It is likely consistent with prior reports of immune stimulation properties that many studies have analyzed FliC preparations that are of flagella. partially degraded, misfolded or contaminated with endotoxin or extraneous proteins as a result of limitations of extraction and DISCUSSION purification methods. This is especially important for immune assays where experimental models are intended to provide Flagellin has been studied as a trigger of immune defense in insights into natural infection and therefore must parallel the a various hosts, including humans, animals and plants (Wyant natural interactive processes and native forms of protein as

Frontiers in Cellular and Infection Microbiology | www.frontiersin.org 11 April 2019 | Volume 9 | Article 118 Acharya et al. Puriﬁcation of UPEC FliC

FIGURE 8 | Cytokine response of macrophages to FliC purified to stages of the protocol designated pre- and post-endotoxin removal. J774A.1 macrophages were stimulated with 0.05-1 µg of FliC that had not been treated for endotoxin removal (“pre-“) vs. treated for endotoxin removal (“post-“) for 5 h and supernatants were used to measure the levels of TNF-α and IL-6. *P<0.05; ****P<0.0001. closely as possible. Despite notable increases in the numbers of of the protein to the exchanger, and no requirement for organic studies of FliC as an immune modulator in recent years, few solvents or pH changes for elution; treatments such as these advances in the methods used for FliC purification have been adversely affect protein integrity (Chang et al., 2013) and reported in four decades (Ibrahim et al., 1985). In this study, were therefore avoided in this study. Several studies from the we establish a method to purify FliC from UPEC which offers 1970’s demonstrate that chemically modified flagellin exhibits advantages of rapid time to purification (1-day), a high yield for altered immunogenic properties (Parish, 1971a,b; Venning, purification of bacterial flagellin and generation of a FliC purified 1975). Chromatographically purified proteins are typically highly to homogeneity suited to immune assay. purified and can be free from endotoxin. It is notable, however, Our initial approach of extracting flagellar filaments from that in our study, endotoxin removal subsequent to FPLC was UPEC by physical shearing methods followed by filtration and essential because appreciable endotoxin was eluted with protein ultracentrifugation yielded FliC as the predominant protein. fractions and caused the production of much higher levels of Several extraneous minor proteins were also present in these multiple cytokines (e.g., TNF-α, IL-6) in macrophages compared FliC extracts and identification of these as having potential to cytokine responses of macrophages exposed to FliC in the to impact host-pathogen interaction studies dictated a further absence of contaminating endotoxin. This stage in the protocol purification approach. Our approach was to further-purify led to substantial loss of protein; however, effective removal FliC using FPLC-mediated size exclusion chromatography, of endotoxin to levels considered acceptable for immunological followed by concentration of the protein and subsequent assays circumvented the responses to endotoxin and enabled removal of residual endotoxin. Prior studies have applied the study of native highly purified FliC. Comparing to prior chromatographic approaches for isolation of flagellin, such as literature, we consider the FliC applied in the current study to ion exchange (Martinez, 1963) and sequential cation/anion be among the most highly purified and useful reported to date in exchange (Simonsen et al., 2014). However, to our knowledge, the context of immune study. the current study is the first to exploit size exclusion (gel To our knowledge, the current study is the first study to filtration) chromatography to purify bacterial flagellin. In the describe the heat stability of flagellar filaments purified from context of protein purification for downstream immune assays, UPEC. In avoiding acid and other chemical denaturation steps size exclusion offers benefits including a lack of covalent binding for FliC purification, this study identifies 60◦C as an ideal

Frontiers in Cellular and Infection Microbiology | www.frontiersin.org 12 April 2019 | Volume 9 | Article 118 Acharya et al. Purification of UPEC FliC temperature with which to monomerize UPEC flagellar filament. of innate immune responses, including NF-κβ, TLR5, and This treatment would avoid denaturation due to acid (Chang host antimicrobial peptides following exposure to this level of et al., 2013) and higher temperatures that can cause irreversible FliC (Smith et al., 2003; Faber et al., 2018; Mowbray et al., denaturation (Matsuura et al., 2015). Our finding that UPEC 2018). We note that our use of a fliC mutant in these assays FliC monomers are stable as monomers for at least 2 h following reflects a crucial control to conclude that the proinflammatory de-polymerization is important to validate the use of FliC as responses induced by FliC are not an artifact secondary to monomers in downstream cell stimulation assays; in such assays, LPS contamination, which is an important consideration in time periods of <2h are realistic in a logistic workflow sense. studies of this type (Eaves-Pyles et al., 2001). We also point out The finding that incubation of UPEC FliC monomers at higher that our expression system is based on Serratia flhDC, which temperatures and for longer periods of time leads to some may be a limitation to our study given a recent observation degree of self-re-polymerisation will require future work to that heterologous expression of regulators that control flagella elucidate the nature of this polymerization. Comparing to other expression systems may not behave in exactly the same bacteria, the filaments of Salmonella serovar Typhimurium and manner, even in systems that show significant synteny (Albanna Vibrio cholerae are completely disassociated into monomers by et al., 2018). In the broader content of bacterial pathogenesis, heating at 80◦C for 15 min; the former but not the latter is Salmonella flagella, which occur with two antigenically distinct disassociated by lower temperatures down to 50◦C (Yoon and forms of flagellin, FliC and FljB (Eom et al., 2013), induce Mekalanos, 2008). In another study, Salmonella flagella were proinflammatory responses that encompass TNF-α, IL-1β, and depolymerized at temperatures as low as 37◦C with mild acid IL-6 in human cells and mice (Ciacci-Woolwine et al., 1997; treatment, whereas Lactobacillus agilis flagella were reported to Mcdermott et al., 2000; Moors et al., 2001) and that appear require 57◦C and stronger acid treatment to achieve monomers. to be independent of different flagellin variants (Horstmann It is also possible that fliC allelic variants may react differently et al., 2017). Listeria flagella also induce TNF-α in mouse in these kinds of dissociation assays. Jointly, however, these data macrophages and systemic IL-6 in vivo (Hayashi et al., 2001). can be used to infer that flagellar filaments of some bacteria These cytokines are key parts of disease pathogenesis during are more resistant to thermal and/or acidic conditions than infection and our observations of UPEC FliC are fundamentally others (Kajikawa et al., 2016). consistent with previous reports of innate immune responses In many previous studies, bacterial flagella filaments are to flagella. Mechanistically, it is well-established that FliC is typically depolymerized into monomers either by heating at 60◦C a TLR5 agonist, and through recognition by this receptor, for 10 min or by acid treatment (pH < 2.5). Self-polymerization FliC activates varied immune responses; this mechanism is the through the addition of short filaments as seeds can occur and basis of novel approaches to disease treatment and prevention lead to re-polymerization of filament; however, precipitation, such as a potential target for vaccine adjuvant and anti-tumor such as with ammonium sulfate has been used by many studies strategies (Ciacci-Woolwine et al., 1997; Wyant et al., 1999; to achieve efficient isolation of flagella filaments (Asakura, 1970). Mcdermott et al., 2000; Hayashi et al., 2001; Hajam et al., Analysis of some heat treatment protocols have led to suggestions 2017). A recent study identified flagellin functioning via the that acid treatment for monomerization may be preferred for TLR5/NFkappaB pathway as a key UPEC virulence factor the maintenance of structural identity (Simonsen et al., 2014); responsible for increased production of host-defense peptides, however, acidic conditions (pH 3.6–4.4) as reported for the such as BD2, which mediate protection of urogenital tissues from generation of FliC monomers (Yoon and Mekalanos, 2008) can infection (Ali et al., 2017). also cause protein denaturation (Fink et al., 1994). We sought In summary, we report a new method for physical extraction to identify the most mild heat treatment at which UPEC flagella and chromatographical purification of flagella filament from filaments could be dissociated into monomers for immune assay UPEC. The purification of flagellin using this method will be given that TLR5 recognizes FliC in the context of monomers particularly suited for immunological assays. Future studies but not flagellar filament (Smith et al., 2003); the requirement of UPEC FliC purified to homogeneity using the methods for dissociation of flagellar filament into FliC monomers for described herein will provide new insight into the biology of cellular recognition might involve phagocytic acidification of the this bacterial structure and will be especially useful to give a local cellular environment and/or cellular translocation of whole more complete understanding of the immunological implications bacteria predicted to lead to depolymerization and thus afford of exposure to UPEC flagella in the context of infection recognition by TLR5. and disease. In applying highly purified CFT073 FliC to a host-pathogen interaction assay, we exposed mouse macrophages as well as human monocytes and epithelial cells, to the protein. Several AUTHOR CONTRIBUTIONS proinflammatory cytokines, including TNF-α, IL-1β, IL-6, KC, and IL-12 were induced in response to the purified FliC in a DA, MJS, TE and BD performed the experiments. DA, manner consistent with previous literature (Wyant et al., 1999; MJS, and BD contributed to drafting of the manuscript Eaves-Pyles et al., 2001; Hayashi et al., 2001; Moors et al., and figures. MAS and GU provided expert input, 2001; Kinnebrew et al., 2012). We also observed significant analyzed the data, and contributed to the drafting of responses to lower doses of FliC (e.g., 0.05 µg), a finding the manuscript. All authors contributed to final editing consistent with prior studies that have reported activation and revisions.

Frontiers in Cellular and Infection Microbiology | www.frontiersin.org 13 April 2019 | Volume 9 | Article 118 Acharya et al. Puriﬁcation of UPEC FliC

FUNDING ACKNOWLEDGMENTS

This work was funded by the National Medical Research Council We thank Dean Gosling and Lahiru Katupitiya for excellent (NHMRC; Australia) under grant number APP1084889. technical assistance.

REFERENCES and diversification in intestinal pathogen recognition. Sci. Rep. 8:11287. doi: 10.1038/s41598-018-29371-0 Albanna, A., Sim, M., Hoskisson, P. A., Gillespie, C., Rao, C. V., and Aldridge, Fink, A. L., Calciano, L. J., Goto, Y., Kurotsu, T., and Palleros, D. R. (1994). P. D. (2018). Driving the expression of the Salmonella enterica sv Typhimurium Classification of acid denaturation of proteins: intermediates and unfolded flagellum using flhDC from Escherichia coli results in key regulatory and cellular states. Biochemistry 33, 12504–12511. differences. Sci. Rep. 8:16705. doi: 10.1038/s41598-018-35005-2 Gerhardt, P. (1994). Methods for General and Molecular Bacteriology. Washington, Ali, A. S. M., Mowbray, C., Lanz, M., Stanton, A., Bowen, S., Varley, C. DC: American Society for Microbiology. L., et al. (2017). Targeting deficiencies in the TLR5 mediated vaginal Gewirtz, A. T. (2006). Flag in the crossroads: flagellin modulates response to treat female recurrent urinary tract infection. Sci. Rep. 7:11039. innate and adaptive immunity. Curr. Opin. Gastroenterol. 22, 8–12. doi: 10.1038/s41598-017-10445-4 doi: 10.1097/01.mog.0000194791.59337.28 Asakura, S. (1970). Polymerization of flagellin and polymorphism of flagella. Adv. Giron, J. A., Torres, A. G., Freer, E., and Kaper, J. B. (2002). The flagella of Biophys. 1, 99–155. enteropathogenic Escherichia coli mediate adherence to epithelial cells. Mol. Barembruch, C., and Hengge, R. (2007). Cellular levels and activity of the Microbiol. 44, 361–379. doi: 10.1046/j.1365-2958.2002.02899.x flagellar sigma factor FliA of Escherichia coli are controlled by FlgM-modulated Givskov, M., Eberl, L., Christiansen, G., Benedik, M. J., and Molin, S. (1995). proteolysis. Mol. Microbiol. 65, 76–89. doi: 10.1111/j.1365-2958.2007.05770.x Induction of phospholipase- and flagellar synthesis in Serratia liquefaciens is Braga, C. J., Massis, L. M., Alencar, B. C., Rodrigues, M. M., Sbrogio- controlled by expression of the flagellar master operon flhD. Mol. Microbiol. Almeida, M. E., and Ferreira, L. C. (2008). Cytotoxic T cell adjuvant 15, 445–454. effects of three Salmonella enterica flagellins. Brazil. J. Microbiol. 39, 44–49. Gomez-Gomez, L., and Boller, T. (2000). FLS2: an LRR receptor-like kinase doi: 10.1590/S1517-838220080001000011 involved in the perception of the bacterial elicitor flagellin in Arabidopsis. Mol. Chaban, B., Hughes, H. V., and Beeby, M. (2015). The flagellum in bacterial Cell 5, 1003–1011. doi: 10.1016/S1097-2765(00)80265-8 pathogens: For motility and a whole lot more. Semin. Cell Dev. Biol. 46, 91–103. Gorbet, M. B., and Sefton, M. V. (2005). Endotoxin: the uninvited guest. doi: 10.1016/j.semcdb.2015.10.032 Biomaterials 26, 6811–6817. doi: 10.1016/j.biomaterials.2005.04.063 Chang, K. C., Cheng, S. J., Chen, Y. C., Huang, H. R., and Liou, J. W. Haiko, J., and Westerlund-Wikstrom, B. (2013). The role of the bacterial flagellum (2013). Nanoscopic analysis on pH induced morphological changes of in adhesion and virulence. Biology 2, 1242–1267. doi: 10.3390/biology2041242 flagella in Escherichia coli. J. Microbiol. Immunol. Infect. 46, 405–412. Hajam, I. A., Dar, P. A., Shahnawaz, I., Jaume, J. C., and Lee, J. H. (2017). doi: 10.1016/j.jmii.2012.08.004 Bacterial flagellin-a potent immunomodulatory agent. Exp. Mol. Med. 49:e373. Chilcott, G. S., and Hughes, K. T. (2000). Coupling of flagellar gene doi: 10.1038/emm.2017.172 expression to flagellar assembly in Salmonella enterica serovar Hayashi, F., Smith, K. D., Ozinsky, A., Hawn, T. R., Yi, E. C., Goodlett, D. R., typhimurium and Escherichia coli. Microbiol. Mol. Biol. Rev. 64, 694–708. et al. (2001). The innate immune response to bacterial flagellin is mediated by doi: 10.1128/MMBR.64.4.694-708.2000 Toll-like receptor 5. Nature 410, 1099–1103. doi: 10.1038/35074106 Ciacci-Woolwine, F., Kucera, L. S., Richardson, S. H., Iyer, N. P., and Mizel, S. Horstmann, J. A., Zschieschang, E., Truschel, T., De Diego, J., Lunelli, M., B. (1997). Salmonellae activate tumor necrosis factor alpha production in a Rohde, M., et al. (2017). Flagellin phase-dependent swimming on epithelial cell human promonocytic cell line via a released polypeptide. Infect. Immunity 65, surfaces contributes to productive Salmonella gut colonisation. Cell. Microbiol. 4624–4633. 19:e12739. doi: 10.1111/cmi.12739 Cullender, T. C., Chassaing, B., Janzon, A., Kumar, K., Muller, C. E., Werner, Hung, C., Zhou, Y., Pinkner, J. S., Dodson, K. W., Crowley, J. R., Heuser, J., et al. J. J., et al. (2013). Innate and adaptive immunity interact to quench (2013). Escherichia coli biofilms have an organized and complex extracellular microbiome flagellar motility in the gut. Cell Host Microbe 14, 571–581. matrix structure. MBio 4, e00645–e00613. doi: 10.1128/mBio.00645-13 doi: 10.1016/j.chom.2013.10.009 Ibrahim, G. F., Fleet, G. H., Lyons, M. J., and Walker, R. A. (1985). Method Datsenko, K. A., and Wanner, B. L. (2000). One-step inactivation of chromosomal for the isolation of highly purified Salmonella flagellins. J. Clin. Microbiol. 22, genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U.S. A. 1040–1044. 97, 6640–6645. doi: 10.1073/pnas.120163297 Iino, T., Komeda, Y., Kutsukake, K., Macnab, R. M., Matsumura, P., Parkinson, J. Depamphilis, M. L., and Adler, J. (1971). Purification of intact flagella from S., et al. (1988). New unified nomenclature for the flagellar genes of Escherichia Escherichia coli and Bacillus subtilis. J. Bacteriol. 105, 376–383. coli and Salmonella typhimurium. Microbiol. Rev. 52, 533–535. Duan, Q., Zhou, M., Zhu, L., and Zhu, G. (2013). Flagella and bacterial Jeannin, P., Bottazzi, B., Sironi, M., Doni, A., Rusnati, M., Presta, M., et al. (2005). pathogenicity. J. Basic Microbiol. 53, 1–8. doi: 10.1002/jobm.201100335 Complexity and complementarity of outer membrane protein A recognition Eaves-Pyles, T., Murthy, K., Liaudet, L., Virag, L., Ross, G., Soriano, F. G., et al. by cellular and humoral innate immunity receptors. Immunity 22, 551–560. (2001). Flagellin, a novel mediator of Salmonella-induced epithelial activation doi: 10.1016/j.immuni.2005.03.008 and systemic inflammation: I kappa B alpha degradation, induction of nitric Kajikawa, A., Midorikawa, E., Masuda, K., Kondo, K., Irisawa, T., Igimi, S., et al. oxide synthase, induction of proinflammatory mediators, and cardiovascular (2016). Characterization of flagellins isolated from a highly motile strain of dysfunction. J. Immunol. 166, 1248–1260. doi: 10.4049/jimmunol.166.2.1248 Lactobacillus agilis. BMC Microbiol. 16:49. doi: 10.1186/s12866-016-0667-x Eom, J. S., Seok Kim, J., Im Jang, J., Kim, B. H., Young Yoo, S., Hyeon Choi, Kakkanat, A., Totsika, M., Schaale, K., Duell, B. L., Lo, A. W., Phan, M. D., et al. J., et al. (2013). Enhancement of host immune responses by oral vaccination (2015). The role of H4 flagella in Escherichia coli ST131 virulence. Sci. Rep. to Salmonella enterica serovar Typhimurium harboring both FliC and FljB 5:16149. doi: 10.1038/srep16149 flagella. PLoS ONE 8:e74850. doi: 10.1371/journal.pone.0074850 Kalmokoff, M. L., Jarrell, K. F., and Koval, S. F. (1988). Isolation of flagella from the Erdem, A. L., Avelino, F., Xicohtencatl-Cortes, J., and Giron, J. A. (2007). Host archaebacterium Methanococcus voltae by phase separation with Triton X-114. protein binding and adhesive properties of H6 and H7 flagella of attaching J. Bacteriol. 170, 1752–1758. and effacing Escherichia coli. J. Bacteriol. 189, 7426–7435. doi: 10.1128/jb.00 Kinnebrew, M. A., Buffie, C. G., Diehl, G. E., Zenewicz, L. A., Leiner, I., Hohl, T. 464-07 M., et al. (2012). Interleukin 23 production by intestinal CD103(+)CD11b(+) Faber, E., Tedin, K., Speidel, Y., Brinkmann, M. M., and Josenhans, C. dendritic cells in response to bacterial flagellin enhances mucosal innate (2018). Functional expression of TLR5 of different vertebrate species immune defense. Immunity 36, 276–287. doi: 10.1016/j.immuni.2011.12.011

Frontiers in Cellular and Infection Microbiology | www.frontiersin.org 14 April 2019 | Volume 9 | Article 118 Acharya et al. Puriﬁcation of UPEC FliC

Kutsukake, K., Iino, T., Komeda, Y., and Yamaguchi, S. (1980). Functional Parish, C. R. (1971b). Immune response to chemically modified flagellin. II. homology of fla genes between Salmonella typhimurium and Escherichia coli. Evidence for a fundamental relationship between humoral and cell-mediated Mol. General Genet. 178, 59–67. immunity. J. Exp. Med. 134, 21–47. La Ragione, R. M., Sayers, A. R., and Woodward, M. J. (2000). The role of fimbriae Parthasarathy, G., Yao, Y., and Kim, K. S. (2007). Flagella promote Escherichia coli and flagella in the colonization, invasion and persistence of Escherichia coli K1 association with and invasion of human brain microvascular endothelial O78:K80 in the day-old-chick model. Epidemiol. Infect. 124, 351–363. cells. Infect. Immunity 75, 2937–2945. doi: 10.1128/IAI.01543-06 Lane, M. C., Alteri, C. J., Smith, S. N., and Mobley, H. L. (2007). Expression Peters, J. E., Thate, T. E., and Craig, N. L. (2003). Definition of the Escherichia of flagella is coincident with uropathogenic Escherichia coli ascension to coli MC4100 genome by use of a DNA array. J. Bacteriol. 185, 2017–2021. the upper urinary tract. Proc. Natl. Acad. Sci. U.S.A. 104, 16669–16674. doi: 10.1128/JB.185.6.2017-2021.2003 doi: 10.1073/pnas.0607898104 Petsch, D., and Anspach, F. B. (2000). Endotoxin removal from protein solutions. Lane, M. C., Lockatell, V., Monterosso, G., Lamphier, D., Weinert, J., Hebel, J. Biotechnol. 76, 97–119. doi: 10.1016/S0168-1656(99)00185-6 J. R., et al. (2005). Role of motility in the colonization of uropathogenic Pichon, C., Hechard, C., Du Merle, L., Chaudray, C., Bonne, I., Guadagnini, Escherichia coli in the urinary tract. Infect. Immunity 73, 7644–7656. S., et al. (2009). Uropathogenic Escherichia coli AL511 requires flagellum doi: 10.1128/IAI.73.11.7644-7656.2005 to enter renal collecting duct cells. Cell. Microbiol. 11, 616–628. Liu, Y. F., Yan, J. J., Lei, H. Y., Teng, C. H., Wang, M. C., Tseng, C. C., et al. doi: 10.1111/j.1462-5822.2008.01278.x (2012). Loss of outer membrane protein C in Escherichia coli contributes to both Ramos, H. C., Rumbo, M., and Sirard, J. C. (2004). Bacterial flagellins: mediators antibiotic resistance and escaping antibody-dependent bactericidal activity. of pathogenicity and host immune responses in mucosa. Trends Microbiol. 12, Infect. Immunity 80, 1815–1822. doi: 10.1128/IAI.06395-11 509–517. doi: 10.1016/j.tim.2004.09.002 Lu, Y., Welsh, J. P., Chan, W., and Swartz, J. R. (2013). Escherichia coli-based cell Ratiner, Y. A. (1998). New flagellin-specifying genes in some Escherichia coli free production of flagellin and ordered flagellin display on virus-like particles. strains. J. Bacteriol. 180, 979–984. Biotechnol. Bioeng. 110, 2073–2085. doi: 10.1002/bit.24903 Reid, S. D., Selander, R. K., and Whittam, T. S. (1999). Sequence diversity of Mahajan, A., Currie, C. G., Mackie, S., Tree, J., Mcateer, S., Mckendrick, I., et al. flagellin (fliC) alleles in pathogenic Escherichia coli. J. Bacteriol. 181, 153–160. (2009). An investigation of the expression and adhesin function of H7 flagella in Rogers, T. J., Thorpe, C. M., Paton, A. W., and Paton, J. C. (2012). Role of lipid rafts the interaction of Escherichia coli O157: H7 with bovine intestinal epithelium. and flagellin in invasion of colonic epithelial cells by Shiga-toxigenic Escherichia Cell. Microbiol. 11, 121–137. doi: 10.1111/j.1462-5822.2008.01244.x coli O113:H21. Infect. Immunity 80, 2858–2867. doi: 10.1128/IAI.00336-12 Martinez, R. J. (1963). A method for the purification of bacterial flagella Rossez, Y., Wolfson, E. B., Holmes, A., Gally, D. L., and Holden, N. J. (2015). by ion exchange chromatography. J. General Microbiol. 33, 115–120. Bacterial flagella: twist and stick, or dodge across the kingdoms. PLoS Pathog. doi: 10.1099/00221287-33-1-115 11:e1004483. doi: 10.1371/journal.ppat.1004483 Matsuura, Y., Takehira, M., Joti, Y., Ogasahara, K., Tanaka, T., Ono, N., et al. Roy, K., Hilliard, G. M., Hamilton, D. J., Luo, J., Ostmann, M. M., and Fleckenstein, (2015). Thermodynamics of protein denaturation at temperatures over 100 J. M. (2009). Enterotoxigenic Escherichia coli EtpA mediates adhesion between degrees C: CutA1 mutant proteins substituted with hydrophobic and charged flagella and host cells. Nature 457, 594–598. doi: 10.1038/nature07568 residues. Sci. Rep. 5:15545. doi: 10.1038/srep15545 Samatey, F. A., Imada, K., Nagashima, S., Vonderviszt, F., Kumasaka, T., Mcdermott, P. F., Ciacci-Woolwine, F., Snipes, J. A., and Mizel, S. B. (2000). Yamamoto, M., et al. (2001). Structure of the bacterial flagellar protofilament High-affinity interaction between gram-negative flagellin and a cell surface and implications for a switch for supercoiling. Nature 410, 331–337. polypeptide results in human monocyte activation. Infect. Immunity 68, doi: 10.1038/35066504 5525–5529. doi: 10.1128/IAI.68.10.5525-5529.2000 Schulke, S., Waibler, Z., Mende, M. S., Zoccatelli, G., Vieths, S., Toda, M., et al. Mcquiston, J. R., Fields, P. I., Tauxe, R. V., and Logsdon, J. M. Jr. (2010). Fusion protein of TLR5-ligand and allergen potentiates activation (2008). Do Salmonella carry spare tyres? Trends Microbiol. 16, 142–148. and IL-10 secretion in murine myeloid DC. Mol. Immunol. 48, 341–350. doi: 10.1016/j.tim.2008.01.009 doi: 10.1016/j.molimm.2010.07.006 Metcalfe, H. J., Best, A., Kanellos, T., La Ragione, R. M., and Werling, Schwarz, H., Schmittner, M., Duschl, A., and Horejs-Hoeck, J. (2014). D. (2010). Flagellin expression enhances Salmonella accumulation Residual endotoxin contaminations in recombinant proteins are in TLR5-positive macrophages. Dev. Compar. Immunol. 34, 797–804. sufficient to activate human CD1c+ dendritic cells. PLoS ONE 9:e113840. doi: 10.1016/j.dci.2010.02.008 doi: 10.1371/journal.pone.0113840 Miao, E. A., Andersen-Nissen, E., Warren, S. E., and Aderem, A. (2007). TLR5 and Silverman, M., and Simon, M. (1974). Characterization of Escherichia coli Ipaf: dual sensors of bacterial flagellin in the innate immune system. Semin. flagellar mutants that are insensitive to catabolite repression. J. Bacteriol. 120, Immunopathol. 29, 275–288. doi: 10.1007/s00281-007-0078-z 1196–1203. Minamino, T., and Imada, K. (2015). The bacterial flagellar motor and its Sim, M., Koirala, S., Picton, D., Strahl, H., Hoskisson, P. A., Rao, C. V., et al. (2017). structural diversity. Trends Microbiol. 23, 267–274. doi: 10.1016/j.tim.2014. Growth rate control of flagellar assembly in Escherichia coli strain RP437. Sci. 12.011 Rep. 7:41189. doi: 10.1038/srep41189 Mobley, H. L., Green, D. M., Trifillis, A. L., Johnson, D. E., Chippendale, G. R., Simonsen, K. A., Anderson-Berry, A. L., Delair, S. F., and Davies, H. Lockatell, C. V., et al. (1990). Pyelonephritogenic Escherichia coli and killing D. (2014). Early-onset neonatal sepsis. Clin. Microbiol. Rev. 27, 21–47. of cultured human renal proximal tubular epithelial cells: role of hemolysin in doi: 10.1128/CMR.00031-13 some strains. Infect. Immunity 58, 1281–1289. Smith, K. D., Andersen-Nissen, E., Hayashi, F., Strobe, K., Bergman, M. A., Barrett, Moors, M. A., Li, L., and Mizel, S. B. (2001). Activation of interleukin-1 receptor- S. L., et al. (2003). Toll-like receptor 5 recognizes a conserved site on flagellin associated kinase by gram-negative flagellin. Infect. Immunity 69, 4424–4429. required for protofilament formation and bacterial motility. Nat. Immunol. 4, doi: 10.1128/IAI.69.7.4424-4429.2001 1247–1253. doi: 10.1038/ni1011 Mowbray, C. A., Shams, S., Chung, G., Stanton, A., Aldridge, P., Suchenko, A., Tahoun, A., Jensen, K., Corripio-Miyar, Y., Mcateer, S. P., Corbishley, A., Mahajan, et al. (2018). High molecular weight hyaluronic acid: a two-pronged protectant A., et al. (2015). Functional analysis of bovine TLR5 and association with IgA against infection of the urogenital tract? Clin. Transl. Immunol. 7:e1021. responses of cattle following systemic immunisation with H7 flagella. Vet. Res. doi: 10.1002/cti2.1021 46:9. doi: 10.1186/s13567-014-0135-2 Orskov, F., and Orskov, I. (1992). Escherichia coli serotyping and disease in man Terashima, H., Kojima, S., and Homma, M. (2008). Flagellar motility in bacteria and animals. Can. J. Microbiol. 38, 699–704. structure and function of flagellar motor. Int. Rev. Cell Mol. Biol. 270, 39–85. Pallen, M. J., and Matzke, N. J. (2006). From The Origin of Species to the doi: 10.1016/s1937-6448(08)01402-0 origin of bacterial flagella. Nat. Rev. Microbiol. 4, 784–790. doi: 10.1038/ Venning, M. M. (1975). The effect of chemical modification of flagellin on its nrmicro1493 subsequent immunogenicity. Immunochemistry 12, 365–372. Parish, C. R. (1971a). Immune response to chemically modified flagellin. I. Wang, L., Rothemund, D., Curd, H., and Reeves, P. R. (2003). Species-wide Induction of antibody tolerance to flagellin by acetoacetylated derivatives of the variation in the Escherichia coli flagellin (H-antigen) gene. J. Bacteriol. 185, protein. J. Exp. Med. 134, 1–20. 2936–2943.

Frontiers in Cellular and Infection Microbiology | www.frontiersin.org 15 April 2019 | Volume 9 | Article 118 Acharya et al. Puriﬁcation of UPEC FliC

Wright, K. J., Seed, P. C., and Hultgren, S. J. (2005). Uropathogenic immunity. Infect. Immunity 76, 1282–1288. doi: 10.1128/IAI.0 Escherichia coli flagella aid in efficient urinary tract colonization. 0736-07 Infect. Immunity 73, 7657–7668. doi: 10.1128/IAI.73.11.7657-7668. Zhou, M., Yang, Y., Chen, P., Hu, H., Hardwidge, P. R., and Zhu, G. (2015). 2005 More than a locomotive organelle: flagella in Escherichia coli. Appl. Microbiol. Wurpel, D. J., Totsika, M., Allsopp, L. P., Hartley-Tassell, L. E., Day, C. Biotechnol. 99, 8883–8890. doi: 10.1007/s00253-015-6946-x J., Peters, K. M., et al. (2014). F9 fimbriae of uropathogenic Escherichia coli are expressed at low temperature and recognise Galbeta1-3GlcNAc- Conflict of Interest Statement: The authors declare that the research was containing glycans. PLoS ONE 9:e93177. doi: 10.1371/journal.pone.00 conducted in the absence of any commercial or financial relationships that could 93177 be construed as a potential conflict of interest. Wyant, T. L., Tanner, M. K., and Sztein, M. B. (1999). Salmonella typhi flagella are potent inducers of proinflammatory cytokine secretion by human monocytes. Copyright © 2019 Acharya, Sullivan, Duell, Eveno, Schembri and Ulett. This is an Infect. Immunity 67, 3619–3624. open-access article distributed under the terms of the Creative Commons Attribution Yonekura, K., Maki-Yonekura, S., and Namba, K. (2003). Complete atomic model License (CC BY). The use, distribution or reproduction in other forums is permitted, of the bacterial flagellar filament by electron cryomicroscopy. Nature 424, provided the original author(s) and the copyright owner(s) are credited and that the 643–650. doi: 10.1038/nature01830 original publication in this journal is cited, in accordance with accepted academic Yoon, S. S., and Mekalanos, J. J. (2008). Decreased potency of practice. No use, distribution or reproduction is permitted which does not comply the Vibrio cholerae sheathed flagellum to trigger host innate with these terms.

Frontiers in Cellular and Infection Microbiology | www.frontiersin.org 16 April 2019 | Volume 9 | Article 118 Appendix 4

Published paper

D. Acharya, M. J. Sullivan, B. L. Duell, K. G. K. Goh, L. Katupitiya, D. Gosling, M. N. Chamoun, A. Kakkanat, D. Chattopadhyay, M. Crowley, D. K. Crossman,

M. A. Schembri, G. C. Ulett. Rapid bladder IL-10 synthesis in response to

uropathogenic Escherichia coli is part of a defence strategy that is triggered by the major

bacterial flagella filament FliC and contingent on TLR5. mSphere. 2019 Nov 27;4(6). pii: e00545-19. doi: 10.1128/mSphere.00545-19.

The contributions of author’s to this publication were:

(Signed) ______(Date)______

Dhruba Acharya

(Countersigned) ______(Date)______

Supervisor: Professor Glen C. Ulett

317

RESEARCH ARTICLE Host-Microbe Biology

Rapid Bladder Interleukin-10 Synthesis in Response to Uropathogenic Escherichia coli Is Part of a Defense Strategy Triggered by the Major Bacterial Flagellar Filament FliC and

Contingent on TLR5 Downloaded from

Dhruba Acharya,a Matthew J. Sullivan,a Benjamin L. Duell,a Kelvin G. K. Goh,a Lahiru Katupitiya,a Dean Gosling,a Michelle N. Chamoun,a Asha Kakkanat,d Debasish Chattopadhyay,b Michael Crowley,c David K. Crossman,c Mark A. Schembri,d Glen C. Uletta,b aSchool of Medical Sciences and Menzies Health Institute Queensland, Grifﬁth University, Parklands, Australia bSchool of Medicine, Division of Infectious Diseases, University of Alabama at Birmingham, Birmingham, Alabama, USA cHeﬂin Center for Genomic Sciences, University of Alabama at Birmingham, Birmingham, Alabama, USA http://msphere.asm.org/ dSchool of Chemistry and Molecular Biosciences, University of Queensland, Brisbane, Australia

ABSTRACT Urinary tract infection (UTI) caused by uropathogenic Escherichia coli (UPEC) engages interleukin-10 (IL-10) as an early innate immune response to regulate inflammation and promote the control of bladder infection. However, the mechanism of engagement of innate immunity by UPEC that leads to elicitation of IL-10 in the bladder is unknown. Here, we identify the major UPEC flagellar filament, FliC, as a key bacterial component sensed by the bladder innate immune system responsible for the induction of IL-10 synthesis. IL-10 responses of human as well as mouse bladder epithelial cell-monocyte cocultures were triggered by flagella of three major on January 6, 2020 by guest UPEC representative strains, CFT073, UTI89, and EC958. FliC purified to homogeneity induced IL-10 in vitro and in vivo as well as other functionally related cytokines, including IL-6. The genome-wide innate immunological context of FliC-induced IL-10 in the bladder was defined using RNA sequencing that revealed a network of transcriptional and antibacterial defenses comprising 1,400 genes that were induced by FliC. Of the FliC-responsive bladder transcriptome, altered expression of il10 and 808 additional genes were dependent on Toll-like receptor 5 (TLR5), according to analysis of TLR5-deficient mice. Examination of the potential of FliC and associated innate immune signature in the bladder to boost host defense, based on prophylactic or therapeutic administration to mice, revealed significant benefits for the control of Citation Acharya D, Sullivan MJ, Duell BL, Goh KGK, Katupitiya L, Gosling D, Chamoun MN, UPEC. We conclude that detection of FliC through TLR5 triggers rapid IL-10 synthesis Kakkanat A, Chattopadhyay D, Crowley M, in the bladder, and FliC represents a potential immune modulator that might offer Crossman DK, Schembri MA, Ulett GC. 2019. benefit for the treatment or prevention of UPEC UTI. Rapid bladder interleukin-10 synthesis in response to uropathogenic Escherichia coli is IMPORTANCE Interleukin-10 is part of the immune response to urinary tract infec- part of a defense strategy triggered by the tion (UTI) due to E. coli, and it is important in the early control of infection in the major bacterial flagellar filament FliC and contingent on TLR5. mSphere 4:e00545-19. bladder. Defining the mechanism of engagement of the immune system by the bac- https://doi.org/10.1128/mSphere.00545-19. teria that enables the protective IL-10 response is critical to exploring how we might Editor Sarah E. F. D'Orazio, University of exploit this mechanism for new infection control strategies. In this study, we reveal Kentucky part of the bacterial flagellar apparatus (FliC) is an important component that is Copyright © 2019 Acharya et al. This is an open-access article distributed under the terms sensed by and responsible for induction of IL-10 in the response to UPEC. We show of the Creative Commons Attribution 4.0 this response occurs in a TLR5-dependent manner. Using infection prevention and International license. control trials in mice infected with E. coli, this study also provides evidence that pu- Address correspondence to Glen C. Ulett, rified FliC might be of value in novel approaches for the treatment of UTI or in pre- g.ulett@griffith.edu.au. Received 28 July 2019 venting infection by exploiting the FliC-triggered bladder transcriptome. Accepted 30 October 2019 Published 27 November 2019 KEYWORDS flagella, urinary tract infection, uropathogenic Escherichia coli

November/December 2019 Volume 4 Issue 6 e00545-19 msphere.asm.org 1 Acharya et al.

rinary tract infections (UTI) are common illnesses, predominantly affecting women Uand causing more than ten million ambulatory visits per year in the United States alone (1). Expenditures aimed at the management of UTI account for approximately $3.5 billion in medical costs annually (2). Up to 80% of acute UTI cases are caused by uropathogenic Escherichia coli (UPEC) (3). Studies have shown key roles for virulence factors of UPEC, such as flagella, autotransporters, capsule, fimbriae, toxins, lipopolysaccharide (LPS), and siderophores, in UTI disease pathogenesis (4–7). The innate immune signature of acute UPEC UTI is reviewed elsewhere (7); it encompasses various cytokines, including interleukin-10 (IL-10), that is upregulated in the bladder within a few hours of experimental infection in mice (8). IL-10 is secreted in urine of adults who exhibit symptomatic UTI (8, 9) and is induced in several in vitro Downloaded from models of UTI, including in monocytes and mast cells (10, 11) and bladder epithelial cell-monocyte cocultures (10), which are used to model host-pathogen interactions (12). IL-10 plays pleiotropic roles in defense against infection depending on the illness and the causal pathogen. Frequently, IL-10 facilitates immune suppression to moderate inflammatory mechanisms that can damage the host (13–16). The contribution of IL-10 to resolution of infection reflects its tightly controlled expression, which can be a key factor in determining disease outcome (17–19). Functionally, an absence of IL-10 in mice exacerbates the host’s ability to control bacterial colonization during the innate phase of infection in the bladder (8). Reflecting its central regulatory role in many http://msphere.asm.org/ diseases and its ability to reduce tissue damage and protect tissue integrity, IL-10 is the subject of clinical trials for inflammatory diseases; however, its manipulation for benefit in a therapeutic setting remains experimental (20). One facet in understanding the role of IL-10 in infectious disease is elucidation of microbial products that elicit production of this key regulator of innate immune responses. Bacterial virulence factors shown to induce the production of IL-10 in experimental disease models include M protein of Streptococcus (21), peptidoglycan- embedded lipopeptides and cell wall glycopolymers of Staphylococcus (22), and flagella of Salmonella (23) and Yersinia (24). For some other pathogens that trigger the

production of IL-10, including Helicobacter and Chlamydia, links between virulence on January 6, 2020 by guest factors and IL-10 elicitation remain elusive. The nature of the host response encom- passing IL-10 can also depend on the genus or species of origin from which the pathogen virulence factor is derived (25–32). Flagella of UPEC contribute to the pathogenesis of UTI in several ways, including through motility that is associated with bacterial ascension from the bladder to the kidneys, leading to the development of pyelonephritis (33, 34). Expression of flagella by UPEC has also been associated with enhanced urinary tract colonization, invasion of host cells (35, 36), survival inside macrophages (37), and biofilm formation (38, 39). The flagellar filament is synthesized as a polymerized product of Ͼ20,000 protein monomers, termed flagellin or FliC (usually encoded by fliC), as reviewed elsewhere (40). In mammals, flagella are characteristically sensed through Toll-like receptor 5 (TLR5), which recognizes FliC monomers but not flagellar filaments (41–45). FliC can also be detected by NLR family apoptosis inhibitory protein 5 (NAIP5) and Ipaf within the intracellular environment (46, 47). Initial observations suggested that TLR11 senses flagellin (48–51); however, it has since been established that binding of flagellin to TLR11 does not occur, and the responses of wild-type and TLR11-deficient mice to flagellin are similar (52). A detailed understanding of how FliC from UPEC engages innate immunity in the bladder during UTI is lacking (34, 53–55), and the potential contribution of FliC to rapid IL-10 induction in the bladder during UTI is unknown. In this study, we examined the role of FliC in the bladder innate immune response to UPEC, with a focus on early IL-10 induction and the role of TLR5 in the FliC-driven bladder defense response.

RESULTS Effect of ﬂagellar expression on UPEC-induced IL-10 in uroepithelial cell monocyte cocultures. In initial experiments testing the effect of differential UPEC ﬂagellar

November/December 2019 Volume 4 Issue 6 e00545-19 msphere.asm.org 2 Rapid FliC-Driven IL-10 in UPEC UTI

TABLE 1 Bacterial strains and plasmids used in this study Strain or plasmid Characteristic(s) Reference or source E. coli strains ␣ Ϫ ϩ DH5 Cloning strain; dlacZΔM15 Δ(lacZYA-argF)U169 recA1 endA1 hsdR17(rK mK ) Bethesda Research Laboratories supE44 thi-1 gyrA96 relA1 MC4100 E. coli K-12 strain, OR:H48 111 MC4100/pflhDC MC4100 containing pflhDC;Knr 112 CFT073 Reference UPEC strain, O6:K2:H1 (ATCC 700928) 101 UTI89 Reference UPEC strain, O18:K1:H7 102 EC958 Reference ST131 UPEC strain, O25b:K100:H4 103 GU2139 CFT073/pflhDC;Knr 57 GU2639 CFT073ΔfliC;Knr 57 GU2671 UTI89ΔfliC;Knr This study Downloaded from EC958ΔfliC EC958ΔfliC;Cmr 68 CFT073⌬4 CFT073 with combined deletions Δfim,Δfoc,Δpap1, and Δpap2 113 GU2647 CFT073Δ4/pflhDC (pflhDC); Knr 57 GU2642 CFT073Δ4 ΔfliC; fliCϪ derivative of CFT073Δ4 57 GU2648 GU2642/pflhDC;Knr (for carrier control) 57

Plasmids pflhDC flhDC operon from Serratia in pVLT33; Cmr 112 pKD4 Template plasmid for kan gene amplification 104 pKD46 ␭-Red recombinase expression plasmid 104 pCP20 FLP synthesis under thermal control 104 http://msphere.asm.org/

expression on IL-10 induction, we used liquid-grown wild-type (WT) and fliC-deficient CFT073 and E. coli MC4100 (deficient for flagella due to a frameshift mutation in the flhD master regulator [56]) and MC4100/pflhDC (pflhDC was used to confer a hyperflagellated state) (Table 1). Uroepithelial cell-monocyte cocultures exhibited a 7-fold increase in IL-10 at 5 h after infection with MC4100/pflhDC and a 4-fold increase for other infections (on average) versus noninfected controls (Fig. 1A). The level of IL-10 induced by MC4100/pflhDC compared to that of MC4100 WT was statistically significant on January 6, 2020 by guest (P ϭ 0.02); there was no difference between CFT073 WT and CFT073ΔfliC strains under these conditions. We next tested bacteria grown on soft agar, which induces swarming associated with increased flagellin expression. In these assays, CFT073 WT induced significantly more IL-10 than the CFT073ΔfliC strain but less IL-10 than CFT073/pflhDC (Fig. 1B). Similar IL-10 responses occurred in cultures exposed to MC4100 WT and MC4100/pflhDC. Experiments comparing the responses of human cell cocultures to UPEC UTI89 and EC958 and their respective fliC-deficient derivatives showed equivalent trends in which higher levels of IL-10 were induced by UPEC expressing flagella than fliC-deficient mutants (Fig. 1C). Measurement of IL-10 induction in response to UPEC CFT073 and derivatives was then undertaken using a multiplex assay to explore functionally opposed (e.g., IL- 12p70, IL-2, and tumor necrosis factor alpha [TNF-␣]) and related cytokines (e.g., IL-4 and IL-6) and thereby gain a broader picture of the immunological context of IL-10 induction (14). In contrast to the induction of IL-10 observed in the response to hyperflagellated UPEC CFT073/pflhDC compared to WT (and significantly lower levels than the CFT073ΔfliC strain), there were no changes in levels of IL-12p70 (Fig. 1D); however, statistically significant changes in several other cytokines, including IL-1␣,-1␤, -2, -4, -6, and TNF-␣, and multiple chemokines (e.g., granulocyte colony-stimulating factor [G-CSF]) were detected (see Fig. S1 in the supplemental material). Hyperflagel- lation in flhDC-complemented UPEC strains and an absence of flagellar expression in fliC-deficient strains was confirmed using immunoblots for FliC (Fig. S2A), as previously described (57); in addition, motility assays showed phenotypes consistent with hyperflagellation in flhDC-complemented UPEC strains (Fig. S2B). Taken together, these data show that flagellar expression in CFT073 and other UPEC strains, including UTI89 and EC958, induces the production of IL-10 in uroepithelial cell monocyte cocultures as well as significant induction of several other functionally opposed and related cytokines.

November/December 2019 Volume 4 Issue 6 e00545-19 msphere.asm.org 3 Acharya et al. Downloaded from http://msphere.asm.org/

FIG 1 IL-10 production in uroepithelial cell monocyte cocultures challenged with UPEC CFT073 and other E. coli strains with altered flagellar expression. (A) Human 5637-U937 cocultures exposed to liquid-grown CFT073 and fliC-deficient CFT073 or MC4100 with or without pflhDC for hyperflagellation. Significance was determined by t test for MC4100 versus MC4100/pflhDC (*, P ϭ 0.02). (B) Human cell cocultures exposed to soft-agar-grown CFT073 or fliC-deficient and pflhDC derivatives and MC4100 strains. Significance was determined by ANOVA for CFT073 strains on January 6, 2020 by guest and t test for MC4100 strains (*, P ϭ 0.02). (C) Responses of human 5637-U937 cocultures to CFT073, UTI89, and EC958 (soft agar grown) and their fliC-deficient mutants. (D) Responses of IL-10 and the functionally opposed cytokine IL-12p70 in cocultures exposed to CFT073, CFT073ΔfliC, and CFT073/pflhDC strains according to multiplex analysis. Significance was determined by ANOVA with Tukey’s post hoc analysis (*, P Ͻ 0.05). Additional responses of other cytokines and chemokines are illustrated in Fig. S1.

IL-10 responses of cell cultures to enriched flagella and purified FliC. Experi- ments examining the responses of uroepithelial cell monocyte cocultures to flagellum- enriched protein from CFT073 (isolated by shearing and ultracentrifugation) showed significant IL-10 responses to flagella from CFT073 WT (versus the CFT073ΔfliC mutant) and MC4100/pflhDC (versus MC4100 WT) (Fig. 2A). Subsequently, we measured IL-10 levels in response to FliC purified to homogeneity from CFT073Δ4/pflhDC using fast protein liquid chromatography (FPLC), because flagellum-enriched preparations contain trace amounts of other outer membrane proteins that could contribute to IL-10 induction (57). Pure FliC triggered significantly more IL-10 than the carrier control that was generated from the CFT073Δ4 ΔfliC strain (Fig. 2B). Similar responses were observed for mouse macrophages but did not reach statistical significance due to higher basal levels of IL-10 detected in these experiments (data not shown). Taken together, these findings show that pure FliC stimulates significant IL-10 synthesis in human uroepithelial cell monocyte cocultures. IL-10 and related responses of the mouse bladder to FliC. We next analyzed the bladder response in mice that received either 30 ␮g of pure FliC from CFT073Δ4/pflhDC or the equivalent volume of carrier control generated from the CFT073Δ4 ΔfliC/pflhDC strain. Transurethral delivery of FliC triggered significant production of IL-10 in the bladders of mice at 2 h postinoculation compared to that of control mice according to multiplex assay (Fig. 3A). Levels of IL-6, often associated with IL-10-regulated responses,

November/December 2019 Volume 4 Issue 6 e00545-19 msphere.asm.org 4 Rapid FliC-Driven IL-10 in UPEC UTI Downloaded from FIG 2 IL-10 production in human cells in vitro after stimulation with flagella and purified FliC from UPEC CFT073. (A) Human uroepithelial cell monocyte cocultures stimulated (5 h) with flagellum-enriched protein (1 ␮g) from CFT073 and CFT073ΔfliC strains or MC4100 with or without pflhDC. Significance was determined by t test for CFT073 strains (*, P Ͻ 0.05). (B) Monocytes stimulated (5 h) with purified FliC (1 ␮g) from CFT073Δ4 strain or carrier control (generated from CFT073Δ4ΔfliC). Significance was determined by t tests (*, P Ͻ 0.05).

were also elevated (Fig. 3B), as were levels of IL-1␣, IL-1␤, and several chemokines, including monocyte chemoattractant protein 1 (MCP-1/CCL2), macrophage inflamma- http://msphere.asm.org/ tory protein 1␣ (MIP-1␣/CCL3) and -␤ (MIP-1␤/CCL4), and RANTES (CCL5) (Fig. 3). However, there were no significant changes in levels of IL-12p40, IL-12p70, TNF-␣, IL-2, IL-4, IL-5, or IL-13 (Fig. S3). Data generated using enzyme-linked immunosorbent assay (ELISA) for IL-10 were consistent with elevated levels of IL-10, as detected by multiplex assay (Fig. S4). Thus, UPEC FliC causes rapid induction of IL-10 in the bladder with concurrent early responses for IL-6, IL-1, and multiple chemokines. The FliC-responsive bladder transcriptome and dependency on TLR5. We next defined a more complete picture of the innate immune response of mouse bladder to FliC using RNA sequencing to comprehensively map the transcriptional responses that

initiated with early IL-10 induction. Bladders of WT mice exposed to FliC or carrier on January 6, 2020 by guest control exhibited distinct global transcriptional signatures (Fig. 4A) that encompassed 1,400 significant gene responses, represented by 831 upregulated and 569 downregulated genes (Fig. 4B); significance criteria included a fold change of ՆϮ2.0 and q value of Ͻ0.05, as described in Materials and Methods. Upregulated genes of particular interest in the context of IL-10 and innate immune activation included il10 (3.3-fold), il6 (3.2-fold), il1a (5.1-fold), il1b (10.9-fold), ccl2 (14.0-fold), ccl3 (11.5-fold), ccl4 (9.6-fold), ccl5 (2.6-fold), and tnf (15.5-fold); the responses of these genes are illustrated as absolute transcript abundance for control and FliC groups in Fig. 4C. The complete list of significant gene responses is listed in Data Set S1. The tlr5 gene was significantly downregulated (2.3-fold). Notably, many transcriptional responses detected by RNA sequencing exhibited consistency with parallel translational activities detected in the bladder, including those for IL-10, -6, and -1 and chemokines, according to the multiplex protein assays (Fig. 3 and Fig. S4). The top five canonical pathways (generated by Reactome analysis within innateDB [58] and ranked according to significance from overrepresentation analysis [ORA]) are summarized in Fig. 4D. These data highlight the extensive activation of networks related to cytokine signaling in the innate immune system and TLR cascades activated as a result of FliC treatment (complete list is in Data Set S1). Integrating Network Objects with Hierarchies (INOH) analysis identified similar strongly activated biological processes in FliC-treated WT mice, including TLR signaling, JAK STAT pathway activity, and GPCR signaling (Fig. 4D and Data Set S1). Taken together, these data illustrate an overall FliC-responsive bladder transcriptome that is characterized by extensive cytokine and TLR signaling and innate immune regulatory processes that are collectively engaged with early il10 induction. Comparative analysis of TLR5-deficient mice enabled delineation of the bladder responses of WT mice that are contingent on TLR5; this identified a total of 809 genes

November/December 2019 Volume 4 Issue 6 e00545-19 msphere.asm.org 5 Acharya et al. Downloaded from http://msphere.asm.org/ on January 6, 2020 by guest

FIG 3 Bladder IL-10 and other cytokine responses in mice treated with purified FliC from UPEC CFT073Δ4 strain. Multiplex analysis of IL-10 and other cytokines in bladder homogenates at 2 h following transurethral delivery of 30 ␮g FliC or carrier control. Significance was determined by t test for FliC versus the control (*, P Ͻ 0.05; ****, P Ͻ 0.0001). All cytokines that exhibited significantly altered expression are shown, with additional multiplex data (for nonsignificant factors) provided in Fig. S3. Data shown represent at least 2 independent experiments with separate groups of mice (n ϭ 9 [at least] per group).

(652 upregulated, 157 downregulated), including il10, that depend on TLR5 for their activation or repression in response to FliC; these are illustrated according to topology analysis of key nodes in Fig. 5 (59). Heat maps and a volcano plot representing the FliC-responsive bladder transcriptome of WT and TLR5-deﬁcient mice are shown in Fig. S5. The complete list of bladder transcriptional responses and biological pathways

November/December 2019 Volume 4 Issue 6 e00545-19 msphere.asm.org 6 Rapid FliC-Driven IL-10 in UPEC UTI Downloaded from http://msphere.asm.org/ on January 6, 2020 by guest

FIG 4 Bladder transcriptome in WT mice in response to pure FliC from UPEC CFT073Δ4. (A) Heat map of transcriptional changes in mouse bladder in response to 30 ␮g pure FliC (in 50 ␮l carrier) or equivalent volume of carrier control (Ctrl) (2-h exposure). (B) Volcano plot of the total number and the breadth of fold change of transcriptional response of genes exhibiting significantly altered expression (fold change of ՆϮ2.0, q value of Ͻ0.05) in the bladder response to pure FliC. (C) Normalized transcript abundances for il10 and several other genes encoding cytokines in the FliC-treated and carrier control groups (bars represent the means Ϯ SEM; an asterisk denotes a fold change of ՆϮ2.0 and q value of Ͻ0.05. (D) Top canonical biological pathways, according to Reactome (upper) and Integrating Network Objects with Hierarchies (INOH) analysis (lower). activated in response to FliC in a TLR5-dependent manner (i.e., WT versus TLR5- deficient mice) is provided in Data Set S2 (also provides a complete list of TLR5- independent responses). Unexpectedly, this analysis also revealed 591 genes that exhibited significantly altered expression in response to FliC independent of TLR5; this comprised 591 genes (179 upregulated and 412 downregulated genes; i.e., responses exclusive to FliC-treated WT versus carrier-treated WT mice and absent from a comparison of FliC-treated WT versus FliC-treated TLR5-deficient mice). A summary of the top 30 gene responses triggered by FliC via TLR5-dependent and -independent mechanisms is provided in Table 2. A visual summary of the responses in the form of a Venn diagram is provided in Fig. S6. The cellular context of TLR5-dependent and -independent responses identified genes with altered expression in the significantly activated TLR signal transduction pathway, as defined by innateDB and KEGG (Fig. 6). Taken together, these data establish that il10 transcriptional activation is part of a rapid bladder defense strategy in response to FliC, which occurs in a TLR5-dependent manner; additionally, il10 is part of a broader response that is initiated concurrently with an assembly of other TLR5-dependent, as well as TLR5-independent, transcriptional responses.

November/December 2019 Volume 4 Issue 6 e00545-19 msphere.asm.org 7 Acharya et al. Downloaded from http://msphere.asm.org/

FIG 5 Topology network of interactive elements of the TLR5-dependent, FliC-responsive bladder transcriptome. The network highlights key nodes that include il10 (blue edge) at the top of the network and the nodes that are directly (green edge) and indirectly (black edge) associated with il10-containing nodes. The network incorporates signiﬁcant elements of cytokine-cytokine receptor interactions, IL-17 and chemokine signaling, lymphocyte signaling and differentiation, and underlying signaling pathways, such as those for NF-␬␤ and MAPK. Images were derived using Network Analyst (59) and based on KEGG ontologies, with colors related to the signiﬁcance of pathway activation.

Controlling UPEC UTI through FliC-mediated innate immunity. After establish- ing a comprehensive transcriptional picture of the bladder innate immune signature generated in response to FliC, we next examined whether this signature could be on January 6, 2020 by guest exploited for infection control. For this, mice were administered 30 ␮g FliC into the bladder at 2 h prior to, or 24 h after, infectious challenge with UPEC, and bacterial loads were subsequently determined (24 h later). Mice that received prophylactic FliC had 80% fewer UPEC in the bladder than control mice that received carrier alone (P ϭ 0.028) (Fig. 7A). Similarly, mice that received FliC therapeutically exhibited 90% fewer UPEC in the bladder than control mice (P ϭ 0.039) (Fig. 7B). There were no signiﬁcant differences in the numbers of UPEC in urine or kidneys of mice between the FliC treatment groups and carrier control groups (Fig. S7). Of note, mice treated prophylactically with the carrier control exhibited signiﬁcantly more UPEC in urine and kidneys than mice treated therapeutically with carrier control (similar trends were noted for mice treated with FliC) (Fig. S7). Taken together, these data provide experimental evidence that the immune regulatory activity induced by FliC in the bladder can be harnessed to enhance the ability of the host to control UPEC locally in the context of both pre- and postexposure to FliC.

DISCUSSION This study was aimed at defining whether UPEC flagella, typically associated with motility and bacterial adherence, are sensed by the bladder innate immune system as part of a defense strategy utilizing IL-10 to control infection (8). The principle finding is that detection of the major flagellar filament of UPEC, FliC, within the bladder causes a very rapid local response, resulting in IL-10 synthesis. This study also shows that the bladder IL-10 response induced by FliC is contingent upon signaling through TLR5; this study does not show that IL-10 induction is the main effect of FliC but rather that high-resolution mapping of the FliC-responsive bladder transcriptome provides new, comprehensive details of how IL-10 is part of a broader bladder response to the major flagellar filament protein. Combined with the diversity of UPEC strains (of defined

November/December 2019 Volume 4 Issue 6 e00545-19 msphere.asm.org 8 Rapid FliC-Driven IL-10 in UPEC UTI

TABLE 2 Top 30 genes in the bladder transcriptional response to FliC that are altered in expression via TLR5-dependent and -independent mechanisms Gene Fold changea P value Annotation Upregulated TLR5-dependent response ccl20 980.3 4.94EϪ56 Chemokine (C-C motif) ligand 20 ngp 934.1 5.55EϪ12 Neutrophilic granule protein slc6a14 647.2 5.13EϪ128 Solute carrier family 6, member 14 sprr2e 510 1.85EϪ16 Small proline-rich protein 2E adgrf1 298 3.19EϪ14 Adhesion G protein-coupled receptor F1 saa1 245 1.33EϪ11 Serum amyloid A1 sprr2d 199.8 5.15EϪ16 Small proline-rich protein 2D saa2 185.1 1.70EϪ05 Serum amyloid A1 ltf 159.9 7.92EϪ31 Lactotransferrin

abcc8 152 1.45EϪ54 ATP-binding cassette, subfamily C member 8 Downloaded from olfm4 145.6 1.06EϪ10 Olfactomedin 4 gm16685 140.2 6.06EϪ73 Predicted gene, 16685 gm5483 123.7 1.11EϪ07 Predicted gene, 5483 sprr2h 123.4 5.96EϪ10 Small proline-rich protein 2H slc26a4 104.4 8.14EϪ09 Solute carrier family 26, member 4

Downregulated TLR5-dependent response fam131b Ϫ4.7 2.84EϪ03 Family with sequence similarity 131, member B oprk1 Ϫ4.8 3.69EϪ04 Opioid receptor, kappa 1 pnmal2 Ϫ4.9 1.38EϪ05 PNMA-like 2

bach2 Ϫ5.1 5.86EϪ17 BTB and CNC homology, basic leucine zipper transcription factor 2 http://msphere.asm.org/ gm4869 Ϫ5.3 1.05EϪ08 Predicted gene, 4869 slc16a14 Ϫ5.3 2.76EϪ12 Solute carrier family 16 (monocarboxylic acid transporters), member 14 gas1 Ϫ5.4 4.31EϪ05 Growth arrest speciﬁc 1 rbbp8nl Ϫ5.4 2.87EϪ06 RBBP8 N-terminal like oprd1 Ϫ6 1.89EϪ15 Opioid receptor, delta 1 alkal1 Ϫ6.1 1.88EϪ03 ALK and LTK ligand 1 evx2 Ϫ6.8 1.71EϪ07 Even-skipped homeobox 2 fam47e Ϫ6.9 1.42EϪ03 Family with sequence similarity 47, member E gm15513 Ϫ7.4 1.83EϪ03 Predicted gene, 15513 foxn1 Ϫ7.6 1.69EϪ05 Forkhead box N1 gm37711 Ϫ8.8 9.75EϪ08 Predicted gene, 37711

Upregulated TLR5-independent response Ϫ

mrgpra2b 124.57 1.02E 06 MAS-related GPR, member A2B on January 6, 2020 by guest mir351 27.64 2.83EϪ06 MicroRNA 351 igkv12-89 22.77 6.51EϪ03 Immunoglobulin kappa chain variable 12-89 gbp6 12.18 2.48EϪ21 Guanylate binding protein 6 gm9378 10.82 8.14EϪ05 Predicted gene 9378 gm24245 9.86 3.22EϪ03 Predicted gene 24245 fam26f 9.05 5.11EϪ20 Family with sequence similarity 26, member F gm43305 7.47 6.25EϪ03 Predicted gene 43305 c030013C21Rik 6.46 1.47EϪ07 RIKEN cDNA C030013C21 gene slpi 6.12 2.06EϪ21 Secretory leukocyte peptidase inhibitor clca3b 6.08 7.96EϪ03 Chloride channel accessory 3B ang4 5.86 2.09EϪ03 Angiogenin, ribonuclease A family, member 4 rem2 5.51 3.73EϪ03 rad- and gem-related GTP binding protein 2 ldoc1 5.51 7.72EϪ05 Regulator of NFKB signaling gm8818 4.66 9.33EϪ04 Predicted pseudogene 8818

Downregulated TLR5-independent response gm34583 Ϫ6.32 4.17EϪ05 Predicted gene 34583 pcdhb2 Ϫ6.41 1.96EϪ03 Protocadherin beta 2 5830418P13Rik Ϫ6.45 1.90EϪ03 RIKEN cDNA 5830418P13 gene slc6a11 Ϫ6.45 5.46EϪ03 Solute carrier family 6 (neurotransmitter transporter, GABA), member 11 gm43480 Ϫ6.49 2.26EϪ03 Predicted gene 43480 gsdmc Ϫ6.55 1.64EϪ05 Gasdermin C slitrk3 Ϫ7.03 6.16EϪ04 SLIT and NTRK-like family, member 3 ucp3 Ϫ7.24 2.00EϪ05 Uncoupling protein 3 (mitochondrial, proton carrier) gbp2b Ϫ7.57 1.13EϪ02 Guanylate binding protein 2b lrtm1 Ϫ8.08 5.20EϪ03 Leucine-rich repeats and transmembrane domain 1 ascl1 Ϫ8.15 3.06EϪ04 Achaete-scute family bhlh transcription factor 1 htr4 Ϫ8.88 3.22EϪ05 5 Hydroxytryptamine (serotonin) receptor 4 gm35507 Ϫ29.13 3.14EϪ03 Predicted gene 35507 otop1 Ϫ29.48 7.62EϪ03 Otopetrin 1 mmd2 Ϫ31.89 2.08EϪ04 Monocyte to macrophage differentiation-associated 2 aFold change refers to gene expression in the bladders of WT mice treated with FliC relative to carrier control.

November/December 2019 Volume 4 Issue 6 e00545-19 msphere.asm.org 9 Acharya et al. Downloaded from http://msphere.asm.org/

FIG 6 Cellular context of TLR5 engagement by UPEC FliC in the bladder leading to early IL-10 induction. Gene transcriptional responses analyzed using innateDB and overlaid on KEGG pathway 4620 Toll-like receptor signaling. Color key: green, downregulated; red, upregulated; yellow box, TLR5-dependent; other diagram components are per KEGG definitions. The illustration highlights possible signaling transduction mechanisms (center) that are engaged by FliC, leading to rapid IL-10 synthesis in the bladder. IL-10 does not form part of the canonical KEGG pathway 4620 but is included as a notional product of TLR5 engagement based on the findings of this study. phenotypes related to flagella) and in vitro models of UTI used in this study, we suggest

rapid IL-10 induction in the bladder response to FliC forms part of a TLR5-dependent on January 6, 2020 by guest program within a complex innate host defense strategy initiated to combat UPEC. In aligning this study with prior studies, several links between IL-10 induction and flagella are of note. For example, flagellum components of Salmonella and Yersinia have been shown to modify IL-10 production. Salmonella flagella trigger IL-10 secretion in splenocytes (60), monocytes (23, 61), and serum (62), but the type of host response may depend on the nature of antigen presentation (63). Flagella of Yersinia have been shown to induce IL-10 in macrophages (24). Interestingly, however, as part of a Paracoccidioides vaccine construct, Salmonella FliC inhibited IL-10 production in the lungs of mice (64). The effects of flagella on synthesis of cytokines such as IL-6 have

FIG 7 Control of UPEC UTI by FliC treatment. (A) Prophylactic FliC was administered to the bladders of mice 2 h prior to infectious challenge with UPEC. (B) Therapeutic FliC was administered to the bladders of mice 24 h after infectious challenge with UPEC. Bacterial loads were determined at 24 h (A) and 48 h (B) after infectious challenge. Both prophylactic and therapeutic FliC treatment signiﬁcantly reduced the numbers of UPEC recovered from the bladders of mice treated with FliC compared to control mice that received carrier alone. Data for urine and kidneys are provided in Fig. S7. Data shown represent pooled data from 2 to 3 independent experiments, each comprising 8 to 10 mice per group (total n ϭ 20 to 30 per group). *, P Ͻ 0.05 by Mann-Whitney U test (data did not satisfy Gaussian distribution or normality tests).

November/December 2019 Volume 4 Issue 6 e00545-19 msphere.asm.org 10 Rapid FliC-Driven IL-10 in UPEC UTI been associated with TLR5 (44, 45). In prior studies, we demonstrated the source of IL-10 in UPEC-infected human urothelial cell-monocyte cocultures is monocytes (not epithelial cells) (8, 10); however, by providing insight into the role of TLR5 in FliC-driven IL-10 responses in UPEC UTI in vivo, the current study provides a new understanding of the mechanism underlying this rapid bladder defense response triggered by UPEC. We suggest this is relevant to UPEC UTI in humans, because some individuals harbor a stop codon within the TLR5 open reading frame that is predicted to ablate host responses to flagella (65), and a TLR5 C1174T single-nucleotide polymorphism has been associated with recurrent UTI in adult women (66). We used enriched E. coli flagellum protein preparations to initially study IL-10 responses in human cell cultures exposed to liquid- or soft-agar-grown E. coli harboring Downloaded from flhDC to drive hyperflagellated E. coli or E. coli deficient in fliC. The combinations of challenge conditions tested, and analysis of different UPEC strains in addition to MC4100, indicate that IL-10 responses to E. coli flagella are not limited to CFT073. Differences in environmental, growth, and stress conditions, or cross talk mechanisms, might affect flagellar expression differently in distinct E. coli strains (67); however, our analysis of UTI89 and EC958 shows a consistent role for FliC in IL-10 induction in the models tested here. MC4100 may be considered irrelevant to UPEC UTI, but inclusion of non-UPEC E. coli shows that the effects of E. coli flagella on IL-10 are not limited to UPEC. These findings are consistent with previous observations that different flagellum http://msphere.asm.org/ H types (H1, H4, and H7) can induce IL-10 secretion, although H4 flagella was identified as the most potent flagellin type able to induce this cytokine (68). Finally, our data are consistent with the well-established paradigm that TLR5 recognizes FliC monomers, not flagellar filaments, and flagellin-mediated stimulation of cytokine synthesis (including IL-10) occurs in the absence of assembled flagellar filaments (69). Separate from flagella, other factors in UPEC are likely to contribute to IL-10 responses in the bladder. Our findings based on acellular flagellum stimulation assays and experiments using WT E. coli and fliC-deficient strains in cell cultures show levels of IL-10 above the baseline in vitro even under conditions where FliC was absent. The

main cell types used in the coculture model in this study act in synergy in response to on January 6, 2020 by guest UPEC to promote IL-10 synthesis (10), which is a phenotype not discernible from monocultures (12, 70). Other bacterial factors associated with IL-10 induction are lipopolysaccharide and type III secretion system proteins (71), the latter of which is not relevant to UPEC but is shed from some E. coli strains (enteropathogenic E. coli and enterohemorrhagic E. coli) under some conditions (72). We were careful to remove endotoxin from the treatments used in this study, and the use of pure FliC shows that this factor of UPEC significantly contributes to IL-10 bladder induction. However, it is likely that FliC (and flagella more broadly) is not the sole PAMP of UPEC that triggers IL-10 production in host cells. Other PAMPS of different bacteria may also induce IL-10; for example, peptidoglycan-embedded lipopeptides and cell wall glycopolymers of Staphylococcus induce IL-10 in monocytes and macrophages (22). Chlamydial major outer membrane protein triggers the production of IL-10 in macrophages (73). LPS- induced IL-10 production through TLR4 is well described (74–77). Thus, it is likely that additional UPEC factors induce IL-10; however, the current findings are consistent with several prior observations of flagella from Salmonella (23, 61) and Yersinia (24), which are reported to induce IL-10 in monocytes and macrophages, respectively. In addition to the effects of UPEC FliC on IL-10 induction, this study defines a multifaceted innate immune response that is engaged in the bladder immediately upon detection of FliC. RNA sequencing identified many factors that have been associated with the host response to flagella in other experimental systems (provided in Table S1 in the supplemental material), illustrating a large degree of consistency in the overall response of the bladder to FliC than other systems. Some factors, such as the genes for serum amyloid A (e.g., saa1), that were strongly induced by FliC in this study have been linked to flagellar function previously (78) and may be critical to host defense against UTI (79). In addition, the many novel factors identified to be induced after exposure to FliC in this study, such as multiple predicted genes and genes

November/December 2019 Volume 4 Issue 6 e00545-19 msphere.asm.org 11 Acharya et al. encoding solute carriers and receptors, have no known links to flagella and will require future investigation into their potential roles in UTI. The transcriptomic data of this study expand our insight into the extent to which the innate immune system is engaged by FliC in the bladder. Several of the responses occurring in the mouse bladder in response to FliC can also be interpreted alongside the responses of human uroepithelial cell-monocyte cocultures to discern numerous consistent responses, such as those for IL-10, IL-1, and IL-6. The complex interplay between IL-10 and the regulation of inflammation in the context of other cytokines, such as IL-6, is reviewed elsewhere (77). Topology analysis identified IL-17 as strongly induced in the mouse bladder response to FliC, consistent with the elevated levels of IL-17 observed in the human cell coculture model of bladder; that IL-17 plays a role in innate defense to UPEC Downloaded from UTI in mice (80); and the findings of the current study implicate FliC in this response. It is likely that several of the cytokines identified as induced by FliC in this study contribute to control of UPEC; for example, other than IL-17, previous studies have shown roles for IL-1␤ (81), IL-6 (82), and G-CSF (83) in modulating host resistance to UPEC UTI. Taken together, these findings support the idea that IL-10 responses to FliC occur concurrently with a diverse repertoire of antimicrobial products and innate immune mediators that are produced as a result of sensing not only flagellum proteins but also other UPEC cell components. Several lines of evidence relating to flagellin and TLR5 have been established using http://msphere.asm.org/ studies of Salmonella enterica serotype Typhimurium flagella, probably reflecting in part its abundant peritrichous expression and commercial availability. Most signaling in response to flagellin occurs through TLR5 (44), which relays sensing to cell response networks that drive production of cytokines and chemokines. TLR5 signaling can vary depending on experimental conditions, such as specific tissue or cell location and the type of pathogen (44, 84). Our results show that IL-10 induction in the bladder as part of early defense against UPEC UTI requires TLR5. TLR5-dependent IL-10 secretion has also been described as part of the response to a flagellin fusion protein studied to prevent allergy (85); our findings are consistent with this observation. In the context of

UTI, a previous study of mice treated with flagellin by transurethral inoculation showed on January 6, 2020 by guest upregulation of KC (CXCL1), MIP2 (CXCL2), MCP-1 (CCL2), IL-6, and TNF-␣ in the bladder (86). That study did not investigate il10; however, the findings of the current study support the view that TLR5 recognition of flagellin is an important element of the innate immune response to UPEC during the early stages of UTI in mice. It is interesting that Andersen-Nissen et al. (86) found that TLR5-deficient mice are able to control UTI initially with a defect in resistance apparent only after 2 to 5 days postinoculation. Our findings show extensive responses to UPEC FliC within just 2 h; it seems likely this early response (including il10) is critical to shape an effective host response that requires additional time to develop and effect restriction of UPEC in the bladder, detectable one or more days later. Flagellin also activates renal collecting duct cells via TLR5, which enables upregulation of CXCL1 and CXCL2 to provide renal host defense against pyelonephritis (87). Additionally, this study describes a novel group of 591 genes that exhibited altered expression (mostly downregulated) in response to FliC independent of TLR5. Identification of this group prompted a search for candidates associated with NLRC4/NAIP activation and IL-1␤ signaling, because NLRC4 is one of the key inflammasome sensors that responds to bacteria (88); most notably, flagellin from Salmonella triggers the pathway following cytosolic recognition of the bacterial ligand, as discussed elsewhere (89). It is NAIP5 and NAIP6, rather than NLRC4, that recognize flagellin (90). Activation of this pathway can lead to NLRC4-mediated pyroptosis and other antimicrobial responses, including shedding of infected epithelial cells and release of prostaglandins and leukotrienes. Among the genes identified as significantly upregulated via TLR5-independent mechanisms following exposure to FliC were those encoding caspase-7 and Gasdermin-D; recently, both of these factors were identified as key substrates downstream of the NLRC4/NAIP5 inflammasome required for resistance to Legionella infection (91). Thus, it would be interesting to investigate the role of NLRC4/NAIP5 and associated factors, such as caspase-7 and Gasdermin-D, in resistance

November/December 2019 Volume 4 Issue 6 e00545-19 msphere.asm.org 12 Rapid FliC-Driven IL-10 in UPEC UTI to UPEC, particularly in the context of TL5-independent driven responses to flagellin in the host response. We observed significant downregulation of tlr5 in WT mice treated with FliC, which is consistent with a previous study that showed treatment with various bacterial ligands downregulated TLR5 expression (92). Other studies have shown responses to flagella in the absence of functional TLR5 signaling (41, 44). TLR11 also forms part of the defense response of the bladder to UPEC in experimental infection in mice (93); we excluded TLR11 from this study because of its absence from the human receptor repertoire and because it has been demonstrated that TLR11 is not a sensor for FliC (52). Further studies are needed to characterize the signaling mechanisms underlying UPEC FliC- mediated and TLR5-dependent IL-10 production. Examples of candidates that would be Downloaded from useful to investigate in characterizing these signaling mechanisms are shown in the TLR signaling KEGG pathway used to interpret these data, which we illustrated with IL-10 highlighted as a notional product of TLR5 engagement (at the time of writing, IL-10 is not included in KEGG pathway 4620). For example, significant upregulation of myd88, nfkb1, and nfkb2 suggests these contribute to rapid production of IL-10 through MyD88-dependent mechanisms with quick activation of NF-␬B and mitogen-activated protein kinase (MAPK). Other differentially expressed genes, such as those related to macrophage and neutrophil inflammation (e.g., ccl20–mip-3␣ and ngp), stress a con- vergence between canonical TLR signaling and early cellular defense responses to http://msphere.asm.org/ UPEC; others, such as mrgpra2b (expressed by neutrophils and mast cells, suggested to have important roles in the innate immune system [94 ]), mir-351, and several predicted genes that were the most strongly upregulated independent of TLR5 (but which have largely uncharacterized functions), underscore the gaps in knowledge of how innate immune responses to UPEC develop and how these might affect the pathogenesis of UTI. Other limitations of this work are the concentrations of FliC used, which are difficult to relate to natural infection; however, similar assay conditions are reported in many published studies on FliC (that have used microgram amounts of less pure FliC); this enables comparison between studies of similar nature.

FliC has been topical in vaccine development for decades and forms part of several on January 6, 2020 by guest recently developed experimental vaccines, including as adjuvant comixed with vaccine antigens and as chimeric or fusion proteins, as reviewed elsewhere (95). For example, an FliC adjuvant has been tested in the context of influenza vaccines in human clinical trials (96). We explored the potential of FliC-driven innate immune responses of the bladder as an approach to infection control of UPEC distinct from vaccine-driven adaptive immunity to gain proof of principle that UPEC FliC is useful for prevention or control of UTI. Our observations of mice administered FliC prophylactically as well as therapeutically provide evidence that FliC is useful for new approaches to the treatment of UTI. In these experiments, higher recovery of UPEC from urine and kidneys of mice treated prophylactically (with carrier or FliC) than from mice treated therapeutically most likely reflects the different time periods used between infectious challenge and UPEC load measurement (i.e., 24 h for prophylactic model versus 48 h for therapeutic model); these differences in recovery of UPEC occurred regardless of the use of FliC; thus, we consider these a reflection of the model rather than effects of FliC. Several flagellum H antigen types have been investigated as part of polyvalent vaccine studies in rats for UPEC (97); however, the problem of flagellin variation and the related need to target multiple virulence factors is an important consideration (98). Finally, the nature of flagellin to shape both innate and adaptive arms of immunity has led to its use as an immunomodulatory antitumor agent (42). How FliC or the immune response to it might be incorporated into novel approaches to treat or prevent UTI remains unclear, but this study establishes that FliC can be used to increase the host’s ability to control UPEC bladder infection. The mechanism of the protective effect observed in this study remains unknown, and addressing the potential role of factors, such as il10, would necessitate different models, such as double TLR5Ϫ/Ϫ and IL-10Ϫ/Ϫ mice, for example. However, we have no evidence that IL-10 is responsible for the protective effect, and given the many genes and cytokines that are altered in expression after FliC

November/December 2019 Volume 4 Issue 6 e00545-19 msphere.asm.org 13 Acharya et al. inoculation, future work will need to examine the mechanism by which the observed protective effect from FliC is afforded. Another avenue for analysis could be the use of UPEC FliC as an adjuvant to promote the efﬁcacy of experimental UPEC vaccines, as reported for other pathogens (99), or alternatively, as an immunomodulatory agent; such an approach was shown to activate TLR5 and induce the production of a host defense peptide, BD2, that may boost control of recurrent UPEC UTI (100).

MATERIALS AND METHODS Cell lines and bacteria. Human 5637 uroepithelial (ATCC number HTB-9), U937 monocyte (ATCC number CRL-1593.2), and mouse J774A.1 (ATCC number TIB-7) cell lines were used. Cells were grown at

37°C with 5% CO2 in complete RPMI (cRPMI) medium (RPMI 1640 supplemented with 25 mM HEPES, 2mM L-glutamine, 10% heat-inactivated fetal bovine serum, 100 mM nonessential amino acids, 1 mM sodium pyruvate, 100 U mlϪ1 penicillin, and 100 mg mlϪ1 streptomycin; Life Technologies, USA). Downloaded from UPEC reference strains CFT073 (101), UTI89 (102), and EC958 (103) and various derivatives, as well as the commensal E. coli MC4100, were used (Table 1). UPEC derivatives included mutants with targeted deletions in fliC, namely, CFT073ΔfliC (57), EC958ΔfliC (68), and UTI89ΔfliC (this study) strains. Addition- ally, a multiple mutant, termed the CFT073Δ4 strain, with combined deletions in four major chaperone- usher fimbriae operons (type 1, F1C, and two P fimbrial gene clusters) (113), was used along with its fliC-deficient derivative, the CFT073Δ4 ΔfliC strain (57 ). E. coli MC4100 and UPEC strains carrying isopropyl-␤-D-thiogalactopyranoside (IPTG)-inducible pflhDC (master operon for flagellar biosynthesis) were used to study hyperflagellated states. Unless otherwise stated, bacteria were grown with agitation (200 rpm) at 37°C in lysogeny broth (LB) or on LB agar (1.5% and 0.25% as required) overnight with antibiotic selection (50 ␮g/ml kanamycin, 30 ␮g/ml chloramphenicol) and IPTG (20 mM) as indicated. For http://msphere.asm.org/ motility assays, overnight cultures were prepared in LB broth (with appropriate antibiotics where necessary), and 1 ␮l of phosphate-buffered saline (PBS) containing approximately 1 ϫ 106 CFU was spotted onto the center of fresh 0.25% LB agar plates (in triplicate) that were supplemented with IPTG and kanamycin as necessary. The plates were incubated at 37°C for 9 h, and rates of motility were determined by measuring the diameter of growth over time. The data are shown as the mean diameter (in millimeters) of motility Ϯ standard errors of the means (SEM) for at least 3 independent experiments. Cell coculture and cytokine measurement. A coculture model of human 5637 uroepithelial cells and U937 monocytes was used for most in vitro assays, essentially as described previously (8). Briefly, 1 ϫ 105 uroepithelial cells and 5 ϫ 104 monocytes in cRPMI were seeded together into the wells of a 96-well plate. The cocultures were infected with 1.5 ϫ 106 CFU of UPEC (multiplicity of infection [MOI],

10) and incubated at 37°C with 5% CO2 for 5 h, a time point previously associated with IL-10 induction by UPEC in vitro (10). For cytokine measurements, supernatants were analyzed using ELISA speciﬁc for

human IL-10 (number 88-7106-86; eBioscience, USA) or multiplex cytokine assays (Bio-Rad, USA). J774A.1 on January 6, 2020 by guest macrophages were used in parallel assays, as indicated. Cell coculture assays were performed at least three times in independent experiments. Preparation of flagellum-enriched E. coli. Broth cultures of E. coli were grown overnight (10 ml LB) at 37°C with shaking (200 rpm), harvested, and washed in PBS three times (8,000 ϫ g for 10 min at 4°C). The cells were adjusted to 3 ϫ 107 CFU/ml in cRPMI medium for use in cocultures. Initially, we tested whether E. coli grown to be flagellum enriched would induce more IL-10 than non-flagellum-enriched E. coli; for this, we used soft-agar cultures to promote swarming growth, which is associated with increased expression of flagellin (105). Soft-agar flagellum-enriched E. coli was prepared using LB agar plates (0.25% agar), onto the surface of which was spotted 10 ␮l containing 3 ϫ 108 CFU (from overnight LB cultures), as previously described (106). The plates were incubated overnight (37°C), and subsequently areas of hyperflagellated E. coli were excised from the agar, resuspended in 500 ␮l PBS by pipetting, and centrifuged (1,000 ϫ g, 5 min at 4°C) to pellet any residual agar. The supernatants containing the bacteria were then diluted in cRPMI for assay (1.5 ϫ 106 CFU/ml; MOI, 10). Colony counts were performed to determine MOI. Results shown represent at least four independent experiments. Preparation of acellular flagella, purification of FliC, and protein analysis. Protein preparations enriched for flagella were isolated from E. coli using a combination of mechanical shearing and ultracentrifugation, essentially as described elsewhere (107). Briefly, 500-ml cultures were grown with shaking (60 rpm) and washed in PBS, and flagella were sheared using a bead beater (57). The suspensions were centrifuged and the supernatants (with flagella) were filtered (0.45 ␮m). Bacteria-free flagella were pelleted (135,000 ϫ g, 90 min, 4°C) and resuspended in 2 ml PBS for freezing at Ϫ20°C. Depolymerization of flagellar filaments into FliC monomers was achieved by heating (60°C, 10 min) prior to analysis, postpurification, or use in downstream assays. FliC was postpurified using fast protein liquid chromatography (FPLC) with an ÄKTA pure protein purification system and a Superdex 200 increase 10/300 GL column (GE Lifesciences) (57). Endotoxin was removed using high-capacity columns (88274; Pierce). Proteins were analyzed using a bicinchoninic acid protein assay kit (number 23227; Thermo Scientific Pierce, USA). Western blots (with anti-flagellum H-pool-E antibody; number 54394; Staten Serum Institut, Denmark) used anti-rabbit IgG horseradish peroxidase conjugate (number sc-2030; Santa Cruz Biotech, USA) and 3,3=-diaminobenzidine substrate. The UPEC FliC proteins prepared in this manner were pure and endotoxin free, as previously described (57). Mouse experiments and treatment of bladder. Examination of the bladder response to flagella and FliC was undertaken using female C57BL/6J or B6.129S1-Tlr5tm1Flv/J mice (The Jackson Laboratory, USA, and Animal Resources Centre, Canning Vale, WA) at 10 to 12 weeks of age. Mice were administered approximately 1.5 ϫ 108 to 2.0 ϫ 108 CFU UPEC or 30 ␮g FliC via the transurethral route in 50 ␮l PBS at

November/December 2019 Volume 4 Issue 6 e00545-19 msphere.asm.org 14 Rapid FliC-Driven IL-10 in UPEC UTI

a slow infusion rate (5 ␮lsϪ1). For the collection of tissues, mice were euthanized by isoflurane anesthesia overdose followed by cervical dislocation. Bladder tissue was collected at 2 h postinoculation, a time point associated with IL-10 responses in UPEC-infected mice (8). For ELISA, bladder was homogenized in a protease inhibitor cocktail (Roche, Castle Hill, NSW, Australia) and clarified at 12,000 ϫ g for 20 min at 4°C. Supernatants were stored at –80°C until assay, which was performed using quintuplicate samples in a commercial IL-10 ELISA (Pierce Endogen, Scoresby, VIC, Australia). Independent experiments using groups of five were repeated at least twice. RNA isolation, sequencing, and bioinformatics. For RNA isolation, bladder tissues were homogenized in TRIzol (Life Technologies, Mulgrave, VIC, Australia). RNase-free DNase-treated RNA that passed Bioanalyzer 2100 (Agilent) analysis was used for RNA sequencing. We performed mRNA sequencing on RNA from C57BL/6 and B6.129S1-Tlr5tm1Flv/J mice (n ϭ 3 to 5 per group) using the Illumina NextSeq 500 platform. Total RNA was subjected to 2 rounds of poly(A)ϩ selection and converted to cDNA. We used TruSeq library generation kits (Illumina, San Diego, California). Library construction consisted of random

fragmentation of the poly(A) mRNA, followed by cDNA production using random primers. The ends of Downloaded from the cDNA were repaired and A-tailed, and adaptors were ligated for indexing (with up to 12 different barcodes per lane) during the sequencing runs. The cDNA libraries were quantitated using qPCR in a Roche LightCycler 480 with the Kapa Biosystems kit (Kapa Biosystems, Woburn, Massachusetts) prior to cluster generation. Clusters were generated to yield approximately 725,000 to 825,000 clusters/mm2. Cluster density and quality were determined during the run after the first base addition parameters were assessed. We ran paired-end 2ϫ 75-bp sequencing runs to align the cDNA sequences to the reference genome. For data preprocessing and bioinformatics, STAR (version 2.5.3) was used to align the raw RNA sequencing fastq reads to the Gencode GRCm38 p4, release M11, mouse reference genome (108). HTSeq-count, version 0.9.1, was used to estimate transcript abundances (109). DESeq2 then was used to normalize and test for differential expression and regulation. Genes that met certain criteria (i.e., fold http://msphere.asm.org/ change of ՆϮ2.0, q value of Ͻ0.05) were accepted as significantly altered in expression (110). Control of UPEC in the bladder using FliC. To explore the potential for FliC and associated innate immune responses in the bladder to be used for infection control or disease prevention purposes, we examined UPEC numbers in the bladders of mice that were treated with 30 ␮g FliC (in 50 ␮l PBS) either prophylactically or therapeutically. In the prophylactic model, infectious challenge with UPEC occurred 2 h after administration of FliC, and UPEC titers were measured 24 h after infectious challenge. In the therapeutic model, mice received infectious challenge and, 24 h later, received FliC; 24 h later, UPEC titers were measured. The infectious challenge in both models was 1.5 ϫ 108 to 2.0 ϫ 108 CFU of UPEC CFT073 in 50 ␮l of PBS inoculated via the transurethral route. Control mice received 50 ␮l of carrier and were challenged in the same manner. The total bacterial loads in the bladders, urine samples, and kidneys of mice were assessed using standard colony count methods, as previously described elsewhere (8). Ethics statement. This study was carried out in accordance with the national guidelines of the Australian National Health and Medical Research Council. The Institutional Animal Care and Use Com- mittee of the University of Alabama at Birmingham and the Animal Ethics Committee of Griffith on January 6, 2020 by guest University reviewed and approved all animal experimentation protocols used in this study (permits: University of Alabama at Birmingham animal protocol IACUC-10089 and Griffith approval MSC/01/18/ AEC). Statistics. Statistical significance was set at a P value of Յ0.05. Welch’s independent samples t test was used to compare IL-10 levels in ELISAs, and analysis of variance (ANOVA) was performed with Tukey’s post hoc comparison for multiple-target Bio-Plex assay. Mann-Whitney U test was used to evaluate mouse bladder titer data. Statistical testing of RNA sequencing data was undertaken using DESeq2 and included significance criteria of a fold change of ՆϮ2.0 and q value of Ͻ0.05, as described elsewhere (110). Other statistical analyses were performed using GraphPad Prism v8.0 and SPSS Statistical Package v22. Data availability. Raw and processed data were deposited in Gene Expression Omnibus (GEO; accession no. GSE132294). SUPPLEMENTAL MATERIAL Supplemental material for this article may be found at https://doi.org/10.1128/ mSphere.00545-19. FIG S1, TIF file, 0.5 MB. FIG S2, PDF file, 1.5 MB. FIG S3, TIF file, 0.6 MB. FIG S4, TIF file, 0.1 MB. FIG S5, PDF file, 1.3 MB. FIG S6, PDF file, 0.4 MB. FIG S7, PDF file, 0.1 MB. TABLE S1, DOCX file, 0.2 MB. DATA SET S1, XLSX file, 10.7 MB. DATA SET S2, XLSX file, 0.4 MB.

ACKNOWLEDGMENT This study was supported with funding from the National Medical Research Council (NHMRC; Australia) under grant number APP1084889 (G.C.U.).

November/December 2019 Volume 4 Issue 6 e00545-19 msphere.asm.org 15 Acharya et al.

REFERENCES 1. Foxman B. 2014. Urinary tract infection syndromes: occurrence, recur- basic science to clinical translation. Immunity 50:871–891. https://doi rence, bacteriology, risk factors, and disease burden. Infect Dis Clin .org/10.1016/j.immuni.2019.03.020. North Am 28:1–13. https://doi.org/10.1016/j.idc.2013.09.003. 21. Price JD, Schaumburg J, Sandin C, Atkinson JP, Lindahl G, Kemper C. 2. Griebling TL. 2005. Urologic diseases in America project: trends in 2005. Induction of a regulatory phenotype in human CD4ϩ T cells by resource use for urinary tract infections in men. J Urol 173:1288–1294. streptococcal M protein. J Immunol 175:677–684. https://doi.org/10 https://doi.org/10.1097/01.ju.0000155595.98120.8e. .4049/jimmunol.175.2.677. 3. Bacheller CD, Bernstein JM. 1997. Urinary tract infections. Med Clin 22. Frodermann V, Chau TA, Sayedyahossein S, Toth JM, Heinrichs DE, North Am 81:719–730. https://doi.org/10.1016/s0025-7125(05)70542-3. Madrenas J. 2011. A modulatory interleukin-10 response to staphylo- 4. Emody L, Kerenyi M, Nagy G. 2003. Virulence factors of uropathogenic coccal peptidoglycan prevents Th1/Th17 adaptive immunity to Staph- Escherichia coli. Int J Antimicrob Agents 22(Suppl 2):29–33. https://doi ylococcus aureus. J Infect Dis 204:253–262. https://doi.org/10.1093/ .org/10.1016/s0924-8579(03)00236-x. infdis/jir276.

5. Totsika M, Moriel DG, Idris A, Rogers BA, Wurpel DJ, Phan MD, Paterson 23. Wyant TL, Tanner MK, Sztein MB. 1999. Salmonella typhi flagella are Downloaded from DL, Schembri MA. 2012. Uropathogenic Escherichia coli mediated uri- potent inducers of proinflammatory cytokine secretion by human nary tract infection. Curr Drug Targets 13:1386–1399. https://doi.org/ monocytes. Infect Immun 67:3619–3624. 10.2174/138945012803530206. 24. McNally A, La Ragione RM, Best A, Manning G, Newell DG. 2007. An 6. Hannan TJ, Totsika M, Mansfield KJ, Moore KH, Schembri MA, Hultgren aflagellate mutant Yersinia enterocolitica biotype 1A strain displays altered SJ. 2012. Host-pathogen checkpoints and population bottlenecks in invasion of epithelial cells, persistence in macrophages, and cytokine persistent and intracellular uropathogenic Escherichia coli bladder in- secretion profiles in vitro. Microbiology 153:1339–1349. https://doi.org/10 fection. FEMS Microbiol Rev 36:616–648. https://doi.org/10.1111/j.1574 .1099/mic.0.2006/000919-0. -6976.2012.00339.x. 25. Chettri JK, Raida MK, Holten-Andersen L, Kania PW, Buchmann K. 2011. 7. Ulett GC, Totsika M, Schaale K, Carey AJ, Sweet MJ, Schembri MA. 2013. PAMP induced expression of immune relevant genes in head kidney Uropathogenic Escherichia coli virulence and innate immune responses leukocytes of rainbow trout (Oncorhynchus mykiss). Dev Comp Immu-

during urinary tract infection. Curr Opin Microbiol 16:100–107. https:// nol 35:476–482. https://doi.org/10.1016/j.dci.2010.12.001. http://msphere.asm.org/ doi.org/10.1016/j.mib.2013.01.005. 26. Cruz-Córdova A, Rocha-Ramírez LM, Ochoa SA, González-Pedrajo B, 8. Duell BL, Carey AJ, Tan CK, Cui X, Webb RI, Totsika M, Schembri MA, Gónzalez-Pedrajo B, Espinosa N, Eslava C, Hernández-Chiñas U, Derrington P, Irving-Rodgers H, Brooks AJ, Cripps AW, Crowley M, Ulett Mendoza-Hernández G, Rodríguez-Leviz A, Valencia-Mayoral P, GC. 2012. Innate transcriptional networks activated in bladder in re- Sadowinski-Pine S, Hernández-Castro R, Estrada-García I, Muñoz- sponse to uropathogenic Escherichia coli drive diverse biological path- Hernández O, Rosas I, Xicohtencatl-Cortes J. 2012. Flagella from five ways and rapid synthesis of IL-10 for defense against bacterial Cronobacter species induce pro-inflammatory cytokines in macrophage urinary tract infection. J Immunol 188:781–792. https://doi.org/10 derivatives from human monocytes. PLoS One 7:e52091. https://doi .4049/jimmunol.1101231. .org/10.1371/journal.pone.0052091. 9. Sundac L, Dando SJ, Sullivan MJ, Derrington P, Gerrard J, Ulett GC. 2016. 27. Gal-Mor O, Suez J, Elhadad D, Porwollik S, Leshem E, Valinsky L, Protein-based profiling of the immune response to uropathogenic McClelland M, Schwartz E, Rahav G. 2012. Molecular and cellular char- Escherichia coli in adult patients immediately following hospital admis- acterization of a Salmonella enterica serovar Paratyphi a outbreak strain sion for acute cystitis. Pathog Dis 74:ftw062. https://doi.org/10.1093/ and the human immune response to infection. Clin Vaccine Immunol femspd/ftw062. 19:146–156. https://doi.org/10.1128/CVI.05468-11.

10. Duell BL, Carey AJ, Dando SJ, Schembri MA, Ulett GC. 2013. Human 28. Lacave-Lapalun JV, Benderitter M, Linard C. 2013. Flagellin or lipopoly- on January 6, 2020 by guest bladder uroepithelial cells synergize with monocytes to promote IL-10 saccharide treatment modified macrophage populations after colorec- synthesis and other cytokine responses to uropathogenic Escherichia tal radiation of rats. J Pharmacol Exp Ther 346:75–85. https://doi.org/ coli. PLoS One 8:e78013. https://doi.org/10.1371/journal.pone.0078013. 10.1124/jpet.113.204040. 11. Chan CY, St John AL, Abraham SN. 2013. Mast cell interleukin-10 drives 29. Vicente-Suarez I, Brayer J, Villagra A, Cheng F, Sotomayor EM. 2009. localized tolerance in chronic bladder infection. Immunity 38:349–359. TLR5 ligation by flagellin converts tolerogenic dendritic cells into acti- https://doi.org/10.1016/j.immuni.2012.10.019. vating antigen-presenting cells that preferentially induce T-helper 1 12. Duell BL, Cripps AW, Schembri MA, Ulett GC. 2011. Epithelial cell responses. Immunol Lett 125:114–118. https://doi.org/10.1016/j.imlet coculture models for studying infectious diseases: benefits and limita- .2009.06.007. tions. J Biomed Biotechnol 2011:852419. https://doi.org/10.1155/2011/ 30. Vicente-Suarez I, Takahashi Y, Cheng F, Horna P, Wang HW, Wang HG, 852419. Sotomayor EM. 2007. Identification of a novel negative role of flagellin 13. Couper KN, Blount DG, Riley EM. 2008. IL-10: the master regulator of in regulating IL-10 production. Eur J Immunol 37:3164–3175. https:// immunity to infection. J Immunol 180:5771–5777. https://doi.org/10 doi.org/10.1002/eji.200737306. .4049/jimmunol.180.9.5771. 31. Yang X, Murani E, Ponsuksili S, Wimmers K. 2013. Association of TLR5 14. Duell BL, Tan CK, Carey AJ, Wu F, Cripps AW, Ulett GC. 2012. Recent sequence variants and mRNA level with cytokine transcription in pigs. insights into microbial triggers of interleukin-10 production in the host Immunogenetics 65:125–132. https://doi.org/10.1007/s00251-012-0662-9. and the impact on infectious disease pathogenesis. FEMS Immunol 32. Zgair AK. 2012. Flagellin administration protects respiratory tract from Med Microbiol 64:295–313. https://doi.org/10.1111/j.1574-695X.2012 Burkholderia cepacia infection. J Microbiol Biotechnol 22:907–916. .00931.x. https://doi.org/10.4014/jmb.1112.11079. 15. Li MC, He SH. 2004. IL-10 and its related cytokines for treatment of 33. Lane MC, Alteri CJ, Smith SN, Mobley HL. 2007. Expression of flagella is inflammatory bowel disease. World J Gastroenterol 10:620–625. coincident with uropathogenic Escherichia coli ascension to the upper https://doi.org/10.3748/wjg.v10.i5.620. urinary tract. Proc Natl Acad SciUSA104:16669–16674. https://doi 16. Kane MM, Mosser DM. 2001. The role of IL-10 in promoting disease .org/10.1073/pnas.0607898104. progression in leishmaniasis. J Immunol 166:1141–1147. https://doi 34. Lane MC, Lockatell V, Monterosso G, Lamphier D, Weinert J, Hebel JR, .org/10.4049/jimmunol.166.2.1141. Johnson DE, Mobley HL. 2005. Role of motility in the colonization of 17. Mege JL, Meghari S, Honstettre A, Capo C, Raoult D. 2006. The two uropathogenic Escherichia coli in the urinary tract. Infect Immun 73: faces of interleukin 10 in human infectious diseases. Lancet Infect Dis 7644–7656. https://doi.org/10.1128/IAI.73.11.7644-7656.2005. 6:557–569. https://doi.org/10.1016/S1473-3099(06)70577-1. 35. Pichon C, Héchard C, Du Merle L, Chaudray C, Bonne I, Guadagnini S, 18. Mosser DM, Zhang X. 2008. Interleukin-10: new perspectives on an old Vandewalle A, Le Bouguénec C. 2009. Uropathogenic Escherichia coli cytokine. Immunol Rev 226:205–218. https://doi.org/10.1111/j.1600 AL511 requires flagellum to enter renal collecting duct cells. Cell Microbiol -065X.2008.00706.x. 11:616–628. https://doi.org/10.1111/j.1462-5822.2008.01278.x. 19. Moore KW, de Waal Malefyt R, Coffman RL, O’Garra A. 2001. 36. Wright KJ, Seed PC, Hultgren SJ. 2005. Uropathogenic Escherichia coli Interleukin-10 and the interleukin-10 receptor. Annu Rev Immunol flagella aid in efficient urinary tract colonization. Infect Immun 73: 19:683–765. https://doi.org/10.1146/annurev.immunol.19.1.683. 7657–7668. https://doi.org/10.1128/IAI.73.11.7657-7668.2005. 20. Ouyang W, O’Garra A. 2019. IL-10 family cytokines IL-10 and IL-22: from 37. Mavromatis CH, Bokil NJ, Totsika M, Kakkanat A, Schaale K, Cannistraci

November/December 2019 Volume 4 Issue 6 e00545-19 msphere.asm.org 16 Rapid FliC-Driven IL-10 in UPEC UTI

CV, Ryu T, Beatson SA, Ulett GC, Schembri MA, Sweet MJ, Ravasi T. 2015. Physical extraction and fast protein liquid chromatography for purify- The co-transcriptome of uropathogenic Escherichia coli-infected mouse ing flagella filament from uropathogenic Escherichia coli for immune macrophages reveals new insights into host-pathogen interactions. assay. Front Cell Infect Microbiol 9:118. https://doi.org/10.3389/fcimb Cell Microbiol 17:730–746. https://doi.org/10.1111/cmi.12397. .2019.00118. 38. Duan Q, Zhou M, Zhu L, Zhu G. 2013. Flagella and bacterial patho- 58. Lynn DJ, Winsor GL, Chan C, Richard N, Laird MR, Barsky A, Gardy JL, genicity. J Basic Microbiol 53:1–8. https://doi.org/10.1002/jobm Roche FM, Chan TH, Shah N, Lo R, Naseer M, Que J, Yau M, Acab M, .201100335. Tulpan D, Whiteside MD, Chikatamarla A, Mah B, Munzner T, Hokamp 39. Hung C, Zhou Y, Pinkner JS, Dodson KW, Crowley JR, Heuser J, Chap- K, Hancock RE, Brinkman FS. 2008. InnateDB: facilitating systems-level man MR, Hadjifrangiskou M, Henderson JP, Hultgren SJ. 2013. Esche- analyses of the mammalian innate immune response. Mol Syst Biol richia coli biofilms have an organized and complex extracellular matrix 4:218. https://doi.org/10.1038/msb.2008.55. structure. mBio 4:e00645. https://doi.org/10.1128/mBio.00645-13. 59. Xia J, Benner MJ, Hancock RE. 2014. NetworkAnalyst–integrative ap- 40. Zhou M, Yang Y, Chen P, Hu H, Hardwidge PR, Zhu G. 2015. More than proaches for protein-protein interaction network analysis and visual a locomotive organelle: flagella in Escherichia coli. Appl Microbiol Bio- exploration. Nucleic Acids Res 42:W167–W174. https://doi.org/10.1093/ technol 99:8883–8890. https://doi.org/10.1007/s00253-015-6946-x. nar/gku443.

41. Ramos HC, Rumbo M, Sirard JC. 2004. Bacterial flagellins: mediators of 60. Sbrogio-Almeida ME, Mosca T, Massis LM, Abrahamsohn IA, Ferreira LC. Downloaded from pathogenicity and host immune responses in mucosa. Trends Microbiol 2004. Host and bacterial factors affecting induction of immune re- 12:509–517. https://doi.org/10.1016/j.tim.2004.09.002. sponses to flagellin expressed by attenuated Salmonella vaccine 42. Hajam IA, Dar PA, Shahnawaz I, Jaume JC, Lee JH. 2017. Bacterial strains. Infect Immun 72:2546–2555. https://doi.org/10.1128/iai.72.5 flagellin–a potent immunomodulatory agent. Exp Mol Med 49:e373. .2546-2555.2004. https://doi.org/10.1038/emm.2017.172. 61. Ciacci-Woolwine F, Kucera LS, Richardson SH, Iyer NP, Mizel SB. 1997. 43. Gewirtz AT. 2006. Flag in the crossroads: flagellin modulates innate and Salmonellae activate tumor necrosis factor alpha production in a hu- adaptive immunity. Curr Opin Gastroenterol 22:8–12. https://doi.org/ man promonocytic cell line via a released polypeptide. Infect Immun 10.1097/01.mog.0000194791.59337.28. 65:4624–4633. 44. Hayashi F, Smith KD, Ozinsky A, Hawn TR, Yi EC, Goodlett DR, Eng JK, 62. Eaves-Pyles T, Murthy K, Liaudet L, Virág L, Ross G, Soriano FG, Szabó C, Akira S, Underhill DM, Aderem A. 2001. The innate immune response to Salzman AL. 2001. Flagellin, a novel mediator of Salmonella-induced bacterial flagellin is mediated by Toll-like receptor 5. Nature 410: epithelial activation and systemic inflammation: I kappa B alpha deg- http://msphere.asm.org/ 1099–1103. https://doi.org/10.1038/35074106. radation, induction of nitric oxide synthase, induction of proinflamma- 45. Andersen-Nissen E, Smith KD, Strobe KL, Barrett SL, Cookson BT, Logan tory mediators, and cardiovascular dysfunction. J Immunol 166: SM, Aderem A. 2005. Evasion of Toll-like receptor 5 by flagellated 1248–1260. https://doi.org/10.4049/jimmunol.166.2.1248. bacteria. Proc Natl Acad SciUSA102:9247–9252. https://doi.org/10 63. Cunningham AF, Khan M, Ball J, Toellner KM, Serre K, Mohr E, MacLen- .1073/pnas.0502040102. nan IC. 2004. Responses to the soluble flagellar protein FliC are Th2, 46. Miao EA, Andersen-Nissen E, Warren SE, Aderem A. 2007. TLR5 and Ipaf: while those to FliC on Salmonella are Th1. Eur J Immunol 34: dual sensors of bacterial flagellin in the innate immune system. Semin 2986–2995. https://doi.org/10.1002/eji.200425403. Immunopathol 29:275–288. https://doi.org/10.1007/s00281-007-0078-z. 64. Braga CJ, Rittner GM, Munoz Henao JE, Teixeira AF, Massis LM, Sbrogio- 47. Lightfield KL, Persson J, Brubaker SW, Witte CE, von Moltke J, Dunipace Almeida ME, Taborda CP, Travassos LR, Ferreira LC. 2009. Paracoccid- EA, Henry T, Sun YH, Cado D, Dietrich WF, Monack DM, Tsolis RM, Vance ioides brasiliensis vaccine formulations based on the gp43-derived P10 RE. 2008. Critical function for Naip5 in inflammasome activation by a sequence and the Salmonella enterica FliC flagellin. Infect Immun conserved carboxy-terminal domain of flagellin. Nat Immunol 77:1700–1707. https://doi.org/10.1128/IAI.01470-08. 9:1171–1178. https://doi.org/10.1038/ni.1646. 65. Hawn TR, Verbon A, Lettinga KD, Zhao LP, Li SS, Laws RJ, Skerrett SJ, 48. Hatai H, Lepelley A, Zeng W, Hayden MS, Ghosh S. 2016. Toll-like Beutler B, Schroeder L, Nachman A, Ozinsky A, Smith KD, Aderem A. on January 6, 2020 by guest receptor 11 (TLR11) interacts with flagellin and profilin through dispa- 2003. A common dominant TLR5 stop codon polymorphism abolishes rate mechanisms. PLoS One 11:e0148987. https://doi.org/10.1371/ flagellin signaling and is associated with susceptibility to Legionnaires’ journal.pone.0148987. disease. J Exp Med 198:1563–1572. https://doi.org/10.1084/jem 49. Shi Z, Cai Z, Yu J, Zhang T, Zhao S, Smeds E, Zhang Q, Wang F, Zhao C, .20031220. Fu S, Ghosh S, Zhang D. 2012. Toll-like receptor 11 (TLR11) prevents 66. Hawn TR, Scholes D, Li SS, Wang H, Yang Y, Roberts PL, Stapleton AE, Salmonella penetration into the murine Peyer patches. J Biol Chem Janer M, Aderem A, Stamm WE, Zhao LP, Hooton TM. 2009. Toll-like 287:43417–43423. https://doi.org/10.1074/jbc.M112.411009. receptor polymorphisms and susceptibility to urinary tract infections in 50. Mathur R, Oh H, Zhang D, Park SG, Seo J, Koblansky A, Hayden MS, adult women. PLoS One 4:e5990. https://doi.org/10.1371/journal.pone Ghosh S. 2012. A mouse model of Salmonella typhi infection. Cell .0005990. 151:590–602. https://doi.org/10.1016/j.cell.2012.08.042. 67. Soutourina OA, Bertin PN. 2003. Regulation cascade of flagellar expres- 51. Mathur R, Zeng W, Hayden MS, Ghosh S. 2016. Mice lacking TLR11 sion in Gram-negative bacteria. FEMS Microbiol Rev 27:505–523. exhibit variable Salmonella typhi susceptibility. Cell 164:829–830. https://doi.org/10.1016/S0168-6445(03)00064-0. https://doi.org/10.1016/j.cell.2016.02.020. 68. Kakkanat A, Totsika M, Schaale K, Duell BL, Lo AW, Phan MD, Moriel DG, 52. Song J, Wilhelm CL, Wangdi T, Maira-Litran T, Lee S-J, Raetz M, Sturge Beatson SA, Sweet MJ, Ulett GC, Schembri MA. 2015. The role of H4 CR, Mirpuri J, Pei J, Grishin NV, McSorley SJ, Gewirtz AT, Bäumler AJ, Pier flagella in Escherichia coli ST131 virulence. Sci Rep 5:16149. https://doi GB, Galán JE, Yarovinsky F. 2016. Absence of TLR11 in mice does not .org/10.1038/srep16149. confer susceptibility to Salmonella Typhi. Cell 164:827–828. https://doi 69. Smith KD, Andersen-Nissen E, Hayashi F, Strobe K, Bergman MA, Barrett .org/10.1016/j.cell.2016.02.015. SL, Cookson BT, Aderem A. 2003. Toll-like receptor 5 recognizes a 53. Snyder JA, Haugen BJ, Buckles EL, Lockatell CV, Johnson DE, Donnen- conserved site on flagellin required for protofilament formation and berg MS, Welch RA, Mobley HL. 2004. Transcriptome of uropathogenic bacterial motility. Nat Immunol 4:1247–1253. https://doi.org/10.1038/ Escherichia coli during urinary tract infection. Infect Immun 72: ni1011. 6373–6381. https://doi.org/10.1128/IAI.72.11.6373-6381.2004. 70. Barrila J, Radtke AL, Crabbe A, Sarker SF, Herbst-Kralovetz MM, Ott CM, 54. Mulvey MA, Schilling JD, Martinez JJ, Hultgren SJ. 2000. Bad bugs and Nickerson CA. 2010. Organotypic 3D cell culture models: using the beleaguered bladders: interplay between uropathogenic Escherichia rotating wall vessel to study host-pathogen interactions. Nat Rev Mi- coli and innate host defenses. Proc Natl Acad SciUSA97:8829–8835. crobiol 8:791–801. https://doi.org/10.1038/nrmicro2423. https://doi.org/10.1073/pnas.97.16.8829. 71. Nagamatsu K, Kuwae A, Konaka T, Nagai S, Yoshida S, Eguchi M, Watanabe 55. Martinez JJ, Mulvey MA, Schilling JD, Pinkner JS, Hultgren SJ. 2000. M, Mimuro H, Koyasu S, Abe A. 2009. Bordetella evades the host immune Type 1 pilus-mediated bacterial invasion of bladder epithelial cells. system by inducing IL-10 through a type III effector, BopN. J Exp Med EMBO J 19:2803–2812. https://doi.org/10.1093/emboj/19.12.2803. 206:3073–3088. https://doi.org/10.1084/jem.20090494. 56. Ferenci T, Zhou Z, Betteridge T, Ren Y, Liu Y, Feng L, Reeves PR, Wang 72. Komoriya K, Shibano N, Higano T, Azuma N, Yamaguchi S, Aizawa SI. L. 2009. Genomic sequencing reveals regulatory mutations and recom- 1999. Flagellar proteins and type III-exported virulence factors are the binational events in the widely used MC4100 lineage of Escherichia coli predominant proteins secreted into the culture media of Salmonella K-12. J Bacteriol 191:4025–4029. https://doi.org/10.1128/JB.00118-09. typhimurium. Mol Microbiol 34:767–779. https://doi.org/10.1046/j.1365 57. Acharya D, Sullivan MJ, Duell BL, Eveno T, Schembri MA, Ulett GC. 2019. -2958.1999.01639.x.

November/December 2019 Volume 4 Issue 6 e00545-19 msphere.asm.org 17 Acharya et al.

73. Bermudez-Fajardo A, Stark A-K, El-Kadri R, Penichet ML, Hölzle K, nella challenge. Cell Rep 8:570–582. https://doi.org/10.1016/j.celrep Wittenbrink MM, Hölzle L, Oviedo-Orta E. 2011. The effect of Chlamy- .2014.06.028. dophila pneumoniae major outer membrane protein (MOMP) on mac- 90. Malik A, Kanneganti TD. 2017. Inflammasome activation and assem- rophage and T cell-mediated immune responses. Immunobiology 216: bly at a glance. J Cell Sci 130:3955–3963. https://doi.org/10.1242/ 152–163. https://doi.org/10.1016/j.imbio.2010.06.004. jcs.207365. 74. Pengal RA, Ganesan LP, Wei G, Fang H, Ostrowski MC, Tridandapani S. 91. Goncalves AV, Margolis SR, Quirino GFS, Mascarenhas DPA, Rauch I, 2006. Lipopolysaccharide-induced production of interleukin-10 is pro- Nichols RD, Ansaldo E, Fontana MF, Vance RE, Zamboni DS. 2019. moted by the serine/threonine kinase Akt. Mol Immunol 43:1557–1564. Gasdermin-D and caspase-7 are the key caspase-1/8 substrates down- https://doi.org/10.1016/j.molimm.2005.09.022. stream of the NAIP5/NLRC4 inflammasome required for restriction of 75. van den Bosch MWM, Palsson-Mcdermott E, Johnson DS, O’Neill LAJ. Legionella pneumophila. PLoS Pathog 15:e1007886. https://doi.org/10 2014. LPS induces the degradation of programmed cell death protein .1371/journal.ppat.1007886. 4 (PDCD4) to release Twist2, activating c-Maf transcription to promote 92. Feng T, Cong Y, Alexander K, Elson CO. 2012. Regulation of Toll-like interleukin-10 production. J Biol Chem 289:22980–22990. https://doi receptor 5 gene expression and function on mucosal dendritic cells. .org/10.1074/jbc.M114.573089. PLoS One 7:e35918. https://doi.org/10.1371/journal.pone.0035918. 76. Sheedy FJ, Palsson-McDermott E, Hennessy EJ, Martin C, O’Leary JJ, 93. Zhang D, Zhang G, Hayden MS, Greenblatt MB, Bussey C, Flavell RA, Downloaded from Ruan Q, Johnson DS, Chen Y, O’Neill LAJ. 2010. Negative regulation of Ghosh S. 2004. A toll-like receptor that prevents infection by uropatho- TLR4 via targeting of the proinflammatory tumor suppressor PDCD4 genic bacteria. Science 303:1522–1526. https://doi.org/10.1126/science by the microRNA miR-21. Nat Immunol 11:141–147. https://doi.org/ .1094351. 10.1038/ni.1828. 94. Dwyer DF, Barrett NA, Austen KF, Immunological Genome Project 77. Carey AJ, Tan CK, Ulett GC. 2012. Infection-induced IL-10 and JAK-STAT: Consortium. 2016. Expression profiling of constitutive mast cells reveals a review of the molecular circuitry controlling immune hyperactivity in a unique identity within the immune system. Nat Immunol 17: response to pathogenic microbes. JAKSTAT 1:159–167. https://doi.org/ 878–887. https://doi.org/10.1038/ni.3445. 10.4161/jkst.19918. 95. Cui B, Liu X, Fang Y, Zhou P, Zhang Y, Wang Y. 2018. Flagellin as a 78. Murdoch CC, Espenschied ST, Matty MA, Mueller O, Tobin DM, Rawls vaccine adjuvant. Expert Rev Vaccines 17:335–349. https://doi.org/10 JF. 2019. Intestinal serum amyloid A suppresses systemic neutrophil .1080/14760584.2018.1457443. http://msphere.asm.org/ activation and bactericidal activity in response to microbiota colo- 96. Taylor DN, Treanor JJ, Strout C, Johnson C, Fitzgerald T, Kavita U, Ozer nization. PLoS Pathog 15:e1007381. https://doi.org/10.1371/journal K, Tussey L, Shaw A. 2011. Induction of a potent immune response in .ppat.1007381. the elderly using the TLR-5 agonist, flagellin, with a recombinant 79. Erman A, Lakota K, Mrak-Poljsak K, Blango MG, Krizan-Hergouth V, hemagglutinin influenza-flagellin fusion vaccine (VAX125, STF2.HA1 SI). Mulvey MA, Sodin-Semrl S, Veranic P. 2012. Uropathogenic Escherichia Vaccine 29:4897–4902. https://doi.org/10.1016/j.vaccine.2011.05.001. coli induces serum amyloid a in mice following urinary tract and 97. Kruze D, Biro K, Holzbecher K, Andrial M, Bossart W. 1992. Protection by systemic inoculation. PLoS One 7:e32933. https://doi.org/10.1371/ a polyvalent vaccine against challenge infection and pyelonephritis. journal.pone.0032933. Urol Res 20:177–181. https://doi.org/10.1007/bf00296534. 80. Sivick KE, Schaller MA, Smith SN, Mobley HL. 2010. The innate immune 98. Brumbaugh AR, Mobley HL. 2012. Preventing urinary tract infection: response to uropathogenic Escherichia coli involves IL-17A in a murine progress toward an effective Escherichia coli vaccine. Expert Rev Vac- model of urinary tract infection. J Immunol 184:2065–2075. https://doi cines 11:663–676. https://doi.org/10.1586/erv.12.36. .org/10.4049/jimmunol.0902386. 99. Honko AN, Mizel SB. 2005. Effects of flagellin on innate and adaptive 81. Symington JW, Wang C, Twentyman J, Owusu-Boaitey N, Schwendener immunity. Immunol Res 33:83–101. https://doi.org/10.1385/IR:33:1:083.

R, Nunez G, Schilling JD, Mysorekar IU. 2015. ATG16L1 deficiency in 100. Ali ASM, Mowbray C, Lanz M, Stanton A, Bowen S, Varley CL, Hilton P, on January 6, 2020 by guest macrophages drives clearance of uropathogenic E. coli in an IL-1beta- Brown K, Robson W, Southgate J, Aldridge PD, Tyson-Capper A, Abraham dependent manner. Mucosal Immunol 8:1388–1399. https://doi.org/10 S, Pickard RS, Hall J. 2017. Targeting deficiencies in the TLR5 mediated .1038/mi.2015.7. vaginal response to treat female recurrent urinary tract infection. Sci Rep 82. Ching CB, Gupta S, Li B, Cortado H, Mayne N, Jackson AR, McHugh KM, 7:11039. https://doi.org/10.1038/s41598-017-10445-4. Becknell B. 2018. Interleukin-6/Stat3 signaling has an essential role in 101. Mobley HL, Green DM, Trifillis AL, Johnson DE, Chippendale GR, Locka- the host antimicrobial response to urinary tract infection. Kidney Int tell CV, Jones BD, Warren JW. 1990. Pyelonephritogenic Escherichia coli 93:1320–1329. https://doi.org/10.1016/j.kint.2017.12.006. and killing of cultured human renal proximal tubular epithelial cells: 83. Ingersoll MA, Kline KA, Nielsen HV, Hultgren SJ. 2008. G-CSF induction role of hemolysin in some strains. Infect Immun 58:1281–1289. early in uropathogenic Escherichia coli infection of the urinary tract 102. Mulvey MA, Schilling JD, Hultgren SJ. 2001. Establishment of a persis- modulates host immunity. Cell Microbiol 10:2568–2578. https://doi tent Escherichia coli reservoir during the acute phase of a bladder .org/10.1111/j.1462-5822.2008.01230.x. infection. Infect Immun 69:4572–4579. https://doi.org/10.1128/IAI.69.7 84. Akira S, Uematsu S, Takeuchi O. 2006. Pathogen recognition and innate .4572-4579.2001. immunity. Cell 124:783–801. https://doi.org/10.1016/j.cell.2006.02.015. 103. Totsika M, Beatson SA, Sarkar S, Phan MD, Petty NK, Bachmann N, 85. Schulke S, Wolfheimer S, Gadermaier G, Wangorsch A, Siebeneicher S, Szubert M, Sidjabat HE, Paterson DL, Upton M, Schembri MA. 2011. Briza P, Spreitzer I, Schiller D, Loeschner B, Uematsu S, Ryffel B, Akira S, Insights into a multidrug resistant Escherichia coli pathogen of the Waibler Z, Vieths S, Toda M, Scheurer S. 2014. Prevention of intestinal globally disseminated ST131 lineage: genome analysis and virulence allergy in mice by rflaA:Ova is associated with enforced antigen pro- mechanisms. PLoS One 6:e26578. https://doi.org/10.1371/journal.pone cessing and TLR5-dependent IL-10 secretion by mDC. PLoS One .0026578. 9:e87822. https://doi.org/10.1371/journal.pone.0087822. 104. Datsenko KA, Wanner BL. 2000. One-step inactivation of chromosomal 86. Andersen-Nissen E, Hawn TR, Smith KD, Nachman A, Lampano AE, genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci Uematsu S, Akira S, Aderem A. 2007. Cutting edge: Tlr5-/- mice are U S A 97:6640–6645. https://doi.org/10.1073/pnas.120163297. more susceptible to Escherichia coli urinary tract infection. J Immunol 105. Wang Q, Frye JG, McClelland M, Harshey RM. 2004. Gene expression 178:4717–4720. https://doi.org/10.4049/jimmunol.178.8.4717. patterns during swarming in Salmonella typhimurium: genes specific 87. Bens M, Vimont S, Ben Mkaddem S, Chassin C, Goujon JM, Balloy V, to surface growth and putative new motility and pathogenicity Chignard M, Werts C, Vandewalle A. 2014. Flagellin/TLR5 signalling genes. Mol Microbiol 52:169–187. https://doi.org/10.1111/j.1365 activates renal collecting duct cells and facilitates invasion and cellular -2958.2003.03977.x. translocation of uropathogenic Escherichia coli. Cell Microbiol 16: 106. Ulett GC, Webb RI, Schembri MA. 2006. Antigen-43-mediated autoag- 1503–1517. https://doi.org/10.1111/cmi.12306. gregation impairs motility in Escherichia coli. Microbiology 152: 88. Yang J, Liu Z, Xiao TS. 2017. Post-translational regulation of inflam- 2101–2110. https://doi.org/10.1099/mic.0.28607-0. masomes. Cell Mol Immunol 14:65–79. https://doi.org/10.1038/cmi 107. Gerhardt P, Murray RGE, Wood WA, Krieg NR. 1994. Chapter 4.4.1.1.a. .2016.29. Isolation of cell components–procedure for the isolation of flagellar 89. Chen KW, Groß CJ, Sotomayor FV, Stacey KJ, Tschopp J, Sweet MJ, filaments, p 83. In Gerhardt P (ed), Methods for general and molecular Schroder K. 2014. The neutrophil NLRC4 inflammasome selectively bacteriology. ASM Press, Washington, DC. promotes IL-1beta maturation without pyroptosis during acute Salmo- 108. Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, Batut P,

November/December 2019 Volume 4 Issue 6 e00545-19 msphere.asm.org 18 Rapid FliC-Driven IL-10 in UPEC UTI

Chaisson M, Gingeras TR. 2013. STAR: ultrafast universal RNA-seq aligner. 112. Givskov M, Eberl L, Christiansen G, Benedik MJ, Molin S. 1995. Bioinformatics 29:15–21. https://doi.org/10.1093/bioinformatics/bts635. Induction of phospholipase- and flagellar synthesis in Serratia liq- 109. Anders S, Pyl PT, Huber W. 2015. HTSeq–a Python framework to work uefaciens is controlled by expression of the flagellar master operon with high-throughput sequencing data. Bioinformatics 31:166–169. flhD. Mol Microbiol 15:445–454. https://doi.org/10.1111/j.1365-2958 https://doi.org/10.1093/bioinformatics/btu638. .1995.tb02258.x. 110. Love MI, Huber W, Anders S. 2014. Moderated estimation of fold 113. Wurpel DJ, Totsika M, Allsopp LP, Hartley-Tassell LE, Day CJ, Peters KM, change and dispersion for RNA-seq data with DESeq2. Genome Biol Sarkar S, Ulett GC, Yang J, Tiralongo J, Strugnell RA, Jennings MP, 15:550. https://doi.org/10.1186/s13059-014-0550-8. Schembri MA. 2014. F9 fimbriae of uropathogenic Escherichia coli are 111. Peters JE, Thate TE, Craig NL. 2003. Definition of the Escherichia coli expressed at low temperature and recognise Galbeta1-3GlcNAc- MC4100 genome by use of a DNA array. J Bacteriol 185:2017–2021. containing glycans. PLoS One 9:e93177. https://doi.org/10.1371/journal https://doi.org/10.1128/jb.185.6.2017-2021.2003. .pone.0093177. Downloaded from http://msphere.asm.org/ on January 6, 2020 by guest

November/December 2019 Volume 4 Issue 6 e00545-19 msphere.asm.org 19