DOCSLIB.ORG

RCH FRACP Genetics 2005 Complex Genetic Mechanisms

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
RCH FRACP Genetics 2005 Complex Genetic Mechanisms RCHRCH FRACPFRACP GeneticsGenetics 20052005 ComplexComplex GeneticGenetic MechanismsMechanisms Dr David Amor [email protected] The human genome • 3.1 gigabases of DNA • About 20,000 genes distributed unevenly across the genome – 17,19,22 gene dense – 4,8,13,18, Y are gene poor • Contained in 46 chromosomes (and mitochondria) • Disease-causing mutations known for about 1,000 genes • Less than 2% codes for proteins • Over 50% repeat sequences of uncertain function Genetic Mechanisms of Disease • Traditional – Single gene disorders • Autosomal dominant • Autosomal recessive • X-linked – Chromosomal – Polygenic • Novel/Complex Mechanisms/inheritance – Genomic imprinting – Trinucleotide repeat disorders – Mitochondrial (Maternal inheritance) – Mosaicism Genomic Imprinting Genomic Imprinting • Epigenetic: a heritable (at the level of the cell and/or the organism) that is not encoded by DNA sequence • Imprinting: the differential expression of a gene according to its parent of origin • Most genes are expressed equally from both paternal and maternal alleles • Genomic imprinting is the epigenetic marking of a gene based on its parental origin that results in monoallelic expression • Genomic imprinting differs from classical genetics in that the maternal and paternal complement of imprinted genes are not equivalent • The mechanism of imprinting appears to involve a parental specific methylation of CpG-rich domains, that is reset during gametogenesis Genomic imprinting and embryogenesis • Approximately 100-200 imprinted genes thought to exist – Involved in many aspects of development including • Fetal and placental growth • Cell proliferation • Brain development • Adult behaviour • Haploid sperm + haploid egg → normal embryo • Haploid sperm + haploid sperm → hydatidiform mole • Haploid egg + haploid egg → ovarian dermoid cyst • Indicate that normal human development only proceeds when a complement of the paternal and maternal genomes is present Imprinting in Genetic Diseases • A number of human diseases are associated with imprinting defects • Diseases result from either – Loss of imprinting (resulting in diallelic rather than monoallelic expression) – Uniparental disomy (resulting in either x2 or no expression) • Imprinting changes can be either – congenital, e.g. • Prader-Willi syndrome, Angelman syndrome • Beckwith-Wiedemann syndrome, Russell-Silver syndrome – or acquired, e.g. • Altered expression of growth control genes in human cancer Uniparental disomy Uniparental disomy: When both copies of a chromosome pair are derived from the same parent. One cause of abnormal imprinting patterns. Typically a result of ‘trisomy rescue’ in early embryonic life Example: Chromosome 15 Methylation status of the SNRPN gene x ! x ! x methylated ! unmethylated Maternally derived ! xx chromosome 15 Paternally derived chromosome 15 xx This child would have Prader-Willi syndrome Prader-Willi syndrome xx xx Deletion on Both 15s are paternal 15 maternal Absence of paternally functioning genes •70% have paternally derived deletion of 15q12 •25% have matUPD15 Angelman syndrome xx xx Deletion on Both 15s are maternal 15 paternal Absence of maternally functioning genes 70 % maternally-derived deletion of 15q12 10 % patUPD15 5 % maternal UBE3A mutation 10 % imprinting centre defects Beckwith-Wiedemann syndrome I • 1 in 15,000 births • Macroglossia • Pre/post natal overgrowth • Anterior abdominal wall defects – Hemihypertrophy – neonatal hypoglycaemia – facial naevus flammeus – ear pits/creases – increased risk of abdominal tumours Genetic / Epigenetic Changes associated with BWS • Chromosome changes associated with 11p (1%) • Segmental UPD11 (20%) – post-zygotic (mitotic) error • DNA mutations in CDKN1C (p57KIP2) (5% but 40% of familial cases) • Loss of imprinting (LOI)of H19 gene (5-10%) – =hypermethylation (silencing) of maternal H19 ⇒ biallelic expression of IGF2 • LOI of LIT1 (40-50% incl some familial cases) – = loss of methylation of maternal LIT1 allele • LOI of both H19 and and LIT1 (rare other than in UPD) • No cause found (15-25%) Molecular basis of BWS Tel H19 H19DMR IGF2 LIT1 KvDMR1 CDKN1C Cent Mat Expressed Silenced Silenced Ch3 Expressed Pat Silenced Ch3 Expressed Expressed Silenced • BWS thought to result from tipping the balance towards the paternal allele – Increased expression of growth promoting gene (? IGF2) – Silencing of growth inhibiting gene (? CDKN1C) Increased tumour risk in BWS • Main risk is for Wilms tumour • Also increased risk for – Hepatoblastoma – Neuroblastoma – Adrenocortical carcinoma – Rhabdomyosarcoma • Overall tumour risk during childhood – Wiedemann (1983) 29/388 = 7.5% – DeBaun (1998) 13/183 = 7.1% – Goldman (2002) 22/159 = 14% – Total 64/730 = 8.8% Genotype-Phenotype correlation • Wiedemann (1983) reported association between hemihyperplasia and cancer – Hemihyperplasia in 12.5% total BWS – Hemihyperplasia in 40% BWS with cancer – Tumours seen in >25% of BWS with hemihyperplasia • Henry (1993) reported tumours more frequent in UPD11 • Lam (1999), Engel (2000), Weksberg (2001) and others showed tumours mainly associated with dysregulation of telomeric domain rather than centromeric domain Tel H19 H19DMR IGF2 LIT1 KvDMR1 CDKN1C Cent Mat Expressed Silenced Silenced Ch3 Expressed Pat Silenced Ch3 Expressed Expressed Silenced Tumour frequencies according to molecular defect (Rump et al. AJMG 2005) • No Wilms tumour seen in patients with defect in centromeric domain (LOI LIT1 or CDKN1C mutation) • Other tumour types seen with comparable frequency in patients with defects in centromeric and telomeric domain Tel H19 H19DMR IGF2 LIT1 KvDMR1 CDKN1C Cent Mat Expressed Silenced Silenced Ch3 Expressed Pat Silenced Ch3 Expressed Expressed Silenced Non-Wilms tumours Wilms tumours Syndromes involving imprinted genes • Syndromes involving imprinted genes – Beckwith–Wiedemann syndrome 11p15 – Prader–Willi syndrome 15q11-q12 – Angelman syndrome 15q11-q12 – Silver–Russell syndrome 7p11-p13, 7q31-qter – Transient neonatal diabetes mellitus 6q24 – PHP1b, Albright hereditary osteodystrophy, McCune–Albright 20q13 – Familial nonchromaffin paraganglioma 11q13 – Maternal and paternal UPD14 syndromes 14 • Syndromes that probably involve imprinted genes – Turner syndrome phenotypes X – Familial pre-eclampsia 10q22 – Maternal UPD2 syndrome 2 – Maternal UPD16 syndrome 16 • Complex genetic diseases with parent-of-origin effects – Asthma, atopy 4q35, 11q13, 16q24, 16p12 – Autism 7q22-q31, 15q11-q13 – Hirschsprung disease 10q11 – Cornelia de Lange syndrome 3q26, 5p13 – Psoriasis 6p, 16q – Handedness 2p12-q11 – Type I diabetes 6p21, 6q25-q27, 10p11-q11, 16q – Type II diabetes 5p, 12q, 18p11 – Alcoholism 1, 2, 4, 8, 9, 16, – Alzheimer disease 10q, 12q – Bipolar affective disorder 1q, 2p, 2q, 6q, 13q, 14q, 16q, 18q – Schizophrenia 2p12-q11, 22q12 Trinucleotide (triplet) Repeat Disorders Trinucleotide Repeats • Repetition of three Nucleotides – e.g. CAGCAGCAGCAGCAGCAGCAGCAGCAG •Normal • Disease Causing When Expanded Beyond a Certain Threshold • Below That Threshold They Are Stable Both in Mitosis and Meiosis • Beyond a Certain Number the Repeat Can Be Unstable in Meiosis ± Mitosis (Dynamic mutations) Characteristics of trinucleotide repeats • Intergenerational Instability – Repeat Changes In Size From Parent To Offspring – Sex Of Transmitting Parent Important – Some More Unstable From Father, Others From Mother • Anticipation – More Severe Phenotype With Successive Generations – Best Example Is Myotonic Dystrophy • Premutations – Repeat Size Which Is Unstable But Does Not Result In A Phenotype – Best Example Is Fragile X Syndrome • Genotype-Phenotype correlation – For All Trinucleotide Repeat Disorders, the Larger the Repeat, the Earlier the Onset – Cannot Use the Repeat Size to Predict Phenotype With Accuracy • Eg: Myotonic Dystrophy Prenatal • Huntington Disease Predictive Test Location of trinucleotide expansions in humans ATG TAA 5’ 3’ CGGCGGCGG GAAGAAGAA CAGCAGCAG CTGCTGCTG Fragile X syndrome Friedreich Ataxia Huntington disease Myotonic dystrophy DRPLA SBMA SCA1 SCA2 SCA3 SCA6 SCA7 Myotonic Dystrophy • Muscle Weakness / Cataract / Myotonia / Infertility • Progressive • CTG Repeat – <37- No Problem – >50- Disease – 50-100- Generally Mild – Congenital Form Often >1000 • Congenital Form Almost Always Maternally Inherited • Worse With Succeeding Generations ( Anticipation) Fragile X syndrome • CGG Repeat • <50- Normal and No Risk for Offspring • 50-200= Premutation- Normal Intellect but Risk to Offspring of Females • >200- Males Have Intellectual Disability but Intellect in Females Is Variably Affected (50% intellectual disability) Fragile X Premutation • Not Truly a Premutation – Females • Premature Ovarian Failure • “Shy” Personality – Males • Ataxia, tremor (FAXTAS) Huntington Disease 1 • Progressive Neurodegenerative Condition • Affects About 1:10 000 • Autosomal Dominant • Gene Identified In 1993 • CAG Repeat → Polyglutamine • Intergenerational instability – Repeats >29 Unstable – Much Greater For Male Than Female Transmission – Juvenile Onset HD Almost Always Paternally Inherited • Protein = Huntingtin- Unknown Function • Likely That Expansion Confers A Toxic Gain Of Function Huntington Disease 2 • Onset 4-80 Years- Mean 40 Years • Inevitably Fatal • No Treatment Known To Alter The Natural History • Onset To Death Averages About 15 Years • Three Main Groups Of Symptoms – 1) Chorea – 2) Cognitive Impairment – 3) Psychiatric Symptoms Including Depression, Personality Changes • Able To Diagnose Presymptomatically • Able To Offer Prenatal
Load more

Recommended publications
  • Impact of Fluorescence in Situ Hybridization in the Detection of Cryptic Fusion Transcript PML/RARA and a Complex T(5;15;17) in a Case of Acute Promyelocytic Leukemia
    Impact of Fluorescence in Situ Hybridization in the Detection of Cryptic Fusion Transcript PML/RARA and A Complex t(5;15;17) in a Case of Acute Promyelocytic Leukemia Gönül OGUR*,****, Turgay FEN**, Gülsan SUCAK***, Pierre HEIMANN*, Gaye CANKUÞ****, Rauf HAZNEDAR**** * Univérsité Libre de Bruxelles, Hôpital Erasme, Service Génétique Medicale, Bruxelles, BELGIUM ** Oncology Hospital, Ankara, TURKEY *** Adult Hematology Department, Faculty of Medicine, Gazi University, Ankara, TURKEY **** GEN-MED Genetic Diseases and Prenatal Diagnosis Center, Ankara, TURKEY ABSTRACT Genetic aspects of a 28 year-old female patient with typical morphological and clinical features of acute promyelocytic leukemia is presented. Pml/rara fusion transcript and a complex translocation involving chromosomes 5, 15 and 17 were detected by fluorescence in situ hybridization (FISH) tech- nique which was applied as in adjunct to conventional cytogenetics. The patient deceased soon in spite of the immediate ATRA and cytostatic therapy. Key Words: FISH, PML/RARA, Acute promyelocytic leukemia. Turk J Haematol 2000;17(4):207-212. INTRODUCTION sociated with t(15;17)(q22;q12-21). The diagnosis of APL and the detection of residual disease are Acute promyelocytic leukemia (APL) is a rara based on the presence of this translocati- distinct subtype of myeloid leukemia characterized on[1,3,4,5,6,7,15]. Rarely alternative balanced trans- by invasion of bone marrow by hypergranular le- locations have been described in subtypes of APL, ukemia cells, by specific translocations almost al- and as more cases are being evaluated, complex, ways involving chromosome 17 and by a high sen- variant translocations are increasingly recogni- sitivity of the promyelocytic blasts to retinoic acid zed[17,19,20,22, 24].
    [Show full text]
  • Rapid Molecular Assays to Study Human Centromere Genomics
    Downloaded from genome.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press Method Rapid molecular assays to study human centromere genomics Rafael Contreras-Galindo,1 Sabrina Fischer,1,2 Anjan K. Saha,1,3,4 John D. Lundy,1 Patrick W. Cervantes,1 Mohamad Mourad,1 Claire Wang,1 Brian Qian,1 Manhong Dai,5 Fan Meng,5,6 Arul Chinnaiyan,7,8 Gilbert S. Omenn,1,9,10 Mark H. Kaplan,1 and David M. Markovitz1,4,11,12 1Department of Internal Medicine, University of Michigan, Ann Arbor, Michigan 48109, USA; 2Laboratory of Molecular Virology, Centro de Investigaciones Nucleares, Facultad de Ciencias, Universidad de la República, Montevideo, Uruguay 11400; 3Medical Scientist Training Program, University of Michigan, Ann Arbor, Michigan 48109, USA; 4Program in Cancer Biology, University of Michigan, Ann Arbor, Michigan 48109, USA; 5Molecular and Behavioral Neuroscience Institute, University of Michigan, Ann Arbor, Michigan 48109, USA; 6Department of Psychiatry, University of Michigan, Ann Arbor, Michigan 48109, USA; 7Michigan Center for Translational Pathology and Comprehensive Cancer Center, University of Michigan Medical School, Ann Arbor, Michigan 48109, USA; 8Howard Hughes Medical Institute, Chevy Chase, Maryland 20815, USA; 9Department of Human Genetics, 10Departments of Computational Medicine and Bioinformatics, University of Michigan, Ann Arbor, Michigan 48109, USA; 11Program in Immunology, University of Michigan, Ann Arbor, Michigan 48109, USA; 12Program in Cellular and Molecular Biology, University of Michigan, Ann Arbor, Michigan 48109, USA The centromere is the structural unit responsible for the faithful segregation of chromosomes. Although regulation of cen- tromeric function by epigenetic factors has been well-studied, the contributions of the underlying DNA sequences have been much less well defined, and existing methodologies for studying centromere genomics in biology are laborious.
    [Show full text]
  • Chromosome Translocation, Recombination, and Nondisjunction
    Am. J. Hum. Genet. 58:1008-1016, 1996 The Impact of Imprinting: Prader-Willi Syndrome Resulting from Chromosome Translocation, Recombination, and Nondisjunction SuEllen Toth-Fejel,'"2 Susan Olson,",2 Kristine Gunter,'2' Franklin Quan," 3'4 Jan Wolford,3 Bradley W. Popovich,"3'4 and R. Ellen Magenis1,2 'Department of Molecular and Medical Genetics, 2Clinical and Research Cytogenetics Laboratories, and 3DNA Diagnostic Laboratory, Oregon Health Sciences University; and 4Shriners Hospital for Crippled Children, Portland Summary Several genetic mechanisms are responsible for the devel- Prader-Willi syndrome (PWS) is most often the result of opment of PWS. The majority (75%) of patients carry a deletion of bands qll.2-q13 of the paternally derived a deletion of the paternally derived chromosome i5qi1 - chromosome 15, but it also occurs either because of q13 (Ledbetter et al. 1981; Butler and Palmer 1983), maternal uniparental disomy (UPD) of this region or, with most nondeletion PWS patients having maternal rarely, from a methylation imprinting defect. A signifi- uniparental disomy (UPD) of chromosome 15 (Nicholls cant number of cases are due to structural rearrange- 1994). A small number of chromosomally normal pa- ments of the pericentromeric region of chromosome 15. tients carry an imprinting defect (Reis et al. 1994). PWS We report two cases of PWS with UPD in which there may be the clinical outcome of any chromosome 15 was a meiosis I nondisjunction error involving an altered structural change in which there has been a physical or chromosome 15 produced by both a translocation event functional loss of genetic material in the imprinted PWS between the heteromorphic satellite regions of chromo- critical region.
    [Show full text]
  • Key Features of Genomic Imprinting During Mammalian Spermatogenesis
    ogy: iol Cu ys r h re P n t & R y e s Anatomy & Physiology: Current m e o a t r a c n h Štiavnická et al., Anat Physiol 2016, 6:5 A Research ISSN: 2161-0940 DOI: 10.4172/2161-0940.1000236 Review Article Open Access Key Features of Genomic Imprinting during Mammalian Spermatogenesis: Perspectives for Human assisted Reproductive Therapy: A Review Miriama Štiavnická*1,2, Olga García Álvarez1, Jan Nevoral1,2, Milena Králíčková1,2 and Peter Sutovsky3,4 1Laboratory of Reproductive Medicine, Biomedical Centre, Department of Histology and Embryology, Charles University in Prague, Czech Republic 2Department of Histology and Embryology, Charles University in Prague, Czech Republic 3Division of Animal Science, and Departments of Obstetrics, Gynecology and Women’s Health, University of Missouri, Columbia, MO, USA 4Departments of Obstetrics, Gynaecology and Women’s Health, University of Missouri, Columbia, MO, USA *Corresponding author: Miriama Štiavnická, Laboratory of Reproductive Medicine, Biomedical Centre, Department of Histology and Embryology, Charles University in Prague, Czech Republic, Tel: +420377593808; E-mail: [email protected] Received date: June 23, 2016; Accepted date: August 16, 2016; Published date: August 23, 2016 Copyright: © 2016 Štiavnická M, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Abstract Increasing influence of epigenetics is obvious in all medical fields including reproductive medicine. Epigenetic alterations of the genome and associated post-translational modifications of DNA binding histones equally impact gamete development and maturation, as well as embryogenesis.
    [Show full text]
  • Genomic Imprinting, Action, and Interaction of Maternal and Fetal Genomes
    Genomic imprinting, action, and interaction of maternal and fetal genomes Eric B. Keverne1 Sub-Department of Animal Behaviour, University of Cambridge, Cambridge CB23 8AA, United Kingdom Edited by Donald W. Pfaff, The Rockefeller University, New York, NY, and approved October 16, 2014 (received for review July 9, 2014) Mammalian viviparity (intrauterine development of the fetus) and striatum (4). Moreover, the growth of the brain in parthe- introduced a new dimension to brain development, with the fetal nogenetic chimeras was enhanced by this increased gene dosage hypothalamus and fetal placenta developing at a time when the from maternally expressed alleles, whereas the brains of an- fetal placenta engages hypothalamic structures of the maternal drogenetic chimeras were smaller, especially relative to body generation. Such transgenerational interactions provide a basis for weight (3). These spatially distinct anatomical outcomes matched ensuring optimal maternalism in the next generation. This success to those brain regions found to be affected in human clinical has depended on genomic imprinting and a biased role of the studies on brain dysfunction seen in Prader–Willi and Angelman’s matriline. Maternal methylation imprints determine parent of origin syndromes (5, 6). The uniparental disomies of restricted chromo- expression of genes fundamental to both placental and hypotha- somal regions found in these clinical disorders were congruent lamic development. The matriline takes a further leading role for with the neural distribution of the chimeric cells. transgenerational reprogramming of these imprints. Developmen- Since these early findings, ∼100 genes have been identified tal errors are minimized by the tight control that imprinted genes to be “imprinted,” the majority of which have been shown to be have on regulation of downstream evolutionary expanded gene expressed in the placenta (7).
    [Show full text]
  • Functional Epialleles at an Endogenous Human Centromere
    Functional epialleles at an endogenous human centromere Kristin A. Maloneya,b,1,2, Lori L. Sullivana,2, Justyne E. Mathenya, Erin D. Stromea, Stephanie L. Merretta, Alyssa Ferrisc, and Beth A. Sullivana,b,3 aDuke Institute for Genome Sciences and Policy, Duke University, Durham, NC 27708; bDepartment of Molecular Genetics and Microbiology, Duke University Medical Center, Durham, NC 27710; and cNorth Carolina School of Science and Mathematics, Durham, NC 27705 Edited by Steven Henikoff, Fred Hutchinson Cancer Research Center, Seattle, WA, and approved July 9, 2012 (received for review February 22, 2012) Human centromeres are defined by megabases of homogenous monomers are arranged tandemly. A defined number of mono- alpha-satellite DNA arrays that are packaged into specialized chro- mers comprise a higher-order repeat (HOR) unit that then is re- matin marked by the centromeric histone variant, centromeric pro- peated hundreds to thousands of times, producing highly tein A (CENP-A). Although most human chromosomes have a single homogenous arrays that are 97–100% identical. Most Homo sa- higher-order repeat (HOR) array of alpha satellites, several chromo- piens chromosomes (HSA) are thought to have a single homoge- somes have more than one HOR array. Homo sapiens chromosome neous alpha-satellite array. However, some chromosomes, such as 17 (HSA17) has two juxtaposed HOR arrays, D17Z1 and D17Z1-B. HSA1, HSA5, HSA7, and HSA15, have two or more distinct arrays Only D17Z1 has been linked to CENP-A chromatin assembly. Here, that are each defined by different HORs (13–15). On HSA5 and we use human artificial chromosome assembly assays to show that HSA7, the two alpha-satellite arrays are separated by up to both D17Z1 and D17Z1-B can support de novo centromere assembly a megabase.
    [Show full text]
  • 15 Chromosome Chapter
    Chromosome 15 ©Chromosome Disorder Outreach Inc. (CDO) Technical genetic content provided by Dr. Iosif Lurie, M.D. Ph.D Medical Geneticist and CDO Medical Consultant/Advisor. Ideogram courtesy of the University of Washington Department of Pathology: ©1994 David Adler.hum_15.gif Introduction Chromosome 15 (as well as chromosomes 13 and 14) is an acrocentric chromosome. Its short arm does not contain any genes. The genetic length of the long arm of chromosome 15 is 81 Mb. It is ~3% of the total human genome. The length of its short arm is ~20 Mb. Chromosome 15 contains from 700 to 1,000 genes. At least 10% of these genes are important for the development of the body plan and sustaining numerous functional activities. There are 2 peculiar characteristics of this chromosome. 1. The structure of some regions of this chromosome (15q11.2 and 15q13.3) is predisposed to a relatively frequent occurrence of microdeletions and microduplications of these areas. Of course, diagnosis of these microanomalies is possible only using sophisticated molecular methods. An increasing amount of evidence regarding the clinical significance of these microanomalies shows that they make a particular niche between “standard” deletions (leading to some defects in all affected persons) and normal variants. Increased frequency of these microanomalies was found in patients with different types of pathology such as: schizophrenia, seizures, obesity, and autism. At the same time, many persons with these abnormalities (including many parents of affected persons) do not have any phenotypic abnormalities. Most likely, these microdeletions have to be considered as “risk factors”, but not the only cause of any type of pathology.
    [Show full text]
  • Chromosomal Disorders
    Understanding Genetic Tests and How They Are Used David Flannery,MD Medical Director American College of Medical Genetics and Genomics Starting Points • Genes are made of DNA and are carried on chromosomes • Genetic disorders are the result of alteration of genetic material • These changes may or may not be inherited Objectives • To explain what variety of genetic tests are now available • What these tests entail • What the different tests can detect • How to decide which test(s) is appropriate for a given clinical situation Types of Genetic Tests . Cytogenetic . (Chromosomes) . DNA . Metabolic . (Biochemical) Chromosome Test (Karyotype) How a Chromosome test is Performed Medicaldictionary.com Use of Karyotype http://medgen.genetics.utah.e du/photographs/diseases/high /peri001.jpg Karyotype Detects Various Chromosome Abnormalities • Aneuploidy- to many or to few chromosomes – Trisomy, Monosomy, etc. • Deletions – missing part of a chromosome – Partial monosomy • Duplications – extra parts of chromosomes – Partial trisomy • Translocations – Balanced or unbalanced Karyotyping has its Limits • Many deletions or duplications that are clinically significant are not visible on high-resolution karyotyping • These are called “microdeletions” or “microduplications” Microdeletions or microduplications are detected by FISH test • Fluorescence In situ Hybridization FISH fluorescent in situ hybridization: (FISH) A technique used to identify the presence of specific chromosomes or chromosomal regions through hybridization (attachment) of fluorescently-labeled DNA probes to denatured chromosomal DNA. Step 1. Preparation of probe. A probe is a fluorescently-labeled segment of DNA comlementary to a chromosomal region of interest. Step 2. Hybridization. Denatured chromosomes fixed on a microscope slide are exposed to the fluorescently-labeled probe. Hybridization (attachment) occurs between the probe and complementary (i.e., matching) chromosomal DNA.
    [Show full text]
  • Genomic Imprinting : a General Overview
    Vol. 8(2), pp. 18-34, October 2013 DOI: 10.5897/BMBR07.003 ISSN 1538-2273 © 2013 Academic Journals Biotechnology and Molecular Biology Reviews http://www.academicjournals.org/BMBR Review Genomic imprinting: A general overview Muniswamy K.1* and Thamodaran P.2 1Division of Veterinary Biotechnology, Indian Veterinary Research Institute, Izatnagar- 243 122, India. 2Division of Veterinary Microbiology, TANUVAS, Chennai-600 007, India. Accepted 27 August, 2013 Usually, most of the genes are biallelically expressed but imprinted gene exhibit monoallelic expression based on their parental origin. Genomic imprinting exhibit differences in control between flowering plants and mammals, for instance, imprinted gene are specifically activated by demethylation, rather than targeted for silencing in plants and imprinted gene expression in plant which occur in endosperm. It also displays sexual dimorphism like differential timing in imprint establishment and RNA based silencing mechanism in paternally repressed imprinted gene. Within imprinted regions, the unusual occurrence and distribution of various types of repetitive elements may act as genomic imprinting signatures. Imprinting regulation probably at many loci involves insulator protein dependent and higher-order chromatin interaction, and/or non-coding RNAs mediated mechanisms. However, placenta- specific imprinting involves repressive histone modifications and non-coding RNAs. The higher-order chromatin interaction involves differentially methylated domains (DMDs) exhibiting sex-specific methylation that act as scaffold for imprinting, regulate allelic-specific imprinted gene expression. The paternally methylated differentially methylated regions (DMRs) contain less CpGs than the maternally methylated DMRs. The non-coding RNAs mediated mechanisms include C/D RNA and microRNA, which are invovled in RNA-guided post-transcriptional RNA modifications and RNA-mediated gene silencing, respectively.
    [Show full text]
  • Rare Allelic Forms of PRDM9 Associated with Childhood Leukemogenesis
    Rare allelic forms of PRDM9 associated with childhood leukemogenesis Julie Hussin1,2, Daniel Sinnett2,3, Ferran Casals2, Youssef Idaghdour2, Vanessa Bruat2, Virginie Saillour2, Jasmine Healy2, Jean-Christophe Grenier2, Thibault de Malliard2, Stephan Busche4, Jean- François Spinella2, Mathieu Larivière2, Greg Gibson5, Anna Andersson6, Linda Holmfeldt6, Jing Ma6, Lei Wei6, Jinghui Zhang7, Gregor Andelfinger2,3, James R. Downing6, Charles G. Mullighan6, Philip Awadalla2,3* 1Departement of Biochemistry, Faculty of Medicine, University of Montreal, Canada 2Ste-Justine Hospital Research Centre, Montreal, Canada 3Department of Pediatrics, Faculty of Medicine, University of Montreal, Canada 4Department of Human Genetics, McGill University, Montreal, Canada 5Center for Integrative Genomics, School of Biology, Georgia Institute of Technology, Atlanta, Georgia, USA 6Department of Pathology, St. Jude Children's Research Hospital, Memphis, Tennessee, USA 7Department of Computational Biology and Bioinformatics, St. Jude Children's Research Hospital, Memphis, Tennessee, USA. *corresponding author : [email protected] SUPPLEMENTARY INFORMATION SUPPLEMENTARY METHODS 2 SUPPLEMENTARY RESULTS 5 SUPPLEMENTARY TABLES 11 Table S1. Coverage and SNPs statistics in the ALL quartet. 11 Table S2. Number of maternal and paternal recombination events per chromosome. 12 Table S3. PRDM9 alleles in the ALL quartet and 12 ALL trios based on read data and re-sequencing. 13 Table S4. PRDM9 alleles in an additional 10 ALL trios with B-ALL children based on read data. 15 Table S5. PRDM9 alleles in 76 French-Canadian individuals. 16 Table S6. B-ALL molecular subtypes for the 24 patients included in this study. 17 Table S7. PRDM9 alleles in 50 children from SJDALL cohort based on read data. 18 Table S8: Most frequent translocations and fusion genes in ALL.
    [Show full text]
  • Environmental Exposure to Endocrine Disrupting Chemicals Influences Genomic Imprinting, Growth, and Metabolism
    G C A T T A C G G C A T genes Review Environmental Exposure to Endocrine Disrupting Chemicals Influences Genomic Imprinting, Growth, and Metabolism Nicole Robles-Matos 1, Tre Artis 2 , Rebecca A. Simmons 3 and Marisa S. Bartolomei 1,* 1 Epigenetics Institute, Center of Excellence in Environmental Toxicology, Department of Cell and Developmental Biology, Perelman School of Medicine, University of Pennsylvania, 9-122 Smilow Center for Translational Research, Philadelphia, PA 19104, USA; [email protected] 2 Division of Hematology/Oncology, Boston Children’s Hospital, Harvard Medical School, Boston, MA 02115, USA; [email protected] 3 Center of Excellence in Environmental Toxicology, Department of Pediatrics, Children’s Hospital of Philadelphia, Perelman School of Medicine, University of Pennsylvania, 1308 Biomedical Research Building II/III, Philadelphia, PA 19104, USA; [email protected] * Correspondence: [email protected] Abstract: Genomic imprinting is an epigenetic mechanism that results in monoallelic, parent-of- origin-specific expression of a small number of genes. Imprinted genes play a crucial role in mam- malian development as their dysregulation result in an increased risk of human diseases. DNA methylation, which undergoes dynamic changes early in development, is one of the epigenetic marks regulating imprinted gene expression patterns during early development. Thus, environmental insults, including endocrine disrupting chemicals during critical periods of fetal development, can alter DNA methylation patterns, leading to inappropriate developmental gene expression and disease risk. Here, we summarize the current literature on the impacts of in utero exposure to endocrine disrupting chemicals on genomic imprinting and metabolism in humans and rodents. We evaluate Citation: Robles-Matos, N.; Artis, T.; Simmons, R.A.; Bartolomei, M.S.
    [Show full text]
  • With Acute Promyelocytic Leukemia (Somatic Cell Hybrids/C-Fes/Localization of Breakpoints/Gene Mapping) DENISE SHEER*, LYNNE R
    Proc. Natl Acad. Sci. USA Vol. 80, pp. 5007-5011, August 1983 Genetics Genetic analysis of the 15;17 chromosome translocation associated with acute promyelocytic leukemia (somatic cell hybrids/c-fes/localization of breakpoints/gene mapping) DENISE SHEER*, LYNNE R. HIORNS*, KARINA F. STANLEY*, PETER N. GOODFELLOW*, DALLAS M. SWALLOWt, SUSAN POVEYt, NORA HEISTERKAMPt, JOHN GROFFENt, JOHN R. STEPHENSONt, AND ELLEN SOLOMON* *Imperial Cancer Research Fund, Lincoln's Inn Fields, London WC2A 3PX, United Kingdom; tMedical Research Council Human Biochemical Genetics Unit, The Galton Laboratory, University College, London WC2, United Kingdom; and tLaboratory of Viral Carcinogenesis, National Cancer Institute, Frederick, Maryland 21701 Communicated by Walter F. Bodmer, April 20, 1983 ABSTRACT Somatic cell hybrids have been constructed be- quences that map at the position of the translocation break- tween a thymidine kinase-deficient mouse cell line and blood leu- points (9, 18, 19). kocytes from a patient with acute promyelocytic leukemia showing The human cellular homologues of the feline sarcoma virus the 15q+;17q- chromosome translocation frequently associated v-fes gene and of v-fps, a transforming gene shared by several with this disease. One hybrid contains the 15q+ translocation independent isolates of avian sarcoma viruses, correspond to a chromosome and very little other human material. We have shown common cellular locus, c-fes (20, 21), mapping on human chro- that the c-fes oncogene, which has been mapped to chromosome mosome 15 (13, 22). Functionally, v-fes and v-fps are also re- 15, is not present in this hybrid and, therefore, probably is trans- lated in that both encode transforming proteins with tyrosine- located to the 17q- chromosome.
    [Show full text]