Quick viewing(Text Mode)

RCH FRACP Genetics 2005 Complex Genetic Mechanisms

RCH FRACP Genetics 2005 Complex Genetic Mechanisms

RCHRCH FRACPFRACP GeneticsGenetics 20052005

ComplexComplex GeneticGenetic MechanismsMechanisms

Dr David Amor [email protected] The

• 3.1 gigabases of DNA • About 20,000 distributed unevenly across the genome – 17,19,22 dense – 4,8,13,18, Y are gene poor • Contained in 46 (and mitochondria) • Disease-causing known for about 1,000 genes • Less than 2% codes for • Over 50% repeat sequences of uncertain function Genetic Mechanisms of Disease

• Traditional – Single gene disorders • Autosomal dominant • Autosomal recessive • X-linked – Chromosomal – Polygenic • Novel/Complex Mechanisms/inheritance – – Trinucleotide repeat disorders – Mitochondrial (Maternal inheritance) – Mosaicism Genomic Imprinting Genomic Imprinting

• Epigenetic: a heritable (at the level of the and/or the organism) that is not encoded by DNA sequence • Imprinting: the differential expression of a gene according to its parent of origin

• Most genes are expressed equally from both paternal and maternal alleles • Genomic imprinting is the epigenetic marking of a gene based on its parental origin that results in monoallelic expression • Genomic imprinting differs from classical genetics in that the maternal and paternal complement of imprinted genes are not equivalent • The mechanism of imprinting appears to involve a parental specific methylation of CpG-rich domains, that is reset during gametogenesis Genomic imprinting and embryogenesis

• Approximately 100-200 imprinted genes thought to exist – Involved in many aspects of development including • Fetal and placental growth • Cell proliferation • Brain development • Adult behaviour • Haploid sperm + haploid egg → normal • Haploid sperm + haploid sperm → hydatidiform mole • Haploid egg + haploid egg → ovarian dermoid cyst

• Indicate that normal human development only proceeds when a complement of the paternal and maternal is present Imprinting in Genetic Diseases

• A number of human diseases are associated with imprinting defects • Diseases result from either – Loss of imprinting (resulting in diallelic rather than monoallelic expression) – (resulting in either x2 or no expression) • Imprinting changes can be either – congenital, e.g. • Prader-Willi syndrome, • Beckwith-Wiedemann syndrome, Russell-Silver syndrome – or acquired, e.g. • Altered expression of growth control genes in human cancer Uniparental disomy Uniparental disomy: When both copies of a pair are derived from the same parent. One cause of abnormal imprinting patterns.

Typically a result of ‘ rescue’ in early embryonic Example: Methylation status of the SNRPN gene x ! x ! x methylated ! unmethylated

Maternally derived ! xx chromosome 15

Paternally derived chromosome 15

xx This child would have Prader-Willi syndrome Prader-Willi syndrome

xx xx

Deletion on Both 15s are paternal 15 maternal

Absence of paternally functioning genes

•70% have paternally derived of 15q12 •25% have matUPD15 Angelman syndrome

xx xx

Deletion on Both 15s are maternal 15 paternal

Absence of maternally functioning genes

70 % maternally-derived deletion of 15q12 10 % patUPD15 5 % maternal UBE3A 10 % imprinting centre defects Beckwith-Wiedemann syndrome I

• 1 in 15,000 births • Macroglossia • Pre/post natal overgrowth • Anterior abdominal wall defects – Hemihypertrophy – neonatal hypoglycaemia – facial naevus flammeus – ear pits/creases – increased risk of abdominal tumours Genetic / Epigenetic Changes associated with BWS

• Chromosome changes associated with 11p (1%) • Segmental UPD11 (20%) – post-zygotic (mitotic) error • DNA mutations in CDKN1C (p57KIP2) (5% but 40% of familial cases) • Loss of imprinting (LOI)of gene (5-10%) – =hypermethylation (silencing) of maternal H19 ⇒ biallelic expression of IGF2 • LOI of LIT1 (40-50% incl some familial cases) – = loss of methylation of maternal LIT1 allele • LOI of both H19 and and LIT1 (rare other than in UPD) • No cause found (15-25%) Molecular basis of BWS

Tel H19 H19DMR IGF2 LIT1 KvDMR1 CDKN1C Cent Mat Expressed Silenced Silenced Ch3 Expressed

Pat Silenced Ch3 Expressed Expressed Silenced

• BWS thought to result from tipping the balance towards the paternal allele – Increased expression of growth promoting gene (? IGF2) – Silencing of growth inhibiting gene (? CDKN1C) Increased tumour risk in BWS

• Main risk is for Wilms tumour • Also increased risk for – Hepatoblastoma – Neuroblastoma – Adrenocortical carcinoma – Rhabdomyosarcoma • Overall tumour risk during childhood – Wiedemann (1983) 29/388 = 7.5% – DeBaun (1998) 13/183 = 7.1% – Goldman (2002) 22/159 = 14% – Total 64/730 = 8.8% Genotype- correlation

• Wiedemann (1983) reported association between hemihyperplasia and cancer – Hemihyperplasia in 12.5% total BWS – Hemihyperplasia in 40% BWS with cancer – Tumours seen in >25% of BWS with hemihyperplasia • Henry (1993) reported tumours more frequent in UPD11 • Lam (1999), Engel (2000), Weksberg (2001) and others showed tumours mainly associated with dysregulation of telomeric domain rather than centromeric domain

Tel H19 H19DMR IGF2 LIT1 KvDMR1 CDKN1C Cent Mat Expressed Silenced Silenced Ch3 Expressed

Pat Silenced Ch3 Expressed Expressed Silenced Tumour frequencies according to molecular defect (Rump et al. AJMG 2005)

• No Wilms tumour seen in patients with defect in centromeric domain (LOI LIT1 or CDKN1C mutation) • Other tumour types seen with comparable frequency in patients with defects in centromeric and telomeric domain

Tel H19 H19DMR IGF2 LIT1 KvDMR1 CDKN1C Cent Mat Expressed Silenced Silenced Ch3 Expressed

Pat Silenced Ch3 Expressed Expressed Silenced Non-Wilms tumours Wilms tumours Syndromes involving imprinted genes

• Syndromes involving imprinted genes – Beckwith–Wiedemann syndrome 11p15 – Prader–Willi syndrome 15q11-q12 – Angelman syndrome 15q11-q12 – Silver–Russell syndrome 7p11-p13, 7q31-qter – Transient mellitus 6q24 – PHP1b, Albright hereditary osteodystrophy, McCune–Albright 20q13 – Familial nonchromaffin paraganglioma 11q13 – Maternal and paternal UPD14 syndromes 14 • Syndromes that probably involve imprinted genes – X – Familial pre-eclampsia 10q22 – Maternal UPD2 syndrome 2 – Maternal UPD16 syndrome 16 • Complex genetic diseases with parent-of-origin effects – Asthma, atopy 4q35, 11q13, 16q24, 16p12 – 7q22-q31, 15q11-q13 – Hirschsprung disease 10q11 – Cornelia de Lange syndrome 3q26, 5p13 – Psoriasis 6p, 16q – Handedness 2p12-q11 – Type I diabetes 6p21, 6q25-q27, 10p11-q11, 16q – Type II diabetes 5p, 12q, 18p11 – Alcoholism 1, 2, 4, 8, 9, 16, – Alzheimer disease 10q, 12q – Bipolar affective disorder 1q, 2p, 2q, 6q, 13q, 14q, 16q, 18q – 2p12-q11, 22q12 Trinucleotide (triplet) Repeat Disorders Trinucleotide Repeats

• Repetition of three Nucleotides – e.g. CAGCAGCAGCAGCAGCAGCAGCAGCAG •Normal • Disease Causing When Expanded Beyond a Certain Threshold • Below That Threshold They Are Stable Both in and • Beyond a Certain Number the Repeat Can Be Unstable in Meiosis ± Mitosis (Dynamic mutations) Characteristics of trinucleotide repeats • Intergenerational Instability – Repeat Changes In Size From Parent To Offspring – Of Transmitting Parent Important – Some More Unstable From Father, Others From • Anticipation – More Severe Phenotype With Successive Generations – Best Example Is Myotonic Dystrophy • Premutations – Repeat Size Which Is Unstable But Does Not Result In A Phenotype – Best Example Is • Genotype-Phenotype correlation – For All Trinucleotide Repeat Disorders, the Larger the Repeat, the Earlier the Onset – Cannot Use the Repeat Size to Predict Phenotype With Accuracy • Eg: Myotonic Dystrophy Prenatal • Huntington Disease Predictive Test Location of trinucleotide expansions in

ATG TAA 5’ 3’

CGGCGGCGG GAAGAAGAA CAGCAGCAG CTGCTGCTG

Fragile X syndrome Friedreich Ataxia Huntington disease Myotonic dystrophy DRPLA SBMA SCA1 SCA2 SCA3 SCA6 SCA7 Myotonic Dystrophy

• Muscle Weakness / Cataract / Myotonia / • Progressive • CTG Repeat – <37- No Problem – >50- Disease – 50-100- Generally Mild – Congenital Form Often >1000 • Congenital Form Almost Always Maternally Inherited • Worse With Succeeding Generations ( Anticipation) Fragile X syndrome

• CGG Repeat • <50- Normal and No Risk for Offspring • 50-200= Premutation- Normal Intellect but Risk to Offspring of Females • >200- Males Have Intellectual Disability but Intellect in Females Is Variably Affected (50% intellectual disability)

Fragile X Premutation • Not Truly a Premutation – Females • Premature Ovarian Failure • “Shy” Personality – Males • Ataxia, tremor (FAXTAS) Huntington Disease 1

• Progressive Neurodegenerative Condition • Affects About 1:10 000 • Autosomal Dominant • Gene Identified In 1993 • CAG Repeat → Polyglutamine • Intergenerational instability – Repeats >29 Unstable – Much Greater For Male Than Female Transmission – Juvenile Onset HD Almost Always Paternally Inherited • = Huntingtin- Unknown Function • Likely That Expansion Confers A Toxic Gain Of Function Huntington Disease 2

• Onset 4-80 Years- Mean 40 Years • Inevitably Fatal • No Treatment Known To Alter The Natural History • Onset To Death Averages About 15 Years • Three Main Groups Of Symptoms – 1) Chorea – 2) Cognitive Impairment – 3) Psychiatric Symptoms Including Depression, Personality Changes • Able To Diagnose Presymptomatically • Able To Offer Prenatal Testing Huntington Disease: Repeat size vs. Age of Onset Pre-symptomatic testing for Huntington disease Pre-symptomatic testing for Huntington disease

Patient requests test Medical and genetic facts Risk based on pedigree Genetic Reasons for test counselling 1 Family issues, Plans following +ve or -ve result

Neurological Feedback on any signs/symptoms before test Explore past coping Psychologist results. Establishes contact with a neurologist styles, coping strategies, assessment reasons for test . . .

Blood taken on Duplicate samples analysed 2 occasions separately minimise lab errors

The model for pre- Genetic Result given, immediate plans symptomatic testing of counselling 2 discussed other severe late-onset genetic conditions eg. familial motor neuron Genetic Follow up by appointment or disease, familial dementias counselling 3, 4 ... phone as required. Genetic Ataxia

• Dominant – Clinical Classification As ADCA I-III – As Genes Were Linked And Then Cloned, They Were Called Spinocerebellar Ataxia (SCA) 1,2,3….. • Recessive – Friedreich’s Ataxia – Ataxia With Vitamin E Deficiency (AVED) – Ataxia Telangiectasia – Ataxia With Retained Reflexes Mitochondrial disease and mitochondrial inheritence Mitochondrial (maternal) inheritance

Mutations in the mitochondrial genome follow matrilineal inheritance

Circular double stranded DNA

Main features: Example: 1. Affected pass on the mutation to all Lebers Hereditary Optic Neuropathy children (though mutant loads may vary) (LHON) 2. Males cannot pass on the disorder 3. Variable expressivity is common Maternal inheritance: Bull sperm at

Sperm 50 mtDNA

Egg 100,000 mtDNA Mitochondrial genome (mtDNA)

OH Cyt b 12S rRNA ND6 BUT NOTE 16S rRNA • Adult-onset Mito Disorders ND5 – ~80% maternally inherited mtDNA mutations ND1 – others autosomal dominant,

ND4 sporadic, autosomal recessive ND2 ND4L ND3 • Childhood-onset Mito Disorders OL CO3 CO1 ATPase6 CO2 – 10 - 20% maternally ATPase8 inherited mtDNA mutations 16 569 base pairs – mostly autosomal recessive multiple copies – some sporadic, X-linked, 13 protein-coding genes autosomal dominant 22 tRNA genes 2 rRNA genes Unique Features of mtDNA

• Maternal Inheritance • Multiple Copies (2 to 10 per mitochondrion) • High Mutation Rate • Heteroplasmy – Co-existence of mutant & wildtype mtDNA • mtDNA bottleneck – In early , a small number of genomes are “selected” to repopulate the oocyte, allowing rapid shifts in heteroplasmy (resets the biological clock?) • Threshold Effect – Minimum critical number of mutant mtDNAs needed for each tissue to become dysfunctional • Tissue-specific segregation / selection Mitochrondrial Genetics: mtDNA Heteroplasmy, Bottleneck & Threshold Effect The clinical features of mitochondrial disease I: “Classical” presentation

• MELAS (Mitochondrial Encephalomyopathy with Lactic Acidosis and Stroke-like episodes) • MERRF (Myoclonic with Ragged Red Fibres) • Leber Hereditary Optic Neuropathy (LHON) • External Ophthalmoplegia • Kearns-Sayre syndrome • Chronic progressive external ophthalmoplegia • NARP (Neurogenic weakness Ataxia with Retinitis Pigmentosa) Clinical Features of Mitochondrial Disease II: “Any symptom, any organ or tissue, any age, any mode of inheritance”

Sensorineural deafness Optic atrophy Myelodysplasia Hypertrophic & dilated Aminoglycoside Retinitis pigmentosa Sideroblastic anemia cardiomyopathies sensitivity Cataracts Thrombocytopenia Conduction defects Cyclic neutropenia Endocardial fibroelastosis

Proximal tubulopathy Liver failure Paragangliomas Insulin secretion Glomerulosclerosis Chronic diarrhoea Hypoparathyroidism defects Nephropathy Villous atrophy Facial dysmorphism Exocrine dysfunction Pseudo-obstruction Hypertrichosis Mosaicism Mosaicism

• Mosaicism is the presence of two or more genetically different cell lines in an individual, all derived from a single zygote (c.f. chimerism) • Mosaicism can be for chromosomal or single gene disorders • Mosaicism may affect either somatic or tissues • Somatic Mosaicism can result in a range of abnormality depending on the amount and distribution of normal cells (e.g. , non-inherited cancers) • Gonadal mosaicism affects the germline tissues, explains the increased risk of recurrence in disorders due to new dominant mutations mosaicism Single gene disorders also exist in mosaic forms

Proteus syndrome Glossary Glossary 1

• Allele — An alternative form of a gene. • — A regulatory mechanism by which variations in the incorporation of a gene's exons, or coding regions, into messenger RNA lead to the production of more than one related protein, or isoform. • — All of the chromosomes except for the sex chromosomes and the mitochondrial chromosome. • — The constricted region near the center of a chromosome that has a critical role in cell division. • Codon — A three-base sequence of DNA or RNA that specifies a single amino acid. • Conservative mutation — A change in a DNA or RNA sequence that leads to the replacement of one amino acid with a biochemically similar one. • Epigenetic — A term describing nonmutational phenomena, such as methylation and modification, that modify the expression of a gene. • Exon — A region of a gene that codes for a protein. Glossary 2

• Frame-shift mutation — The addition or deletion of a number of DNA bases that is not a multiple of three, thus causing a shift in the reading frame of the gene. This shift leads to a change in the reading frame of all parts of the gene that are downstream from the mutation, often leading to a premature stop codon and ultimately, to a truncated protein. • Gain-of-function mutation — A mutation that produces a protein that takes on a new or enhanced function. • Genomics — The study of the functions and interactions of all the genes in the genome, including their interactions with environmental factors. • Genotype — A person's genetic makeup, as reflected by his or her DNA sequence. • Haplotype — A group of nearby alleles that are inherited together. • Heterozygous — Having two different alleles at a specific autosomal (or in a female) gene . • Homozygous — Having two identical alleles at a specific autosomal (or X chromosome in a female) gene locus. • Intron — A region of a gene that does not code for a protein. Glossary 3

• Linkage disequilibrium — The nonrandom association in a population of alleles at nearby loci. • Loss-of-function mutation — A mutation that decreases the production or function of a protein (or does both). • Missense mutation — Substitution of a single DNA base that results in a codon that specifies an alternative amino acid. • Monogenic — Caused by a mutation in a single gene. • Motif — A DNA-sequence pattern within a gene that, because of its similarity to sequences in other known genes, suggests a possible function of the gene, its protein product, or both. • Multifactorial — Caused by the interaction of multiple genetic and environmental factors. • Nonconservative mutation — A change in the DNA or RNA sequence that leads to the replacement of one amino acid with a very dissimilar one. • Nonsense mutation — Substitution of a single DNA base that results in a stop codon, thus leading to the truncation of a protein. Glossary 4

• Penetrance — The likelihood that a person carrying a particular mutant gene will have an altered phenotype. • Phenotype — The clinical presentation or expression of a specific gene or genes, environmental factors, or both. • Point mutation — The substitution of a single DNA base in the normal DNA sequence. • Regulatory mutation — A mutation in a region of the genome that does not encode a protein but affects the expression of a gene. • Repeat sequence — A stretch of DNA bases that occurs in the genome in multiple identical or closely related copies. • Silent mutation — Substitution of a single DNA base that produces no change in the amino acid sequence of the encoded protein. • Single-nucleotide polymorphism (SNP) — A common variant in the genome sequence; the contains about 10 million SNPs. • Stop codon — A codon that leads to the termination of a protein rather than to the addition of an amino acid. The three stop codons are TGA, TAA, and TAG. Appendix:

Evolutionary hypotheses for the origin of imprinting

(From Morison et al. Trends in Genetics 2005) Genetic conflict hypothesis (GCH):

Because of multiple paternity, a mother's offspring are equally related to her but can be less related to each other. A mother's genetic interests are best served by keeping control over the distribution of her resources to these offspring, sharing it equally among them. Mothers can retain such control by inactivating fetal growth-enhancing genes that they pass on to their offspring. A father's fitness is enhanced, however, by enabling his offspring to obtain as much of this resource as maximizes their survival, even at the expense of half-sibs and the mother. Inactivating fetal growth inhibitors in his offspring serves this purpose. Ovarian time bomb hypothesis (OTH):

The spontaneous development of an unfertilized egg in an ovary is a form of ovarian trophoblastic disease, essentially ovarian cancer. Inactivating the only (maternal) copy of early-acting growth enhancers lowers this risk, as does upregulating any growth inhibitors. This second change could leave the fetus with too much inhibitor, an imbalance that can be corrected by downregulating the paternal copy. Thus, both the GCH and the OTH predict that fetal growth-affecting genes are likely to be targets of imprinting, and that growth enhancers should be maternally attenuated and growth inhibitors, paternally so. X-linked sex-specific selection hypothesis (XSSH):

Early in development, female eutherians randomly inactivate most of one of the two X chromosomes in each cell. Consequently, they are a mosaic of tissues with active paternal or maternal X chromosomes. Males, however, have only a maternal X, which is always active. Thus changes to the level of expression of genes on the paternal X will affect females only; changes to the maternal X will affect males more than females. Thus any selection pressure that differs between would be augmented by imprinting. In particular, selection for larger males – common in mammals – could be aided by inactivating maternal X-linked growth inhibitors and paternal X-linked growth enhancers, the opposite predictions of the GCH and the OTH. Sexually antagonistic selection hypothesis (SASH):

• This idea is an extension of the XSSH to autosomal loci and suggests that loci with different levels of optimal expression in males and females are likely to be imprinted. Imprinting will be favoured if the benefits to offspring of one sex outweigh the costs to those of the other. Moreover, the SASH suggests that – provided some molecular mechanism exists – loci could be subject to sex-specific imprinting (e.g. being maternally silenced in sons but not daughters).

Top View